SYSTEMS FOR AND METHODS OF TREATMENT SELECTION

20230395193 · 2023-12-07

    Inventors

    Cpc classification

    International classification

    Abstract

    The disclosure relates to a system comprising software that predicts responsiveness of subjects to certain disease modifying drugs. Embodiments of the disclosure include methods comprising calculating a differential interaction score (DIS), correlating the DIS with the likelihood that a dysfunctional protein-protein interaction is the causal agent of a disease or disorder, and identifying a subject responsive to a treatment based upon the causal agent.

    Claims

    1. A method of identifying an interaction between a pathogen protein and a host protein, the method comprising: (a) identifying a first pathogen protein that co-localizes with a first host protein in one or a plurality of bioassays; (b) calculating a differential interaction score (DIS) corresponding to a pathogen protein and a host protein in a sample; and (c) correlating the DIS with the likelihood that the dysfunctional protein-protein interaction is a causal agent of pathogenicity of the pathogen.

    2. (canceled)

    3. The method of claim 1, wherein the bioassay comprises one or a combination of: mass spectrometry analysis is performed on a plurality of samples from a population of subjects infected with the pathogen; siRNA knockdown analysis, CRISPR-mediated knockout analysis, infectivity analysis; and co-immunoprecipitation.

    4. The method of claim 1 further comprising the step of: compiling genetic data about a population of subjects that comprise a mutation in a nucleic acid sequence that encodes the first host protein.

    5. The method of claim 1, wherein the one or plurality of bioassays comprises performing a mass spectrometry analysis on a sample associated with the disorder to identify dysfunctional protein-protein interactions associated with the disorder

    6. The method of claim 1, wherein each sample comprises a mixture of population of cells unaffected by the disorder and a population of cells expressing a mutation.

    7. The method of claim 6, wherein the calculating comprises calculating one or more of a SAINTexpress algorithm score, a CompPASS algorithm score, and a MiST algorithm score.

    8. The method of claim 7, wherein the calculating comprises calculating a SAINTexpress algorithm score and a MiST algorithm score.

    9. The method of claim 7, wherein the SAINTexpress algorithm score is calculated by a formula:
    P(X.sub.ij|♦)=π.sub.TP(X.sub.ij|λ.sub.ij)+(1−π.sub.T)P(X.sub.ij|κ.sub.ij)  (1) wherein X.sub.ij is the spectral count for a prey protein i identified in a purification of bait j; wherein λ.sub.ij is the mean count from a Poisson distribution representing true interaction; wherein κ.sub.ij is the mean count from a Poisson distribution representing false interaction; wherein π.sub.T is the proportion of true interactions in the data; and wherein dot notation represents all relevant model parameters estimated from the data for the pair of prey i and bait j.

    10. The method of claim 7, wherein the MiST algorithm score is calculated by a first formula: A b , i = .Math. r = 1 N ? Q b , i , r N R ? indicates text missing or illegible when filed wherein A.sub.b,i is the abundance of a given bait-prey pair i,b; wherein Q.sub.b,i,r is the quantity of bait-prey pair b,I in a replica r; and N.sub.r is the number of replicas; a second formula: R b , i + .Math. r = 1 N ? Q b , i , r .Math. log ( Q b , i , r ) log 2 ( N R ) - 1 ? indicates text missing or illegible when filed wherein R.sub.b,i is the reproducibility of a given bait-prey pair b,I; and a third formula: S b , i = A b , i .Math. b = 1 N ? A b , i ? indicates text missing or illegible when filed wherein S.sub.b,i is the specificity of a given bait-prey pair b,i; and wherein N.sub.B is the number of baits.

    11. The method of claim 7, wherein the CompPASS algorithm score is calculated by a Z-score formula pair: x _ j = .Math. ? ? x i , j k ? n = 1 , 2 , .Math. m ( Eq . 1 ) z i , j = x i , j - x _ j σ j ( Eq . 2 ) ? indicates text missing or illegible when filed wherein X is the TSC; wherein i is the bait number; wherein j is the interactor; wherein n is which interactor is being considered; wherein k is the total number of baits; and wherein s is the standard deviation of the TSC mean; a S-score formula: S i , j = ( k .Math. ? ? ? ) x i , j ; f i , j = { 1 ? x i , j > 0 x i , j ( Eq . 3 ) ? indicates text missing or illegible when filed wherein f is 0 or 1; a D-score formula: D ? = ( k .Math. ? ? ? ) P x i , j ; f i , j = { 1 : x i , j > 0 x i , j p = number of ? in which the ? is present ( Eq . 4 ) ? indicates text missing or illegible when filed wherein p is 1 or 2; and a WD-score formula: WD i , j = ( k .Math. ? ? ? ω j ) P x i , j ( Eq . 5 ) ω j = ( σ j x _ j ) , x _ j = .Math. ? ? x i , j k ? n = 1 , 2 , .Math. m , if ω j ? 1 ? ω j = 1 if ω j ? 1 ? ω j = ω j f i , j = { 1 ; x i , j > 0 x i , j p = number of replicates ? in which the interactor is present ? indicates text missing or illegible when filed wherein w.sub.j is a weight factor wherein σ.sub.j is a standard deviation.

    12. The method of claim 1, wherein the DIS is calculated by a first formula:
    DIS.sub.A(b,p)=S.sub.C1(b,pS.sub.C2(b,p)×[1−S.sub.C3(b,p)] wherein DIS.sub.A(b,p) is the DIS for each protein-protein interaction (PPI) (b, p) that is conserved in a first bioassay and a second bioassay, but not shared by a third bioassay; wherein S.sub.C1(b,p) is the probability of a PPI being present in the first bioassay; wherein S.sub.C2(b,p) is the probability of a PPI being present in the second bioassay; and wherein S.sub.c□(b,p) is the probability of a PPI being present in the third bioassay; and a second formula:
    DIS.sub.B(b,p)=[1−S.sub.C1(b,p)]×[1−S.sub.C2(b,p)]×S.sub.C3(b,p wherein DIS.sub.B(b,p) is the DIS score for each PPI (b, p) that is conserved in the third bioassay, but not shared by the first bioassay and the second bioassay; wherein a (+) sign is assigned if DIS.sub.A(b,p)>DIS.sub.B(b,p); and wherein a (−) sign is assigned if DIS.sub.A(b,p)<DIS.sub.B(b,p).

    13-25. (canceled)

    26. A method of identifying an interaction between a first protein and a second protein, wherein the first protein is associated with a disorder of a subject, the method comprising: (a) identifying a first protein that co-localizes with the second protein in one or a plurality of bioassays; (b) calculating a differential interaction score (DIS) corresponding to the first protein and a second protein in a sample from the subject; and (c) correlating the DIS with the likelihood that the dysfunctional protein-protein interaction is a causal agent of pathogenicity of the pathogen.

    27. The method of claim 26, wherein the sample is a population of cells.

    28. The method of claim 26, wherein the bioassay comprises one or a combination of: mass spectrometry analysis is performed on a plurality of samples from a population of subjects infected with the pathogen; siRNA knockdown analysis, CRISPR-mediated knockout analysis, infectivity analysis; and co-immunoprecipitation.

    29. The method of any of claim 26 further comprising the step of: compiling genetic data about a population of subjects that comprise a mutation in a nucleic acid sequence that encodes the first protein.

    30. The method of, claim 26 wherein the one or plurality of bioassays comprises performing a mass spectrometry analysis on a sample associated with the disorder to identify dysfunctional protein-protein interactions associated with the disorder.

    31.-50. (canceled)

    51. A method of identifying a subject likely to respond to a disorder treatment, the method comprising: a. calculating a differential interaction score (DIS); and b. correlating the DIS with a likelihood that a dysfunctional protein-protein interaction is a causal agent of the disorder, wherein if the DIS score is above a first threshold, then the subject is likely to respond to a disorder treatment based upon the causal agent, and wherein if the DIS score is below the first threshold, then the subject is not likely to respond to the disorder treatment based upon the causal agent.

    52. The method of claim 51, further comprising: a. compiling genetic data about a population of subjects comprising the subject, wherein the population of subjects has a mutation candidate that causes the disorder; and b. performing a mass spectrometry analysis on a sample associated with the disorder to identify dysfunctional protein-protein interactions associated with the disorder.

    53. A method of predicting a likelihood that a subject does or does not respond to a disorder treatment, the method comprising: a. compiling genetic data about a population of subjects that has a mutation candidate that causes a disorder, wherein the population of subjects includes the subject; b. performing a mass spectrometry analysis on a sample associated with the disorder to identify dysfunctional protein-protein interactions associated with the disorder; c. calculating a differential interaction score (DIS); d. correlating the DIS with the likelihood that the dysfunctional protein-protein interaction is the causal agent of the disorder; and e. selecting a treatment for the subject based upon the causal agent.

    54. The method of claim 53, further comprising: (f) comparing the DIS score to a first threshold; and (g) classifying the subject as being likely to respond to a disorder treatment, wherein each of steps (f) and (g) are performed after step (c), and wherein the first threshold is calculated relative to a first control dataset.

    55. The method of claim 54, wherein the disorder is a viral infection.

    56. The method of claim 55, wherein the viral infection is due to a Coronavirus.

    57. A computer program product encoded on a computer-readable storage medium, wherein the computer program product comprises instructions for: a. identifying protein-protein interactions associated with the disorder; and b. calculating a differential interaction score (DIS).

    58. The computer program product of claim 57, further comprising a step of correlating the DIS with the likelihood that the dysfunctional protein-protein interaction is a causal agent of the disorder.

    59. The computer program product of claim 57, further comprising instructions for selecting a treatment for the subject based upon the causal agent.

    60. The computer program product of claim 57, further comprising instructions for: (d) comparing the DIS score to a first threshold; and (e) classifying the subject as being likely to respond to a disorder treatment, wherein each of steps (d) and (e) are performed after step (c), and wherein the first threshold is calculated relative to a first control dataset.

    61. A system comprising the computer program product of claim 57, and one or more of: a. a processor operable to execute programs; and b. a memory associated with the processor.

    62-66. (canceled)

    67. A method of selecting a disorder treatment for a subject in need thereof, the method comprising: a. identifying genetic data from the subject in need of treatment; b. comparing the genetic data from the subject to a compilation of genetic data from population of subjects that has a mutation candidate that causes a disorder, wherein the population of subjects includes the subject in need thereof; c. performing a mass spectrometry analysis on a sample from the subject associated with the disorder to identify dysfunctional protein-protein interactions associated with the disorder; d. calculating a differential interaction score (DIS); e. correlating the DIS with the likelihood that the dysfunctional protein-protein interaction is a causal agent of the disorder; and f. selecting a disorder treatment for the subject based upon the causal agent.

    68. The method of claim 0, wherein the step of identifying the genetic information from a subject comprises sequencing the genetic information from a biopsy or sample obtained from the subject.

    69. The method of claim 0, wherein the calculating of the DIS score is calculated by a first formula:
    DIS.sub.A(b,p)=S.sub.C1(b,pS.sub.C2(b,p)×[1−S.sub.C3(b,p)] wherein DIS.sub.A(b,p) is the DIS for each PPI (b, p) that is conserved in a first cell line and a second cell line, but not shared by a third cell line; wherein S.sub.C1(b,p) is the probability of a PPI being present in the first cell line; wherein S.sub.C2(b,p) is the probability of a PPI being present in the second cell line; and wherein S.sub.c□(b,p) is the probability of a PPI being present in the third cell line; and a second formula:
    DIS.sub.B(b,p)=[1−S.sub.C1(b,p)]×[1−S.sub.C2(b,p)]×S.sub.C3(b,p wherein DIS.sub.B(b,p) is the DIS score for each PPI (b, p) that is conserved in the third cell line, but not shared by the first cell line and the second cell line; wherein a (+) sign is assigned if DIS.sub.A(b,p)>DIS.sub.B(b,p); and wherein a (−) sign is assigned if DIS.sub.A(b,p)<DIS.sub.B(b,p).

    70-74. (canceled)

    75. A method of constructing a three-dimensional (3D) structure of a protein comprising: a. obtaining a molecular 3D structure of the protein using one or a plurality of structural-biology techniques; b. obtaining a predicted 3D structure of the protein based on sequence using one or a plurality of deep neural networks; c. dividing the predicted 3D structure into a plurality of overlapping regions; d. rigid-body fitting the plurality of overlapping regions against the molecular 3D structure; e. examining a plurality of regions with top scoring fits and generating new region boundaries; f. combining the plurality of regions with top scoring fits into a complete 3D protein structure; and g. refining the complete 3D protein structure into the molecular 3D structure to construct the 3D structure of the protein.

    76. The method of claim 75, further comprising repeating steps d) and e) for one or a plurality of times.

    77. The method of claim 75, wherein the one or plurality of structural-biology techniques are chosen from cryogenic electron microscopy (cryo-EM), cryo-electron tomography (cryo-ET), nuclear magnetic resonance (NMR) spectroscopy, X-ray crystallography, and small-angle X-ray scattering (SAXS).

    78. The method of claim 75, wherein the molecular 3D structure of the protein is obtained using cryo-EM.

    79. The method of claim 75, wherein the molecular 3D structure of the protein has a resolution of about 20 ångströms (□) or better.

    80-84. (canceled)

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0022] The accompanying figures, which are incorporated in and constitute a part of this specification, illustrate several embodiments and together with the description serve to explain the principles of the invention.

    [0023] FIG. 1A-E show representative data illustrating an overview of coronavirus genome annotations and integrative analysis. Specifically, FIG. 1A shows the genome annotation of SARS-CoV-2, SARS-CoV-1, and MERS-CoV with putative protein coding genes highlighted. The intensity of the filled color indicates the lowest sequence identity between SARS-CoV2 and SARS-CoV-1 or SARS-CoV-2 and MERS. FIG. 1B-D show the genome annotation of structural protein genes for SARS-CoV-2 (FIG. 1B), SARS-CoV-1 (FIG. 1C), and MERS-CoV (FIG. 1D). Color intensity indicates sequence identity to specified virus. FIG. 1E shows an overview of comparative coronavirus analysis. Proteins from SARS-CoV-2, SARS-CoV-1, and MERS-CoV were analyzed for their protein interactions and subcellular localization, and these data were integrated for comparative host interaction network analysis, followed by functional, structural, and clinical data analysis for exemplary virus-specific and pan-viral interactions. The SARS-CoV-2 interactome was previously published in a separate study (D. E. Gordon, Nature (2020)). SARS=both SARS-CoV-1 and SARS-CoV-2; MERS=MERS-CoV; Nsp=non-structural protein; Orf=open reading frame.

    [0024] FIG. 2A-G show representative data illustrating a comparative analysis of coronavirus-host interactomes.

    [0025] FIG. 3A-F show representative viabilites, knockdown efficiencies, and editing efficiencies in response to siRNA and CRISPR perturbations.

    [0026] FIG. 4A-F show representative data illustrating the functional interrogation of SARS-CoV-2 interactors using genetic perturbations.

    [0027] FIG. 5A-C show representative data illustrating the predicted binding modes of mPGES-2 and Nsp7.

    [0028] FIG. 6A-F show a representative analysis of coronavirus protein localization.

    [0029] FIG. 7 shows representative data illustrating the immunolocalization of Strep-tagged SARS-CoV-2 non-structural (Nsp) proteins. HeLaM cells were transfected with 2×Strep-tagged viral proteins, fixed, and immunostained with anti-Strep antibodies. Samples were also immunostained for the Golgi-localized protein Syntaxin 5 (STX5). Scale bar=10 μm.

    [0030] FIG. 8 shows representative data illustrating the immunolocalization of Strep-tagged SARS-CoV-2 structural and accessory proteins. HeLaM cells were transfected with 2×Strep-tagged viral proteins, fixed, and immunostained with anti-Strep antibodies. Samples were also immunostained for the Golgilocalized protein Syntaxin 5 (STX5). Scale bar=10 μm.

    [0031] FIG. 9 shows representative data illustrating the immunolocalization of Strep-tagged SARS-CoV-1 non-structural (Nsp) proteins. HeLaM cells were transfected with 2×Strep-tagged viral proteins, fixed, and immunostained with anti-Strep antibodies. Samples were also immunostained for the Golgilocalized protein Syntaxin 5 (STX5). Scale bar=10 μm.

    [0032] FIG. 10 shows representative data illustrating the immunolocalization of Strep-tagged SARS-CoV-1 structural and accessory proteins. HeLaM cells were transfected with 2×Strep-tagged viral proteins, fixed, and immunostained with anti-Strep antibodies. Samples were also immunostained for the Golgilocalized protein Syntaxin 5 (STX5). Scale bar=10 μm. Ring structures formed by SARS-CoV1 Orf6 highlighted in enlarged micrograph image.

    [0033] FIG. 11 shows representative data illustrating the immunolocalization of Strep-tagged MERS-CoV non-structural (Nsp) proteins. HeLaM cells were transfected with 2×Strep-tagged viral proteins, fixed, and immunostained with anti-Strep antibodies. Samples were also immunostained for the Golgi-localized protein Syntaxin 5 (STX5). Scale bar=10 μm.

    [0034] FIG. 12 shows representative data illustrating the immunolocalization of Strep-tagged MERS-CoV structural and accessory proteins. HeLaM cells were transfected with 2×Strep-tagged viral proteins, fixed, and immunostained with anti-Strep antibodies. Samples were also immunostained for the Golgilocalized protein Syntaxin 5 (STX5). Scale bar=10 μm. Ring structures formed by MERS-CoV Orf8b highlighted in enlarged micrograph image.

    [0035] FIG. 13 shows representative data illustrating the immunolocalization of SARS-CoV-2 proteins in infected Caco-2 cells. Caco-2 cells were infected with SARS-CoV-2, fixed, and immunostained with specific polyclonal antibodies. Samples were co-stained with anti-PDI or Alexa Fluor 647-conjugated phalloidin, and nuclei were stained with DAPI. Scale bar=10 μm.

    [0036] FIG. 14A-D show representative data illustrating a comparison of enriched terms and shared interactors across viruses.

    [0037] FIG. 15A-D show representative data illustrating that a comparative differential interaction analysis reveals shared virus-host interactions.

    [0038] FIG. 16A-G show representative data illustrating the interaction between Orf9b and human Tom70.

    [0039] FIG. 17A-C show representative data illustrating that Org9b interacts specifically with Tom70.

    [0040] FIG. 18A-E show representative data illustrating that the CryoEM structure of Orf9b-Tom70 complex reveals Orf9b adopting a helical fold and binding at the substrate recognition site of Tom70.

    [0041] FIG. 19A-C show representative data illustrating an Orf9b-Tom70 cryoEM density map and the Fourier Shell Correlation of the final reconstruction.

    [0042] FIG. 20 shows a representative image illustrating subtle conformational changes at the MEEVD binding site of Tom70.

    [0043] FIG. 21A-F show representative data illustrating that SARS-CoV-2 Orf8 and functional interactor IL17RA are linked to viral outcomes.

    [0044] FIG. 22A-E show representative data illustrating the perturbation of drug targets and the performance of selected drugs against coronavirus replication in vitro.

    [0045] FIG. 23A-D show representative data illustrating that real-world data analysis of drugs identified through molecular investigation support their antiviral activity.

    [0046] FIG. 24 shows representative data illustrating departures from neutral evolution in SIGMAR1.

    [0047] FIG. 25 shows representative images illustrating SARS-CoV-1 protein expression. Input samples from immunoprecipitations were probed by immunoblot using anti-Strep antibody. Red arrowhead indicates that the band appears near expected molecular weight. Nsp=non-structural protein; Orf=open reading frame.

    [0048] FIG. 26 shows representative images illustrating MERS-CoV protein expression. Input samples from immunoprecipitations were probed by immunoblot using anti-Strep antibody. Red arrowhead indicates that the band appears near expected molecular weight. Nsp=non-structural protein; Orf=open reading frame.

    [0049] FIG. 27 shows representative data illustrating a correlation analysis of SARS-CoV-1 proteomics samples. Pearson's pairwise correlations were calculated for all combinations of replicates of SARS-CoV-1 affinity purification-mass spectrometry (AP-MS) samples. Unbiased clustering was applied and correlation scores are depicted by heatmap. All MS samples were compared and clustered using standard artMS (https://github.com/biodavidjm/artMS) procedures on observed feature intensities computed by MaxQuant.

    [0050] FIG. 28 shows representative data illustrating a correlation analysis of MERS-CoV proteomics samples. Pearson's pairwise correlations were calculated for all combinations of replicates of MERS-CoV affinity purification-mass spectrometry (AP-MS) samples. Unbiased clustering was applied and correlation scores are depicted by heatmap. All MS samples were compared and clustered using standard artMS (https://github.com/biodavidjm/artMS) procedures on observed feature intensities computed by MaxQuant.

    [0051] FIG. 29 shows a representative illustration of the SARS-CoV-1 Virus-Human Protein Interaction Network. Virus-human protein-protein interaction map depicting high-confidence interactions (MiST≥0.7 & Saint BFDR≤0.05 & Average Spectral Counts≥2) for SARS-CoV-1 as derived from affinity purificationmass spectrometry (AP-MS) is shown. Viral bait proteins are depicted with orange diamonds and human proteins with dark grey circles. Human-human interactions are depicted in thin, dark grey lines. Proteins within the same protein complexes or biological process are indicated with light yellow or light blue highlighting, respectively, and annotated accordingly. Human-human physical interactions, protein complex definitions, and biological process groupings are derived from CORUM (M. Giurgiu, et al., CORUM: the comprehensive resource of mammalian protein complexes-2019. Nucleic Acids Res. 47, D559-D563 (2019)), Gene Ontology (biological process), and manually curated from literature sources.

    [0052] FIG. 30 shows a representative illustration of the MERS-CoV Virus-Human Protein Interaction Network. Virus-human protein-protein interaction map depicting high-confidence interactions (MiST≥0.7 & Saint BFDR≤0.05 & Average Spectral Counts≥2) for MERS-CoV as derived from affinity purification-mass spectrometry (AP-MS) is shown. Viral bait proteins are depicted with yellow diamonds and human proteins with dark grey circles. Human-human interactions are depicted in thin, dark grey lines. Proteins within the same protein complexes or biological process are indicated with light yellow or light blue highlighting, respectively, and annotated accordingly. Human-human physical interactions, protein complex definitions, and biological process groupings are derived from CORUM (M. Giurgiu, et al., CORUM: the comprehensive resource of mammalian protein complexes-2019. Nucleic Acids Res. 47, D559-D563 (2019)), Gene Ontology (biological process), and manually curated from literature sources.

    [0053] FIG. 31 shows a representative illustration of the SARS-CoV-2 Nsp16 Virus-Host Protein Interaction Network. Virus-human protein-protein interaction map depicting high-confidence interactions (MiST≥0.7 & Saint BFDR≤0.05 & Average Spectral Counts≥2) for SARS-CoV-2 Nsp16 protein is shown. This network is derived from affinity purification-mass spectrometry (AP-MS) data. Viral bait proteins are depicted with red diamonds and human proteins with dark grey circles. Human-human interactions are depicted in thin, dark grey lines. Proteins within the same protein complexes or biological process are indicated with light yellow or light blue highlighting, respectively, and annotated accordingly. Human-human physical interactions, protein complex definitions, and biological process groupings are derived from CORUM (M. Giurgiu, et al., CORUM: the comprehensive resource of mammalian protein complexes-2019. Nucleic Acids Res. 47, D559-D563 (2019)), Gene Ontology (biological process), and manually curated from literature sources.

    [0054] FIG. 32 shows a representative flowchart illustrating the use of mass spectrometry to generate protein-protein interaction (PPI) maps, which can then be analyzed using differential interaction scoring (DIS) to identify novel drug targets and, thus, to develop novel drugs.

    [0055] FIG. 33 shows a representative flowchart illustrating the use of mass spectrometry in combination with differential interaction scoring (DIS) to identify novel drug targets for viral diseases such as, for example, coronaviruses, which can then be used to develop novel therapeutics for treating these diseases.

    [0056] FIG. 34 shows a representative flowchart illustrating the use of mass spectrometry in combination with differential interaction scoring (DIS) to identify novel drug targets for neurodegenerative diseases such as, for example, Amyotrophic Lateral Sclerosis (ALS), Parkinson's disease, and Alzheimer's disease (AD), which can then be used to develop novel therapeutics for treating these diseases.

    [0057] FIG. 35 shows a representative flowchart illustrating the use of mass spectrometry in combination with differential interaction scoring (DIS) to identify novel drug targets for neuropsychiatric diseases such as, for example, autism, schizophrenia, obsessive compulsive disorder (OCD), anxiety, and depression, which can then be used to develop novel therapeutics for treating these diseases.

    [0058] FIG. 36 shows a representative flowchart illustrating the use of mass spectrometry in combination with differential interaction scoring (DIS) to identify novel drug targets for cancers such as, for example, breast, head and neck, lung, pancreatic, and brain, which can then be used to develop novel chemotherapeutics.

    [0059] FIG. 37 shows a representative flowchart illustrating the use of structural-biology techniques, such as cryoEM, in combination with artificial intelligence (AI) prediction based on deep neural networks to construct a 3-dimensional (3D) structure of a protein.

    [0060] FIG. 38 shows a representative flowchart illustrating the architecture of the Alphafold system for predicting structure from protein sequence.

    [0061] FIG. 39A shows that AI prediction by itself fails to recapitulate the correct global protein structure. Correct structure in black; top 6 scoring predictions based on the Alphafold system in grayscale; best RMSD 16 Å, average RMSD 34 Å. FIG. 39B shows that cryoEM by itself only yields low resolution density for full protein, preventing complete model from being constructed. Region which cannot be built solely based on cryoEM data is circled. FIG. 39C shows that the combination of the two methodologies (AI and cryoEM) yields high resolution structure for complete protein. The model obtained from cryoEM in black; the model obtained from AlphaFold prediction in grayscale.

    [0062] Additional advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or can be learned by practice of the invention. The advantages of the invention will be realized and attained by means of the elements and combinations particularly pointed out in the appended claims. It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed.

    DETAILED DESCRIPTION OF EMBODIMENTS

    [0063] Before the present systems and methods are described, it is to be understood that the present disclosure is not limited to the particular processes, compositions, or methodologies described, as these may vary. It is also to be understood that the terminology used in the description is for the purposes of describing the particular versions or embodiments only, and is not intended to limit the scope of the present disclosure. Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the present disclosure, the methods, devices, and materials in some embodiments are now described. All publications mentioned herein are incorporated by reference in their entirety. Nothing herein is to be construed as an admission that the present disclosure is not entitled to antedate such disclosure by virtue of prior invention.

    Definitions

    [0064] Unless otherwise defined herein, scientific and technical terms used in connection with the present disclosure shall have the meanings that are commonly understood by those of ordinary skill in the art. The meaning and scope of the terms should be clear, however, in the event of any latent ambiguity, definitions provided herein take precedent over any dictionary or extrinsic definition. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular.

    [0065] The indefinite articles “a” and “an,” as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean “at least one.” The phrase “and/or,” as used herein in the specification and in the claims, should be understood to mean “either or both” of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Other elements may optionally be present other than the elements specifically identified by the “and/or” clause, whether related or unrelated to those elements specifically identified unless clearly indicated to the contrary. Thus, as a non-limiting example, a reference to “A and/or B,” when used in conjunction with open-ended language such as “comprising” can refer, in one embodiment, to A without B (optionally including elements other than B); in another embodiment, to B without A (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.

    [0066] As used herein in the specification and in the claims, “or” should be understood to have the same meaning as “and/or” as defined above. For example, when separating items in a list, “or” or “and/or” shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as “only one of” or “exactly one of,” or, when used in the claims, “consisting of,” will refer to the inclusion of exactly one element of a number or list of elements. In general, the term “or” as used herein shall only be interpreted as indicating exclusive alternatives (i.e. “one or the other but not both”) when preceded by terms of exclusivity, “either,” “one of,” “only one of,” or “exactly one of.” “Consisting essentially of,” when used in the claims, shall have its ordinary meaning as used in the field of patent law.

    [0067] The term “about” is used herein to mean within the typical ranges of tolerances in the art. For example, “about” can be understood as about 2 standard deviations from the mean. According to certain embodiments, when referring to a measurable value such as an amount and the like, “about” is meant to encompass variations of ±20%, ±10%, ±5%, ±1%, ±0.9%, ±0.8%, ±0.7%, ±0.6%, ±0.5%, ±0.4%, ±0.3%, ±0.2% or ±0.1% from the specified value as such variations are appropriate to perform the disclosed methods. When “about” is present before a series of numbers or a range, it is understood that “about” can modify each of the numbers in the series or range.

    [0068] The term “at least” prior to a number or series of numbers (e.g. “at least two”) is understood to include the number adjacent to the term “at least,” and all subsequent numbers or integers that could logically be included, as clear from context. When “at least” is present before a series of numbers or a range, it is understood that “at least” can modify each of the numbers in the series or range.

    [0069] Ranges provided herein are understood to include all individual integer values and all subranges within the ranges.

    [0070] As used herein, the terms “patient,” “individual diagnosed with . . . ,” and “individual suspected of having . . . ” all refer to an individual who has been diagnosed with a particular disease or a disorder (e.g., viral and bacterial diseases, cancers, neurodegenerative diseases, and neuropsychiatric disorders), has been given a probable diagnosis of a particular disease or disorder (e.g., viral and bacterial diseases, cancers, neurodegenerative diseases, and neuropsychiatric disorders), or an individual who has positive scans (e.g., PET scans) but otherwise lacks major symptoms of a particular disease or disorder and is without a clinical diagnosis of a disease disorder.

    [0071] As used herein, the term “animal” includes, but is not limited to, humans and non-human vertebrates such as wild animals, rodents, such as rats, ferrets, and domesticated animals, and farm animals, such as dogs, cats, horses, pigs, cows, sheep, and goats. In some embodiments, the animal is a mammal. In some embodiments, the animal is a human. In some embodiments, the animal is a non-human mammal.

    [0072] As used herein, the terms “comprising” (and any form of comprising, such as “comprise,” “comprises,” and “comprised”), “having” (and any form of having, such as “have” and “has”), “including” (and any form of including, such as “includes” and “include”), or “containing” (and any form of containing, such as “contains” and “contain”), are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.

    [0073] The term “diagnosis” or “prognosis” as used herein refers to the use of information (e.g., genetic information or data from other molecular tests on biological samples, signs and symptoms, physical exam findings, cognitive performance results, etc.) to anticipate the most likely outcomes, timeframes, and/or response to a particular treatment for a given disease, disorder, or condition, based on comparisons with a plurality of individuals sharing common nucleotide sequences, symptoms, signs, family histories, or other data relevant to consideration of a patient's health status.

    [0074] As used herein, the phrase “in need thereof” means that the animal or mammal has been identified or suspected as having a need for the particular method or treatment. In some embodiments, the identification can be by any means of diagnosis or observation. In any of the methods and treatments described herein, the animal or mammal can be in need thereof. In some embodiments, the subject in need thereof is a human seeking prevention of a disease or disorder (e.g., viral and bacterial diseases, cancers, neurodegenerative diseases, and neuropsychiatric disorders). In some embodiments, the subject in need thereof is a human diagnosed with a disease or disorder (e.g., viral and bacterial diseases, cancers, neurodegenerative diseases, and neuropsychiatric disorders). In some embodiments, the subject in need thereof is a human seeking treatment for a disease or disorder (e.g., viral and bacterial diseases, cancers, neurodegenerative diseases, and neuropsychiatric disorders). In some embodiments, the subject in need thereof is a human undergoing treatment for a disease or disorder (e.g., viral and bacterial diseases, cancers, neurodegenerative diseases, and neuropsychiatric disorders).

    [0075] As used herein, the term “mammal” means any animal in the class Mammalia such as rodent (i.e., mouse, rat, or guinea pig), monkey, cat, dog, cow, horse, pig, or human. In some embodiments, the mammal is a human. In some embodiments, the mammal refers to any non-human mammal. The present disclosure relates to any of the methods or compositions of matter wherein the sample is taken from a mammal or non-human mammal. The present disclosure relates to any of the methods or compositions of matter wherein the sample is taken from a human or non-human primate.

    [0076] As used herein, the term “predicting” refers to making a finding that an individual has a significantly enhanced probability or likelihood of benefiting from and/or responding to a treatment for a disease or disorder (e.g., viral and bacterial diseases, cancers, neurodegenerative diseases, and neuropsychiatric disorders).

    [0077] A “score” is a numerical value that may be assigned or generated after normalization of the value corresponding to protein-protein interactions associated with a particular disorder (e.g., viral and bacterial diseases, cancers, neurodegenerative diseases, and neuropsychiatric disorders). In some embodiments, the score is normalized in respect to a control data value, such as a value corresponding to a sample from a subject not exhibiting a mutation (e.g wildtype gene or protein from subject).

    [0078] As used herein, the term “stratifying” refers to sorting individuals into different classes or strata based on the features of the particular disease or disorder (e.g., viral and bacterial diseases, cancers, neurodegenerative diseases, and neuropsychiatric disorders). For example, stratifying a population of individuals with a cancer involves assigning the individuals on the basis of the severity of the disease (e.g., stage 0, stage 1, stage, 2, stage 3, etc.).

    [0079] As used herein, the term “subject,” “individual,” or “patient,” used interchangeably, means any animal, including mammals, such as mice, rats, other rodents, rabbits, dogs, cats, swine, cattle, sheep, horses, or primates, such as humans. In some embodiments, the subject is a human seeking treatment for a particular disease or disorder (e.g., viral and bacterial diseases, cancers, neurodegenerative diseases, and neuropsychiatric disorders). In some embodiments, the subject is a human diagnosed with a particular disease or disorder (e.g., viral and bacterial diseases, cancers, neurodegenerative diseases, and neuropsychiatric disorders). In some embodiments, the subject is a human suspected of having a particular disease or disorder (e.g., viral and bacterial diseases, cancers, neurodegenerative diseases, and neuropsychiatric disorders). In some embodiments, the subject is a healthy human being.

    [0080] As used herein, the term “threshold” refers to a defined value by which a normalized score can be categorized. By comparing to a preset threshold, a normalized score can be classified based upon whether it is above or below the preset threshold.

    [0081] As used herein, the terms “treat,” “treated,” or “treating” can refer to therapeutic treatment and/or prophylactic or preventative measures wherein the object is to prevent or slow down (lessen) an undesired physiological condition, disorder or disease, or obtain beneficial or desired clinical results. For purposes of the embodiments described herein, beneficial or desired clinical results include, but are not limited to, alleviation of symptoms; diminishment of extent of condition, disorder or disease; stabilized (i.e., not worsening) state of condition, disorder or disease; delay in onset or slowing of condition, disorder or disease progression; amelioration of the condition, disorder or disease state or remission (whether partial or total), whether detectable or undetectable; an amelioration of at least one measurable physical parameter, not necessarily discernible by the patient; or enhancement or improvement of condition, disorder or disease. Treatment can also include eliciting a clinically significant response without excessive levels of side effects. Treatment also includes prolonging survival as compared to expected survival if not receiving treatment.

    [0082] As used herein, the term “therapeutic” means an agent utilized to treat, combat, ameliorate, prevent, or improve an unwanted condition or disease of a patient.

    [0083] A “therapeutically effective amount” or “effective amount” of a composition is a predetermined amount calculated to achieve the desired effect, i.e., to treat, combat, ameliorate, prevent, or improve one or more symptoms of a disease or disorder (e.g., viral and bacterial diseases, cancers, neurodegenerative diseases, and neuropsychiatric disorders). The activity contemplated by the present methods includes both medical therapeutic and/or prophylactic treatment, as appropriate. The specific dose of a compound administered according to the present disclosure to obtain therapeutic and/or prophylactic effects will, of course, be determined by the particular circumstances surrounding the case, including, for example, the compound administered, the route of administration, and the condition being treated. It will be understood that the effective amount administered will be determined by the physician in the light of the relevant circumstances including the condition to be treated, the choice of compound to be administered, and the chosen route of administration, and therefore the above dosage ranges are not intended to limit the scope of the present disclosure in any way. A therapeutically effective amount of compounds of embodiments of the present disclosure is typically an amount such that when it is administered in a physiologically tolerable excipient composition, it is sufficient to achieve an effective systemic concentration or local concentration in the tissue.

    Methods of Developing Protein-Protein Interaction Maps and Identifying Protein-Protein Interactions

    [0084] In some embodiments, the disclosure relates to methods of identifying an interaction between a pathogen protein and a host protein, the method comprising: (a) identifying a first pathogen protein that co-localizes with a first host protein in one or a plurality of bioassays; (b) calculating a differential interaction score (DIS) corresponding to a pathogen protein and a host protein in a sample; and (c) correlating the DIS with the likelihood that the dysfunctional protein-protein interaction is a causal agent of pathogenicity of the pathogen.

    [0085] In some embodiments, the disclosure relates to methods of identifying an interaction between a first protein and a second protein, wherein the first protein is associated with a disorder of a subject, the method comprising: (a) identifying a first protein that co-localizes with the second protein in one or a plurality of bioassays; (b) calculating a differential interaction score (DIS) corresponding to the first protein and a second protein in a sample from the subject; and (c) correlating the DIS with the likelihood that the dysfunctional protein-protein interaction is a causal agent of pathogenicity of the pathogen. In some embodiments, the method further comprises the step of: compiling genetic data about a population of subjects that comprise a mutation in a nucleic acid sequence that encodes the first protein. In some embodiments, the one or plurality of bioassays comprises performing a mass spectrometry analysis on a sample associated with the disorder to identify dysfunctional protein-protein interactions associated with the disorder.

    [0086] In some embodiments, the sample is a population of cells.

    [0087] In some embodiments, the bioassay comprises one or a combination of: mass spectrometry analysis is performed on a plurality of samples from a population of subjects infected with the pathogen; siRNA knockdown analysis, CRISPR-mediated knockout analysis, infectivity analysis; and co-immunoprecipitation.

    [0088] In some embodiments, the method further comprises the step of: compiling genetic data about a population of subjects that comprise a mutation in a nucleic acid sequence that encodes the first host protein.

    [0089] In some embodiments, the one or plurality of bioassays comprises performing a mass spectrometry analysis on a sample associated with the disorder to identify dysfunctional protein-protein interactions associated with the disorder.

    [0090] In some embodiments, each sample comprises a mixture of population of cells unaffected by the disorder and a population of cells expressing a mutation.

    [0091] In some embodiments, the calculating comprises calculating one or more of a SAINTexpress algorithm score, a CompPASS algorithm score, and a MiST algorithm score. In some embodiments, the calculating comprises calculating a SAINTexpress algorithm score and a MiST algorithm score.

    [0092] In some embodiments, the SAINTexpress algorithm score is calculated by a formula:

    [00001] ? ? indicates text missing or illegible when filed [0093] wherein X.sub.ij is the spectral count for a prey protein i identified in a purification of bait j; [0094] wherein λ.sub.ij is the mean count from a Poisson distribution representing true interaction; [0095] wherein κ.sub.ij is the mean count from a Poisson distribution representing false interaction; [0096] wherein π.sub.T is the proportion of true interactions in the data; and wherein dot notation represents all relevant model parameters estimated from the data for the pair of prey i and bait j.

    [0097] In some embodiments, the MiST algorithm score is calculated by a first formula:

    [00002] A b , i = .Math. r = 1 N B Q b , i , r N R

    wherein A.sub.b,i is the abundance of a given bait-prey pair i,b; wherein Q.sub.b,i,r is the quantity of bait-prey pair b,I in a replica r; and N.sub.r is the number of replicas; a second formula:

    [00003] R b , i = .Math. r = 1 N B Q b , i , r .Math. log ( Q b , i , r ) log 2 ( N R ) - 1

    wherein R.sub.b,i is the reproducibility of a given bait-prey pair b,I; and a third formula:

    [00004] S b , i = A b , i .Math. b = 1 N B A b , i

    wherein S.sub.b,i is the specificity of a given bait-prey pair b, i; and wherein N.sub.B is the number of baits.

    [0098] In some embodiments, the CompPASS algorithm score is calculated by a Z-score formula pair:

    [00005] X _ j = .Math. ? X i , j k ; n = 1 , 2 , .Math. m ( Eq . 1 ) Z i , j = X i , j - X _ j σ i ( Eq . 2 ) ? indicates text missing or illegible when filed

    wherein X is the TSC; wherein i is the bait number; wherein j is the interactor; wherein n is which interactor is being considered; wherein k is the total number of baits; and wherein s is the standard deviation of the TSC mean; a S-score formula:

    [00006] S i , j = ( k .Math. ? f i , j ) X i , j ; f i , j = { 1 : X i , j > 0 X i , j ( Eq . 3 ) ? indicates text missing or illegible when filed

    wherein f is 0 or 1; a D-score formula:

    [00007] D i , j = ( k .Math. ? f i , j ) p X i , j ; f i , j = { 1 : X i , j > 0 X i , j p = number of replicates runs in which the interactor is present ( Eq . 4 ) ? indicates text missing or illegible when filed

    wherein p is 1 or 2; and a WD-score formula:

    [00008] WD i , j = ( k .Math. ? f i , j ω j ) p X i , j ω i = ( σ j X _ i ) , X _ j = .Math. ? X i , j k ; n = 1 , 2 , .Math. m , if ω j 1 .fwdarw. ω j = 1 if ω j > 1 .fwdarw. ω j = ω j f i , j = { 1 : X i , j > 0 X i , j p = number of replicates runs in which the interactor is present ( Eq . 5 ) ? indicates text missing or illegible when filed

    wherein w.sub.j is a weight factor; wherein σ.sub.j is a standard deviation.

    [0099] In some embodiments, the DIS is calculated by a first formula:


    DIS.sub.A(b,p)=S.sub.C1(b,pS.sub.C2(b,p)×[1−S.sub.C3(b,p)]

    wherein DIS.sub.A(b,p) is the DIS for each protein-protein interaction (PPI) (b, p) that is conserved in a first bioassay and a second bioassay, but not shared by a third bioassay; wherein S.sub.C1(b,p) is the probability of a PPI being present in the first bioassay; wherein S.sub.C2(b,p) is the probability of a PPI being present in the second bioassay; and wherein S.sub.c3(b,p) is the probability of a PPI being present in the third bioassay; and a second formula:


    DIS.sub.B(b,p)=[1−S.sub.C1(b,p)]×[1−S.sub.C2(b,p)]×S.sub.C3(b,p

    wherein DIS.sub.B(b,p) is the DIS score for each PPI (b, p) that is conserved in the third bioassay, but not shared by the first bioassay and the second bioassay; wherein a (+) sign is assigned if DIS.sub.A(b,p)>DIS.sub.B(b,p); and wherein a (−) sign is assigned if DIS.sub.A(b,p)<DIS.sub.B(b,p).

    [0100] In some embodiments, the first, second and third bioassays are expression in a first cell line, expression in a second cell line and expression in a third cell line, respectively.

    [0101] In some embodiments, the DIS is an average of a SAINTexpress algorithm score and a CompPASS algorithm score.

    [0102] In some embodiments, the DIS comprises a SAINTexpress algorithm score.

    [0103] In some embodiments, the DIS is from about 0.0 to about 1.0.

    [0104] In some embodiments, a DIS of greater than about 0.5 indicates that the protein-protein interaction is likely a causal agent of the disorder.

    [0105] In some embodiments, a DIS of less than about 0.5 indicates that the protein-protein interaction is not likely a causal agent of the disorder.

    [0106] In some embodiments, the bioassay is a mass spectrometry analysis performed on a plurality of samples; and calculating comprises calculating a SAINTexpress algorithm score for each sample, and averaging the SAINTexpress algorithm scores.

    [0107] In some embodiments, the pathogen is a virus. In some embodiments, the pathogen is selected from human immunodeficiency virus (HIV), human papillomavirus (HPV), chicken pox virus, infectious mononucleosis, mumps, measles, rubella, VSV, ebola, viral gastroenteritis, viral hepatitis, viral meningitis, human metapneumovirus, human parainfluenza virus type 1, parainfluenza virus type 2, parainfluenza virus type 3, respiratory syncytial virus, viral pneumonia, yellow fever virus, tick-borne encephalitis virus, Chikungunya virus (CHIKV), Venezuelan equine encephalitis (VEEV), Eastern equine encephalitis (EEEV), Western equine encephalitis (WEEV), dengue (DENY), influenza, West Nile virus (WNV), zika (ZIKV), Middle East Respiratory Syndromes (MERS), Severe Acute Respiratory Syndrome (SARS), and coronavirus disease 2019 (COVID-19).

    [0108] In some embodiments, the pathogen protein is from Coronaviridae. In some embodiments, the pathogen protein is expressed by one of: Middle East Respiratory Syndromes coronavirus (MERS-CoV), Severe Acute Respiratory Syndrome coronavirus (SARS-CoV), and SARS-CoV-2.

    [0109] In some embodiments, the protein-protein interaction is an Orf9b: Tom70 interaction or an Orf8: IL17RA interaction.

    [0110] In some embodiments, the host protein is human prostaglandin E synthase type 2 (PGES-2) or a human sigma receptor.

    [0111] In some embodiments, the bioassay comprises one or a combination of: mass spectrometry analysis is performed on a plurality of samples from a population of subjects infected with the pathogen; siRNA knockdown analysis, CRISPR-mediated knockout analysis, infectivity analysis; and co-immunoprecipitation.

    [0112] In some embodiments, the method further comprises the step of: compiling genetic data about a population of subjects that comprise a mutation in a nucleic acid sequence that encodes the first protein.

    [0113] In some embodiments, the one or plurality of bioassays comprises performing a mass spectrometry analysis on a sample associated with the disorder to identify dysfunctional protein-protein interactions associated with the disorder.

    [0114] In some embodiments, a nucleic acid that encodes the first protein comprises at least about 70% sequence identity to any one of the nucleic acids identified in Table X.

    [0115] In some embodiments, the disorder is a cancer. In some embodiments, the cancer is a sarcoma, a carcinoma, a hematological cancer, a solid tumor, breast cancer, cervical cancer, gastrointestinal cancer, colorectal cancer, brain cancer, skin cancer, head and neck cancer, prostate cancer, ovarian cancer, thyroid cancer, testicular cancer, pancreatic cancer, liver cancer, endometrial cancer, melanoma, a glioma, leukemia, lymphoma, chronic myeloproliferative disorder, myelodysplastic syndrome, myeloproliferative neoplasm, non-small cell lung carcinoma, or plasma cell neoplasm (myeloma). In some embodiments, the cancer is breast cancer, head and neck cancer, lung cancer, pancreatic cancer, or brain cancer.

    [0116] In some embodiments, the disorder is a neuropsychiatric disease. In some embodiments, the neuropsychiatric disorder is autism, schizophrenia, obsessive-compulsive disorder (OCD), anxiety, depression, migraine headaches, palsies, seizures, addiction, uncontrolled anger, anorexia nervosa, bulimia nervosa, binge-eating disorder, attention deficit disorder (ADD), or attention-deficit/hyperactivity disorder (ADHD).

    [0117] In some embodiments, the neuropsychiatric disorder is autism, schizophrenia, obsessive-compulsive disorder (OCD), anxiety, or depression. In some embodiments, the disorder is a neurodegenerative disease.

    [0118] In some embodiments, the neurodegenerative disease is amytrophic lateral sclerosis (ALS), Parkinson's disease, Alzheimer's disease, Prion disease, motor neurone diseases (MND), Huntington's disease, spinocerebellar ataxia (SCA), or spinal muscular atrophy (SMA).

    [0119] In some embodiments, the neurodegenerative disease is amytrophic lateral sclerosis (ALS), Parkinson's disease, or Alzheimer's disease.

    [0120] In some embodiments, the method further comprises harvesting samples with a functional bioassay. In some embodiments, the functional bioassay is an animal model comprising growth of transformed cell lines.

    [0121] In some embodiments, the disorder is a viral disease that is due to a Coronavirus, and wherein the disorder treatment comprises administration of a prostaglandin E synthase type 2 (PGES-2) inhibitor or a sigma receptor inhibitor.

    [0122] In some embodiments, the sigma receptor inhibitor is an antipsychotic (e.g., fluphenazine, chlorpromazine, haloperidol), an antihistamine (e.g., clemastine, meclizine), an antimalarial (e.g., hydroxychloroquine, chloroquine), amiodarone, tamoxifen, triparanol, clomiphene, or propranalol.

    [0123] In some embodiments, the method further comprises a step of mapping the spatial organization of the protein-protein interaction.

    [0124] In some embodiments, the method further comprises a step of validating the protein-protein interaction by performing one or combination of: X-ray crystallography, mass spectrometry, and electron microscopy.

    [0125] In some embodiments, the electron microscopy is cryogenic electron microscopy.

    [0126] In some embodiments, the disclosure relates to methods of imaging a protein, the method comprising: (a) identifying a first protein that co-localizes with a first host protein in one or a plurality of bioassays; (b) calculating a differential interaction score (DIS) corresponding to the first protein in a sample; and (c) predicting the three-dimensional structure of the first protein by integrating the DIS score into a fit of cryo-EM structure image. In some embodiments, the first protein is isolated in vitro from a sample. In some embodiments, the sample is from a cell extract or subject. In some embodiments, the first protein is mutated as compared to a wild-type or endogenous, unmutated sequence. In some embodiments, the method is a computer-implemented method performed on a system disclosed herein, comprising instructions for execution of the DIS calculation.

    [0127] In some embodiments, the disclosure relates to methods of imaging an interaction between a pathogen protein and a host protein, the method comprising: (a) identifying a first pathogen protein that co-localizes with a first host protein in one or a plurality of bioassays; (b) calculating a differential interaction score (DIS) corresponding to a pathogen protein and a host protein in a sample; and (c) correlating the DIS with the likelihood that the dysfunctional protein-protein interaction is a causal agent of pathogenicity of the pathogen.

    [0128] In some embodiments, the disclosure relates to methods of imaging an interaction between a first protein and a second protein, wherein the first protein is associated with a disorder of a subject, the method comprising: (a) identifying a first protein that co-localizes with the second protein in one or a plurality of bioassays; (b) calculating a differential interaction score (DIS) corresponding to the first protein and a second protein in a sample from the subject; and (c) correlating the DIS with the likelihood that the dysfunctional protein-protein interaction is a causal agent of pathogenicity of the pathogen. In some embodiments, the method further comprises the step of: compiling genetic data about a population of subjects that comprise a mutation in a nucleic acid sequence that encodes the first protein. In some embodiments, the one or plurality of bioassays comprises performing a mass spectrometry analysis on a sample associated with the disorder to identify dysfunctional protein-protein interactions associated with the disorder.

    [0129] In some embodiments, the method further comprises applying Cryo-EM as described elsewhere herein, thereby providing a 3-dimensional structure of the interaction. For example, in some embodiments, the method further comprises: (a) obtaining a molecular volume for the first protein while co-localized with the second protein using a structural-biology technique at a resolution of about 20 Å or better (less); (b) predicting a 3D structure of the first protein co-localized with the second protein based on artificial intelligence (AI) prediction using one or a plurality of deep neural networks to predict the 3D structure based on sequence; (c) breaking the 3D structure predicted in step (b) into overlapping regions; (d) global rigid-body fitting the overlapping regions against the molecular volume obtained in step (a); (e) examining top scoring fits and generating new region boundaries; (f) optionally repeating steps (d) and (e) for one or a plurality of times; (g) combining the regions into a complete protein-protein structure; and (h) refining the complete protein-protein structure obtained in step (g) into the molecular volume of (a). In some embodiments, the method further comprises applying Cryo-EM as described elsewhere herein, thereby providing a 3-dimensional structure of the interaction. For example, in some embodiments, the method further comprises: (a) obtaining a molecular volume for the first protein while co-localized with the second protein using a structural-biology technique; (b) predicting a 3D structure of the first protein co-localized with the second protein based on artificial intelligence (AI) prediction; (c) breaking the 3D structure predicted in step (b) into overlapping regions; (d) global rigid-body fitting the overlapping regions against the molecular volume obtained in step (a); and (e) examining top scoring fits and generating new region boundaries. In some embodiments, the method further comprises generating a structural image of the first protein and/or second protein based upon any one or more of steps (a), (b), (c), (d) and (e). In some embodiments, the AI prediction is performed by applying one or a plurality of deep neural networks to predict the 3D structure based on amino acid sequence. In some embodiments, the AI prediction is performed by using AlphaFold (available at https://alphafold.ebi.ac.uk, which is incorporated by reference in its entirety). In some embodiments, the methods further comprise optionally repeating steps (d) and (e) for one or a plurality of times. In some embodiments, the methods further comprise (g) combining the regions into a complete protein-protein structure. In some embodiments the methods further comprise (h) refining the complete protein-protein structure obtained in step (g) into the molecular volume of (a). In some embodiments, the methods further comprise imaging the complete protein-protein structure by using a computer program product in a system operably connected to or part of a controller in a system disclosed herein, such system comprising a display operably connected to the controller and capable of displaying the complete protein-protein structure to an operator of the system. In some embodiments, the methods are computer-implemented methods comprising a step of calculating a DIS.

    [0130] In some embodiments, the disclosed methods further comprise creating a genetic interaction phenotypic profile. Genetic interaction phenotypic profiles are disclosed in PCT/US21/55059, the contents of which are hereby incorporated by reference.

    Methods of Identifying Therapeutic Targets and of Screening for and Evaluating Therapeutics

    [0131] In some embodiments, the disclosure relates to methods of identifying a therapeutic target for a disorder treatment, the method comprising: (a) compiling genetic data about a population of subjects that has a mutation candidate that causes a disorder; (b) performing a mass spectrometry analysis on a sample associated with the disorder to identify dysfunctional protein-protein interactions associated with the disorder; (c) calculating a differential interaction score (DIS); (d) correlating the DIS with the likelihood that the dysfunctional protein-protein interaction is a causal agent of the disorder, wherein if the DIS score is above a first threshold, then the causal agent is selected as a therapeutic target for the disorder treatment, and wherein if the DIS score is below the first threshold, then the causal agent is not selected as a therapeutic target for the disorder treatment.

    [0132] In some embodiments, the disclosure relates to methods of identifying a therapeutic target for a disorder treatment, the method comprising: (a) calculating a differential interaction score (DIS); and (b) correlating the DIS with a likelihood that a dysfunctional protein-protein interaction is a causal agent of the disorder, wherein if the DIS score is above a first threshold, then the causal agent is selected as a therapeutic target for the disorder treatment, and wherein if the DIS score is below the first threshold, then the causal agent is not selected as a therapeutic target for the disorder treatment.

    [0133] In some embodiments, the disclosure relates to methods of identifying a therapeutic for treating a disorder, the method comprising screening a candidate compound for binding with, or activity against a therapeutic target, wherein the therapeutic target was identified via a disclosed method.

    [0134] In some embodiments, the disclosure relates to methods of predicting a likelihood that a disorder is responsive to a therapeutic, the method comprising: (a) compiling genetic data about a population of subjects that has a mutation candidate that causes a disorder; (b) performing a mass spectrometry analysis on a sample associated with the disorder to identify dysfunctional protein-protein interactions associated with the disorder; (c) calculating a differential interaction score (DIS); (d) correlating the DIS with the likelihood that the dysfunctional protein-protein interaction is the causal agent of the disorder; and (e) selecting a therapeutic for treating the disorder based upon the causal agent.

    [0135] In some embodiments, the sample is a population of cells.

    [0136] In some embodiments, the bioassay comprises one or a combination of: mass spectrometry analysis is performed on a plurality of samples from a population of subjects infected with the pathogen; siRNA knockdown analysis, CRISPR-mediated knockout analysis, infectivity analysis; and co-immunoprecipitation.

    [0137] In some embodiments, the method further comprises the step of: compiling genetic data about a population of subjects that comprise a mutation in a nucleic acid sequence that encodes the first host protein.

    [0138] In some embodiments, the one or plurality of bioassays comprises performing a mass spectrometry analysis on a sample associated with the disorder to identify dysfunctional protein-protein interactions associated with the disorder.

    [0139] In some embodiments, each sample comprises a mixture of population of cells unaffected by the disorder and a population of cells expressing a mutation.

    [0140] In some embodiments, the calculating comprises calculating one or more of a SAINTexpress algorithm score, a CompPASS algorithm score, and a MiST algorithm score as further described elsewhere herein. In some embodiments, the calculating comprises calculating a SAINTexpress algorithm score and a MiST algorithm score.

    [0141] In some embodiments, the DIS is calculated by a first formula:


    DIS.sub.A(b,p)=S.sub.C1(b,pS.sub.C2(b,p)×[1−S.sub.C3(b,p)]

    wherein DIS.sub.A(b,p) is the DIS for each protein-protein interaction (PPI) (b, p) that is conserved in a first bioassay and a second bioassay, but not shared by a third bioassay; wherein S.sub.C1(b,p) is the probability of a PPI being present in the first bioassay; wherein S.sub.C2(b,p) is the probability of a PPI being present in the second bioassay; and wherein S.sub.c3(b,p) is the probability of a PPI being present in the third bioassay; and a second formula:


    DIS.sub.B(b,p)=[1−S.sub.C1(b,p)]×[1−S.sub.C2(b,p)]×S.sub.C3(b,p)

    wherein DIS.sub.B(b,p) is the DIS score for each PPI (b, p) that is conserved in the third bioassay, but not shared by the first bioassay and the second bioassay; wherein a (+) sign is assigned if DIS.sub.A(b,p)>DIS.sub.B(b,p); and wherein a (−) sign is assigned if DIS.sub.A(b,p)<DIS.sub.B(b,p).

    [0142] In some embodiments, the first, second and third bioassays are expression in a first cell line, expression in a second cell line and expression in a third cell line, respectively.

    [0143] In some embodiments, the DIS is an average of a SAINTexpress algorithm score and a CompPASS algorithm score.

    [0144] In some embodiments, the DIS comprises a SAINTexpress algorithm score.

    [0145] In some embodiments, the DIS is from about 0.0 to about 1.0.

    [0146] In some embodiments, a DIS of greater than about 0.5 indicates that the protein-protein interaction is likely a causal agent of the disorder.

    [0147] In some embodiments, a DIS of less than about 0.5 indicates that the protein-protein interaction is not likely a causal agent of the disorder.

    [0148] In some embodiments, the bioassay is a mass spectrometry analysis performed on a plurality of samples; and calculating comprises calculating a SAINTexpress algorithm score for each sample, and averaging the SAINTexpress algorithm scores.

    [0149] In some embodiments, the pathogen is a virus. In some embodiments, the pathogen is selected from human immunodeficiency virus (HIV), human papillomavirus (HPV), chicken pox virus, infectious mononucleosis, mumps, measles, rubella, VSV, ebola, viral gastroenteritis, viral hepatitis, viral meningitis, human metapneumovirus, human parainfluenza virus type 1, parainfluenza virus type 2, parainfluenza virus type 3, respiratory syncytial virus, viral pneumonia, yellow fever virus, tick-borne encephalitis virus, Chikungunya virus (CHIKV), Venezuelan equine encephalitis (VEEV), Eastern equine encephalitis (EEEV), Western equine encephalitis (WEEV), dengue (DENY), influenza, West Nile virus (WNV), zika (ZIKV), Middle East Respiratory Syndromes (MERS), Severe Acute Respiratory Syndrome (SARS), and coronavirus disease 2019 (COVID-19).

    [0150] In some embodiments, the pathogen protein is from Coronaviridae. In some embodiments, the pathogen protein is expressed by one of: Middle East Respiratory Syndromes coronavirus (MERS-CoV), Severe Acute Respiratory Syndrome coronavirus (SARS-CoV), and SARS-CoV-2.

    [0151] In some embodiments, the protein-protein interaction is an Orf9b: Tom70 interaction or an Orf8: IL17RA interaction.

    [0152] In some embodiments, the host protein is human prostaglandin E synthase type 2 (PGES-2) or a human sigma receptor.

    [0153] In some embodiments, the bioassay comprises one or a combination of: mass spectrometry analysis is performed on a plurality of samples from a population of subjects infected with the pathogen; siRNA knockdown analysis, CRISPR-mediated knockout analysis, infectivity analysis; and co-immunoprecipitation.

    [0154] In some embodiments, the method further comprises the step of: compiling genetic data about a population of subjects that comprise a mutation in a nucleic acid sequence that encodes the first protein.

    [0155] In some embodiments, the one or plurality of bioassays comprises performing a mass spectrometry analysis on a sample associated with the disorder to identify dysfunctional protein-protein interactions associated with the disorder.

    [0156] In some embodiments, a nucleic acid that encodes the first protein comprises at least about 70% sequence identity to any one of the nucleic acids identified in Table X.

    [0157] In some embodiments, the disorder is a cancer. In some embodiments, the cancer is a sarcoma, a carcinoma, a hematological cancer, a solid tumor, breast cancer, cervical cancer, gastrointestinal cancer, colorectal cancer, brain cancer, skin cancer, head and neck cancer, prostate cancer, ovarian cancer, thyroid cancer, testicular cancer, pancreatic cancer, liver cancer, endometrial cancer, melanoma, a glioma, leukemia, lymphoma, chronic myeloproliferative disorder, myelodysplastic syndrome, myeloproliferative neoplasm, non-small cell lung carcinoma, or plasma cell neoplasm (myeloma). In some embodiments, the cancer is breast cancer, head and neck cancer, lung cancer, pancreatic cancer, or brain cancer.

    [0158] In some embodiments, the disorder is a neuropsychiatric disease. In some embodiments, the neuropsychiatric disorder is autism, schizophrenia, obsessive-compulsive disorder (OCD), anxiety, depression, migraine headaches, palsies, seizures, addiction, uncontrolled anger, anorexia nervosa, bulimia nervosa, binge-eating disorder, attention deficit disorder (ADD), or attention-deficit/hyperactivity disorder (ADHD).

    [0159] In some embodiments, the neuropsychiatric disorder is autism, schizophrenia, obsessive-compulsive disorder (OCD), anxiety, or depression. In some embodiments, the disorder is a neurodegenerative disease.

    [0160] In some embodiments, the neurodegenerative disease is amytrophic lateral sclerosis (ALS), Parkinson's disease, Alzheimer's disease, Prion disease, motor neurone diseases (MND), Huntington's disease, spinocerebellar ataxia (SCA), or spinal muscular atrophy (SMA).

    [0161] In some embodiments, the neurodegenerative disease is amytrophic lateral sclerosis (ALS), Parkinson's disease, or Alzheimer's disease.

    [0162] In some embodiments, the method further comprises harvesting samples with a functional bioassay. In some embodiments, the functional bioassay is an animal model comprising growth of transformed cell lines.

    [0163] In some embodiments, the disorder is a viral disease that is due to a Coronavirus, and wherein the disorder treatment comprises administration of a prostaglandin E synthase type 2 (PGES-2) inhibitor or a sigma receptor inhibitor.

    [0164] In some embodiments, the sigma receptor inhibitor is an antipsychotic (e.g., fluphenazine, chlorpromazine, haloperidol), an antihistamine (e.g., clemastine, meclizine), an antimalarial (e.g., hydroxychloroquine, chloroquine), amiodarone, tamoxifen, triparanol, clomiphene, or propranalol.

    [0165] In some embodiments, the step of identifying the genetic information from a subject comprises sequencing the genetic information from a biopsy or sample obtained from the subject.

    [0166] In some embodiments, the first, second and third cell lines are cell lines used in performance of a functional bioassay.

    [0167] In some embodiments, the step of selecting a disorder treatment comprises selecting a treatment from a database of known treatments for the dysfunctional protein-protein interaction.

    [0168] In some embodiments, the method further comprises a step of mapping the spatial organization of the protein-protein interaction.

    [0169] In some embodiments, the method further comprises a step of validating the protein-protein interaction by performing one or combination of: X-ray crystallography, mass spectrometry, and electron microscopy.

    [0170] In some embodiments, the electron microscopy is cryogenic electron microscopy.

    Methods of Identifying and Monitoring a Subject's Responsiveness to a Hyperproliferative Disorder Treatment

    [0171] In some embodiments, the disclosure relates to methods of identifying a subject likely to respond to a disorder treatment, the method comprising: (a) calculating a differential interaction score (DIS); and (b) correlating the DIS with a likelihood that a dysfunctional protein-protein interaction is a causal agent of the disorder, wherein if the DIS score is above a first threshold, then the subject is likely to respond to a disorder treatment based upon the causal agent, and wherein if the DIS score is below the first threshold, then the subject is not likely to respond to the disorder treatment based upon the causal agent. In some embodiments, the method further comprises (a) compiling genetic data about a population of subjects comprising the subject, wherein the population of subjects has a mutation candidate that causes the disorder; and (b) performing a mass spectrometry analysis on a sample associated with the disorder to identify dysfunctional protein-protein interactions associated with the disorder.

    [0172] In some embodiments, the disclosure relates to methods of predicting a likelihood that a subject does or does not respond to a disorder treatment, the method comprising: (a) compiling genetic data about a population of subjects that has a mutation candidate that causes a disorder, wherein the population of subjects includes the subject; (b) performing a mass spectrometry analysis on a sample associated with the disorder to identify dysfunctional protein-protein interactions associated with the disorder; (c) calculating a differential interaction score (DIS); (d) correlating the DIS with the likelihood that the dysfunctional protein-protein interaction is the causal agent of the disorder; and (e) selecting a treatment for the subject based upon the causal agent. In some embodiments, the method further comprises: (f) comparing the DIS score to a first threshold; and (g) classifying the subject as being likely to respond to a disorder treatment, wherein each of steps (f) and (g) are performed after step (c), and wherein the first threshold is calculated relative to a first control dataset.

    [0173] In some embodiments, the disclosure relates to methods of treating a viral infection due to a Coronavirus in a subject having a genetic alteration in PGES-2 signaling, the method comprising administering to the subject a pharmaceutically effective amount of a PGES-2 inhibitor, wherein the subject was previously identified as being in need of treatment by: (a) performing a mass spectrometry analysis on a sample from the subject; (b) identifying dysfunctional protein-protein interactions associated with the viral infection; and (c) calculating a differential interaction score (DIS).

    [0174] In some embodiments, the disclosure relates to methods of treating a Coronaviridae viral infection in a subject in need thereof, the method comprising administering to the subject a pharmaceutically effective amount of a sigma receptor inhibitor, wherein the subject was previously identified as being in need of treatment by: (a) performing a mass spectrometry analysis on a sample from the subject; (b) identifying dysfunctional protein-protein interactions associated with the viral infection; and (c) calculating a differential interaction score (DIS).

    [0175] In some embodiments, the disclosure relates to methods of selecting a disorder treatment for a subject in need thereof, the method comprising: (a) identifying genetic data from the subject in need of treatment; (b) comparing the genetic data from the subject to a compilation of genetic data from population of subjects that has a mutation candidate that causes a disorder, wherein the population of subjects includes the subject in need thereof; (c) performing a mass spectrometry analysis on a sample from the subject associated with the disorder to identify dysfunctional protein-protein interactions associated with the disorder; (d) calculating a differential interaction score (DIS); (e) correlating the DIS with the likelihood that the dysfunctional protein-protein interaction is a causal agent of the disorder; and (f) selecting a disorder treatment for the subject based upon the causal agent.

    [0176] In some embodiments, the sample is a population of cells.

    [0177] In some embodiments, the bioassay comprises one or a combination of: mass spectrometry analysis is performed on a plurality of samples from a population of subjects infected with the pathogen; siRNA knockdown analysis, CRISPR-mediated knockout analysis, infectivity analysis; and co-immunoprecipitation.

    [0178] In some embodiments, the method further comprises the step of: compiling genetic data about a population of subjects that comprise a mutation in a nucleic acid sequence that encodes the first host protein.

    [0179] In some embodiments, the one or plurality of bioassays comprises performing a mass spectrometry analysis on a sample associated with the disorder to identify dysfunctional protein-protein interactions associated with the disorder.

    [0180] In some embodiments, each sample comprises a mixture of population of cells unaffected by the disorder and a population of cells expressing a mutation.

    [0181] In some embodiments, the calculating comprises calculating one or more of a SAINTexpress algorithm score, a CompPASS algorithm score, and a MiST algorithm score as further described elsewhere herein. In some embodiments, the calculating comprises calculating a SAINTexpress algorithm score and a MiST algorithm score.

    [0182] In some embodiments, the DIS is calculated by a first formula:


    DIS.sub.A(b,p)=S.sub.C1(b,pS.sub.C2(b,p)×[1−S.sub.C3(b,p)]

    wherein DIS.sub.A(b,p) is the DIS for each protein-protein interaction (PPI) (b, p) that is conserved in a first bioassay and a second bioassay, but not shared by a third bioassay; wherein S.sub.C1(b,p) is the probability of a PPI being present in the first bioassay; wherein S.sub.C2(b,p) is the probability of a PPI being present in the second bioassay; and wherein S.sub.c3(b,p) is the probability of a PPI being present in the third bioassay; and a second formula:


    DIS.sub.B(b,p)=[1−S.sub.C1(b,p)]×[1−S.sub.C2(b,p)]×S.sub.C3(b,p)

    wherein DIS.sub.B(b,p) is the DIS score for each PPI (b, p) that is conserved in the third bioassay, but not shared by the first bioassay and the second bioassay; wherein a (+) sign is assigned if DIS.sub.A(b,p)>DIS.sub.B(b,p); and wherein a (−) sign is assigned if DIS.sub.A(b,p)<DIS.sub.B(b,p).

    [0183] In some embodiments, the first, second and third bioassays are expression in a first cell line, expression in a second cell line and expression in a third cell line, respectively.

    [0184] In some embodiments, the DIS is an average of a SAINTexpress algorithm score and a CompPASS algorithm score.

    [0185] In some embodiments, the DIS comprises a SAINTexpress algorithm score.

    [0186] In some embodiments, the DIS is from about 0.0 to about 1.0.

    [0187] In some embodiments, a DIS of greater than about 0.5 indicates that the protein-protein interaction is likely a causal agent of the disorder.

    [0188] In some embodiments, a DIS of less than about 0.5 indicates that the protein-protein interaction is not likely a causal agent of the disorder.

    [0189] In some embodiments, the bioassay is a mass spectrometry analysis performed on a plurality of samples; and calculating comprises calculating a SAINTexpress algorithm score for each sample, and averaging the SAINTexpress algorithm scores.

    [0190] In some embodiments, the pathogen is a virus. In some embodiments, the pathogen is selected from human immunodeficiency virus (HIV), human papillomavirus (HPV), chicken pox virus, infectious mononucleosis, mumps, measles, rubella, VSV, ebola, viral gastroenteritis, viral hepatitis, viral meningitis, human metapneumovirus, human parainfluenza virus type 1, parainfluenza virus type 2, parainfluenza virus type 3, respiratory syncytial virus, viral pneumonia, yellow fever virus, tick-borne encephalitis virus, Chikungunya virus (CHIKV), Venezuelan equine encephalitis (VEEV), Eastern equine encephalitis (EEEV), Western equine encephalitis (WEEV), dengue (DENY), influenza, West Nile virus (WNV), zika (ZIKV), Middle East Respiratory Syndromes (MERS), Severe Acute Respiratory Syndrome (SARS), and coronavirus disease 2019 (COVID-19).

    [0191] In some embodiments, the pathogen protein is from Coronaviridae. In some embodiments, the pathogen protein is expressed by one of: Middle East Respiratory Syndromes coronavirus (MERS-CoV), Severe Acute Respiratory Syndrome coronavirus (SARS-CoV), and SARS-CoV-2.

    [0192] In some embodiments, the protein-protein interaction is an Orf9b: Tom70 interaction or an Orf8: IL17RA interaction.

    [0193] In some embodiments, the host protein is human prostaglandin E synthase type 2 (PGES-2) or a human sigma receptor.

    [0194] In some embodiments, the bioassay comprises one or a combination of: mass spectrometry analysis is performed on a plurality of samples from a population of subjects infected with the pathogen; siRNA knockdown analysis, CRISPR-mediated knockout analysis, infectivity analysis; and co-immunoprecipitation.

    [0195] In some embodiments, the method further comprises the step of: compiling genetic data about a population of subjects that comprise a mutation in a nucleic acid sequence that encodes the first protein.

    [0196] In some embodiments, the one or plurality of bioassays comprises performing a mass spectrometry analysis on a sample associated with the disorder to identify dysfunctional protein-protein interactions associated with the disorder.

    [0197] In some embodiments, a nucleic acid that encodes the first protein comprises at least about 70% sequence identity to any one of the nucleic acids identified in Table X.

    [0198] In some embodiments, the disorder is a cancer. In some embodiments, the cancer is a sarcoma, a carcinoma, a hematological cancer, a solid tumor, breast cancer, cervical cancer, gastrointestinal cancer, colorectal cancer, brain cancer, skin cancer, head and neck cancer, prostate cancer, ovarian cancer, thyroid cancer, testicular cancer, pancreatic cancer, liver cancer, endometrial cancer, melanoma, a glioma, leukemia, lymphoma, chronic myeloproliferative disorder, myelodysplastic syndrome, myeloproliferative neoplasm, non-small cell lung carcinoma, or plasma cell neoplasm (myeloma). In some embodiments, the cancer is breast cancer, head and neck cancer, lung cancer, pancreatic cancer, or brain cancer.

    [0199] In some embodiments, the disorder is a neuropsychiatric disease. In some embodiments, the neuropsychiatric disorder is autism, schizophrenia, obsessive-compulsive disorder (OCD), anxiety, depression, migraine headaches, palsies, seizures, addiction, uncontrolled anger, anorexia nervosa, bulimia nervosa, binge-eating disorder, attention deficit disorder (ADD), or attention-deficit/hyperactivity disorder (ADHD).

    [0200] In some embodiments, the neuropsychiatric disorder is autism, schizophrenia, obsessive-compulsive disorder (OCD), anxiety, or depression. In some embodiments, the disorder is a neurodegenerative disease.

    [0201] In some embodiments, the neurodegenerative disease is amytrophic lateral sclerosis (ALS), Parkinson's disease, Alzheimer's disease, Prion disease, motor neurone diseases (MND), Huntington's disease, spinocerebellar ataxia (SCA), or spinal muscular atrophy (SMA).

    [0202] In some embodiments, the neurodegenerative disease is amytrophic lateral sclerosis (ALS), Parkinson's disease, or Alzheimer's disease.

    [0203] In some embodiments, the method further comprises harvesting samples with a functional bioassay. In some embodiments, the functional bioassay is an animal model comprising growth of transformed cell lines.

    [0204] In some embodiments, the subject is a mammal. In some embodiments, the mammal is a human.

    [0205] In some embodiments, the subject has been diagnosed with a need for treatment of the disorder prior to the administering step.

    [0206] In some embodiments, the method further comprises identifying a subject in need of treatment of the disorder.

    [0207] In some embodiments, the subject is identified as being likely to respond to a treatment if the DIS score is greater than 0.5.

    [0208] In some embodiments, the subject is identified as being unlikely to respond to a treatment if the DIS score is 0.5 or less.

    [0209] In some embodiments, the method further comprises selecting a disorder treatment for the subject based upon the interaction between the first and second protein.

    [0210] In some embodiments, the disorder is a viral disease that is due to a Coronavirus, and wherein the disorder treatment comprises administration of a prostaglandin E synthase type 2 (PGES-2) inhibitor or a sigma receptor inhibitor.

    [0211] In some embodiments, the sigma receptor inhibitor is an antipsychotic (e.g., fluphenazine, chlorpromazine, haloperidol), an antihistamine (e.g., clemastine, meclizine), an antimalarial (e.g., hydroxychloroquine, chloroquine), amiodarone, tamoxifen, triparanol, clomiphene, or propranalol.

    [0212] In some embodiments, the subject comprises a genetic alteration in sigma receptor signaling.

    [0213] In some embodiments, the step of identifying the genetic information from a subject comprises sequencing the genetic information from a biopsy or sample obtained from the subject.

    [0214] In some embodiments, the first, second and third cell lines are cell lines used in performance of a functional bioassay.

    [0215] In some embodiments, the step of selecting a disorder treatment comprises selecting a treatment from a database of known treatments for the dysfunctional protein-protein interaction.

    [0216] In some embodiments, the method further comprises a step of mapping the spatial organization of the protein-protein interaction.

    [0217] In some embodiments, the method further comprises a step of validating the protein-protein interaction by performing one or combination of: X-ray crystallography, mass spectrometry, and electron microscopy.

    [0218] In some embodiments, the electron microscopy is cryogenic electron microscopy.

    Systems

    [0219] The above-described methods can be implemented in any of numerous ways. For example, the embodiments may be implemented using a computer program product (i.e., software), hardware, software, or a combination thereof. When implemented in software, the software code can be executed on any suitable processor or collection of processors, whether provided in a single computer or distributed among multiple computers.

    [0220] In some embodiments, the disclosure relates to computer program products encoded on a computer-readable storage medium, wherein the computer program product comprises instructions for: (a) identifying protein-protein interactions associated with the disorder; and (b) calculating a differential interaction score (DIS).

    [0221] In some embodiments, the disclosure relates to systems for identifying a protein interaction network in a subject, the system comprising: (a) a processor operable to execute programs; (b) a memory associated with the processor; (c) a database associated with said processor and said memory; and (d) a program stored in the memory and executable by the processor, the program being operable for: (i) performing a mass spectrometry analysis on a sample from a subject that has a mutation candidate that causes a disorder; (ii) identifying dysfunctional protein-protein interactions associated with the disorder; and (iii) calculating a differential interaction score (DIS).

    [0222] In some embodiments, the instructions further comprise a step of correlating the DIS with the likelihood that the dysfunctional protein-protein interaction is a causal agent of the disorder.

    [0223] In some embodiments, the computer program product further comprise instructions for selecting a treatment for the subject based upon the causal agent.

    [0224] In some embodiment, the computer program product further comprises instructions for: (d) comparing the DIS score to a first threshold; and (e) classifying the subject as being likely to respond to a disorder treatment, wherein each of steps (d) and (e) are performed after step (c), and wherein the first threshold is calculated relative to a first control dataset.

    [0225] In some embodiments, disclosed is a system comprising a disclosed computer program product, and one or more of: (a) a processor operable to execute programs; and (b) a memory associated with the processor.

    [0226] Further, it should be appreciated that a computer may be embodied in any of a number of forms, such as a rack-mounted computer, a desktop computer, a laptop computer, or a tablet computer. Additionally, a computer may be embedded in a device not generally regarded as a computer but with suitable processing capabilities, including a Personal Digital Assistant (PDA), a smart phone, or any other suitable portable or fixed electronic device.

    [0227] Also, a computer may have one or more input and output devices. These devices can be used, among other things, to present a user interface. Examples of output devices that can be used to provide a user interface include printers or display screens for visual presentation of output and speakers or other sound generating devices for audible presentation of output. Examples of input devices that can be used for a user interface include keyboards, and pointing devices, such as mice, touch pads, and digitizing tablets. As another example, a computer may receive input information through speech recognition or in other audible format.

    [0228] Such computers may be interconnected by one or more networks in any suitable form, including a local area network or a wide area network, such as an enterprise network, and intelligent network (IN) or the Internet. Such networks may be based on any suitable technology and may operate according to any suitable protocol and may include wireless networks, wired networks, or fiber optic networks.

    [0229] A computer employed to implement at least a portion of the functionality described herein may include a memory, coupled to one or more processing units (also referred to herein simply as “processors”), one or more communication interfaces, one or more display units, and one or more user input devices. The memory may include any computer-readable media, and may store computer instructions (also referred to herein as “processor-executable instructions”) for implementing the various functionalities described herein. The processing unit(s) may be used to execute the instructions. The communication interface(s) may be coupled to a wired or wireless network, bus, or other communication means and may therefore allow the computer to transmit communications to and/or receive communications from other devices. The display unit(s) may be provided, for example, to allow a user to view various information in connection with execution of the instructions. The user input device(s) may be provided, for example, to allow the user to make manual adjustments, make selections, enter data or various other information, and/or interact in any of a variety of manners with the processor during execution of the instructions.

    [0230] The various methods or processes outlined herein may be coded as software that is executable on one or more processors that employ any one of a variety of operating systems or platforms. The disclosure also relates to a computer readable storage medium comprising executable instructions. Additionally, such software may be written using any of a number of suitable programming languages and/or programming or scripting tools, and also may be compiled as executable machine language code or intermediate code that is executed on a framework or virtual machine.

    [0231] In this respect, various inventive concepts may be embodied as a computer readable storage medium (or multiple computer readable storage media) (e.g., a computer memory, one or more floppy discs, compact discs, optical discs, magnetic tapes, flash memories, circuit configurations in Field Programmable Gate Arrays or other semiconductor devices, or other non-transitory medium or tangible computer storage medium) encoded with one or more programs that, when executed on one or more computers or other processors, perform methods that implement the various embodiments of the invention disclosed herein. The computer readable medium or media can be transportable, such that the program or programs stored thereon can be loaded onto one or more different computers or other processors to implement various aspects of the present invention as discussed above. In some embodiments, the system comprises cloud-based software that executes one or all of the steps of each disclosed method instruction.

    [0232] The terms “program” or “software” are used herein in a generic sense to refer to any type of computer code or set of computer-executable instructions that can be employed to program a computer or other processor to implement various aspects of embodiments as discussed above. Additionally, it should be appreciated that according to one aspect, one or more computer programs that when executed perform methods of the present disclosure need not reside on a single computer or processor, but may be distributed in a modular fashion amongst a number of different computers or processors to implement various aspects of the present invention.

    [0233] Computer-executable instructions may be in many forms, such as program modules, executed by one or more computers or other devices. Generally, program modules include routines, programs, objects, components, data structures, etc. that perform particular tasks or implement particular abstract data types. Typically, the functionality of the program modules may be combined or distributed as desired in various embodiments.

    [0234] Also, data structures may be stored in computer-readable media in any suitable form. For simplicity of illustration, data structures may be shown to have fields that are related through location in the data structure. Such relationships may likewise be achieved by assigning storage for the fields with locations in a computer-readable medium that convey relationship between the fields. However, any suitable mechanism may be used to establish a relationship between information in fields of a data structure, including through the use of pointers, tags or other mechanisms that establish relationship between data elements.

    [0235] Also, the disclosure relates to various embodiments in which one or more methods. The acts performed as part of the method may be ordered in any suitable way. Accordingly, embodiments may be constructed in which acts are performed in an order different than illustrated, which may include performing some acts simultaneously, even though shown as sequential acts in illustrative embodiments.

    [0236] Computer-implemented embodiments of the disclosure relate to methods of determining a subject likely to respond to disease-modifying agents comprising steps of: (e) comparing the first normalized score to a first threshold relative to a first control dataset of a sample and comparing a second normalized score to a second threshold relative to a control dataset of the sample; and (f) classifying the subject as being likely to respond to a chemotherapeutic treatment based upon results of comparing of step (e) relative to the first and/or second threshold; wherein each of steps (e) and (f) are performed after step (d).

    [0237] In some embodiments, the disclosure relates to a system that comprises at least one processor, a program storage, such as memory, for storing program code executable on the processor, and one or more input/output devices and/or interfaces, such as data communication and/or peripheral devices and/or interfaces. In some embodiments, the user device and computer system or systems are communicably connected by a data communication network, such as a Local Area Network (LAN), the Internet, or the like, which may also be connected to a number of other client and/or server computer systems. The user device and client and/or server computer systems may further include appropriate operating system software.

    [0238] In some embodiments, components and/or units of the devices described herein may be able to interact through one or more communication channels or mediums or links, for example, a shared access medium, a global communication network, the Internet, the World Wide Web, a wired network, a wireless network, a combination of one or more wired networks and/or one or more wireless networks, one or more communication networks, an a-synchronic or asynchronous wireless network, a synchronic wireless network, a managed wireless network, a non-managed wireless network, a burstable wireless network, a non-burstable wireless network, a scheduled wireless network, a non-scheduled wireless network, or the like.

    [0239] Discussions herein utilizing terms such as, for example, “processing,” “computing,” “calculating,” “determining,” or the like, may refer to operation(s) and/or process(es) of a computer, a computing platform, a computing system, or other electronic computing device, that manipulate and/or transform data represented as physical (e.g., electronic) quantities within the computer's registers and/or memories into other data similarly represented as physical quantities within the computer's registers and/or memories or other information storage medium that may store instructions to perform operations and/or processes.

    [0240] Some embodiments may take the form of an entirely hardware embodiment, an entirely software embodiment, or an embodiment including both hardware and software elements. Some embodiments may be implemented in software, which includes but is not limited to firmware, resident software, microcode, or the like.

    [0241] Furthermore, some embodiments may take the form of a computer program product accessible from a computer-usable or computer-readable medium providing program code for use by or in connection with a computer or any instruction execution system. For example, a computer-usable or computer-readable medium may be or may include any apparatus that can contain, store, communicate, propagate, or transport the program for use by or in connection with the instruction execution system, apparatus, or device.

    [0242] In some embodiments, the medium may be or may include an electronic, magnetic, optical, electromagnetic, InfraRed (IR), or semiconductor system (or apparatus or device) or a propagation medium. Some demonstrative examples of a computer-readable medium may include a semiconductor or solid state memory, magnetic tape, a removable computer diskette, a Random Access Memory (RAM), a Read-Only Memory (ROM), a rigid magnetic disk, an optical disk, or the like. Some demonstrative examples of optical disks include Compact Disk-Read-Only Memory (CD-ROM), Compact Disk-Read/Write (CD-R/W), DVD, or the like.

    [0243] In some embodiments, a data processing system suitable for storing and/or executing program code may include at least one processor coupled directly or indirectly to memory elements, for example, through a system bus. The memory elements may include, for example, local memory employed during actual execution of the program code, bulk storage, and cache memories which may provide temporary storage of at least some program code in order to reduce the number of times code must be retrieved from bulk storage during execution.

    [0244] In some embodiments, input/output or I/O devices (including but not limited to keyboards, displays, pointing devices, etc.) may be coupled to the system either directly or through intervening I/O controllers. In some embodiments, network adapters may be coupled to the system to enable the data processing system to become coupled to other data processing systems or remote printers or storage devices, for example, through intervening private or public networks. In some embodiments, modems, cable modems and Ethernet cards are demonstrative examples of types of network adapters. Other suitable components may be used.

    [0245] Some embodiments may be implemented by software, by hardware, or by any combination of software and/or hardware as may be suitable for specific applications or in accordance with specific design requirements. Some embodiments may include units and/or sub-units, which may be separate of each other or combined together, in whole or in part, and may be implemented using specific, multi-purpose or general processors or controllers. Some embodiments may include buffers, registers, stacks, storage units and/or memory units, for temporary or long-term storage of data or in order to facilitate the operation of particular implementations.

    [0246] Some embodiments may be implemented, for example, using a machine-readable medium or article which may store an instruction or a set of instructions that, if executed by a machine, cause the machine to perform a method steps and/or operations described herein. Such machine may include, for example, any suitable processing platform, computing platform, computing device, processing device, electronic device, electronic system, computing system, processing system, computer, processor, or the like, and may be implemented using any suitable combination of hardware and/or software. The machine-readable medium or article may include, for example, any suitable type of memory unit, memory device, memory article, memory medium, storage device, storage article, storage medium and/or storage unit; for example, memory, removable or non-removable media, erasable or non-erasable media, writeable or re-writeable media, digital or analog media, hard disk drive, floppy disk, Compact Disk Read Only Memory (CD-ROM), Compact Disk Recordable (CD-R), Compact Disk Re-Writeable (CD-RW), optical disk, magnetic media, various types of Digital Versatile Disks (DVDs), a tape, a cassette, or the like. The instructions may include any suitable type of code, for example, source code, compiled code, interpreted code, executable code, static code, dynamic code, or the like, and may be implemented using any suitable high-level, low-level, object-oriented, visual, compiled and/or interpreted programming language, e.g., C, C++, Java™, BASIC, Pascal, Fortran, Cobol, assembly language, machine code, or the like.

    [0247] Many of the functional units described in this specification have been labeled as circuits, in order to more particularly emphasize their implementation independence. For example, a circuit may be implemented as a hardware circuit comprising custom very-large-scale integration (VLSI) circuits or gate arrays, off-the-shelf semiconductors such as logic chips, transistors, or other discrete components. A circuit may also be implemented in programmable hardware devices such as field programmable gate arrays, programmable array logic, programmable logic devices or the like.

    [0248] In some embodiment, the circuits may also be implemented in machine-readable medium for execution by various types of processors. An identified circuit of executable code may, for instance, comprise one or more physical or logical blocks of computer instructions, which may, for instance, be organized as an object, procedure, or function. Nevertheless, the executables of an identified circuit need not be physically located together, but may comprise disparate instructions stored in different locations which, when joined logically together, comprise the circuit and achieve the stated purpose for the circuit. Indeed, a circuit of computer readable program code may be a single instruction, or many instructions, and may even be distributed over several different code segments, among different programs, and across several memory devices. Similarly, operational data may be identified and illustrated herein within circuits, and may be embodied in any suitable form and organized within any suitable type of data structure. The operational data may be collected as a single data set, or may be distributed over different locations including over different storage devices, and may exist, at least partially, merely as electronic signals on a system or network.

    [0249] The computer readable medium (also referred to herein as machine-readable media or machine-readable content) may be a tangible computer readable storage medium storing the computer readable program code. The computer readable storage medium may be, for example, but not limited to, an electronic, magnetic, optical, electromagnetic, infrared, holographic, micromechanical, or semiconductor system, apparatus, or device, or any suitable combination of the foregoing. As alluded to above, examples of the computer readable storage medium may include but are not limited to a portable computer diskette, a hard disk, a random access memory (RAM), a read-only memory (ROM), an erasable programmable read-only memory (EPROM or Flash memory), a portable compact disc read-only memory (CD-ROM), a digital versatile disc (DVD), an optical storage device, a magnetic storage device, a holographic storage medium, a micromechanical storage device, or any suitable combination of the foregoing. In the context of this document, a computer readable storage medium may be any tangible medium that can contain, and/or store computer readable program code for use by and/or in connection with an instruction execution system, apparatus, or device.

    [0250] The computer readable medium may also be a computer readable signal medium. A computer readable signal medium may include a propagated data signal with computer readable program code embodied therein, for example, in baseband or as part of a carrier wave. Such a propagated signal may take any of a variety of forms, including, but not limited to, electrical, electro-magnetic, magnetic, optical, or any suitable combination thereof. A computer readable signal medium may be any computer readable medium that is not a computer readable storage medium and that can communicate, propagate, or transport computer readable program code for use by or in connection with an instruction execution system, apparatus, or device. As also alluded to above, computer readable program code embodied on a computer readable signal medium may be transmitted using any appropriate medium, including but not limited to wireless, wireline, optical fiber cable, Radio Frequency (RF), or the like, or any suitable combination of the foregoing. In one embodiment, the computer readable medium may comprise a combination of one or more computer readable storage mediums and one or more computer readable signal mediums. For example, computer readable program code may be both propagated as an electro-magnetic signal through a fiber optic cable for execution by a processor and stored on RAM storage device for execution by the processor.

    [0251] Computer readable program code for carrying out operations for aspects of the present disclosure may be written in any combination of one or more programming languages, including an object oriented programming language such as Java, Smalltalk, C++ or the like and conventional procedural programming languages, such as the “C” programming language or similar programming languages. The computer readable program code may execute entirely on a user's computer, partly on the user's computer, as a stand-alone computer-readable package, partly on the user's computer and partly on a remote computer or entirely on the remote computer or server. In the latter scenario, the remote computer may be connected to the user's computer through any type of network, including a local area network (LAN) or a wide area network (WAN), or the connection may be made to an external computer (for example, through the Internet using an Internet Service Provider).

    [0252] The program code may also be stored in a computer readable medium that can direct a computer, other programmable data processing apparatus, or other devices to function in a particular manner, such that the instructions stored in the computer readable medium produce an article of manufacture including instructions which implement the function/act specified in the schematic flowchart diagrams and/or schematic block diagrams block or blocks.

    [0253] Functions, operations, components and/or features described herein with reference to one or more embodiments, may be combined with, or may be utilized in combination with, one or more other functions, operations, components and/or features described herein with reference to one or more other embodiments, or vice versa.

    [0254] Although the disclosure has been described with reference to exemplary embodiments, it is not limited thereto. Those skilled in the art will appreciate that numerous changes and modifications may be made to the preferred embodiments of the disclosure and that such changes and modifications may be made without departing from the true spirit of the disclosure. It is therefore intended that the appended claims be construed to cover all such equivalent variations as fall within the true spirit and scope of the disclosure.

    [0255] All referenced journal articles, patents, and other publications are incorporated by reference herein in their entireties.

    Cryo-EM

    [0256] Cryogenic electron microscopy, also known as electron cryomicroscopy (cryo-EM), is an electron microscopy (EM) technique applied on samples cooled to cryogenic temperatures and embedded in an environment of vitreous water. Cryo-EM is an emerging, computer vision-based approach to determine 3-dimensional (3D) macromolecular structure with subnanometre resolution. Cryo-EM is applicable to medium to large-sized molecules in their native state. This scope of applicability is in contrast to X-ray crystallography, which requires a crystal of the target molecule, which are often impossible to grow, or nuclear magnetic resonance (NMR) spectroscopy, which is limited to relatively small molecules. Cryo-EM has the potential to unveil the molecular and chemical nature of fundamental biology through the discovery of atomic structures of previously unknown biological structures, many of which have proven difficult or impossible to study by conventional structural biology techniques.

    [0257] In cryo-EM, molecules are embedded in a frozen-hydrated state, suspended across holes in a thin carbon film (R. Henderson, Q. Rev. Biophys. 37, 3 (2004); and W. Chiu et al, Structure 13, 363 (2005)), and then imaged with a transmission electron microscope in the presence of coherent, high-energy electrons (10-50 eVA2). A large number of such samples are obtained, each of which provides a micrograph containing hundreds of visible, individual molecules. In a process known as particle picking, individual molecules are imaged, resulting in a stack of cropped images of the molecule (referred to as particle images). Each particle image provides a noisy view of the molecule with an unknown pose. Once a large set of 2-dimensional (2D) electron microscope particle images of the molecule have been obtained, reconstruction is carried out to estimate the 3D density of a target molecule from the images. The ability of cryo-EM to resolve the structures of complex proteins depends on the techniques underlying the reconstruction process.

    [0258] Generally, images obtained by cryo-EM can be analyzed to identify micrographs of single particles. Single particle selection can be done with the help of software tools such as SIGNATURE (Chen & Grigorieff (2007) J Struct Biol 157(1):168-73). The astigmatic defocus, specimen tilt axis, and tilt angle for each micrograph can be determined using the computer program CTFTILT (Mindell & Grigorieff (2003) J Struct Biol 142(3):334-47). Obtaining separate defocus values for each particle according to its coordinate in the original image improves the data quality of the cryo-EM density map which is obtained by averaging single-particle micrographs of particles.

    [0259] Fitting of known atomic models within a cryo-EM density map is a common approach for building models of complex structures. A number of computational fitting tools are available which range from simple rigid-body localization of protein structures, such as Situs (Wriggers et al. (1999) J Struct Biol 125(2-3):185-95), Foldhunter (Jiang et al. (2001) J Mol Biol 308(5):1033-44) and Mod-EM (Topf et al. (2005) J Struct Biol 149(2):191-203), to complex and dynamic flexible fitting algorithms like NMFF (Tama et al. (2004) J Struct Biol 147(3):315-2), Flex-EM (Topf et al. (2008) Structure 16(2):295-307), MDFF (Trabuco et al. (2009) Methods 49(2):174-80) and DireX (Schroder et al. (2007) Structure 15(12):1630-41; Zhang et al. (2010) Nature 463(7279):379-83), which morph known structures to a density map.

    [0260] When an atomic model is not known, cryo-EM density maps can be used in building and/or evaluating structural models from a gallery of potential models that are constructed in silico (see Topf et al. (2005) J Struct Biol 149(2):191-203; Baker et al. (2006) PLoS Comput Biol 2(10):e146; DiMaio et al. (2009) J Mol Biol 392(1):181-90; Topf et al. (2006) J Mol Biol 357(5):1655-68; Zhu et al. (2010) J Mol Biol 397(3):835-51). A related template structure must be known for constrained comparative modeling or, for constrained ab initio modeling, the fold to be modelled must be relatively small. For example, an initial structure may be obtained using IMIRS (Liang et al. (2002) J Struct Biol 137(3):292-304). Further alignment and reconstruction can be performed with FREALIGN (Grigorieff (2007) J Struct Biol 157(1):117-25) using a known protein structure and a known structure of a heterologous protein or a close homologue as template.

    [0261] Significant structural and functional information can be obtained directly from the density map itself. For example, at from about 5 to about 10 Å resolutions, some secondary structure elements are visible in cryo-EM density maps: α-helices appear as cylinders, while β-sheets appear as thin, curved plates. These secondary structure elements can be reliably identified and quantified using feature recognition tools to describe a protein structure or infer the function of individual proteins. At near-atomic resolutions (3-5 Å), the pitch of α-helices, separation of β-strands, as well as the densities that connect them, can be visualized unambiguously (see e.g., Cheng et al. (2010) J Mol Biol 397(3):852-63; Jiang et al. (2008) Nature 451(7182):1130-4; Ludtke et al. (2008) Structure 16(3):441-8; Yu et al. (2008) Nature 453(7193):415-9). The disclosure relates to a method of creating a cryo-EM image or performing cryo-EM imaging comprising: [0262] (a) calculating a differential interaction score (DIS); (b) applying the DIS score a density map readable by one or more computer program products capable of displaying an image corresponding to the readable density map; (c) displaying an image of a protein on a display in operable communication with a controller or system comprising the computer program product. In some embodiments, the method further comprises (d) correlating the DIS with the likelihood that a dysfunctional protein-protein interaction is the causal agent of the disorder. In some embodiments, the resulting image of the method of performing cryo-EM has a resolution from about 5 to about 20 angstroms, from about 5 to about 15 angstroms, or from about 5 to about 10 angstroms. In some embodiments, the image created by applying the DIS score has a resolution of about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19 or about 20 angstroms.

    [0263] De novo model building in cryo-EM comprises feature recognition, sequence analysis, secondary structure element correspondence, Ca placement and model optimization. Various software applications can be used, e.g., EMAN for density map segmentation and manipulation (Ludtke et al. (1999) J Struct Biol 128(1):82-97), SSEHunter (Baker et al. (2007) Structure 15(1):7-19) to detect secondary structure elements, visualization in UCSF's Chimera (Pettersen et al. (2004) J Comput Chem 25(13):1605-12) and atom manipulation in Coot (Emsley & Cowtan (2004) Acta Crystallogr D Biol Crystallogr 60(Pt 12 Pt 1):2126-32; Emsley et al. (2010) Acta Crystallogr D Biol Crystallogr 66(Pt 4):486-501).

    [0264] Secondary structure identification programs like SSEHunter provide a semi-automated mechanism for detecting and displaying visually observable secondary structure elements in a density map (Baker et al. (2007) Structure 15(1):7-19). Registration of secondary structure elements in the sequence and structure, combined with geometric and biophysical information, can be used to anchor the protein backbone in the density map (Cheng et al. (2010) J Mol Biol 397(3):852-63; Ludtke et al. (2008) Structure 16(3):441-8). This sequence-to-structure correspondence relates the observed secondary structure elements in the density to those predicted in the sequence. The modeling toolkit GORGON couples sequence-based secondary structure prediction with feature detection and geometric modeling techniques to generate initial protein backbone models (Baker et al. (2011) J Struct Biol 174(2):360-73). Automatic modeling methods such as EM-IMO (electron microscopy-iterative modular optimization) can be used for building, modifying and refining local structures of protein models using cryo-EM maps as a constraint (Zhu et al. (2010) J Mol Biol 397(3):835-51).

    [0265] Once a correspondence has been determined using secondary structure element, Ca atoms can be assigned to the density beginning with α-helices and followed by β-strands and loops. For example, by taking advantage of clear bumps for Ca atoms, Ca models can be built using the Baton build utility in the crystallographic programs 0 (Jones et al. (1991) Acta Cystallogr A 47 (Pt 2):110-9) and/or Coot (Emsley & Cowtan (2004) Acta Crystallogr D Biol Crystallogr 60(Pt 12 Pt 1):2126-32). Ca positions can be interactively adjusted such that they fit the density optimally while maintaining reasonable geometries and eliminating clashes within the model. Coarse full-atom models can be refined in a pseudocrystallographic manner using CNS (Brunger et al. (1998) Acta Cystallogr D Biol Crystallogr 54(Pt 5):905-21). Models can be further optimized using computational modeling software such as Rosetta (DiMaio et al. (2009) J Mol Biol 392(1):181-90). Full-atom models can also be built with the help of other computational tools such as REMO (Li & Zhang (2009) Proteins 76(3):665-76). The quality of a model can be confirmed by visual comparison of the model with the density map. Pseudocrystallographic R factor/Rfree analysis (Briinger (1992) Nature 355(6359):472-5) provides a measure of the agreement between observed and computed structure factor amplitudes and may be used to confirm that the obtained atomic model provides a good fit to the cryo-EM density maps. Protein model geometry can be checked by PROCHECK (Laskowski et al. (1993) J Appl Cryst 26:283-91).

    [0266] In cryo-EM, the image intensity is a reflection of the electron phase shift due to electrostatic potentials, including the internal potentials of the atoms in the specimen. In the weak-phase approximation, the Fourier transform I(s) of the image intensity I(x,y) is most readily expressed in terms of the two-dimensional spatial frequency s, as:


    Î(s)=Î.sub.0[δ(s)+2h(s){circumflex over (φ)}(s)]

    [0267] In the equation above, Î.sub.0 is the mean image intensity, δ(s) is the two dimensional Dirac delta function, and h(s) is the contrast transfer function (CTF). T{circumflex over (φ)}(s)nction is the Fourier transform of the specimen's phase shift φ(x, y). The image contrast depends on a number of factors including the ice thickness, as unstained biological specimens are embedded in a thin film (e.g., ˜100 nm) of vitreous ice:

    [00009] C = Δ I I s = ( φ protein - φ water ) .Math. t protein φ water .Math. t ice

    [0268] In the equation above, φ.sub.protein and φ.sub.water are phase shifts of electrons passing through protein and water regions, and t.sub.protein and t.sub.ice are thicknesses of the protein molecules and ice layer, respectively. The calculated image contrast drops dramatically as the ice thickness increases from, e.g., 10 nm to 100 nm. The protein particles may be clearly seen when contained in a thin ice layer, but not in a thick ice layer. Experiments have shown that by extensive efforts to optimize the vitrification process, the contrast of recorded cryo-EM images may increase dramatically.

    [0269] Resolution

    [0270] While cryo-EM could be used as a substitute technique for protein crystallography, the main drawback, however, is the low resolution of the structures obtainable with conventional technology. For example, resolutions of about 7.4 Å (angstroms) have been achieved for virus analysis and resolutions of about 11.5 Å have been achieved for large protein complexes such as ribosome. With recent improvement in this technology, cryo-EM resolutions are now approaching 1.5 ångströms (Å) (Bhella, D., Biophysical Reviews. 2019, 11 (4): 515-519).

    [0271] In some embodiments, the resolution of the structures obtainable with the methods of the disclosure is from about 1.0 Å to about 20.0 Å. In some embodiments, the resolution of the structures obtainable with the methods of the disclosure is from about 2.0 Å to about 18.0 Å. In some embodiments, the resolution of the structures obtainable with the methods of the disclosure is from about 2.5 Å to about 16.0 Å. In some embodiments, the resolution of the structures obtainable with the methods of the disclosure is from about 3.0 Å to about 14.0 Å. In some embodiments, the resolution of the structures obtainable with the methods of the disclosure is from about 3.5 Å to about 12.0 Å. In some embodiments, the resolution of the structures obtainable with the methods of the disclosure is from about 4.0 Å to about 10.0 Å. In some embodiments, the resolution of the structures obtainable with the methods of the disclosure is from about 4.5 Å to about 8.0 Å.

    [0272] In some embodiments, the resolution of the structures obtainable with the methods of the disclosure is about 1.0 Å. In some embodiments, the resolution of the structures obtainable with the methods of the disclosure is about 1.5 Å. In some embodiments, the resolution of the structures obtainable with the methods of the disclosure is about 2.0 Å. In some embodiments, the resolution of the structures obtainable with the methods of the disclosure is about 2.5 Å. In some embodiments, the resolution of the structures obtainable with the methods of the disclosure is about 3.0 Å. In some embodiments, the resolution of the structures obtainable with the methods of the disclosure is about 3.5 Å. In some embodiments, the resolution of the structures obtainable with the methods of the disclosure is about 4.0 Å. In some embodiments, the resolution of the structures obtainable with the methods of the disclosure is about 4.5 Å. In some embodiments, the resolution of the structures obtainable with the methods of the disclosure is about 5.0 Å. In some embodiments, the resolution of the structures obtainable with the methods of the disclosure is about 5.5 Å. In some embodiments, the resolution of the structures obtainable with the methods of the disclosure is about 6.0 Å. In some embodiments, the resolution of the structures obtainable with the methods of the disclosure is about 6.5 Å. In some embodiments, the resolution of the structures obtainable with the methods of the disclosure is about 7.0 Å. In some embodiments, the resolution of the structures obtainable with the methods of the disclosure is about 7.5 Å. In some embodiments, the resolution of the structures obtainable with the methods of the disclosure is about 8.0 Å. In some embodiments, the resolution of the structures obtainable with the methods of the disclosure is about 8.5 Å. In some embodiments, the resolution of the structures obtainable with the methods of the disclosure is about 9.0 Å. In some embodiments, the resolution of the structures obtainable with the methods of the disclosure is about 9.5 Å. In some embodiments, the resolution of the structures obtainable with the methods of the disclosure is about 10.0 Å. In some embodiments, the resolution of the structures obtainable with the methods of the disclosure is about 11.0 Å. In some embodiments, the resolution of the structures obtainable with the methods of the disclosure is about 12.0 Å. In some embodiments, the resolution of the structures obtainable with the methods of the disclosure is about 13.0 Å. In some embodiments, the resolution of the structures obtainable with the methods of the disclosure is about 14.0 Å. In some embodiments, the resolution of the structures obtainable with the methods of the disclosure is about 15.0 Å. In some embodiments, the resolution of the structures obtainable with the methods of the disclosure is about 16.0 Å. In some embodiments, the resolution of the structures obtainable with the methods of the disclosure is about 17.0 Å. In some embodiments, the resolution of the structures obtainable with the methods of the disclosure is about 18.0 Å. In some embodiments, the resolution of the structures obtainable with the methods of the disclosure is about 19.0 Å. In some embodiments, the resolution of the structures obtainable with the methods of the disclosure is about 20.0 Å.

    [0273] Methods

    [0274] The disclosure further relates to methods of predicting three-dimensional (3D) structure of macromolecules, such as proteins, protein complexes, and viral particles, by combining structural-biology techniques and artificial-intelligence (AI) techniques. The traditional structural-biology techniques, such as nuclear magnetic resonance (NMR) spectroscopy, X-ray crystallography, and cryo-electron microscopy (cryo-EM), predict the 3D structure of a macromolecule based on the molecule itself. The AI techniques, based on machine deep learning, predict the 3D structure of a macromolecule based on genomic data.

    [0275] Artificial-Intelligence (AI) Techniques

    [0276] The AI techniques computationally predict the 3D structure of a macromolecule based solely on genomic data. These techniques generally involve use of deep neural networks to predict protein structure based on sequence. Several algorithms have been developed for such prediction.

    [0277] AlphaFold, for example, is such an algorithm developed by DeepMind (London, UK) that focuses specifically on the problem of modeling target shapes from scratch, without using previously solved proteins as templates. AlphaFold can achieve a high degree of accuracy when predicting the physical properties of a protein structure, and then used two distinct methods to construct predictions of full protein structures. Both of these methods rely on deep neural networks that are trained to predict properties of the protein from its genetic sequence. The properties AlphaFold's networks predict are: (a) the distances between pairs of amino acids and (b) the angles between chemical bonds that connect those amino acids.

    [0278] AlphaFold works in two steps. It starts with so-called multiple sequence alignments by comparing a protein's sequence with similar ones in a database to reveal pairs of amino acids that do not lie next to each other in a chain, but that tend to appear in tandem. This suggests that these two amino acids are located near each other in the folded protein. AlphaFold trains a neural network to take such pairings to predict a distribution of distances between every pair of residues in a folded protein. These probabilities are then combined into a score that estimates how accurate a proposed protein structure is. By comparing its predictions with precisely measured distances in proteins, AlphaFold learns to make better guesses about how proteins would fold up. In parallel, AlphaFold also trains another neural network predicting the angles of the joints between consecutive amino acids in the folded protein chain.

    [0279] Using these scoring functions, AlphaFold is able to search the protein landscape to find structures that match the predictions. The first method used in AlphaFold is built on techniques commonly used in structural biology, and repeatedly replaced pieces of a protein structure with new protein fragments. AlphaFold trains a generative neural network to invent new fragments, which were used to continually improve the score of the proposed protein structure.

    [0280] In a second step, AlphaFold creates a physically possible—but nearly random—folding arrangement for a sequence. Instead of using another neural network, AlphaFold uses an optimization method called gradient descent—a mathematical technique commonly used in machine learning for making small, incremental improvements—to optimize scores and iteratively refine the structure so it comes close to the (not-quite-possible) predictions from the first step and results in highly accurate structures. This technique is applied to entire protein chains rather than to pieces that must be folded separately before being assembled into a larger structure, to simplify the prediction process.

    [0281] A representative flowchart illustrating the architecture of the Alphafold system for predicting structure from protein sequence is provided in FIG. 38.

    [0282] Another algorithm for protein 3D structure prediction was developed by Mohammed AlQuraishi, a biologist at Harvard Medical School in Boston, Massachusetts. This algorithm uses a totally different approach. Instead of 2-step approaches as AlphaFold, AlQuraishi's algorithm uses a mathematical function to calculate protein structures in a single step. At the core of AlQuraishi's approach is again a neural network that is fed with known data on how amino-acid sequences map to protein structures and then learns to produce new structures from unfamiliar sequences. Instead of using a neural network to predict certain features of a structure, such as the neural networks predicting the angles and distances between amino acids in the folded protein used in AlphaFold, AlQuraishi's system uses end-to-end differentiable deep learning to create mappings end-to-end and then use an algorithm to laboriously search for a plausible structure that incorporates those features. This approach, which AlQuraishi dubs a recurrent geometric network, predicts the structure of one segment of a protein partly on the basis of what comes before and after it. AlQuraishi's algorithm is published in AlQuraishi, Cell Systems, 2019, 8: 292-301, incorporated by reference herein.

    [0283] AlQuraishi's model featurizes a protein of length L as a sequence of vectors (x.sub.1, . . . , X.sub.L) where x.sub.t∈R.sup.d for all t. The dimensionality d is 41, where 20 dimensions are used as a one-hot indicator of the amino acid residue at a given position, another 20 dimensions are used for the PSSM of that position, and 1 dimension is used to encode the information content of the position. The PSSM values are sigmoid transformed to lie between 0 and 1. The sequence of input vectors are fed to an LS™ (Hochreiter and Schmidhuber, Neural Comput., 1997, 9(8):1735-1780), whose basic formulation is described by the following set of equation.


    i.sub.t=σ(W.sub.i[x.sub.t,h.sub.t-1]+b.sub.i),


    f.sub.t=σ(W.sub.f[x.sub.t,h.sub.t-1]+b.sub.f),


    o.sub.t=σ(W.sub.o[x.sub.t,h.sub.t-1]+b.sub.o),


    {tilde over (c)}.sub.t=tan h(W.sub.c[x.sub.t,h.sub.t-1]+b.sub.c),


    c.sub.t=i.sub.t⊙{tilde over (c)}.sub.t+f.sub.t⊙c.sub.t-1,


    h.sub.t=o.sub.t⊙ tan h(c.sub.t),

    [0284] W.sub.i, W.sub.f, W.sub.o, W.sub.c are weight matrices, b.sub.i, b.sub.f, b.sub.o, b.sub.c are bias vectors, h.sub.t and c.sub.t are the hidden and memory cell state for residue t, respectively, and Θ is element-wise multiplication. It uses two LSTMs, running independently in opposite directions (1 to L and L to 1), to output two hidden states h.sub.t.sup.(f) and h.sub.t.sup.(b) for each residue position t corresponding to the forward and backward directions. Depending on the RGN architecture, these two hidden states are either the final outputs states or they are fed as inputs into one or more LS™ layers.

    [0285] The outputs from the last LSTM layer form a sequence of a concatenated hidden state vectors ([h.sub.I.sup.(f), h.sub.I.sup.(b)], . . . , [h.sub.L.sup.(f), h.sub.L.sup.(b)]). Each concatenated vector is then fed into an angularization layer described by the following set of equations:


    p.sub.t=softmax(W.sub.φ[h.sub.t.sup.(f),h.sub.t.sup.(b)]+b.sub.φ).


    φ.sub.t=arg(p.sub.texo(iΦ)).

    [0286] W.sub.φ is a weight matrix, bφ is a bias vector, Φ is a learned alphabet matrix, and arg is the complex-valued argument function. Exponentiation of the complex-valued matrix iΦ is performed element-wise. The Φ matrix defines an alphabet of size m whose letters correspond to triplets of torsional angles defined over the 3-torus. The angularization layer interprets the LS™ hidden state outputs as weights over the alphabet, using them to compute a weighted average of the letters of the alphabet (independently for each torsional angle) to generate the final set of torsional angles φ.sub.t∈S.sup.I×S.sup.I×S.sup.I for residue t (the standard notation for protein backbone torsional angles are overloaded, with φt corresponding to the (ψ, φ, ω) triplet). Note that φt may be alternatively computed using the following equation, where the trigonometric operations are performed element-wise:


    φ.sub.t=a tan 2(p.sub.t sin(Φ),p.sub.t cos(Φ)).

    [0287] In general, the geometry of a protein backbone can be represented by three torsional angles φ, ψ, and ω that define the angles between successive planes spanned by the N, C.sup.α, and C′ protein backbone atoms (Ramachandran et al., J. Mol. Biol., 1963, 7:95-99). While bond lengths and angles vary as well, their variation is sufficiently limited that they can be assumed fixed. Similar claims hold for side chains as well, although the attention is restricted to backbone structure. The resulting sequence of torsional angles (φ.sub.1, . . . , φ.sub.L) from the angularization layer is fed sequentially, along with the coordinates of the last three atoms of the nascent protein chain (c.sub.1, c.sub.3t), into recurrent geometric units that convert this sequence into 3D Cartesian coordinates, with three coordinates resulting from each residue, corresponding to the N, Cα, and C′ backbone atoms. Multiple mathematically-equivalent formulations exist for this transformation; one is adopted based on the Natural Extension Reference Frame (Parsons et al., J. Comput. Chem., 2005, 26(10):1063-1068.), described by the following set of equations:

    [00010] c ^ k = f kmod 3 [ cos ( θ kmod 3 ) cos ( φ k / 3 kmod 3 ) sin ( θ kmod 3 ) sin ( φ k / 3 kmod 3 ) sin ( θ kmod 3 ) ] , m k = c k - 1 - c k - 2 , n k = m k - 1 × m k ^ , M k = [ m k ^ , n k ^ × m k ^ , n k ^ ] , c k = M k c k ^ + c k - 1 .

    [0288] Where r.sub.k is the length of the bond connecting atoms k−1 and K, θ.sub.k is the bond angle formed by atoms k−2, k−1, and k, φ.sub.k/3,k mod 3 is the predicted torsional angle formed by atoms k−2 and k−1, C.sub.k is the position of the newly predicted atom k, {circumflex over (m)} is the unit-normalized version of m, and x is the cross product. Note that k indexes atoms 1 through 3 L, since there are three backbone atoms per residue. For each residue t, it is computed C.sub.3t-2, C.sub.3t-1, and C.sub.3t using the three predicted torsional angles of residue t, specifically

    [00011] φ t , j = φ .Math. 3 t 3 .Math. , ( 3 t + j ) mod 3

    for j={0,1,2}. The bond lengths and angles are fixed, with three bond length (r.sub.0, r.sub.1, r.sub.2) corresponding to N—C.sup.α, C.sup.α—C′, and C′—N, and three bond angles (θ.sub.0, θ.sub.1, θ.sub.2) corresponding to N—C.sup.α—C′, C.sup.α—C′—N, and C′—N—C.sup.α. As there are only three unique values we have r.sub.k=r.sub.k mod 3 and θ.sub.6k=θ.sub.k mod 3. In practice, a modified version of the above equations which enable much higher computational efficiency is employed (AlQuraishi, J. Comput. Chem., 2019, 40(7):885-892).

    [0289] The resulting sequence (C.sub.1, . . . , C.sub.3L) fully describes the protein backbone chain structure and is the model's final predicted output. For training purposes a loss is necessary to optimize model parameters. The dRMSD metric is used as it is differentiable and captures both local and global aspects of protein structure. It is defined by the following set of equations:

    [00012] d ~ j , k = .Math. c j - c k .Math. 2 . d j , k = d ~ j , k ( exp ) - d ~ j , k ( pred ) . dRMSD = .Math. D .Math. 2 L ( L - 1 ) .

    where {dj,k} are the elements of matrix D, and {tilde over (d)}.sub.j,k.sup.−(exp) and {tilde over (d)}.sub.j,k.sup.(pred) are computed using the coordinates of the experimental and predicted structures, respectively. In effect, the dRMSD computes the l2-norm of the distances over distances, by first computing the pairwise distances between all atoms in both the predicted and experimental structures individually, and then computing the distances between those distances. For most experimental structures, the coordinates of some atoms are missing. They are excluded from the dRMSD by not computing the differences between their distances and the predicted ones.

    [0290] RGN hyperparameters were manually fit, through sequential exploration of hyperparameter space, using repeated evaluations on the ProteinNet11 validation set and three evaluations on ProteinNet11 test set. Once chosen the same hyperparameters were used to train RGNs on ProteinNet7-12 training sets. The validation sets were used to determine early stopping criteria, followed by single evaluations on the ProteinNet7-12 test sets to generate the final reported numbers (excepting ProteinNet11).

    [0291] The final model consisted of two bidirectional LSTM layers, each comprised of 800 units per direction, and in which outputs from the two directions are first concatenated before being fed to the second layer. Input dropout set at 0.5 was used for both layers, and the alphabet size was set to 60 for the angularization layer. Inputs were duplicated and concatenated; this had a separate effect from decreasing dropout probability. LSTMs were random initialized with a uniform distribution with support [−0.001, 0.01], while the alphabet was similarly initialized with support [−π, π]. ADAM was used as the optimizer, with a learning rate of 0.001, β1=0.95 and β2=0.99, and a batch size of 32. Gradients were clipped using norm rescaling with a threshold of 5.0. The loss function used for optimization was length-normalized dRMSD (i.e. dRMSD divided by protein length), which is distinct from the standard dRMSD used for reporting accuracies.

    [0292] RGNs are very seed sensitive. As a result, a milestone scheme is used to restart underperforming models early. If a dRMSD loss milestone is not achieved by a given iteration, training is restarted with a new initialization seed. In general, 8 models were started and, after surviving all milestones, were run for 250 k iterations, at which point the lower performing half were discarded, and similarly at 500 k iterations, ending with 2 models that were usually run for ˜2.5M iterations. Once validation error stabilized, the learning rate is reduced by a factor of 10 to 0.0001, and run for a few thousand additional iterations to gain a small but detectable increase in accuracy before ending model training.

    [0293] Determination of 3-Dimensional Structure of a Protein of Interest

    [0294] Referring to FIG. 37, which shows a representative flowchart illustrating the use of structural-biology techniques in combination with artificial intelligence (AI) prediction to construct a 3-dimensional (3D) structure of a protein. Based on this flowchart, the methods of the disclosure comprises the following steps: (a) obtaining a molecular volume for a protein of interest using a structural-biology technique at a resolution of about 20 Å or better; (b) predicting a 3D structure of the protein of interest based on artificial intelligence (AI) prediction using one or a plurality of deep neural networks to predict the 3D structure based on sequence; (c) breaking the 3D structure predicted in step (b) into overlapping regions; (d) global rigid-body fitting the overlapping regions against the molecular volume obtained in step (a); (e) examining top scoring fits and generating new region boundaries; (f) optionally repeating steps (d) and (e) for one or a plurality of times; (g) combining the regions into a complete protein structure; and (h) refining the complete protein structure obtained in step (g) into the molecular volume of (a).

    [0295] In some embodiments, the structural-biology technique used in the methods of the disclosure comprises cryo-EM. In some embodiments, the structural-biology technique used in the methods of the disclosure comprises cryo-TM. In some embodiments, the structural-biology technique used in the methods of the disclosure comprises small angle x-ray scattering (SAXS).

    [0296] In some embodiments, the resolution of the molecular volume of the protein of interest obtained by the structural-biology technique used in the methods of the disclosure is from about 4 Å to about 10 Å. In some embodiments, the resolution is from about 5 Å to about 11 Å. In some embodiments, the resolution is from about 6 Å to about 12 Å. In some embodiments, the resolution is from about 7 Å to about 13 Å. In some embodiments, the resolution is from about 8 Å to about 14 Å. In some embodiments, the resolution is from about 9 Å to about 15 Å. In some embodiments, the resolution is from about 10 Å to about 16 Å. In some embodiments, the resolution is from about 11 Å to about 17 Å. In some embodiments, the resolution is from about 12 Å to about 18 Å. In some embodiments, the resolution is from about 13 Å to about 19 Å. In some embodiments, the resolution is from about 12 Å to about 20 Å. In some embodiments, the resolution is about 4 Å. In some embodiments, the resolution is about 5 Å. In some embodiments, the resolution is about 6 Å. In some embodiments, the resolution is about 7 Å. In some embodiments, the resolution is about 8 Å. In some embodiments, the resolution is about 9 Å. In some embodiments, the resolution is about 10 Å. In some embodiments, the resolution is about 11 Å. In some embodiments, the resolution is about 12 Å. In some embodiments, the resolution is about 13 Å. In some embodiments, the resolution is about 14 Å. In some embodiments, the resolution is about 15 Å. In some embodiments, the resolution is about 16 Å. In some embodiments, the resolution is about 17 Å. In some embodiments, the resolution is about 18 Å. In some embodiments, the resolution is about 19 Å. In some embodiments, the resolution is about 20 Å.

    [0297] In some embodiments, the AI technique used in the methods of disclosure predicts the protein structure based on the distances between pairs of amino acids. In some embodiments, the AI technique used in the methods of disclosure predicts the protein structure based on the angles between chemical bonds that connect those amino acids. In some embodiments, the AI technique used in the methods of disclosure predicts the protein structure based on both the protein structure based on the distances between pairs of amino acids and the angles between chemical bonds that connect those amino acids. In some embodiments, the AI technique used in the methods of disclosure predicts protein structure based on end-to-end differentiable deep learning to create mappings end-to-end and use an algorithm to laboriously search for a plausible structure that incorporates those features. In some embodiments, the AI technique used in the methods of disclosure predicts protein structure based on the algorithm disclosed herein as initially published in in AlQuraishi, Cell Systems, 2019, 8: 292-301, incorporated by reference herein.

    [0298] In some embodiments, the deep neural network used in the methods of the disclosure is a neural network trained for predicting a distance between every pair of amino acid residues in a folded protein. In some embodiments, the deep neural network is a neural network trained for predicting an angle of the joints between consecutive amino acids in a folded protein. In some embodiments, the deep neural network is an end-to-end differentiable deep learning network.

    [0299] Referring to FIG. 38, which shows a representative flowchart illustrating the architecture of one of the AI techniques suitable for practicing the methods of the disclosure, the Alphafold system, for predicting structure from protein sequence. As a first step, multiple sequences are aligned and the alignments are used together with available databases to train neural networks. In this illustration, the neural network training are focused on two aspects: predicting a distance between every pair of amino acid residues in a folded protein (distance prediction) and predicting an angle of the joints between consecutive amino acids in a folded protein (angle prediction). These two sets of predictions are then used to calculate a score using gradient descent, which is then used to predict the protein 3-D structure.

    [0300] To demonstrate the methods of the disclosure for determining the global protein structure, the Nsp2 protein of SARS CoV2 was used as the protein of interest. The Nsp2 protein of SARS CoV2 has no known function and experiment in SARS CoV1 showed that Nsp2 is not essential but its selection causes a replication defect. A number of high confidence host interactions for Nsp2 were identified using the MS technique. A 3.2 Å SARS CoV2 cryoEM structure was then constructed completely de novo. The experimental model thus built finds no homologous structures in the protein database. It was noted that a 10-amino acid loop and the C-terminus of 120 amino acids in length were missing from this built experimental model (FIG. 39B). The presence of this missing C-terminus was confirmed in a 3.8 Å reconstruction under different conditions (data not shown). However, as it was predicted to be all beta sheets, a de novo structure cannot be built experimentally.

    [0301] The structure of Nsp2 of SARS CoV2 was also predicted using the AI technique, particularly the AlphaFold program. As shown in FIG. 39A however, the AI prediction by itself fails to recapitulate the correct global protein structure. It appears that the AI technique, such as the AlphaFold program, can have high accuracy in local prediction but lack accuracy in global prediction. In contrast, the protein structure determined by the structural-biology techniques, such as cryoEM, has high accuracy in global prediction, but sometimes lacks accuracy in local prediction as shown in FIG. 39B. By combining the two methodologies as in the methods of the disclosure, a high resolution structure for complete protein can be constructed as shown in FIG. 39C.

    [0302] In some embodiments, the AI predicted protein structure is divided into overlapping regions of from about 100 to about 300 amino acids in length. In some embodiments, the AI predicted protein structure is divided into overlapping regions of from about 110 to about 280 amino acids in length. In some embodiments, the AI predicted protein structure is divided into overlapping regions of from about 120 to about 260 amino acids in length. In some embodiments, the AI predicted protein structure is divided into overlapping regions of from about 130 to about 240 amino acids in length. In some embodiments, the AI predicted protein structure is divided into overlapping regions of from about 140 to about 220 amino acids in length. In some embodiments, the AI predicted protein structure is divided into overlapping regions of from about 150 to about 200 amino acids in length. In some embodiments, the AI predicted protein structure is divided into overlapping regions of from about 160 to about 180 amino acids in length. In some embodiments, the AI predicted protein structure is divided into overlapping regions of about 100 amino acids in length. In some embodiments, the AI predicted protein structure is divided into overlapping regions of about 110 amino acids in length. In some embodiments, the AI predicted protein structure is divided into overlapping regions of about 120 amino acids in length. In some embodiments, the AI predicted protein structure is divided into overlapping regions of about 130 amino acids in length. In some embodiments, the AI predicted protein structure is divided into overlapping regions of about 140 amino acids in length. In some embodiments, the AI predicted protein structure is divided into overlapping regions of about 150 amino acids in length. In some embodiments, the AI predicted protein structure is divided into overlapping regions of about 160 amino acids in length. In some embodiments, the AI predicted protein structure is divided into overlapping regions of about 170 amino acids in length. In some embodiments, the AI predicted protein structure is divided into overlapping regions of about 180 amino acids in length. In some embodiments, the AI predicted protein structure is divided into overlapping regions of about 190 amino acids in length. In some embodiments, the AI predicted protein structure is divided into overlapping regions of about 200 amino acids in length. In some embodiments, the AI predicted protein structure is divided into overlapping regions of about 210 amino acids in length. In some embodiments, the AI predicted protein structure is divided into overlapping regions of about 220 amino acids in length. In some embodiments, the AI predicted protein structure is divided into overlapping regions of about 230 amino acids in length. In some embodiments, the AI predicted protein structure is divided into overlapping regions of about 240 amino acids in length. In some embodiments, the AI predicted protein structure is divided into overlapping regions of about 250 amino acids in length. In some embodiments, the AI predicted protein structure is divided into overlapping regions of about 260 amino acids in length. In some embodiments, the AI predicted protein structure is divided into overlapping regions of about 270 amino acids in length. In some embodiments, the AI predicted protein structure is divided into overlapping regions of about 280 amino acids in length. In some embodiments, the AI predicted protein structure is divided into overlapping regions of about 290 amino acids in length. In some embodiments, the AI predicted protein structure is divided into overlapping regions of about 300 amino acids in length.

    [0303] Depending on the length of the regions the AI predicted protein structure is divided into, the length of the overlapping regions may vary. In some embodiments, the regions of the AI predicted protein structure overlap one another by about 10% of the length of the regions. In some embodiments, the regions of the AI predicted protein structure overlap one another by about 15% of the length of the regions. In some embodiments, the regions of the AI predicted protein structure overlap one another by about 20% of the length of the regions. In some embodiments, the regions of the AI predicted protein structure overlap one another by about 25% of the length of the regions. In some embodiments, the regions of the AI predicted protein structure overlap one another by about 30% of the length of the regions. In some embodiments, the regions of the AI predicted protein structure overlap one another by about 35% of the length of the regions. In some embodiments, the regions of the AI predicted protein structure overlap one another by about 40% of the length of the regions. In some embodiments, the regions of the AI predicted protein structure overlap one another by about 45% of the length of the regions. In some embodiments, the regions of the AI predicted protein structure overlap one another by about 50% of the length of the regions.

    [0304] In some embodiments, the regions of the AI predicted protein structure overlap one another by about 10 amino acid residues. In some embodiments, the regions of the AI predicted protein structure overlap one another by about 15 amino acid residues. In some embodiments, the regions of the AI predicted protein structure overlap one another by about amino acid residues. In some embodiments, the regions of the AI predicted protein structure overlap one another by about 25 amino acid residues. In some embodiments, the regions of the AI predicted protein structure overlap one another by about 30 amino acid residues. In some embodiments, the regions of the AI predicted protein structure overlap one another by about 35 amino acid residues. In some embodiments, the regions of the AI predicted protein structure overlap one another by about 40 amino acid residues. In some embodiments, the regions of the AI predicted protein structure overlap one another by about amino acid residues. In some embodiments, the regions of the AI predicted protein structure overlap one another by about 50 amino acid residues. In some embodiments, the regions of the AI predicted protein structure overlap one another by about 55 amino acid residues. In some embodiments, the regions of the AI predicted protein structure overlap one another by about 60 amino acid residues. In some embodiments, the regions of the AI predicted protein structure overlap one another by about 65 amino acid residues. In some embodiments, the regions of the AI predicted protein structure overlap one another by about amino acid residues. In some embodiments, the regions of the AI predicted protein structure overlap one another by about 75 amino acid residues. In some embodiments, the regions of the AI predicted protein structure overlap one another by about 80 amino acid residues. In some embodiments, the regions of the AI predicted protein structure overlap one another by about 90 amino acid residues. In some embodiments, the regions of the AI predicted protein structure overlap one another by about 100 amino acid residues.

    [0305] In some embodiments, the AI predicted protein structure is divided into regions of about 100 amino acid residues and overlap one another by about 25 amino acid residues. In some embodiments, the AI predicted protein structure is divided into regions of about 110 amino acid residues and overlap one another by about 30 amino acid residues. In some embodiments, the AI predicted protein structure is divided into regions of about 120 amino acid residues and overlap one another by about 35 amino acid residues. In some embodiments, the AI predicted protein structure is divided into regions of about 130 amino acid residues and overlap one another by about 40 amino acid residues. In some embodiments, the AI predicted protein structure is divided into regions of about 140 amino acid residues and overlap one another by about 45 amino acid residues. In some embodiments, the AI predicted protein structure is divided into regions of about 150 amino acid residues and overlap one another by about 50 amino acid residues. In some embodiments, the AI predicted protein structure is divided into regions of about 160 amino acid residues and overlap one another by about 55 amino acid residues. In some embodiments, the AI predicted protein structure is divided into regions of about 170 amino acid residues and overlap one another by about 60 amino acid residues. In some embodiments, the AI predicted protein structure is divided into regions of about 180 amino acid residues and overlap one another by about 65 amino acid residues. In some embodiments, the AI predicted protein structure is divided into regions of about 190 amino acid residues and overlap one another by about 70 amino acid residues. In some embodiments, the AI predicted protein structure is divided into regions of about 200 amino acid residues and overlap one another by about 75 amino acid residues.

    [0306] The overlapping regions of the AI predicted protein structure are then globally aligned with the molecular volume of the protein of interest obtained from the structural-biology technique using one or a plurality of global rigid-body fitting packages to obtain a global rigid-body transformation. Publically available global rigid-body fitting packages includes, but not limited to, Situs (available at situs.biomachina.org) and Chimera (available at www.cgl.ucsf.edu/chimera). In some embodiments, the global rigid-body fitting is performed using the Situs package. In some embodiments, the global rigid-body fitting is performed using the Chimera package.

    [0307] The overlapping regions of the AI predicted protein structure with top scoring fits are selected and further examined to generate new region boundaries. If necessary, another run of global rigid-body fitting can be performed using the selected top-scoring regions. The finally selected top-scoring regions are combined into a complete protein structure, which is then refined into the molecular volume of the protein of interest obtained from the structural-biology technique. This refinement of the protein structure can be performed using publically available algorithms, such as Rosetta Relax (see rosettacommons.org).

    EXEMPLIFICATION

    [0308] Representative examples of the disclosed methods and systems are illustrated in the following non-limiting methods and examples.

    Materials and Methods

    [0309] Cells

    [0310] HEK293T/17 (HEK293T) cells were procured from the UCSF Cell Culture Facility, and are available through UCSF's Cell and Genome Engineering Core (https://cgec.ucsf.edu/cell-culture-and-banking-services). HEK293T cells were cultured in Dulbecco's Modified Eagle's Medium (DMEM) (Corning) supplemented with 10% Fetal Bovine Serum (FBS) (Gibco, Life Technologies) and 1% Penicillin-Streptomycin (Corning) and maintained at 37° C. in a humidified atmosphere of 5% CO.sub.2. STR analysis by the Berkeley Cell Culture Facility on Aug. 8, 2017 authenticates these as HEK293T cells with 94% probability.

    [0311] HeLaM cells (RRID: CVCL_R965) were originally obtained from the laboratory of M. S. Robinson (CIMR, University of Cambridge, UK) and routinely tested for mycoplasma contamination. HeLaM cells were grown in DMEM supplemented with 10% FBS, 100 U/ml penicillin, 100 μg/ml streptomycin and 2 mM glutamine at 37° C. in a 5% CO.sub.2 humidified incubator.

    [0312] A549 cells stably expressing ACE2 (A549-ACE2) were a kind gift from Dr. Olivier Schwartz. A549-ACE2 cells were cultured in DMEM supplemented with 10% FBS, blasticidin (20 μg/ml, Sigma) and maintained at 37° C. with 5% CO.sub.2. STR analysis by the Berkeley Cell Culture Facility on Jul. 17, 2020 authenticates these as A549 cells with 100% probability.

    [0313] Caco-2 cells were cultured in DMEM with GlutaMAX and pyruvate (Gibco, 10569010) and supplemented with 20% FBS (Gibco, 26140079). For Caco-2 cells utilized in Cas9-RNP knockouts, STR analysis by the Berkeley Cell Culture Facility on Apr. 23, 2020 authenticates these as Caco-2 cells with 100% probability.

    [0314] Vero E6 cells were purchased from ATCC and thus authenticated (VERO C1008 [Vero 76, clone E6, Vero E6] (ATCC, CRL-1586). Vero E6 cells tested negative for mycoplasma contamination. Vero E6 cells were cultured in DMEM (Corning) supplemented with 10% Fetal Bovine Serum (FBS) (Gibco, Life Technologies) and 1% Penicillin-Streptomycin (Corning) and maintained at 37° C. in a humidified atmosphere of 5% CO.sub.2.

    [0315] Coronavirus Annotation and Plasmid Cloning

    [0316] SARS-CoV-1 isolate Tor2 (NC_004718) and MERS-CoV (NC_019843) were downloaded from Genbank and utilized to design 2×-Strep tagged expression constructs of open reading frames (Orfs) and proteolytically mature nonstructural proteins (Nsps) derived from Orf1ab (with N-terminal methionines and stop codons added as necessary). Protein termini were analyzed for predicted acylation motifs, signal peptides, and transmembrane regions, and either the N- or C-terminus was chosen for tagging as appropriate. Finally, reading frames were codon optimized and cloned into pLVX-EF1alpha-IRES-Puro (Takara/Clontech) including a 5′ Kozak motif.

    [0317] Immunofluorescence Microscopy of Viral Protein Constructs

    [0318] Approximately 60,000 HeLaM cells were seeded onto glass coverslips in a 12-well dish and grown overnight. The cells were transfected using 0.5 μg of plasmid DNA and either polyethylenimine (Polysciences) or Fugene HD (Promega; 1 part DNA to 3 parts transfection reagent) and grown for a further 16 hours.

    [0319] Transfected cells were fixed with 4% paraformaldehyde (Polysciences) in PBS at room temperature for 15 minutes. The fixative was removed and quenched using 0.1 M glycine in PBS. The cells were permeabilized using 0.1% saponin in PBS containing 10% FBS. The cells were stained with the indicated primary and secondary antibodies for 1 hour at room temperature. The coverslips were mounted onto microscope slides using ProLong Gold antifade reagent (ThermoFisher) and imaged using a UplanApo 60×oil (NA 1.4) immersion objective on a Olympus BX61 motorized wide-field epifluorescence microscope. Images were captured using a Hamamatsu Orca monochrome camera and processed using ImageJ.

    [0320] To gain insight into the intracellular distribution of each Strep-tagged construct, approximately 100 cells per transfection were manually scored. Each construct was assigned an intracellular distribution in relation to the plasma membrane, endoplasmic reticulum, Golgi, cytoplasm and mitochondria (scored out of 7). In several instances the viral proteins were observed on membranes which did not fit any of the basic categories so were defined as being localized on undefined membranes. Many of the constructs had several localizations so this was also reflected in the scoring. The scoring also took into account the impact of expression level on the localization of the constructs.

    [0321] Meta Analysis of Immunofluorescence Data

    [0322] The data concerning viral protein location was first sorted for all Strep-tagged viral proteins expressed individually in three heatmaps (one per virus) using a custom R script (“pheatmap” package). The information concerning protein localization during SARS-CoV-2 infection was added as a square border color code in the first heatmap, to compare the two different localization patterns. In order to compare the predicted versus the experimentally determined locations, the top scoring sequence-based localization prediction for each protein was taken from DeepLoc (J. J. Almagro Armenteros, et al. DeepLoc: prediction of protein subcellular localization using deep learning. Bioinformatics. 33, 3387-3395 (2017)) if the score was bigger than 1. When more than one localization can be assigned to the same protein, as many top scoring ones were taken as the number of experimentally assigned localizations available for the same protein. Finally, for each cell compartment, the number of experimentally assigned viral proteins was counted, and the subset of them predicted to that same compartment as “correct predictions.” To compare changes in protein interactions with changes in protein localization (Strep-tagged experiment versus sequence-based prediction), the Jaccard index of prey overlap was calculated for each viral protein (SARS-CoV-2 vs. SARS-CoV-1 and SARS-CoV-2 vs. MERS-CoV) and plotted together, for proteins with the same localization and for proteins with different localization.

    [0323] Generation of Polyclonal Sheep Antibodies Targeting SARS-CoV-2 Proteins

    [0324] Sheep were immunized with individual N-terminal GST-tagged SARS-CoV-2 recombinant proteins or N-terminal MBP-tagged proteins (for SARS-CoV-2 S, S-RBD, and Orf7a), followed by up to 5 booster injections four weeks apart from each other. Sheep were subsequently bled and IgGs were affinity purified using the specific recombinant N-terminal maltose binding protein (MBP)-tagged viral proteins. Each antiserum specifically recognized the appropriate native viral protein. Characterisation of each antiserum by western blotting, immunoprecipitation and immunofluorescence of virus-infected and mock-infected cells were described elsewhere. All antibodies generated can be requested at https://mrcppu-covid.bio/. Also see Table 1.

    TABLE-US-00001 TABLE 1 Antigen Working Catalogue Reagent Species Dilution Supplier Number Sheep anti- SARS-COV-2 1/200 MRC PPU Reagents DA103 Nsp1 and Services Sheep anti- SARS-COV-2 1/200 MRC PPU Reagents DA105 Nsp2 and Services Sheep anti- SARS-COV-2 1/200 MRC PPU Reagents DA118 Nsp5 and Services Sheep anti- SARS-COV-2 1/200 MRC PPU Reagents DA093 Nsp7 and Services Sheep anti- SARS-COV-2 1/200 MRC PPU Reagents DA110 Nsp8 and Services Sheep anti- SARS-COV-2 1/200 MRC PPU Reagents DA094 Nsp9 and Services Sheep anti- SARS-COV-2 1/200 MRC PPU Reagents DA091 Nsp10 and Services Sheep anti- SARS-COV-2 1/200 MRC PPU Reagents DA111 Nsp13 and Services Sheep anti- SARS-COV-2 1/200 MRC PPU Reagents DA112 Nsp14 and Services Sheep anti-M SARS-COV-2 1/200 MRC PPU Reagents DA107 Protein and Services Sheep anti- SARS-COV-2 1/200 MRC PPU Reagents DA102 Orf3a and Services Sheep anti- SARS-COV-2 1/200 MRC PPU Reagents DA087 Orf6 and Services Sheep anti- SARS-COV-2 1/200 MRC PPU Reagents DA092 Orf7b and Services Sheep anti- SARS-COV-2 1/200 MRC PPU Reagents DA088 Orf8 and Services Sheep anti- SARS-COV-2 1/200 MRC PPU Reagents DA089 Orf9a (Orf9b and Services in this manuscript) Mouse anti- N/A 1/5000 Qiagen 34850 Strep Mouse anti- N/A 1/1000 IBA Lifesciences 2-1507- StrepMAB 001 Rabbit anti- Human 1/500 Synaptic Systems 110 053 STX5 Rabbit anti- Human Cell Signaling 3177S BiP Rabbit anti- Human Cell Signaling 3501S PDI Mouse anti- Human 1/200 Alexis Biologicals G1/93 ERGIC-53 Rabbit anti- Human 1/1000 Proteintech 11802-1- TOM20 AP Mouse anti- Human 1/500 Santa Cruz sc-390545 TOM70 Mouse anti- Human 1/200 BD 610457 EEA1 Goat anti- Rabbit 1/500 ThermoFisher A32731 Rabbit Alexa Scientific Fluor Plus 488 Goat anti- Mouse 1/1000 ThermoFisher A32742 Mouse Alexa Scientific Fluor Plus 594 Goat anti- Mouse 1/20,000 BioRad 1706516 Mouse HRP AF568-labeled Sheep 1/400 Invitrogen A21099 donkey-anti- sheep AF647-labeled 1/400 Hypermol 8817-01 Phalloidin AF488-labeled Rabbit 1/400 Invitrogen A21441 chicken-anti- rabbit AF488-labeled Mouse 1/400 Invitrogen A21200 chicken-anti- mouse Rabbit anti-NP SARS-COV-2 1/10,000 Garcis-Sastre Lab antisera

    [0325] Immunofluorescence Microscopy of Infected Caco-2 Cells

    [0326] For infection experiments in human colon epithelial Caco-2 cells (ATCC, HTB-37), SARS-CoV-2 isolate Muc-IMB-1, kindly provided by the Bundeswehr Institute of Microbiology, Munich, Germany, was used. SARS-CoV-2 was propagated in Vero E6 cells in DMEM supplemented with 2% FBS. All work involving live SARS-CoV-2 was performed in the BSL3 facility of the Institute of Virology, University Hospital Freiburg, and was approved according to the German Act of Genetic Engineering by the local authority (Regierungspraesidium Tuebingen, permit UNI.FRK.05.16/05).

    [0327] Caco-2 human colon epithelial cells seeded on glass coverslips were infected with SARS-CoV-2 (Strain Muc-IMB-1/2020, second passage on Vero E6 cells (2×10.sup.6 PFU/ml)) at an MOI of 0.1. At 24 hours post-infection, cells were washed with PBS and fixed in 4% paraformaldehyde in PBS for 20 minutes at room temperature, followed by 5 minutes of quenching in 0.1 M glycine in PBS at room temperature. Cells were permeabilized and blocked in 0.1% saponin in PBS supplemented with 10% fetal calf serum for 45 minutes at room temperature and incubated with primary antibodies for 1 hour at room temperature. After washing 15 minutes with blocking solution, AF568-labeled donkey-anti-sheep (Invitrogen, #A21099; 1:400) secondary antibody as well as AF4647-labeled Phalloidin (Hypermol, #8817-01, 1:400) were applied for 1 hour at room temperature. Subsequent washing was followed by embedding in Diamond Antifade Mountant with DAPI. Fluorescence images were generated using a LSM800 confocal laser-scanning microscope (Zeiss) equipped with a 63×, 1.4 NA oil objective and Airyscan detector and the Zen blue software (Zeiss) and processed with Zen blue software and ImageJ/Fiji.

    [0328] Transfection and Cell Harvest for Immunoprecipitation Experiments

    [0329] For each affinity purification (SARS-CoV-1 baits, MERS-CoV baits, GFP-2×Strep, or empty vector controls), ten million HEK293T cells were transfected with up to 15 μg of individual expression constructs using PolyJet transfection reagent (SignaGen Laboratories) at a 1:3 μg:μl ratio of plasmid to transfection reagent based on manufacturer's protocol. After more than 38 hours, cells were dissociated at room temperature using 10 ml PBS without calcium and magnesium (D-PBS) with 10 mM EDTA for at least 5 minutes, pelleted by centrifugation at 200×g, at 4° C. for 5 minutes, washed with 10 ml D-PBS, pelleted once more and frozen on dry ice before storage at −80° C. for later immunoprecipitation analysis. For each bait, three independent biological replicates were prepared.

    [0330] Anti-Strep-Tag Affinity Purification

    [0331] Frozen cell pellets were thawed on ice for 15-20 minutes and suspended in 1 ml Lysis Buffer [IP Buffer (50 mM Tris-HCl, pH 7.4 at 4° C., 150 mM NaCl, 1 mM EDTA) supplemented with 0.5% Nonidet P 40 Substitute (NP-40; Fluka Analytical) and cOmplete mini EDTA-free protease and PhosSTOP phosphatase inhibitor cocktails (Roche)]. Samples were then freeze-fractured by refreezing on dry ice for 10-20 minutes, then rethawed and incubated on a tube rotator for 30 minutes at 4° C. Debris was pelleted by centrifugation at 13,000×g, at 4° C. for 15 minutes. Up to 56 samples were arrayed into a 96-well Deepwell plate for affinity purification on the KingFisher Flex Purification System (Thermo Scientific) as follows: MagStrep “type3” beads (30 μl; IBA Lifesciences) were equilibrated twice with 1 ml Wash Buffer (IP Buffer supplemented with 0.05% NP-40) and incubated with 0.95 ml lysate for 2 hours. Beads were washed three times with 1 ml Wash Buffer and then once with 1 ml IP Buffer. Beads were released into 75 μl Denaturation-Reduction Buffer (2 M urea, 50 mM Tris-HCl pH 8.0, 1 mM DTT) in advance of on-bead digestion. All automated protocol steps were performed at 4° C. using the slow mix speed and the following mix times: 30 seconds for equilibration/wash steps, 2 hours for binding, and 1 minute for final bead release. Three 10 second bead collection times were used between all steps.

    [0332] On-Bead Digestion for Affinity Purification

    [0333] Bead-bound proteins were denatured and reduced at 37° C. for 30 minutes, alkylated in the dark with 3 mM iodoacetamide for 45 minutes at room temperature, and quenched with 3 mM DTT for 10 minutes. To offset evaporation, 22.5 μl 50 mM Tris-HCl, pH 8.0 were added prior to trypsin digestion. Proteins were then incubated at 37° C., initially for 4 hours with 1.5 μl trypsin (0.5 μg/μl; Promega) and then another 1-2 hours with 0.5 μl additional trypsin. All steps were performed with constant shaking at 1,100 rpm on a ThermoMixer C incubator. Resulting peptides were combined with 50 μl 50 mM Tris-HCl, pH 8.0 used to rinse beads and acidified with trifluoroacetic acid (0.5% final, pH<2.0). Acidified peptides were desalted for MS analysis using a BioPureSPE Mini 96-Well Plate (20 mg PROTO 300 C18; The Nest Group, Inc.) according to standard protocols.

    [0334] Mass Spectrometry Operation and Peptide Search

    [0335] Samples were re-suspended in 4% formic acid, 2% acetonitrile solution, and separated by a reversed-phase gradient over a nanoflow C18 column (Dr. Maisch). Each sample was directly injected via a Easy-nLC 1200 (Thermo Fisher Scientific) into a Q-Exactive Plus mass spectrometer (Thermo Fisher Scientific) and analyzed with a 75 minute acquisition, with all MS1 and MS2 spectra collected in the orbitrap; data were acquired using the Thermo software Xcalibur (4.2.47) and Tune (2.11 QF1 Build 3006). For all acquisitions, QCloud was used to control instrument longitudinal performance during the project (C. Chiva, et al., QCloud: A cloud-based quality control system for mass spectrometry-based proteomics laboratories. PLoS One. 13, e0189209 (2018)). All proteomic data was searched against the human proteome (uniprot reviewed sequences downloaded Feb. 28, 2020), EGFP sequence, and the SARS-CoV or MERS protein sequences using the default settings for MaxQuant (version 1.6.12.0) (J. Cox, M. Mann, MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification. Nat. Biotechnol. 26, 1367-1372 (2008)). Detected peptides and proteins were filtered to 1% false discovery rate in MaxQuant. All MS raw data and search results files have been deposited to the ProteomeXchange Consortium via the PRIDE partner repository with the dataset (identifier PXD PXDO21588, Username: reviewer_pxd021588@ebi.ac.uk, password: B5Ho3HES).

    [0336] High-Confidence Protein Interaction Scoring

    [0337] Identified proteins were then subjected to protein-protein interaction scoring with both SAINTexpress (version 3.6.3) and MiST (https://github.com/kroganlab/mist) (Teo, et al. SAINTexpress: improvements and additional features in Significance Analysis of INTeractome software. J. Proteomics. 100, 37-43 (2014); S. Jäger, et al., Global landscape of HIV-human protein complexes. Nature. 481, 365-370 (2011)). A two-step filtering strategy was applied to determine the final list of reported interactors, which relied on two different scoring stringency cut-offs. In the first step, all protein interactions that had a MiST score≥a SAINTexpress Bayesian false-discovery rate (BFDR)≤0.05, and an average spectral count≥2 were chosen. For all proteins that fulfilled these criteria, information about the stable protein complexes that they participated in was extracted from the CORUM (M. Giurgiu, et al., CORUM: the comprehensive resource of mammalian protein complexes-2019. Nucleic Acids Res. 47, D559-D563 (2019)) database of known protein complexes. In the second step, the stringency was relaxed, and additional interactors that (1) formed complexes with interactors determined in filtering step 1 and (2) fulfilled the following criteria: MiST score≥0.6, SAINTexpress BFDR≤0.05, and average spectral counts≥2, were recovered. Proteins that fulfilled filtering criteria in either step 1 or step 2 were considered to be high-confidence protein-protein interactions (HC-PPIs).

    [0338] Using this filtering criteria, nearly all of the baits recovered a number of HC-PPIs in close alignment with previous datasets reporting an average of around 6 PPIs per bait (E. L. Huttlin, et al., The BioPlex Network: A Systematic Exploration of the Human Interactome. Cell. 162, 425-440 (2015)). However, for a subset of baits, a much higher number of PPIs that passed these filtering criteria were observed. For these baits, the MiST scoring was instead performed using a larger in-house database of 87 baits that were prepared and processed in an analogous manner to this SARS-CoV-2 dataset. This was done to provide a more comprehensive collection of baits for comparison, to minimize the classification of non-specifically binding background proteins as HC-PPIs. This was performed for SARS-CoV-1 baits (M, Nsp12, Nsp13, Nsp8, and Orf7b), MERS-CoV baits (Nsp13, Nsp2, and Orf4a), and SARS-CoV-2 Nsp16. SARS-CoV-2 Nsp16 MiST was scored using the in-house database as well as all previous SARS-CoV-2 data (Gordon, et al. A SARS-CoV-2 protein interaction map reveals targets for drug repurposing. Nature (2020)).

    [0339] Hierarchical Clustering of Virus-Human Protein Interactions

    [0340] Hierarchical clustering was performed on interactions for (1) viral bait proteins shared across all three viruses (LIST) and (2) passed the high-confidence scoring criteria (MiST score≥0.6, SAINTexpress BFDR≤0.05, and average spectral counts≥2) in at least one virus. Clustering was performed using a new Interaction Score (K), which was defined as the average between the MiST and Saint score for each virus-human interaction. This was done to provide a single score that captured the benefits from each scoring method. Clustering was performed using the ComplexHeatmap package in R, using the “average” clustering method and “euclidean” distance metric. K-means clustering (k=7) was applied to capture all possible combinations of interaction patterns between viruses.

    [0341] Gene Ontology Enrichment Analysis on Clusters

    [0342] Sets of genes found in 7 clusters were tested for enrichment of Gene Ontology (GO) terms, which was performed using the enricher function of clusterProfiler package in R (G. Yu, et al., clusterProfiler: an R package for comparing biological themes among gene clusters. OMICS. 16, 284-287 (2012)). The GO terms were obtained from the C5 collection of Molecular Signature Database (MSigDBv7.1) and include Biological Process, Cellular Component, and Molecular Function ontologies. Significant GO terms were identified (adjusted p-value<0.05) and further refined to select non-redundant terms. To select non-redundant gene sets, a GO term tree based on distances (1−Jaccard Similarity Coefficients of shared genes) between the significant terms was first constructed. The GO term tree was cut at a specific level (h=0.99) to identify clusters of non-redundant gene sets. For results with multiple significant terms belonging to the same cluster, the term with the lowest adjusted p-value was selected.

    [0343] Sequence Similarity Analysis

    [0344] Protein sequence similarity was assessed by comparing the protein sequences from SARS-CoV-1 and MERS-CoV to SARS-CoV-2 for orthologous viral bait proteins. The corresponding protein-protein interaction similarity was represented by a Jaccard index, using the high-confidence interactomes for each virus.

    [0345] Gene Ontology Enrichment and PPI Similarity Analysis

    [0346] The high-confidence interactors of the three viruses were tested for enrichment of GO terms as described above. Next, GO terms that are significantly enriched (adjusted p-value<0.05) in all 3 viruses were selected. For each enriched term, the list of its associated genes was generated, and the Jaccard Index of pairwise comparisons of 3 viruses computed.

    [0347] Orthologous Versus Non-Orthologous Interactions Analysis

    [0348] For a given pair of viruses, all pairs of baits that share interactors were identified and categorized into “orthologous” and “non-orthologous” groups based on whether the two baits were orthologs or not. Then, the total number of shared interactors in each group was summed up to calculate the corresponding fractions. This was performed for all pairwise combinations of the three viruses.

    [0349] Structural Modeling and Comparison of MERS-CoV Orf4a and SARS-CoV-2 Nsp8

    [0350] To obtain a sensitive sequence comparison between MERS-CoV Orf4a and SARS-CoV-2 Nsp8, their homologs were taken into consideration. First, homologs of these proteins were searched for in the UniRef30 database using hhblits (1 iteration, E-value cutoff 1e-3) (M. Remmert, et al., HHblits: lightning-fast iterative protein sequence searching by HMM-HMM alignment. Nat. Methods. 9, 173-175 (2011)). Subsequently, the resulting alignments were filtered to include only sequences with at least 80% coverage to the corresponding query sequence, and hidden Markov models (HMMs) were created using hhmake. Finally, the HMMs of Orf4a andNsp8 homologs were locally aligned using hhalign. The structure of Orf4a was predicted de novo using trRosetta (J. Yang, et al., Improved protein structure prediction using predicted interresidue orientations. Proc. Natl. Acad. Sci. U.S.A 117, 1496-1503 (2020)). To provide greater coverage than that provided by experimental structures, SARS-CoV-2 Nsp8 was modeled using the structure of its SARS-CoV homolog as template (PDB: 2AHM) (Y. Zhai, et al., Insights into SARS-CoV transcription and replication from the structure of the nsp7-nsp8 hexadecamer. Nat. Struct. Mol. Biol. 12, 980-986 (2005)) using SWISS-MODEL (A. Waterhouse, et al., SWISS-MODEL: homology modelling of protein structures and complexes. Nucleic Acids Res. 46, W296-W303 (2018)). To search for local structural similarities between Orf4a and Nsp8, Geometricus, a structure embedding tool based on 3D rotation invariant moments, was used (J. Durairaj, et al., Geometricus Represents Protein Structures as Shape-mers Derived from Moment Invariants (2020), p. 2020.09.07.285569). This generates so-called shape-mers, analogous to sequence k-mers. The structures were fragmented into overlapping k-mers based on the sequence (k=20) and into overlapping spheres surrounding each residue (radius=15 Å). To ensure that the similarities found between these distinct structures were significant, a high resolution of 7 was used to define the shape-mers. This resulted in the identification of 4 different shape-mers common to Orf4a and Nsp8. The entire Orf4a structure was aligned with residues 96 to 191 of the Nsp8 structure (i.e., after removal of the long N-terminal helix) using the Caretta structural alignment algorithm detailed by (M. Akdel, et al., Caretta—A multiple protein structure alignment and feature extraction suite. Comput. Struct. Biotechnol. J. 18, 981-992 (2020)), using 3D rotation invariant moments (Durairaj et al. 2020) for initial superposition. The parameters were optimized to maximize the Caretta score. The resulting alignment used k=30, radius=16 Å, gap open penalty=0.05, and gap extend penalty=0.005, and had a root-mean-square deviation (RMSD) of 7.6 Å across 66 aligning residues.

    [0351] Differential Interaction Score (DIS) Analysis

    [0352] A differential interaction score (DIS) was calculated for interactions that (1) originated from viral bait proteins shared across all three viruses and (2) passed the high-confidence scoring criteria (MiST score≥0.6, SAINTexpress BFDR≤0.05, and average spectral counts≥2) in at least one virus. The DIS was defined to be the difference between the interaction scores (K) from each virus. DIS near 0 indicates that the interaction is confidently shared between the two viruses being compared, while a DIS near −1 or +1 indicates that the host protein interaction is specific for one virus or the other. A fourth DIS (SARS-MERS) was computed by averaging K from SARS-CoV-1 and SARS-CoV-2 prior to calculating the difference with MERS-CoV. Here, a DIS near +1 indicates SARS-specific interactions (shared between SARS-CoV-1 and SARS-CoV-2 but absent in MERS-CoV), a DIS near −1 indicates MERS-specific interactions (present in MERS-CoV and absent or lowly confident in both SARS-CoVs), and a DIS near 0 indicates interactions shared between all three viruses.

    [0353] For each pairwise virus comparison, as well as the SARS-MERS comparison, DIS was defined based on cluster membership of interactions (FIG. 2A). For the SARS2-SARS1 comparison, interactions from every cluster except 5 were used, as those interactions are considered absent from both SARS-CoV-2 and SARS-CoV-1. For the SARS2-MERS comparison, interactions from all clusters except 3 were used. For the SARS1-MERS comparison, interactions from all clusters except 6 were used. For the SARS-MERS comparison, only interactions from clusters 2, 4, and 5 were used.

    [0354] Referring to FIG. 2A, clustering analysis (k-means) of interactors from SARS-CoV-2, SARS-CoV-1, and MERS-CoV weighted according to the average between their MIST and Saint scores (interaction score K) and percentages of total interactions is shown. Included are only viral protein baits represented amongst all three viruses and interactions that pass the high-confidence scoring threshold for at least one virus. Seven clusters highlight all possible scenarios of shared versus unique interactions.

    [0355] Network Generation and Visualization

    [0356] Protein-protein interaction networks were generated in Cytoscape (P. Shannon, et al., Cytoscape: a software environment for integrated models of biomolecular interaction networks. Genome Res. 13, 2498-2504 (2003)) and subsequently annotated using Adobe Illustrator. Host-host physical interactions, protein complex definitions, and biological process groupings were derived from CORUM (M. Giurgiu, et al., CORUM: the comprehensive resource of mammalian protein complexes-2019. Nucleic Acids Res. 47, D559-D563 (2019)), Gene Ontology (biological process), and manually curated from literature sources. All networks were deposited in NDEx (R. T. Pillich, et al., NDEx: A Community Resource for Sharing and Publishing of Biological Networks. Methods Mol. Biol. 1558, 271-301 (2017)).

    [0357] siRNA Library and Transfection in A549-ACE2 Cells

    [0358] An OnTargetPlus siRNA SMARTpool library (Horizon Discovery) was purchased targeting 331 of the 332 human proteins previously identified to bind SARS-CoV-2 (D. E. Gordon, et al., A SARS-CoV-2 protein interaction map reveals targets for drug repurposing. Nature (2020)) (PDE4DIP was not available for purchase and excluded from the assay). This library was arrayed in 96-well format, with each plate also including two non-targeting siRNAs and one siRNA pool targeting ACE2 (see Table 2 Å provided in U.S. Provisional Application No. 63/091,929 filed on Oct. 15, 2020, expressly incorporated by reference herein). The siRNA library was transfected into A549 cells stably expressing ACE2 (A549-ACE2, kindly provided by Dr. Olivier Schwartz), using Lipofectamine RNAiMAX reagent (Thermo Fisher). Briefly, 6 pmoles of each siRNA pool were mixed with 0.25 μl RNAiMAX transfection reagent and OptiMEM (Thermo Fisher) in a total volume of 20 μl. After a 5 minute incubation period, the transfection mix was added to cells seeded in a 96-well format. 24 hours post-transfection, the cells were subjected to SARS-CoV-2 infection as described in “Viral infection and quantification assay in A549-ACE2 cells,” or incubated for 72 hours to assess cell viability using the CellTiter-Glo luminescent viability assay according to the manufacturer's protocol (Promega). Luminescence was measured in a Tecan Infinity 2000 plate reader, and percentage viability calculated relative to untreated cells (100% viability) and cells lysed with 20% ethanol or 4% formalin (0% viability), included in each experiment.

    [0359] Viral Infection and Quantification Assay in A549-ACE2 Cells

    [0360] Cells seeded in a 96-well format were inoculated with a SARS-CoV-2 stock (BetaCoV/France/IDF0372/2020 strain, generated and propagated once in Vero E6 cells and a kind gift from the National Reference Centre for Respiratory Viruses at Institut Pasteur, Paris, originally supplied through the European Virus Archive goes Global platform) at a MOI of 0.1 PFU per cell. Following a one hour incubation period at 37° C., the virus inoculum was removed, and replaced by DMEM containing 2% FBS (Gibco, Thermo Fisher). 72 hours post-infection the cell culture supernatant was collected, heat inactivated at 95° C. for 5 minutes and used for RT-qPCR analysis to quantify viral genomes present in the supernatant. Briefly, SARS-CoV-2 specific primers targeting the N gene region: 5′-TAATCAGACAAGGAACTGATTA-3′ (Forward) and 5′-CGAAGGTGTGACTTCCATG-3′ (Reverse) (D. K. W. Chu, et al., Molecular Diagnosis of a Novel Coronavirus (2019-nCoV) Causing an Outbreak of Pneumonia. Clin. Chem. 66, 549-555 (2020)) were used with the Luna® Universal One-Step RT-qPCR Kit (New England Biolabs) in an Applied Biosystems QuantStudio 6 thermocycler, with the following cycling conditions: 55° C. for 10 minutes, 95° C. for 1 minute, and 40 cycles of 95° C. for 10 seconds, followed by 60° C. for 1 minute. The number of viral genomes is expressed as PFU equivalents/ml, and was calculated by performing a standard curve with RNA derived from a viral stock with a known viral titer.

    [0361] Knockdown Validation with qRT-PCR in A549-ACE2 Cells

    [0362] Gene-specific quantitative PCR primers targeting all genes represented in the OnTargetPlus library were purchased and arrayed in a 96-well format identical to that of the siRNA library (IDT; see Table 2B provided in U.S. Provisional Application No. 63/091,929 filed on Oct. 15, 2020, expressly incorporated by reference herein). A549-ACE2 cells treated with siRNA were lysed using the Luna® Cell Ready Lysis Module (New England Biolabs) following the manufacturer's protocol. The lysate was used directly for gene quantification by RT-qPCR with the Luna® Universal One-Step RT-qPCR Kit (New England Biolabs), using the gene-specific PCR primers and GAPDH as a housekeeping gene. The following cycling conditions were used in an Applied Biosystems QuantStudio 6 thermocycler: 55° C. for 10 minutes, 95° C. for 1 minute, and 40 cycles of 95° C. for 10 seconds, followed by 60° C. for 1 minute. The fold change in gene expression for each gene was derived using the 2.sup.−ΔΔCT, 2 (Delta Delta CT) method (K. J. Livak, T. D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25, 402-408 (2001)), normalized to the constitutively expressed housekeeping gene GAPDH. Relative changes were generated comparing the control siRNA knockdown transfected cells to the cells transfected with each siRNA.

    [0363] sgRNA Selection for Cas9 Knockout Screen

    [0364] sgRNAs were designed according to Synthego's multi-guide gene knockout (R.

    [0365] Stoner, et al., Methods and systems for guide ma design and use. US Patent (2019), (available at https://patentimages.storage.googleapis.com/95/c7/43/3d48387ce0f116/US20190382797A1.p df)). Briefly, two or three sgRNAs are bioinformatically designed to work in a cooperative manner to generate small, knockout-causing, fragment deletions in early exons (FIG. 3A-F). These fragment deletions are larger than standard indels generated from single guides. The genomic repair patterns from a multi-guide approach are highly predictable based on the guide-spacing and design constraints to limit off-targets, resulting in a higher probability protein knockout phenotype (see Table 3 provided in U.S. Provisional Application No. 63/091,929 filed on Oct. 15, 2020, expressly incorporated by reference herein).

    [0366] Referring to FIG. 3A, Z-score was plotted against viability in A549-ACE2 siRNA knockdowns.

    [0367] Referring to FIG. 3B, Z-score was plotted against siRNA knockdown efficiency in A549-ACE2 cells for 327 of the 332 genes included in the final siRNA dataset. Knockdown efficiency was not obtained for the remaining 5 genes.

    [0368] Referring to FIG. 3C, Z-score was plotted against editing efficiency (ICE-D score) for 227 of the 288 genes included in the final Caco-2 CRISPR dataset. ICE-D scores were not obtained for the remaining 61 genes.

    [0369] Referring to FIG. 3D, representative genotype in Caco-2 SIGMAR1 Knockout is shown. Use of multiguide strategy causes genomic dropout between sgRNAs. Plurality of alleles at SIGMAR1 locus have undergone frameshift mutation.

    [0370] Referring to FIG. 3E, the correlation between quantitative but destructive measurement of cell viability using CellTiter-Glo and non-invasive longitudinal tracking using brightfield imaging is shown. Both measurements are in agreement suggesting both methods can be used to determine gene essentiality (error bars±1 S.D., R2=0.77). These data are from a separate experiment using A549 cells.

    [0371] Referring to FIG. 3F, longitudinal tracking of Caco-2 gene knockout pools using brightfield imaging is shown. Pools were imaged every day for 11 days except for days of passaging (days 2 and 8, vertical dotted line). The majority of pools showed exponential growth. However, several stayed below the limit of detection (red horizontal line) suggesting pools were lost due to the essential nature of the gene.

    [0372] sgRNA Synthesis for Cas9 Knockout Screen

    [0373] RNA oligonucleotides were chemically synthesized on Synthego solid-phase synthesis platform, using CPG solid support containing a universal linker. 5-Benzylthio-1H-tetrazole (BTT, 0.25 M solution in acetonitrile) was used for coupling, (3-((Dimethylamino-methylidene)amino)-3H-1,2,4-dithiazole-3-thione (DDTT, 0.1 M solution in pyridine)) was used for thiolation, dichloroacetic acid (DCA, 3% solution in toluene) was used for detritylation. Modified sgRNA were chemically synthesized to contain 2′-O-methyl analogs and 3′ phosphorothioate nucleotide interlinkages in the terminal three nucleotides at both 5′ and 3′ ends of the RNA molecule. After synthesis, oligonucleotides were subject to a series of deprotection steps, followed by purification by solid phase extraction (SPE). Purified oligonucleotides were analyzed by ESI-MS.

    [0374] Arrayed Knockout Generation with Cas9-RNPs

    [0375] For Caco-2 transfection, 10 pmol Streptococcus Pyogenes NLS-Sp.Cas9-NLS (SpCas9) nuclease (Aldevron; 9212) was combined with 30 pmol total synthetic sgRNA (10 pmol each sgRNA, Synthego) to form ribonucleoproteins (RNPs) in 20 μl total volume with SF Buffer (Lonza VSSC-2002) and allowed to complex at room temperature for 10 minutes.

    [0376] All cells were dissociated into single cells using TrypLE Express (Gibco), resuspended in culture media and counted. 100,000 cells per nucleofection reaction were pelleted by centrifugation at 200×g for 5 minutes. Following centrifugation, cells were resuspended in transfection buffer according to cell type and diluted to 2×10.sup.4 cells/μl. 5 μl of cell solution was added to preformed RNP solution and gently mixed. Nucleofections were performed on a Lonza HT 384-well nucleofector system (Lonza, #AAU-1001) using program CM-150 for Caco-2 Immediately following nucleofection, each reaction was transferred to a tissue-culture treated 96-well plate containing 100 μl normal culture media and seeded at a density of 50,000 cells/well. Transfected cells were incubated following standard protocols.

    [0377] Quantification of Arrayed Knockout Efficiency

    [0378] Two days post-nucleofection, genomic DNA was extracted from cells using DNA QuickExtract (Lucigen, #QE09050). Briefly, cells were lysed by removal of the spent media followed by addition of 40 μl of QuickExtract solution to each well. Once the QuickExtract DNA Extraction Solution was added, the cells were scraped off the plate into the buffer. Following transfer to compatible plates, DNA extract was then incubated at 68° C. for 15 minutes followed by 95° C. for 10 minutes in a thermocycler before being stored for downstream analysis.

    [0379] Amplicons for indel analysis were generated by PCR amplification with NEBNext polymerase (NEB, #M0541) or AmpliTaq Gold 360 polymerase (Thermo Fisher Scientific, #4398881) according to the manufacturer's protocol. The primers were designed to create amplicons between 400-800 bp, with both primers at least 100 bp distance from any of the sgRNA target sites (Table 4). PCR products were cleaned-up and analyzed by Sanger sequencing (Genewiz). Sanger data files and sgRNA target sequences were input into Inference of CRISPR Edits (ICE) analysis (ice.synthego.com) to determine editing efficiency and to quantify generated indels (T. Hsiau, et al., Inference of CRISPR Edits from Sanger Trace Data (2018), p. 251082). Percentage of alleles edited is expressed as an ice-d score. This score is a measure of how discordant the sanger trace is before vs. after the edit. It is a simple and robust estimate of editing efficiency in a pool, especially suited to highly disruptive editing techniques like multi-guide.

    TABLE-US-00002 TABLE 4 CAS9 KNOCKOUT AMPLICON PCR AND SEQUENCING PRIMERS Gene Sequencing Symbol Gene ID Primer F (5′-3′) Primer R (5′-3′) Primer (5′-3′) AAR2  25980 AAGCATCTTTCCCC TGGGGACAGGTCT TTCTGATTA CACGTT ACCTCTT ACTCTGGTTT CTTTCTTTCT C AASS  10157 GCTGGAGTAAGCA TCTCAGGAGACCA GGAGTAAGC TAGGGTGA GAACTGA ATAGGGTGA AAATAATAC TTT AATF  26574 TGTTCAGAGTCTAG TGTCTACTCACCAG GTATCTTAG CTGGGAGT ACGATCCT GAAGATCAG TTGAAGAAA CTC ACAD9  28976 TGCACGTGACTAA GGCAGGTTTGGGG TGCACGTGA GGCCTTG AATCTCA CTAAGGCCT TG ACADM     34 CCACTTCAGTAGTA GGAAGAATGGAGT ATGATTGAA TAAATACCACTG GTGAGTTATTGT GGCATTTAA ATAGTGATG ACT ACSL3   2181 GCCAAGGGTACAC AGGGACCTGTTTTC GGTACACAC ACAGTGA CTAACTGA AGTGAATCT AATGCTATA AAA ADAM9   8754 GAGGGCTCAGTTG GTCCGCACACACCT GCCGCGCGC CGTCAG GGA GTGCTCGTC GGGCGCGCG TGC ADAMTS1   9510 ACAACGTAGACTC GGACAGCCTGACC GTAGACTCC CTAAGAGGA ATAAGCA TAAGAGGAC AGTCTCACA G AES    166 CATGACTCACTCCA CCCTCTTAGAAGCC CATGACTCA GCTGGG GCAAGT CTCCAGCTG GG AGPS   8540 AATGTGAAGCTCC CCTCGACGCTAACT TGGCACCCG AGACGCA CCTTCC CCGCCAAGT CGCCGCGGT GGC AKAP8  10270 AAAAAGAGAAGCG ACTATGAGTTCGAC AAAAAGAGA AAGGCGG CTGGGGT AGCGAAGGC GG AKAP8L  26993 TTCTGGGAGAAGA ACATTGAGCCTCCC TTCTGGGAG GGGAGGG AACCAG AAGAGGGAG GG AKAP9  10142 ACGAAGTAGGTTG CATGCCACTGTGTC ATAATCTTC CCATACCA CCACTA CAGGTGGTG AGTGATGTT TTA ALG11 440138 TCTCAGGGTAGGTA AGCGTATCCCATTG CAGGGTAGG GCAGGC AATCAATGT TAGCAGGCT TTTT ALG5  29880 TCCCTCTCTGCCGA TGAACTAAAACCT AACTACAAC ACTACA GAGAGTGAGT AATTATCAA CTGTGTGCT CAA ALG8  79053 CTGGCTGAATGGCT GGCTTCAGAGGGC GCAGAGGTT GTTGGA TTTCTCC CTTAACTGC CTATTAAG ANO6 196527 TCTTCACTTTTAGT GCTTCTGGTGGCTG CTTTTAGTG GGTGGTCTCT GATTGA GTGGTCTCT GTATTGTTTT T AP2A2    161 ATGCTGAGAACAC CTGTGACAGCCTCT ATGCTGAGA TGCTGCT CCTGG ACACTGCTG CT AP2M1   1173 CCACAGGGAGTCA CTCACCATCCAGCA TTTAGGCAT TAAGAAGGG GCTCAT TGGCTTTCTT TGGAG AP3B1   8546 CACACATTCGCCCC CGCTCCTCCGTACG CACACATTC AAACTC AGAAC GCCCCAAAC TC ARF6    382 AATCAAGTTGTGCG CCAGTGTAGTAATG GATGCCCGA GTCGGT CCGCCA GTGAGCGGG GGGCCTGGG CCT ARL6IP6 151188 CTGCGGCTTCCTTT CGGGAAAGATACC ACCCTTGCT GCAAC ATTGCGC CTCCGTGGT TTA ATE1  11101 GACTGCACGACTA TGCCACAATGGAT GATGGAAAG AGTCATCCT AATAGGAACA ACCCAGGGT TTAAAATGA CTC ATP13A3  79572 CCTCATTTTATCCA TGTGACAAGACAA CAGCGATGT GGCAGCG TAAATACCTATCTG TCCCTTCATC G TATTATTTC ATP1B1    481 TGGGGTTACCTAAT TGGCCAGAGTTCA CTAATCTAA CTAAATGCCA ATCTTTCA ATGCCAGAG GAGTGATTT AAC ATP5L  10632 TTGACAGGCTGGAT CAGGTCAGACGAG CAAAGATCT TCTGCA TGGAAGG TTGGACATT TAAGTATCT TCG BAG5   9529 GTGTGATACCTTGC ACCAACATCCTTCT GAGATTTTT TTTCCGC ATTAGTAGGCT CCTCCAGTTT TAACATGTG TC BCKDK  10295 GGTAGATGGGAGC TTGAGCAGAGAAC CTGAGCCTG TGCTCTC CCCCAAC TCAGCATCC TC BCS1L    617 CCTCCACCCTTGCA AAGTCTCGACACTG CTTGCATTCC TTCCAA AGGTGC AATACCACC CTTAC BZW2  28969 ACAGCAACGTGTG GCCACACTGCTAG CGTGTGTAC TACATCT GCCTATT ATCTATACA TACATGTCA TTC C1orf50  79078 GAGGGGGTCCTTG GCCACCGACTCAC GAGGGGGTC AAAGGC AATGACA CTTGAAAGG CAA CCDC86  79080 TCTCCACCCCTCAC GTGTAGGTCTTGCT CTCCACCCC CAACAT GACGCT TCACCAACA TG CDK5RAP2  55755 TCAGCTGACAGGG GACGCTTAATCTCC TCAGCTGAC GACTCAT TACCTGCA AGGGGACTC ATATTTAGA AG CENPF   1063 TGTTAACTTCTTGG CACCTGTGAAATTA TGTTAACTTC GATTATGGCT CCTCAAGCA TTGGGATTA TGGCTTTAT AT CEP112 201134 ATTTCCCAGGGCAT GAAGTTCTGCCTGC ATATCTAGA GCAGTC CCTACA TGATGGCCC TTATTTCTGT TC CEP135   9662 TGATAACCATGTCT AGCCAGTATGAAC CATTGTTTA TGTTGAGGT AGAAACCTT GTTAAAGAT CAGGGTGGA TAT CEP350   9857 GGGAAATCCATGG CATCATGTTGTCGC CATCTGGAA TGCACCT CGCTTT TCAAAGCAC GTATACTGT GTA CEP68  23177 AAGCACCTTGATA ACTCTGGCTGGTCC GTAGACCTG GCCGTGT TCTTCT GATAGCTTC TCTGTCTCTC CHMP2A  27243 GGTCCATGCCCAAC CGTGACCCTGTTCT TTTTTAACAT TCTTGA GCTTCT TTGCTGCTCT GTCTGCTTA A CHPF  79586 TTGCGGCAGCCTTC GTGCTGACCTCTCA GGGGCGCAG CAG GACCAC TTGTTGCAG CAGCATGCG CGA CHPF2  54480 CCTTCTCAGCCCCA TTGGTTGATGCTGA CTAGAGGGG ACTCAC GGTGGC GATGTATAT TCTGAACAA G CISD3 284106 TCACGGTCCTATGG TTTTGTTCCCAAGC GCATCAGAT TGTCCT CCCCTT CAGCCTCTT GTAGAG CIT  11113 CCGCAAAGCCCTA AGACGATCTTCTCC GCAAAGCCC ACAGGTA GCAACA TAACAGGTA GACT CLCC1  23155 AATCTTGCTAAATA ACTTTCAGCATCAG AATCTTGCT CTGACAGTGC TACTCAATGA AAATACTGA CAGTGCATA TAT CLIP4  79745 AGCACTGATCTGCT GCATATGAAACAA TATATTAAC GTGTTG GATGGATTAGAAG AATAAGAGT GA GCAGTGATG AGC CNTRL  11064 CACAACCTGAGGC AGAAGGATGATAT CTTCGTCAT TTCGTCA CTTAAGGCACA ATTGCTACT GAAAACTTT GTG COL6A1   1291 CGGTTTGGGGTCTC CTTAGGAGGTTGA CGGTTTGGG TCACTC GGCCGTC GTCTCTCACT C COLGALT1  79709 CTGCAGGTGACGTC GACTCACCATAGC CTGCAGGTG ACTCC GCCGTG ACGTCACTC CG COQ8B  79934 CCAAAGTCACACCT AGAGGCTGAGGGA CAAAGTCAC ACCCCC GACTTCA ACCTACCCC CAAAGTTG CRTC3  64784 GCCACTTTGTCGGG AACGGCTAGCGGG GGGGTCCCT CTGA TGTC CCAGGTGGC CGCCGGCGG CGG CSDE1   7812 CCTTAACAAGGTA ACATGGGTTTACTA CCTTAACAA AATGCCCATT TGTGTTCTTCT GGTAAATGC CCATTAGG CWC27  10283 AGCAGCTTTCTACA TGGAATGTTTTTAC GCAGCTTTC AAATAGGGT AAAGGTAGCTC TACAAAATA GGGTATATT TCT CYB5B  80777 GCCACTCCCTTCAT AAGCCTCCCTTCCT CCTTCATTG TGGTGA TCCCA GTGAAAAGA AAACGAAC CYB5R3   1727 TTACCCCCTCTACA GCCTCAGAAGAAG CTCTACAGC GCCAGG CTGCAGA CAGGGAGAC TCAGTTC DCAF7  10238 TTTGAAACTAGGG CAAGAGGGTTCTG TTTGAAACT GTCGGGC AGGCCTG AGGGGTCGG GC DCAKD  79877 GTGGAGGGGATGC AAAGAAGCACCCG GCCAGTAAG CAGTAAG AGTTCCC CAGTATGAA CTCATCAG DDX10   1662 CACAGCCCTCCTTT CTCCACTCTGCAAC CCCTCCTTTT TCCTGA TCCTCG CCTGACGTC ATT DDX21   9188 CAGTCAAGCAGAT ATGCTGACTGAGA CAGTCAAGC TCTTTACTATCAGA GCCCTTG AGATTCTTT ACTATCAGA ATA DNAJC11  55735 AACACACGGCTGG TCCTGGTGGAGTGT CTGGGAATG GAATGAA CCTACC AAGCGCTTT CTTTTT DNAJC19 131118 GGAAGCAGGAGAA TGCAGTTTGTAATG AAGCAATCA TGGGTCC AGTTGGGG CTTAGAACT TCATGGATA TTT DPH5  51611 AGGACAAAGCACC TGGTTGTCATCGTG CTTGGTTGG CTTTCAT TTCATCAC TGTAAAATT TCCATTCTTC TG DPY19L1  23333 AGCTCACTCTCCAG GCACAGCGCCCCT GGCGGGCGG CGG AAGT AGGGTGGAG GGCGGGCTC GTC ECSIT  51295 AGGTCAGAGGGAG GAGCTTCCTGCAGA CAAGAAAGA GCAAGAA CGGTG GAGATGAGT GATGAAAAG A EMC1  23065 TGCAAAGGAAACT CACTAAGCAACAG CATACTCAC CCAGGCA TGGGTACT AGCCTTCAA GATATTCTG AG ERC1  23085 GTGTGATCTTTTCA GTGTCATGGTGCTT GTGTGATCT TTACAGATATGGTG TTAGGTGT TTTCATTACA GATATGGTG TA ERGIC1  57222 GACCCCTACTATGC TCAGGGTCAGGTC TTTAGCGGA ACTGCC GAGTGAG GTCATTGTC CTGTC ERMP1  79956 AGAGGAGGCCAGC CGTCTCCCAAAACC AACAAACTC ATTTAAAT ACCACT TGTTTTAGTG AGTCAATGT AT ERP44  23071 CAGTATAACATAA TGAACCAAAAAGT ACTCATTAA GCATTTGCCTTGAG TCTCACTAAGCA GTATACGTA TGTCAAATC CAC ETFA   2108 AGGGAAGAAACCT GACACAAATAGCT CTTTTAGTTC TTTAGTTCCT AGATTTTCGCT CTTTTTCACA CATGGTAAT G EXOSC2  23404 CCCTTCGGGTTCGC TCCAGGTCTCCCAC GCCTTATTGT CTTATT AAGGAA TGCCAATTG TAAACATG EXOSC3  51010 TCAAAGCAGGGCT AAGGGCGGGTGTT CAAAGCAGG ACCACTC GGAAG GCTACCACT CTC EXOSC5  56915 AGTCGTGAGGGAG ACTGGTTACGCAGC GTATCCCTG AGATGTGT CTGTTT CGTATTTAG TAGTATTCA ATC EXOSC8  11340 GGCCACAGTTGCCT TCCTCTTACCTTTC CAGTAATCC TTACTG CTGGAGA ATAAATTGA AAAGTTTAG GCC FAM134C 162427 GTGCAGCGAAGAA CATCTGCGCAGTTG GAGAAGTAG AACAGGG CTGTTA AGCCCTAGA GGAACCAAC FAM162A  26355 AAGACACATGTGG GGGTATGATATAG AAGACACAT GAAGTACTT GAACCTCTTCTCT GTGGGAAGT ACTTATTTA AAA FAM8A1  51439 ACCAGCCACCGAC CACTTGCCGGGAGT ACCAGCCAC TACTAGG ACTCG CGACTACTA GG FAM98A  25940 ACGTCTACCCTCAG TGCAGTGGTGTAA GTCTACCCT CTCCTA GAAAGGAT CAGCTCCTA AATTGG FAR2  55711 AAAGCCACGATGC CATTGCCCATCACA AAAGCTCTT TCTCACT CACGC GGAAGCAAC AGAAACATT TTA FASTKD5  60493 ACAGACAGGAGCT GCCAAAGAGATCA GAGAAGTCT GAGAAGTC ATACTGACACC CAGATGCAT TATAGCTGT GAA FBLN5  10516 TTGTGGTGAGCATG GGTGTTTGGGAGTG GTGAGCATG CCAGAT CTTCCT CCAGATACA GACGATG FBN1   2200 ACAACCCTAGCAC TGGAGAAGGCGGG GAGGTCTTG CTCTAAGG AGGA CCAAGGAGT CTTC FBN2   2201 GCTCCAGCTAAAG CTGACTCTTTTCTG CTCCAGCTA GGTCTGG AGGCGC AAGGGTCTG GGA FBXL12  54850 GTCACACGGTAGG CCTCTCACTCTGTC GTCACACGG TACCACC ACCCCA TAGGTACCA CC FGFR1OP  11116 CGTTGAAGGTAGA TGCATTGATACAAT GGCTCTGTA GGCTCTGT CTGAATGCATC AAAGAAATA GGCATAATT TTT FYCO1  79443 ACTCTGCTAGCTCC CACGGGACTCACT ACTCTGCTA TCCTCC GGACAAG GCTCCTCCTC C G3BP2   9908 GCACATGTACACA TGTAAGGAAATCA TCACTCAAA CACGCAC ATGAGGGTAGGT CAACAGGTC AAACACAAA TTC GCC1  79571 CTGCTACTGCTAAC CGTTCAGACCCTCC CTCTTCGGA GCCACT ATGGAG CTTTGGAGG TGG GCC2   9648 TGGGAGATGCACA TCTCTGCTTCATGT GAAAATTTG TAAGGAGT TCCTTAGCT AAAAATGAG TTGATGGCA GTA GDF15   9518 TCCCCCTAAATACA GTGAGTATCCGGA CTAAATACA CCCCCA CTGCAGG CCCCCAGAC CCC GFER   2671 CGCCACACACTGCT TCCGCATCCACGTC CCACACACT CTTTTAC TTGAAG GCTCTTTTAC TGGAGAAAG GGCX   2677 ACAGCATGAAATT AGCTGTCAAGACC CAGCATGAA GATCACAGCA CTAACAGT ATTGATCAC AGCAGAAGT GAA GGH   8836 TGGTCATTCACATC TCCATGTGTAACTC TCATTCACA TTCAACCTG AGGTGCC TCTTCAACCT GTGTAAATA AT GHITM  27069 ACAGTGGATGGTT CACACTAAAGGCA CTGAAAATT GGGCAAA GAGCAGC AAAAAGGTC GCTTTATTTC CT GIGYF2  26058 TGTTCTCTTTACTA ACAGCAGATTTGG CTCTTTACTA GGTCAGTCCA CTTTGGT GGTCAGTCC ATTTGAGTTT G GNB1   2782 ACTGAAAGAGACA TGGGAAGAGGTAG AAGGGAGAA GGAGAAGGG GCACAGT AGAAAAATC AGAACTTGT ATT GNG5   2787 GAAAGTCCTGGGG AGAGACAAAGTTC GAACTAATC CGGAAG GGAGCCC GTCCCCCTA AAACACAG GOLGA2   2801 ACAGTGCCCCCAA AAGAAGGTGGGAA AAACTCACC ACTCAC TCTGGGC CACAGCAGC TG GOLGA3   2802 GACGTGGAGGGTG AGAAAGTGCCGTG CTTACACAG GGAAAAG CTCATGA TTGCGTTTCT TGCATAGGA AG GOLGA7  51125 TGAGCCTTGAAGCT ACGGCAACTATCA TTGAAGCTA ATCCAGT CCATGTAA TCCAGTATTT ATAAGAGGG AT GOLGB1   2804 ACAAGCCACTCAG GCAGTTACAGCAG CTCAGATGG ATGGTAGAG ATGGAAGC TAGAGATGT GGACTTC GORASP1  64689 CATCCTGCCCTCAG CCATCTCAGGCCCA CAGACCTGC TCTTCC GACTTG CCCAGTAAA CTCATC GPAA1   8733 GTATCAGGCCCAG GAAGGGAGCCTCT GTATCAGGC GCTTAGG GAGCAGA CCAGGCTTA GG GPX1   2876 ACAGGAGAGAAGG TATCGAGAATGTG TTCTAACCA GCAGCTA GCGTCCC CAAACAAGG GAGATTTTC TAT GRIPAP1  56850 CCGGCCGCAAATA ACTTGGTATGCTCT TGAACTAAT TCTCCTT TGGTATTCT GCAGAATGA TATCACCTTT TA GRPEL1  80273 GCAGTAACTTGCCA ACAGAAATGTTTTC CTTAACTCT CCTGGG TCCCCAAGT GGCTTTAGT CTGTCACCA ATG GTF2F2   2963 CGGCGTGTTCCTCT GGCTGAAAGACAC TGTTCCTCTT TTTCCT TTTGCGT TTCCTCGGTT CC HEATR3  55027 TATGCCCTCTTCCA GTCAGAAGGCGCG TATGCCCTCT CGCCT CAATG TCCACGCCT G HECTD1  25831 GCTCCGACCTCAGA CTTTGCTGCAGTTG AGAAAGAGA AGATCC CCTTTCT ATGGGAAGA AAGATGTTT AAT HMOX1   3162 CTGCTTGTTTTGCC CAGGGCTTTCTGGG TAAAAGGTT CAGTGG CAATCT TTTAGGCTG AGAAAGTGC ATG HOOK1  51361 AGTGCTTTTGGTTG GCTTTCTGCCAAGC CTTTTGGTTG GTTACTCA TTTAATAGT GTTACTCAG AATTTTGGA AT HS2ST1   9653 CCCATGTTTTCCAT TGAGATCAGCACTC TTGTATCTTT ATCCCTTGG ACATCCC TCTAATCAT GGTCCAAAG TT HS6ST2  90161 CGAACGTGCGCTA CACAGAATGCCAG CCCAGCACC CTGG CTCCTCC TGCCCAGCC GGGGTGCAA ACG HSBP1   3281 CTACTCCCATAATG GCGACAGATGAAT GGTCCCGCG CCCCGC GGGGCTA AGCTGCCAG TCTCGTCGC GAG IDE   3416 GACTCTGGACCAG AAAACCCGGAGCA GCTCCCGCC GCCTCT GCTACC TGGCGAGCC GCTCTTCCG GGC IL17RA  23765 TCTGGGTCGACAG CCTGAGTCGCGAG CCATGCATG ACTGTGA CTTCTAG AGCTCAGGT AACAG INHBE  83729 TGTGGCAGGAGAA ACACCAGACTTCTC GACACAAAG GGAGGAG ACCCCT CAGTCTCTA CTTTTCTAGA G INTS4  92105 CTCAATAAAAGCTT ACTGTATTTTCCTA CTCAATAAA CCTAATGAATACCC AGTCCATCAGCT AGCTTCCTA ATGAATACC CTA ITGB1   3688 CGAGCCTTCAACA AAAGCCAGAATTG CAACAGAAA GAAACTGG GGGTACA CTGGTCAGA GTTTGCATA AAG KDELC1  79070 ACCAGGACTCATA AGAGGAAGAATGT GTAGAAAGC ACTTAGCTTTCA GGAGGAGA CTTTATTTTT CTTCTTTCAG T KDELC2 143888 GGAGCTGACCAGA TTTCCCGCCCGAAA AGGGGCGAC CCCAAAA GACC ACACGCCGG GGAGGGACG CCA LARP4B  23185 ACTTGCAGTGACTC GCTGAGCCTTTGGA GTGACTCAA AACTTCT GCCTAT CTTCTTTAGA CTGTAAAAG AC LMAN2  10960 GTGACCTTCCTTCC AGCTGGGGAGAGA GACTTTATC AGAGCC AGAGAGG CACGGGAGG CAG MAP7D1  55700 ACAAGGGAGAGGG CGGGGTCATTACAC ATGAGCAAT CCACATA ACACCT CTGACCTCT CTCCTCTCTT MARC1  64757 CCGACCAAGTGGA CCCCCTTGCAGGAT CCGACCAAG AGCTGAG TTCACA TGGAAGCTG AG MARK1   4139 AGGGAGCTGAAGT AGACTCCAGAGAG GGAGCTGAA CCAGAAGA GTCCAGG GTCCAGAAG AAATTATAA ATA MAT2B  27430 CTGATGCCCGACCC CTTGAGAGCAAGG TAACTTAAC TAACTT ATAGTTTCTGT TTTAGAATT GGCTTGCAG ATA MDN1  23195 ACTTCCAAAAATG TCTTTTCTGGGGGT CCAAAAATG AAGCAGCAA GACAGG AAGCAGCAA TTTAACAAA CTA MEPCE  56257 GCGGTTGAGTCCTC TTTCCCGACCGACC CGGTTGAGT GAGTAG GCA CCTCGAGTA GTTC MFGE8   4240 CAGACAGCAAACA CCTCCCAGGTCTGA CTGCCCTAC CCTGGGT AGAGGA CTAGCTCAG TTTG MIB1  57534 GTTATTCTCACGTC GTGTCCCACTGCAG GGCTCGCTG CCCCGG ACCTC CCGCCCCCG CCGACGCCT AGA MIPOL1 145282 GTCCCAGCCGTCAC ACCCTGATGGCAA CTCCAAAAT TAAATT GGTATGG TTACCTGTG CTTACAAAT TTA MOV10   4343 TCCTTCAGGGAATG CCTGTCCACCAGCT GAGGGGGTG GGGGAA CTTTCC AGTTTCCTA AGC MPHOSPH10  10199 ATGTTGTTGGGGGC CCATGTCGGACACT AAGAGTGCT CAGAAT TCCTCC GTGAAATTA TTACCTGTA ATT MTCH1  23787 AGCCTCCCATCTCC ACATCCGGCGTGTC AGCCTCCCA CTACG CCA TCTCCCTAC GG MYCBP2  23077 CACACACGAGAAA GACGGATTCTACCC CTCCTATCTC CTGCAGC AGCCG GATAAGTGC TCCTG NARS2  79731 TGAAAGCAAAGTT GAGCAGCTGAGAA GTTATCGGA CCAGCGC AGGAGGG ACAGTTTTG TGAAAAGTA ATG NAT14  57106 GTGTGCCACACTGA TCCCCTGCATTTGT CCACACTGA ACATCG GCCAG ACATCGGAC TGT NDFIP2  54602 GACCTTCCTCTTTA AGCCCATTAACAG ACCTTCCTCT TTGTAAAGAAACT ACATGATAATTACA TTATTGTAA G C AGAAACTGA AA NEU1   4758 GGTTCCCTCTACCC CTTGTTCTGGGACC CTCAGGCAA CTCAGG CCATCC CCAACCCTC TAAGTTC NGDN  25983 TCTGAGCGTTGTTT TCACTTAAATGAGA TCTCTTGTAT CTCTTGT GCTACTGTGTGA TAGCATAAC TTTCTCATTG G NINL  22981 CTCCCCAAAGTGAC GCTGAGTGTGCACC CCCATATCTT CAAGCT TTCTCA GTGATTATG TGCTACAAA AA NLRX1  79671 AGTTTGTCCAGTGG GGCATCCGGGTTA CAGACTTTC CTTCCC AAGAGCT TGGACAGTC TATATTTTCT CA NOL10  79954 GCAAAGCTCACTG CCAGGAAGTGCGT AAAGCTCAC ACCCTGA CATCAGT TGACCCTGA TTATCC NPC2  10577 TAAAGGGAGTCTG GAGCAGAGCACCT AGTGAACCC GGAGCCA TCCCATT TAGCTTTGC ATGAG NPTX1   4884 GGTCGCCCATGGTG ATAAAAGGCGCGG CCCGAGCCG TTCTT GCTCC GGCTGCTTG CGGCCGCCG CCC NSD2   7468 AGCTGTAGAGGTC GGGTGTCCCAATCC ACCTATCCT CTGGCAT CTTTCA AGGTTTTAA ATGTAATTG CTT NUTF2  10204 AGGGAAACTGAAG CAAGACTCTCCTCT CTTTTCAGA TGTGGCC GCCTGC GTCTTTCCA GGGCCTTA PABPC1  26986 GCGCGTCATCACCC CATGGCCTCGCTCT GTCATCACC TAAAGT ACGTG CTAAAGTTT GAGAGC PABPC4   8761 TGGCAACATGCTGT ACTCCAGCTCGTCC CAACATGCT CGTGAT TCG GTCGTGATG CC PCNT   5116 GGGAGAGCATGTG GGACTTGGATCGA GTGTGGTCT AGCACG ACCCAGG CATGAACCT AGTGAG PCSK6   5046 TCAGACTCCCCGAG CTGTGATGCGGTGT CGAGTGACT TGACTC CCTCAT CCTCCACAC TG PDE4DIP   9659 CGAATCCCTTGGCC ACCATCAACTAACC ATATCCCAC AGTGAT CTCCACA TTGAAAGTA TAGGCAGAA TAT PDZD11  51248 CCGCGCTGAACCTC GGTTGGAGCTGCTG CTGAACCTC TTAACA TCTGAA TTAACAGTA TGGAAATGA AG PIGO  84720 TGGGGCTGAATCTC GCTGGGCTTGTATT GAATCTCCA CAGGAT CAGGGA GGATCCTCT GCAAG PIGS  94005 GTGAAGGGCAGCT CTTCGCACGGAGAT CACTGACTC TCTCCTG CCCAAT CCGCGTAAA CA PITRM1  10531 CCATGTGGCTTTCC GCTGGAGGATTGT TCCTGAAGG TGAAGG GGTGTCA ATTAAATTT CTAATGTCC TTC PKP2   5318 TCTCTGGAAGCCCT TCACGTACCCCAGG CTCTGGAAG TCTCTCA CCA CCCTTCTCTC AAG PLD3  23646 TGAATAGCCCCAA TTTCTGTGGGGAGG GAATAGCCC GACTAATCACT AGGAGG CAAGACTAA TCACTCTTCT G PLEKHA5  54477 ACATTCCCAACCAT TTCATGACCCCTCC AACCATAGA AGAGTGCT CCTTCT GTGCTAATT AAACCAGAG ATC PLEKHF2  79666 GCCCTTTTGATGTG AGTGACATTTTCCA TTTTGATGTG CTTAGTGA GGGGAAT CTTAGTGAT TATCTTAGA GG PMPCA  23203 ATAAATACGCACG CGTTCCCGCTACTT CCAGAGTGC CAGCTGC CACCTT AAGTAAAAT ATCAGCTTG PMPCB   9512 TGGCTTTAGGACAG CACCAGCCAACGA CAGAGATCT TGGCTG AAAAGCT CAGTGGAAC CAAAATTCA A POFUT1  23509 AGCTTTGGCGTCTT TGACATAGTCTTGG TTTTAATTGT TTGATGA GGGCCT CATGTAGTC TGAACTGTC TT POLA1   5422 CCCAATTTGGAGAT CCTCTGCAGAAATC CAATTTGGA TAAAGAGAAATGC ACATTTTCA GATTAAAGA GAAATGCAA ACA POLA2  23649 AGGTCTGGGTATGT TGGAACTTGTTCTA TCCAACCCC CCAACC CCAGCCT ATTAAACTG ATTCAATTT ATA POR   5447 GTCCAAGACTGTG GGACAGAGAGAGG GTCCAAGAC GCTGTCT AGGCTGA TGTGGCTGT CT PPIL3  53938 TCACATTTTAGGGG TGCTGCTATCACGT GTGCTAATA TAGGTGCT TTTCAGT ATTTCTGCTT TAAAATTGC AC PPT1   5538 GGCTCCTTCCCCTT CTGAAAGCTCCAG CTTTCCAAT CTCTCT GGTAGGG GCAGATCCT TCAAATCCT AAA PRIM1   5557 TAATGTGAGCCTGA TCGGCCATAAGCG TAATGTGAG CCACGC CCTG CCTGACCAC GC PRIM2   5558 GGATATTTTCTGCA GAGGTTGAGAAAC TATATGATG CATAGATGGACA CCTGCCA TCGTTACAG GAAATAAAC TGG PRKAR2A   5576 TGCCACCCCTCTAG GAAAGGCCGGCGT CCACCCCTC ACCTC GAGT TAGACCTCT GG PRKAR2B   5577 GAGGTTGCCATGGT CTCACCATTGAACG GAGGTTGCC TTCCGG CCCCT ATGGTTTCC GG PRRC2B  84726 GAAGGGGCATGAT AGTGGCATCAGCA CACAGAGCA GCTGTCA CCCTTTT CCCTTGTGA CAAG PSMD8   5714 CCCGAGCACTCAG TTGCTCGTACATGC CAGGGCAGC ACTGAAG CGGTC CATGTTCATT ATTG PTBP2  58155 ACATTGATCCCAAA TCACCATACTGGAG TTAAAAATA GCCTGG CAAAGCT TCTGTTGAG GGGCCATTT AAT PVR   5817 TACCCTCCTCGCCT AACCCGAACATCCT TACCCTCCTC GCCAT CAGCG GCCTGCCAT G QSOX2 169714 CACTCGGGAAATG CTCAGAAACCCAC GAAATGGGT GGTGGAA CCCAGC GGAATGAGT TGGG RAB10  10890 TGTCACTTCCTACT AGTACATTATATCC GTTTTCCCTT GTTTTCCCT TGAAGATCAGTTG TCAGATTTTC G ATCCAGTAT G RAB14  51552 GTTTTACATGGCAA TGCTTATTTAGTGG GTTTTACAT CTTAAGAAACC ATTTTCCCCC GGCAACTTA AGAAACCAT AAA RAB18  22931 AGCTGGAGTTTAG CTCATTGACATGTG CCATGGGTT AACCATGGG TTTTCAAACCA TCATTTCATG TATGATAAA AG RABIA   5861 CAACCAGAATCCCT TCACATCCTGATAA CCTTGAAAG TGAAAGCA TCTCCACAGT CAAACGTAA AACTAATTA CTA RAB2A   5862 TGTGCGTCTCGTTG ACAATTCAGTTGCA TAACTTTTTC ACTTGA GGTTTCTGT CTAAGACTG GTGAAGTTA AG RAB5C   5878 AGTTGCTGGGCTCA TTACAGTTGGAGGT CACAGACGC ATTCCA CCCCCT ATTTAGTCC CTAATG RAB7A   7879 TTCCACATCTGCCC TGAAGAACAGGGA GTACCCTAT CACATC AGGAAAATGT ATTTTTACCC AGAGAGAAA AC RAB8A   4218 AAGGTCTCCCCGCG GCGACTGCTCTTCT GGGACGCAG ACT CCCTTT GGGCGGGCG TCGGCCGCG GTG RALA   5898 TGTTTGCAAATGAG TGTCACAAGCAAC CAAATGAGG GAAACCAAGA AACATTACTCT AAACCAAGA AATTGTCTA AAA RAP1GDS1   5910 TGTGGAGCAGAAG TGGGACAGGTATG GGAGCAGAA GTAATTTTGT AATGACTGT GGTAATTTT GTATAAAGA CAT RBM28  55131 CGTAAGGGAATGC ACGAGCACTTCCG ATAAACTGA TTTGCCC GAATCTC CTCCTATGA ACGCATCTA AAG RBM41  55285 GCTTCTCTTTTACC CTCTTACAGTGCTG CAATGTCTG AATGTCTGCA AACCTCCA CATTCTAAA AATCAAAGA AGA RDX   5962 CCATGATCCAGCTG CAGAGACTCTTCTT ATCCAGCTG GCAACT CTTGCAAGT GCAACTTAA AATCTGGAA AAA REEP5   7905 TCCGATGCCCACGC GAGTGGAGGACGC CTGATCCCT TTTC GTAGAC GAATATGCT GCTTGTC REEP6  92840 GGAGCCGTCACTCT TCTCCTGGTATCCT GTCACTCTG GCTAAG CCGGAC CTAAGCCTG TATCTG RHOA    387 ACTTGGACTAAGAT GCCCCATGGTTACC GAATGGATT GGCAGGA AAAGCA CTTCTTTCCA ACATTTTTGT T RNF41  10193 GCTCCAATCTGATT ACAAGAGGGAGGC CACAGGCAG CCCTGCT CTGAAATG AATATCCAC TCATCTAG RPL36  25873 AGCAGGTAAGTGG CAGGCAGGAAGTC AGCAGGTAA TTTCCCG CCACTC GTGGTTTCC CG RRP9   9136 TAGTGTTGGCCTTT TCCTGCATTATCCA CAAGGCTAC CCCACC GCCCTG AACAACCAG ATCCTTA RTN4  57142 AGTCTCCTCCATCA AGAGTGGGTTTAA GTATAGCTC TGAGCCT AATGTGGGT AAGCAAATA ACTGCAATT ATC SAAL1 113174 ATAGTTTTGGGGTC CAGGCTCCGAACA ATAGTTTTG CGCAGC GCAGATG GGGTCCGCA GC SBNO1  55206 GCTTCACATGTATA TGGGTCTAATAGA CTTCACATG TTTAAAATTGGGCC GATTGTTGGATTGT TATATTTAA AATTGGGCC AAG SCAP  22937 TTAGCTAACCAGGC CCTAGTGTGCAGA TTAGCTAAC CAGGAC GCCAAGT CAGGCCAGG ACTAGAGTT SCARB1    949 AAACCAAGACAGG ATTGCAGGCGAGT AAACCAAGA TGGACCC AGAAGGG CAGGTGGAC CC SCCPDH  51097 TAGGAAACCTCCC GAAACGCTCGTTTG TAGGAAACC GTCGGAA GGGC TCCCGTCGG AAG SELENOS  55829 GCCCCACCGAGAA GGCTTTGAGGGCA CACCGAGAA CCATATA GGAGTTA CCATATACT TCCTACTTTT T SEPSECS  51091 CACCCCCTCCTAAC GCGAGTTGCATTCT CTCCTAACA AACACC GGTTCC ACACCATTT GGCTTTCAC TG SIRT5  23408 GCATCTGCCATGTT CTGAAACAGCAGG CATCTGCCA GTTTGA ACAGGTG TGTTGTTTGA ACATAGT SLC25A21  89874 AAGGGAAAGCACT ATTCTGGCTTGAAG TTCTTCAAG CAGGTGT GGAAGTT AAGATAAAT TTTGGTGTC AGA SLC27A2  11001 GTGGCAGGAAAAA ACTGGCTACGTATG AGGGGCATT GGCAGAC CTCTCA TATAACCAA CATAAATAT GTA SLC30A6  55676 TCAGTTCAAGTTGC ACAACTTAACACC GCCTTATCC CTTATCCA AAACAACTGCA ATTTAAAAA TAAAGAGTG TGG SLC30A7 148867 GTCCGGCAGAAAG GCAACTCAGCAGC GTCCAGTGA GGAGAAG AGAGGTA GGGAGAGTC AAAAACTC SLC30A9  10463 AGGAAGGCCTCCC GAAGGTTCTGAGG CCTATTGGT TATTGGT TTGGCGA GCTCAACGT GTTAC SLC44A2  57153 CCCCTGGTTCTGCT GTTTGCTGGGGATG CTGGTTCTG GGAATT AGGACA CTGGAATTC CAATG SLC9A3R1   9368 GGGATTGGTCTGTG CCTGCTGGTGGGTC GATTGGTCT GTCCTC TCCTT GTGGTCCTC TCTC SLU7  10569 GGGGGACAAGAGA CCTTGAGGAGGGG TGTAGGTAT GGAAGGA GAAGAGA TATTATCTA GAGATGTGA CGG SMOC1  64093 TGCAGCAGTTACTA GGGGAGTTGAAGA TTACTAGCC GCCACG GCCACTC ACGGCCCTT TTAG SNIP1  79753 CACTCTCAACAGCC GAAGCGGAAGTCC CTCTCAACA CCTCAG AGGAGTT GCCCCTCAG GATTAAGTC SPG20  23111 GGCACCTCCTGAA AGAATGAGACTCTT TGAAGATCA GATCATTCT GTTTCAACCA TTCTGCAGA GAAGTGG SRP19   6728 AGGGAAGTCTTCAT CAGAAAAACGAGC CTTCATGCC GCCACG TGCCAGG ACGTCAGAG ACTAGAGAT C SRP72   6731 TGCCACGAGAGCA GAGGAGTGAGACC CCACGAGAG GAAGATT TGCGTC CAGAAGATT ATGATCT STC2   8614 CCCAGCCATTTCAT GTAACCTCTATCCG CATTTCATC CACCCT AGCCGC ACCCTGCTA GCAC STOML2  30968 TCAGCTTTAGCCTT CAAGGAGGGGTGG CAAGAGAAG GGCCTT GAAAAGG GGACAGAGC TTGCTTG SUN2  25777 GGAAGAACCAGGG GAACCCACACCCT CTCCAAGAG GCTCTTC GCACTAG CTTCTGAAA AGTGG TAPT1 202018 GAGGAACTGTCAA AGGAAGAAGATGG GGAGCCTCG CGGCCG CGGCTAC GCAGCCTCG GCGGCTCCG CGC TARS2  80222 GACTCTGAGCTCGA CCCCTGCTCAAGTG CTTGTATCA AGGACC AAGAGA CCCAATCCC CTTAAAAAG TAG TBCA   6902 AAATCAGAGCGGC GCCCTCTAGTAAAC AAATCAGAG CAGTGAG CCGCC CGGCCAGTG AG TBKBP1   9755 CTCGGGGCAGGAA TACACTCTATCAGG CAGGAAGTT GTTTCTG CGCCCT TCTGGGTTG CATCTTAG TCF12   6938 CCGACAATGTGAG AAAGCATAGCCAG AGTGGTCTA GGTGGAG AAGTACAGA ATTGAATTC AAAACGTAC TTA THTPA  79178 GGCCTTAATGTCAC CGTGTGGGGTCCTA CTTAATGTC CGAGGT AGACAC ACCGAGGTA GAGAGAAAA G TIMM10  26519 TTCTCTTCCTGCTT CCCAGGGGTAGGA CATCTAAAT GGCTCC GAGTGAA GCCCAACTC ATTCTAGTG AC TIMM10B  26515 TTTCGAGGCCAGAC CTCCTTTCTTCCCC TTTCGAGGC GTTCAG ATGCCC CAGACGTTC AG TIMM29  90580 GGCGGCTCTGAGG GAGCCCCAGGTTG CTCTGAGGA AGATTTT ACGTAG GATTTTGGT CCCG TIMM8B  26521 GTCGCCCAAATCTT ACCCACGACGACG AAATCTTCC CCCTGT AAAGAAA CTGTTTTACA CCTTTTCTTT T TIMM9  26520 AGTAACTCAGCAG TCTGTAGATCATAC CATCTTCTCT CTGCAGG TGTACCCATTT AAAATGGTC TGACTTGGT AC TLE1   7088 GGGAAAAAGTAAA TGTACAACCCCAAC GAACAGAAG CCCTGAATGGT CCGAAG GATGAGTTT CACTATTAA ACT TLE3   7090 CCTGCACCAGGTAT GAATGGGAAGAGC TATCAACAG CAACAGA CACTCCC ATGACTCCA AATCCTTGG TAA TM2D3  80213 CAAGCGCTCCATCT CAGAAGGCTCAAC CAAGCGCTC CCGTG CGGAAGA CATCTCCGT GC TMED5  50999 CGGGCTGGCTTCCT GTCAACCACGAGG CTCGCCTCTT GAA AGTCCAG CACCACCAG G TOMM70   9868 ACCATGTCCAAGTG CTCGCTCGCTCATT GGGACCTTC AGCACC GCTTTC AGGGTGTCC GCTGCCCGG GGC TORIAIP1  26092 TACACAGCAGCGA TCTAGCCGGGTTCG GGCGGCGGC CGACG TTTTCC CCCAGCGAC TCGCAACTG CCT TRIM59 286827 TGGTAAGGCAATG TGGAGGTTAATGCC TCTAATAGA ACCACAAAC TAGAATGTT CAGTAAACA TTTAATGGTT GC TRMT1  55621 GCAAACTCGGTGA GGCTCTCTGACCCT AAACTCGGT TCACAGC CTCTGT GATCACAGC ACATC TUBGCP2  10844 TGAAGGAAACAGA GCGCTTAGCCTGTT TGAAGGAAA CCCTGCG GTAGTG CAGACCCTG CG TUBGCP3  10426 GGACACAAAAGCA AGGGGACTTTGGCT GACACAAAA AGCCTGG TCATTT GCAAGCCTG GATG TYSND1 219743 AGCAGCTCAGCAG GGCGCTAGGCAGC GGGCTGCAG GAAGC TTCA GGGACGCCC GCGGGACGG GGC UBAP2  55833 CATGCCCGGCCTTA CCCCATTTTCCAAA ATATTTTTAT CTGTAG GGTTCTCC ATTTAGAAA GTAATTATA AA UBXN8   7993 GGGGACGACTTGC CGATGCAGTCTGG GAAACACGG CTTTCTT GAGTTGT CTACAGACT ATAACTTTA AAA UPF1   5976 GCACTGTTACCTCT CCATGTGCCGCTCA GCACTGTTA CGGTCC CCT CCTCTCGGT CC USP13   8975 CGGAGACTCGCCA AGGAAGAGAAGAG GGAGACTCG TTGGATT GTCCCGG CCATTGGAT TAAAAATAG USP54 159195 GAAAAGGGGCTAA TGCTTTTTCGACAT CCTTTTGTCC GCTGGGT TGGGGTC TTACTAAAG ATACTGTCA AT VPS11  55823 AGATCTAGGACTA GACCCCTCCGACA AGATCTAGG CCCCGCG AACAGAT ACTACCCCG CG VPS39  23339 ATGTTTTCCCCCTC CTCTGGCTGGGGA TTGCAAGAA TGGAGT ATGCTAG CTAGACTAT CCCATTTTTA AT WASHC4  23325 TGGGGGTAGATGG TCTGCATGGCTTAG TAGTGGCTT GCTAGTG AGAAAAGGA TTTCATAAT ATGTTAGGG TTT WFS1   7466 CCATGCATCCTTCC CTCTACAGGAAGG GTAACCAAG CTGGTA TTCTGGTC TCCTGACAC CTTCTATGA GTC YIF1A  10897 CCTCTGTGTGCTCC TTGGGGTCCCCTCA CTGTGTGCT ATCCC CTGATC CCATCCCTG AG ZC3H18 124245 TGGCCTGTCTTTCT TCTGAGTCCTGGTC CTGTCTTTCT CTGCAG TTGGGA CTGCAGAGT GGAG ZC3H7A  29066 AAAACCCCCAAAT ACGATGAAAGTGA CAAATTCAG TCAGCCT CTGAGTACA CCTATATGC AATACTGAA AAA ZDHHC5  25921 TGGCCTTTGACCAA TTTCCCCGGCCCCT CTTGCAGAT CCTCTG ACT TTATAGAGC AAAATAAAC TGG ZNF318  24149 TTACAGCCAAGTCC AGAAGACAAGTCT GATGGTGTC CCTGGA AGATTGCCTTGA TCCTTTGTTG GTGTCTCTT ZNF503  84858 GGTACGGAAGCAG CCCTCGCTTTCTGC GTACGGAAG TAGCCTC CCTAAG CAGTAGCCT CTTC ABCC1 4363 CCTCTTTCCCTGGG CCCAGGGTTATGAC CTCTTTCCCT CTTGTT TGATGCA GGGCTTGTT GTCTTTG ATP6AP1 537 ACAGCCAACCAGT CCCGAGCAAGGAA CCAACCAGT GAGAAGG CAGTCC GAGAAGGAG TGG BRD2 6046 GGGCCAGCAATAA ATGGCCATGCGAA AATAAAAGC AAGCTCC CTGATGT TCCACAGAT TGTTTGGAT ATT BRD4 23476 CTGACCAGGAGAC ACTGATATCTCACG CTGACCAGG ATGCAGG GGGGCT AGACATGCA GG CEP250 11190 ATGTGCTTTGGTCC GCTAGATGTAGGC AGTTCAAGA CCAGTT CACTCCC GGAGGTTGA AGTGG COMT 1312 GTGAAATACCCCTC CTGGTGGGGAGGA GTGAAATAC CAGCGG CAAAGTG CCCTCCAGC GG CSNK2A2 1459 ACATTTGTGGGCTG TCCATCTGATTGGC ATCAAAATA AATCAAAA TAACATTGT GTGAAGTAC AAACCCAGA AAA CSNK2B 1460 GGTCAGAAGCCCA CAGGATGACCCCC TAAGGCCCA GGTTTCT AATCAGA AAAGTAGGT GCTAG CUL2 8453 GAACGTTCCACAC AGACTCACATCTTT CTAAATACC ACTCCCT CCCAGTTGT CACCTTACC CTGACTATA GAC DCTPP1 79077 CCGGTATCTTCCCA AATTGGTCGGAGCT CGTTCCTAG GGGCTA CTGGAG TTACCACTC GGAG DNMT1 1786 TCAAAAGAGAACC TCATCGCCCCTCCC CTAGTTTCTA CCCACCC CAT GCCACCAGG GAGCTAC EDEM3 80267 GACCCTGTCCACCC GTCCGTGTTACTCC GACCCTGTC CTCTAG GCATCC CACCCCTCT AG EIF4E2 9470 CCTCACAACACCAC AGTGATGCAGTTTT TATAGTGTC ACATGA GAGAGACT TTCCATGCTT ATGTTCTTA AC EIF4H 7458 AGAATGGCTGATG GTGACCACACAAG TTTTCTGTTG CTTCTGC GTGCATG GAAGCAAAA GCTCTTAAA AT ELOB 6923 GAGGTCTAAACAT AGCAGCCGCGATG GAGGTCTAA CGCCCCC GTGA ACATCGCCC CC ERLEC1 27248 TTGATATGTCGTCT GGAAGAGGCCGAA TTGATATGT GCCCCG CCCTTAG CGTCTGCCC CG ERO1B 56605 GGACCGTCACCATC AACCGTCCCCTTGG GACCGTCAC TTCCTC GTC CATCTTCCTC TTTT F2RL1 2150 AGCCCCTATAAGC CCCCATAAATCCAG CCCTATAAG ATTTTGTGT TTGTTGCC CATTTTGTGT AATCCTCTA AT FKBP10 60681 AAGAGGACAGGAA AACAAGGAAACAG AAGAGGACA GAGGGGG GACCCCG GGAAGAGGG GG FKBP15 23307 TTGAGGGTACAAG TCAATTTTGAAGCT AGTAGACAA CACTCCC AGTTCAGTGGT GATAATGGC TTTTCAAGTT TT FKBP7 51661 AGAGAAACACTGC CTTTGTGACGCAGG AGAGAAACA CATATAATGTGA ACAACG CTGCCATAT AATGTGATT TTT FOXRED2 80020 GGCTGAGCAGAGA CGTGACCCAGATTG CTGAGCAGA GTTCCAG CAGTGA GAGTTCCAG TCG GLA 2717 AAAAAGCAGCAGC AGTCATCGGTGATT AACTGTTCC AGAGTCG GGTCCG CGTTGAGAC TCTC HDAC2 3066 AGGAAAAAGAGGG CAGCTGGTAAAAG GAGGGTATA TATAGCTCTC TGTGCGT GCTCTCATTC TTATTCATC HYOU1 10525 TCCAGGTTTGACAA TCCTTCACTCCGGG ATCACTGCC TGGCCA TATCCA AGTGTATCT GAAGGGAAA AG IMPDH2 3615 TAAACCCCTACTCC AAGTGCCTTTTTGT CTTGCTAAT CACCCC GGGGGA GATCGTTGC CCTTC LARP1 23367 TGACCATGCTTCCC GGCACCTAAAGCT CATCTCAGG ACTGAA CCTCCAG TGTGAAAAT GACCTTAGA ATA LOX 4015 CCAGCGGTGACTCC TCCCTCACGTGATT GCCGGCCGT AGATG TGAGCC CCGCGTTCG CGCCGCGGC GGT MARK2 2011 TCTTCACATGCCTA ATCCCACAGCTTTT CCTGCACCC CCAGCC TGCACC TCATCCCTTA TATATTTT MARK3 4140 ACAGCCACGTATG TGGTATTTACCTCT ACGTATGCA CAAAATATCT CTGCCTGT AAATATCTA ATTTCTTCCT GA MRPS2 51116 AGGAGCATGCGAG AGTTTCGACCGCGT CGGAGGGGC GAGGAT GCAG GCGGGGACC CGATGGAGC GGC MRPS25 64432 CAGGAGTGGGGTT CGGGTGCTAGCTA CCTCAGTCT CTTGTCC GTCCTTT GGACCTCTG TAAAATG MRPS27 23107 TGGAAAAGTAGCA TCTGTCACATTGCA TTATTAATG GCTACAGGA CTCTGT AACTTATAC CCAGCTCCA TTC MRPS5 64969 GCCTTGAACTATAA ACTCCCTCGTCTTG TGAAAATAC CAATTGCAATC GTTCTT TCTTCAGAA CCTATGTAA TCG NDUFAF1 51103 TTGCACAGTACCCA AGTGGCTTCTCCTG CCTCAGAGC CTTCGG GCAAAG TCAGAGTTC CATATAG NDUFAF2 91942 ATGGTGAGCGCCG GATGCCAGAGTGA GTTACTAGA TTACTAG AGGGGTC AGGGCTCCA GGATG NDUFB9 4715 GGAAAACGCTCCT AACCCGGGTCTACC GAAAACGCT CTTACCGA ATAGGA CCTCTTACC GATAAACTT GAA NEK9 91754 GGGAAGAGTGGTG CATCTGAAGCGAG GAAGAGTGG AAGACCC CGGGAC TGAAGACCC TAAGACATA TA NGLY1 55768 AGAACTAAGAACA AGGCATTATTTACC ATGGGGCAT AAATATGGGGCA TTAGGCTGT AAATTCAGG AATAAATCA TAA NUP210 23225 ATGACATGAGCAG CTCATCACCTGCTG ATGACATGA TGGTGGC GCCTG GCAGTGGTG GC NUP214 8021 GAAGAATTCCAGG GGGTTAACCTATGA ATTTATCTGT GATACTTAATCC AGCTTCCA ATAACTAGG TATTGGGGT GT NUP54 53371 CTCTGAGTAGGACT TGATCTGACTGGCG CTCTGAGTA CCCCGG GTTTCC GGACTCCCC GG NUP58 9818 CGTACTTTTGCGTG GGGCGGCTAGATT GTACTTTTGC GTTGCT AAGTGCT GTGGTTGCT CC NUP62 23636 GAAGCACCGATCC CCAGTCATGCCACT CGATCCCCA CCAAAGA GAGCTT AAGAAAATC CAGTTC NUP88 4927 CAGCCAAGAGGAG GCGGATTGGCTGTG CCAAGAGGA CAAGGAA CTCA GCAAGGAAC AAAAA NUP98 4928 ACTCTCTTCCTTTC AGGAATTGACTTA CAGCCTATT CAGCCT GTGGCTCTGA AACCTTTTC AGTACATAT TGA OS9 10956 GGACCTTGGAGCC ACTCTTCCCGATTC CGTTTACAA ACGTTTA CCCGTA ATAGGAATA GGGTACGTG PLOD2 5352 GGCAACCTACAGA AGAAGAGTGGTTA GGCAACCTA ATAGTAATATCTAC CGGTACAGT CAGAATAGT T AATATCTAC TTT PRKACA 5566 GTGCTGCTTTTGAG TGGCTCCGGCATCC CTTTTGAGG GGATGT CTA GATGTTACT GAGGTTG PTGES2 80142 CTGATCAGCATCCC CTGAGGGTTCCCTT CTGATCAGC CATCCC AGCGTC ATCCCCATC CC RAE1 8480 ACTCTGCTCATTGC CAGGACACAAGTA CTGCTCATT GCTCTT CGGGGAC GCGCTCTTG TCTGAAAA RBX1 9978 TGCGACAGCCCCTT CGTCACGCCGATCA CCCTTTAAG TAAGAG ACTCTA AGGCGTGGT CAC RIPK1 8737 AGTCTTGCCCTGAG ATCCGAAGAGCCA CCCTGAGGT GTTTTCT TCGTCAC TTTCTCTCTG TTTTCTTTA SDF2 6388 TGGTGTTGCGATTA TTCGCCATTAGCTT CGATTAAGA AGATGCC CCGGTT TGCCTTAGA ACAATTCAG TTC SIGMAR1 10280 ATCCGAGATCTCAG GGAGCCTAGGGTT CAATCGCAC CCCAGT CCGAAG ATGACACTA TCAGGGTAT TC SIL1 64374 CTTGGAACTGATGC GAGCAAGTGACGA GTTGTTGGG CCACCA CATGGGA AGGATTAAA TGAGAATAC ATA TBK1 29110 TGAGACATGCACA CACCCTTGGAAGC TGCACACAT CATACACGT GAGTACC ACACGTAAA TATCTACATT AT TMEM97 27346 TGTCCACGAGCCTC AAAGTTGGGTTAG TCCACGAGC CTC GAGCGGG CTCCTCTTCT C TOR1A 1861 ATCCTCAATCCCCT GCCCTGAAGAAAG ATCCTCAAT AGCCCC ATGGCCT CCCCTAGCC CC UGGT2 55757 GGAAGGAGGTGGT AGTAACGGACTCG GAAGGAGGT GATGCTC AGCTCCT GGTGATGCT CAG ZYG11B 79699 AAGTGTGATGGAA GCAACTTCAGCCA GATGGAAAT ATTTTGGCT GGTCTTC TTTGGCTATT CTTTAACTGT T ACE2 59272 CTGGGACTCCAAA CGCCCAACCCAAG CAAAATCAG ATCAGGGA TTCAAAG GGATATGGA GGCAAACAT C

    [0380] Identification of Essential Genes for siRNA and Cas9 Knockout Screen

    [0381] Here, longitudinal imaging in A549 cells was used to assess cell viability (FIG. 3A-F). For benchmarking, relative cell viability was measured by CellTiter-Glo Luminescent Cell Viability Assay (Promega; G7571) as per manufacturer's instructions. Briefly, two passages post-nucleofection A549 siRNA pools cultured in 96-well tissue-culture treated plates (Corning, #3595) were lysed in the CellTIter-Glo reagent, by removing spent media and adding 100 μl of the CellTiter-Glo reagent containing the CellTiter-Glo buffer and CellTiter-Glo Substrate. Cells were placed on an orbital shaker for 2 minutes on a SpectraMax iD5 (Molecular Devices) and then incubated in the dark at room temperature for 10 minutes. Completely lysed cells were pipette mixed and 25 μl were transferred to a 384-well assay plate (Corning, #3542). The luminescence was recorded on a SpectraMax iD5 (Molecular Devices) with an integration time of 0.25 seconds per well. Luminescence readings were all normalized to the without-sgRNA control condition.

    [0382] To determine cell viability in Caco-2 knockouts we used longitudinal imaging (FIG. 3A-F). All gene knockout pools were maintained for a minimum of six passages to determine the effect of loss of protein function on cell fitness prior to viral infection. Viability was determined through longitudinal imaging and automated image analysis using a Celigo Imaging Cytometer (Celigo). Each gene knockout pool was split in triplicate wells on separate plates. Every day, except the day of seeding, each well was scanned and analyzed using built in ‘Confluence’ imaging parameters using auto-exposure and autofocus with an offset of −45 μm. Analysis was performed with standard settings except for an intensity threshold setting of 8. Confluency was averaged across 3 wells and plotted over time. Viability genes were determined as pools that were less than 20% confluent 5 days post seeding following 6 passages.

    [0383] Genes deemed essential were excluded from the knockout screen.

    [0384] Cells, Virus, and Infections for Caco-2 Cas9 Knockout Screen

    [0385] Wild-type and CRISPR edited Caco-2 cells were grown at 37° C., 5% CO.sub.2 in DMEM, 10% FBS. SARS-CoV-2 stocks were grown and titered on Vero E6 cells as described previously (A. S. Jureka, et al., Propagation, Inactivation, and Safety Testing of SARS-CoV-2. Viruses. 12 (2020), doi:10.3390/v12060622). Wild-type and CRISPR edited Caco-2 cell lines were infected with SARS-CoV-2 at an MOI of 0.01 in DMEM supplemented with 2% FBS. 72 hours post-infection, supernatants were harvested and stored at −80° C. and the Caco-2 WT/CRISPR KO cells were fixed with 10% neutral buffered formalin (NBF) for 1 hour at room temperature to enable further analysis.

    [0386] Focus Forming Assay for Caco-2 Cas9 Knockout Screen

    [0387] Vero E6 cells were plated into 96 well plates at confluence (50,000 cells/well) in DMEM supplemented with 10% heat-inactivated FBS (Gibco). Prior to infection, supernatants from infected Caco-2 WT/CRISPR KO cells were thawed and serially diluted from 10.sup.−1 to 10.sup.−8. Growth media was removed from the Vero E6 cells and 40 μl of each virus dilution was plated. After 1 hour adsorption at 37° C., 5% CO.sub.2, 40 μl of 2.4% microcrystalline cellulose (MCC) overlay supplemented with DMEM powdered media (Gibco) to a concentration of 1×was added to each well of the 96 well plate to achieve a final MCC overlay concentration of 1.2%. Plates were then incubated at 37° C., 5% CO.sub.2 for 24 hours. The MCC overlay was gently removed and cells were fixed with 10% NBF for 1 hour at room-temperature. After removal of NBF, monolayers were washed with ultrapure water and ice-cold 100% methanol/0.3% H.sub.2O.sub.2 was added for 30 minutes to permeabilize the cells and quench endogenous peroxidase activity. Monolayers were then blocked for 1 hour in PBS with 5% non-fat dry milk (NFDM). After blocking, monolayers were incubated with SARS-CoV N primary antibody (Novus Biologicals; NB100-56576-1:2000) for 1 hour at room temperature in PBS, 5% NFDM. Monolayers were washed with PBS and incubated with an HRP-Conjugated secondary antibody for 1 hour at room temperature in PBS with 5% NFDM. Secondary was removed, monolayers were washed with PBS, and then developed using TrueBlue substrate (KPL) for 30 minutes. Plates were imaged on a Bio-Rad Chemidoc utilizing a phosphorscreen and foci were counted by eye to calculate focus forming units per ml (FFU/ml) for each knockout. The original formalin-fixed Caco-2 WT/CRISPR KO cells were stained with Dapi (Thermo Scientific) and imaged on a Cytation 5 plate reader to determine cell viability. Wells containing no cells were excluded from further analyses.

    [0388] Quantitative Analysis and Scoring of Knockdown and Knockout Library Screens

    [0389] Virus readout by qPCR (A549-ACE2, expressed as PFU/ml) and focus forming assay readouts (Caco-2, FFU/ml) were processed using the RNAither package (https://www.bioconductor.org/packages/release/bioc/html/RNAither.html) in the statistical computing environment R. The two datasets were normalized separately, using the following method. The readouts were first log transformed (natural logarithm), and robust Z-scores (using median and MAD “median absolute deviation” instead of mean and standard deviation) were then calculated for each 96-well plate separately. Z-scores of multiple replicates of the same perturbation were averaged into a final Z-score for presentation in FIG. 4A-F. No filtering was done based on differences in replicate Z-scores. It is suggested to consult the replicate Z-scores for all genes/perturbations of interest. The A549-ACE2 siRNA screen includes 3 replicates (or more) of each perturbation, and the Caco-2 CRISPR screen includes 2 replicates (or more) of each perturbation. The results from the A549-ACE2 screen cover all 332 screened genes (331 SARS-CoV-2 interactors plus ACE2). The results from the Caco-2 screen cover 286 of the screened genes plus ACE2. The remaining Caco-2 genes were either deemed essential, failed editing, or failed in the focus forming assay.

    [0390] Referring to FIG. 4A, A549-ACE2 cells were transfected with siRNA pools targeting each of the human genes from the SARS-CoV-2 interactome, followed by infection with SARS-CoV-2 and virus quantification using RT-qPCR. Cell viability and knockdown efficiency in uninfected cells was determined in parallel.

    [0391] Referring to FIG. 4B, Caco-2 cells with CRISPR knockouts of each human gene from the SARS-CoV-2 interactome were infected with SARS-CoV-2, and supernatants were serially diluted and plated onto Vero E6 cells for quantification. Viabilities of the uninfected CRISPR knockout cells were determined in parallel.

    [0392] Referring to FIG. 4C and FIG. 4D, a plot of results from the infectivity screens in A549-ACE2 knockdown cells (FIG. 4C) and Caco-2 knockout cells (FIG. 4D) sorted by Z-score (Z<0, decreased infectivity; Z>0 increased infectivity) is shown. Negative controls (non-targeting control for siRNA, nontargeted cells for CRISPR) and positive controls (ACE2 knockdown/knockout) are highlighted.

    [0393] Referring to FIG. 4E, results from both assays with potential hits (14>2) highlighted in red (A549-ACE2), yellow (Caco-2) and orange (both) are shown.

    [0394] Referring to FIG. 4F, pan-coronavirus interactome reduced to human preys with significant increase (red nodes) or decrease (blue nodes) in SARS-CoV2 replication upon knockdown/knockout is shown. Viral proteins baits from SARS-CoV-2 (red), SARS-CoV-1 (orange) and MERS-CoV (yellow) are represented as diamonds. The thickness of the edge indicates the strength of the PPI in spectral counts. KD=Knockdown; KO=Knockout; PPI=protein-protein interaction.

    [0395] See also Tables 5 Å-G provide in U.S. Provisional Application No. 63/091,929 filed on Oct. 15, 2020, expressly incorporated by reference herein.

    [0396] Antiviral Drug and Cytotoxicity Assays (A549-ACE2 Cells)

    [0397] 2,500 A549-ACE2 cells were seeded into 96- or 384-well plates in DMEM (10% FBS) and incubated for 24 hours at 37° C., 5% CO.sub.2. Two hours prior to infection, the media was replaced with 120 μl (96 well format) or 50 μl (384 well format) of DMEM (2% FBS) containing the compound of interest at the indicated concentration. At the time of infection, the media was replaced with virus inoculum (MOI 0.1 PFU/cell) and incubated for 1 hour at 37° C., 5% CO.sub.2. Following the adsorption period, the inoculum was removed, replaced with 120 μl (96 well format) or 50 μl (384 well format) of drug-containing media, and cells incubated for an additional 72 hours at 37° C., 5% CO.sub.2. At this point, the cell culture supernatant was harvested, and viral load assessed by RT-qPCR (as described in ‘Viral infection and quantification assay in A549-ACE2 cells’). Viability was assayed using the CellTiter-Glo assay following the manufacturer's protocol (Promega). Luminescence was measured in a Tecan Infinity 2000 plate reader, and percentage viability calculated relative to untreated cells (100% viability) and cells lysed with 20% ethanol or 4% formalin (0% viability), included in each experiment.

    [0398] Antiviral Drug and Cytotoxicity Assays (Vero E6 Cells)

    [0399] Viral growth and cytotoxicity assays in the presence of inhibitors were performed as previously described (Gordon, et al. A SARS-CoV-2 protein interaction map reveals targets for drug repurposing. Nature (2020). 2,000 Vero E6 cells were seeded into 96-well plates in DMEM (10% FBS) and incubated for 24 hours at 37° C., 5% CO.sub.2. Two hours before infection, the medium was replaced with 100 μl of DMEM (2% FBS) containing the compound of interest at concentrations 50% greater than those indicated, including a DMSO control. SARS-CoV-2 virus (100 PFU; MOI 0.025) was added in 50 μl of DMEM (2% FBS), bringing the final compound concentration to those indicated. Plates were then incubated for 48 hours at 37° C. After infection, supernatants were removed and cells were fixed with 4% formaldehyde for 24 hours prior to being removed from the BSL3 facility. The cells were then immunostained for the viral NP protein (rabbit anti-sera produced in the Garcia-Sastre lab; 1:10,000) with a DAPI counterstain. Infected cells (488 nm) and total cells (DAPI) were quantified using a Celigo (Nexcelcom) imaging cytometer. Infectivity is measured by the accumulation of viral NP protein in the nucleus of the cells (fluorescence accumulation). Percent infection was quantified as (Infected cells/Total cells)−Background)*100 and the DMSO control was then set to 100% infection for analysis. The IC.sub.50 and IC.sub.90 for each experiment was determined using the Prism (GraphPad Software) software. Cytotoxicity measurements were performed using the MTT assay (Roche), according to the manufacturer's instructions. Cytotoxicity was performed in uninfected Vero E6 cells with same compound dilutions and concurrent with viral replication assay. All assays were performed in biologically independent triplicates.

    [0400] Co-Immunoprecipitation Assays for Orf9b and Tom70

    [0401] HEK293T and A549 cells were transfected with the indicated mammalian expression plasmids using Lipofectamine 2000 (Invitrogen) and TranslT-X2 (Minis Bio) respectively. 24 hours post-transfection, cells were harvested and lysed in NP-40 lysis buffer (0.5% Nonidet P 40 Substitute (NP-40; Fluka Analytical), 50 mM Tris-HCl, pH 7.4 at 4° C., 150 mM NaCl, 1 mM EDTA) supplemented with cOmplete mini EDTA-free protease and PhosSTOP phosphatase inhibitor cocktails (Roche). Clarified cell lysates were incubated with Streptactin Sepharose beads (IBA) for 2 hours at 4° C., followed by five washes with NP-40 lysis buffer. Protein complexes were eluted in the SDS loading buffer and were analyzed by western blotting with the indicated antibodies.

    [0402] Quantification of Tom70 Downregulation in HeLaM Cells Overexpressing Orf9b

    [0403] HeLaM cells were transiently transfected with plasmids encoding GFP-Strep, SARS-CoV-1 Orf9b-Strep or SARS-CoV-2 Orf9b-Strep. The next day, the cells were fixed using 4% paraformaldehyde and immunostained with antibodies against Strep tag, and Tom20 or Tom70. Representative images for each construct were captured by acquiring a single optical section using a Nikon A1 confocal fitted with a CFI Plan Apochromat VC 60×oil objective (NA 1.4). For image quantification multiple fields of view were captured for each construct using a CFI Super Plan Fluor ELWD 40×objective (NA 0.6). The mean fluorescent intensity for Tom20 and Tom70 was measured by manually drawing a region of interest around each cell using ImageJ. Between 30 and 60 cells were quantified for each construct.

    [0404] Quantification of Tom70 Downregulation in Infected Caco-2 Cells

    [0405] Caco-2 cells were seeded on glass coverslips in triplicate and infected with SARS-CoV-2 at an MOI of 0.1 as described above. At 24 hours post-infection, cells were fixed with 4% paraformaldehyde and immunostained with antibodies against Tom70, Tom20 and Orf9b. For signal quantification images of non-infected and neighbouring infected cells were acquired using a LSM800 confocal laser-scanning microscope (Zeiss) equipped with a 63×, 1.4 NA oil objective and the Zen blue software (Zeiss). The mean fluorescence intensity of each cell was measured by ImageJ software. 43 cells were quantified for each condition, infected or non-infected, from three independent experiments.

    [0406] Co-Expression and Purification of Orf9b-Tom70 (109-End) Complexes

    [0407] SARS-CoV-2 Orf9b and Tom70 (residues 109-end) were coexpressed using a pET29-b(+) vector backbone where Orf9b was tag-less and Tom70 had an N-terminal 10×His-tag and SUMO-tag. LOBSTR E. coli cells transformed with the above construct were grown at 37° C. till O.D. (600 nm)=0.8 and the expression was induced at 37° C. with 1 mM IPTG for 4 hours. Frozen cell pellets were resuspended in 25 ml lysis buffer (200 mM NaCl, 50 mM Tris-HCl pH 8.0, 10% v/v glycerol, 2 mM MgCl.sub.2) per liter cell culture, supplemented with cOmplete protease inhibitor tablets (Roche), 1 mM PMSF (Sigma), 100 μg/ml lysozyme (Sigma), 5 μg/ml DNaseI (Sigma), and then homogenized with an immersion blender (Cuisinart). Cells were lysed by 3×passage through an Emulsiflex C3 cell disruptor (Avestin) at ˜15,000 psi, and the lysate clarified by ultracentrifugation at 100,000×g for 30 minutes at 4° C. The supernatant was collected, supplemented with 20 mM imidazole, loaded into a gravity flow column containing Ni-NTA superflow resin (Qiagen), and rocked with the resin at 4° C. for 1 hour. After allowing the column to drain, resin was rinsed twice with 5 column volumes (cv) of wash buffer (150 mM KCl, 30 mM Tris-HCl pH 8.0, 10% v/v glycerol, 20 mM imidazole, 0.5 mM tris(hydroxypropyl)phosphine (THP, VWR)) supplemented with 2 mM ATP (Sigma) and 4 mM MgCl.sub.2, then washed with 5 cv wash buffer with 40 mM imidazole. Resin was then rinsed with 5 cv Buffer A (50 mM KCl, 30 mM Tris-HCl pH 8.0, 5% glycerol, 0.5 mM THP) and protein was eluted with 2×2.5 cv Buffer A+300 mM imidazole. Elution fractions were combined, supplemented with Ulp1 protease, and rocked at 4° C. for 2 hours. Ulp1-digested Ni-NTA eluate was diluted 1:1 with additional Buffer A, loaded into a 50 ml Superloop, and applied to a MonoQ 10/100 column on an Äkta pure system (GE Healthcare) using 100% Buffer A, 0% Buffer B (1000 mM KCl, 30 mM Tris-HCl pH 8.0, 5% glycerol, 0.5 mM THP). The MonoQ column was washed with 0%-40% Buffer B gradient over 15 cv, peak fractions were analyzed by SDS-PAGE and the identity of tagless Tom70(109-end) and Orf9b proteins confirmed by intact protein mass spectrometry (Xevo G2-XS Mass Spectrometer, Waters). Peak fractions eluting at −15% B contained relatively pure Tom70(109-end) and Orf9b, and these were concentrated using 10 kDa Amicon centrifugal filter (Millipore) and further purified by size exclusion chromatography using a Superdex 200 increase 10/300 GL column (GE healthcare) in buffer containing 150 mM KCl, 20 mM HEPES-NaOH pH 7.5, 0.5 mM THP. The sole size-exclusion peak contained both Tom70(109-end) and Orf9b, and the center fraction was used directly for cryo-EM grid preparation.

    [0408] Expression and Purification of SARS-CoV-2 Orf9b

    [0409] Orf9b with N-terminal 10×His-tag and SUMO-tag was expressed using a pET-29b(+) vector backbone. LOBSTR E. coli cells transformed with the above construct were grown at 37° C. until reaching O.D. (600 nm)=0.8 and the expression was induced at 37° C. with 1 mM IPTG for 6 hours. Frozen cell pellets were lysed, homogenized, clarified, and subject to Ni affinity purification as described above for Orf9b-Tom70 complexes, with several small changes. Lysis buffers and Ni-NTA wash buffers contained 500 mM NaCl, and an additional wash step using 10 cv wash buffer+0.2% TWEEN20+500 mM NaCl was carried out prior to the ATP wash. Orf9b was eluted from Ni-NTA resin in Buffer A (50 mM NaCl, 25 mM Tris pH 8.5, 5% glycerol, 0.5 mM THP) supplemented with 300 mM imidazole. This eluate was diluted 1:1 with additional Buffer A, loaded into a 50 ml Superloop, and applied to a MonoQ 10/100 column on an Akta pure system (GE Healthcare) using 100% Buffer A, 0% Buffer B (1000 mM NaCl, 25 mM Tris-HCl pH 8.5, 5% glycerol, 0.5 mM THP). The MonoQ column was washed with 0%-40% Buffer B gradient over 15 cv, and relatively pure Orf9b eluted at 20-25% Buffer B, whereas Orf9b and contaminating proteins eluted at 30-35% buffer B. Fractions from these two peaks were combined and incubated with Ulp1 and HRV3C proteases at 4° C. for 2 hours, supplemented with 10 mM imidazole, then thrice flowed back through 1 ml of Ni-NTA resin equilibrated with size-exclusion buffer (as above)+10 mM imidazole. The reverse-Ni purified sample was concentrated using 10 kDa Amicon centrifugal filter and then further purified by size exclusion chromatography using a Superdex 200 increase 10/300 GL column.

    [0410] Expression and Purification of Tom70(109-End)

    [0411] Tom70 (109-end) with N-terminal 10×His-tag and SUMO-tag and C-terminus Spy-tag, HRV-3C protease cleavage site, and eGFP-tag was expressed using a pET-21(+) vector backbone. LOB STR E. coli cells transformed with the above construct were grown at 37° C. till O.D. (600 nm)=0.8 and the expression was induced at 16° C. with 0.5 mM IPTG overnight. The soluble domain of Tom70 (Tom70 (109-end)) was purified as described in (A. C. Y. Fan, et al., Hsp90 functions in the targeting and outer membrane translocation steps of Tom70-mediated mitochondrial import. J. Biol. Chem. 281, 33313-33324 (2006)) with some modifications. Frozen cell pellets of LOB STR E. coli transformed with the above construct were resuspended in 50 ml lysis buffer (500 mM NaCl, 20 mM KH.sub.2PO.sub.4 pH 7.5) per liter cell culture, supplemented with 1 mM PMSF (Sigma) and 100 ug/ml, and homogenized. Cells were lysed by 3× passage through an Emulsiflex C3 cell disruptor (Avestin) at ˜15,000 psi, and the lysate clarified by ultracentrifugation at 100,000×g for 30 minutes at 4° C. The supernatant was collected, supplemented with 20 mM imidazole, loaded into a gravity flow column containing Ni-NTA superflow resin (Qiagen), and rocked with the resin at 4° C. for 1 hour. After allowing the column to drain, resin was rinsed with twice with 5 column volumes (cv) of wash buffer (500 mM KCl, 20 mM KH.sub.2PO.sub.4 pH 8.0, 20 mM imidazole, 0.5 mM THP) supplemented with 2 mM ATP-4 mM MgCl.sub.2, then washed with 5 cv wash buffer with 40 mM imidazole. Bound Tom70 (109-end) was then cleaved from the resin by 2 hour incubation with Ulp1 protease in 4 cv elution buffer (150 mM KCl, 20 mM KH.sub.2PO.sub.4 pH 8.0, 5 mM imidazole, 0.5 mM THP). After cleavage with Ulp1, the flow through was collected along with a 2 cv rinse of the resin with additional elution buffer. These fractions were combined and HRV3C protease was added to remove the C-terminal EGFP tag (1:20 HRV3C to Tom70). After 2 hour HRV3C digestion at 4° C., the double-digested Tom70(109-end) was concentrated using a 30 kDa Amicon centrifugal filter (Millipore) and further purified by size exclusion chromatography using a Superdex 200 increase 10/300 GL column (GE healthcare) in buffer containing 150 mM KCl, 20 mM HEPES-NaOH pH 7.5, 0.5 mM THP.

    [0412] Prediction of SARS-CoV-2 Orf9b Internal Mitochondrial Targeting Sequence

    [0413] Orf9b was analyzed for the presence of an internal mitochondrial targeting sequence (i-MTS) as described in (S. Backes, et al., Tom70 enhances mitochondrial preprotein import efficiency by binding to internal targeting sequences. J. Cell Biol. 217, 1369-1382 (2018)) using the TargetP-2.0 server (J. J. Almagro Armenteros, et al., Detecting sequence signals in targeting peptides using deep learning. Life Sci Alliance. 2 (2019), doi:10.26508/lsa.201900429). Sequences corresponding to Orf9b N-terminal truncations of 0 to 62 residues were submitted to the TargetP-2.0 server, and the probability of the peptides containing an MTS plotted against the numbers of residues truncated. A similar analysis using the MitoFates server (Y. Fukasawa, et al., MitoFates: improved prediction of mitochondrial targeting sequences and their cleavage sites. Mol. Cell. Proteomics. 14, 1113-1126 (2015)) predicted that Orf9b residues 54-63 were the most likely to comprise a presequence MTS based on propensity to form a positively charged amphipathic helix. Notably this analysis was consistent with the secondary structure prediction from JPRED (A. Drozdetskiy, et al., JPred4: a protein secondary structure prediction server. Nucleic Acids Res. 43, W389-94 (2015)).

    [0414] CryoEM Sample Preparation and Data Collection

    [0415] 3 μL of Orf9b-Tom70 complex (12.5 μM) was added to a 400 mesh 1.2/1.3R Au Quantifoil grid previously glow discharged at 15 mA for 30 seconds. Blotting was performed with a blot force of 0 for 5 seconds at 4° C. and 100% humidity in a FEI Vitrobot Mark IV (ThermoFisher) prior to plunge freezing into liquid ethane. 1534 118-frame super-resolution movies were collected with a 3×3 image shift collection strategy at a nominal magnification of 105,000× (physical pixel size: 0.834 Å/pix) on a Titan Krios (ThermoFisher) equipped with a K3 camera and a Bioquantum energy filter (Gatan) set to a slit width of 20 eV. Collection dose rate was 8 e-/pixel/second for a total dose of 66 e-/A2. Defocus range was 0.7 um to 2.4 um. Each collection was performed with semi-automated scripts in SerialEM (D. N. Mastronarde, Automated electron microscope tomography using robust prediction of specimen movements. J Struct. Biol. 152, 36-51 (2005)).

    [0416] CryoEM Image Processing and Model Building

    [0417] 1534 movies were motion corrected using Motioncor2 (S. Q. Zheng, et al., MotionCor2: anisotropic correction of beam-induced motion for improved cryo-electron microscopy. Nat. Methods. 14, 331-332 (2017)) and dose-weighted summed micrographs were imported in cryosparc (v2.15.0). 1427 micrographs were curated based on CTF fit (better than 5 Å) from a patch CTF job. Template-based particle picking resulted in 2,805,121 particles and 1,616,691 particles were selected after 2D-classification. Five rounds of 3D-classification using multi-class ab-initio reconstruction and heterogenous refinement yielded 178,373 particles. Homogenous refinement of these final particles led to a 3.1 Å electron density map which was used for model building. The reconstruction was filtered by the masked FSC and sharpened with a b-factor of −145.

    [0418] To build the model of Tom70(109-end), the crystal structure of Saccharomyces cerevisiae Tom71 (PDB ID: 3fp3; sequence identity 25.7%) was first fit into the cryoEM density as a rigid body in UCSF ChimeraX and then relaxed into the final density using Rosetta FastRelax mover in torsion space. This model, along with a BLAST alignment of the two sequences (S. F. Altschul, et al., Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25, 3389-3402 (1997)), was used as a starting point for manual building using COOT (P. Emsley, K. Cowtan, Coot: model-building tools for molecular graphics. Acta Crystallogr. D Biol. Crystallogr. 60, 2126-2132 (2004)). After initial building by hand the regions with poor density fit/geometry were iteratively rebuilt using Rosetta (R. Y.-R. Wang, et al., Automated structure refinement of macromolecular assemblies from cryo-EM maps using Rosetta. Elife. 5 (2016), doi:10.7554/eLife.17219). Orf9b was built de novo into the final density using COOT, informed and facilitated by the predictions of the TargetP-2.0, MitoFates, and JPRED servers. The Orf9b-Tom70 complex model was submitted to the Namdinator web server (R. T. Kidmose, et al., Namdinator—automatic molecular dynamics flexible fitting of structural models into cryo-EM and crystallography experimental maps. IUCrJ. 6, 526-531 (2019)) and further refined in ISOLDE 1.0 (T. I. Croll, ISOLDE: a physically realistic environment for model building into low-resolution electron-density maps. Acta Crystallogr D Struct Biol. 74, 519-530 (2018)) using the plugin for UCSF ChimeraX (T. D. Goddard, et al., UCSF ChimeraX: Meeting modern challenges in visualization and analysis. Protein Sci. 27, 14-25 (2018)). Final model B-factors were estimated using Rosetta. The model was validated using phenix.validation_cryoem (P. V. Afonine, et al., New tools for the analysis and validation of cryo-EM maps and atomic models. Acta Crystallogr D Struct Biol. 74, 814-840 (2018)). The final model contains residues 109-272, 298-600 of human Tom70, and 39-76 of SARS-CoV-2 Orf9b. Molecular interface between Orf9b and Tom70 was analyzed using the PISA web server (E. Krissinel, K. Henrick, Inference of macromolecular assemblies from crystalline state. J. Mol. Biol. 372, 774-797 (2007)). Figures were prepared using UCSF ChimeraX.

    [0419] Computational Human Genetics Analysis

    [0420] To look for genetic variants associated with the list of proteins that had a significant impact on SARS-CoV-2 replication, the largest proteomic GWAS study to date was used (B. B. Sun, et al., Genomic atlas of the human plasma proteome. Nature. 558, 73-79 (2018)). IL17RA was identified as one of the proteins assayed in Sun et al.'s proteomic GWAS. It was observed that IL17RA had multiple cis-acting protein quantitative trait loci (pQTLs) at a corrected p-value 1×10.sup.−5, where cis-acting is defined as within 1 MB of the transcription start site of IL17RA.

    [0421] The GSMR method (Z. Zhu, et al., Causal associations between risk factors and common diseases inferred from GWAS summary data. Nat. Commun. 9, 224 (2018)) was used to perform MR using near-independent (linkage disequilibrium or LD r.sup.2=0.05) cis-pQTLs for IL17RA. The advantage of GSMR method over conventional MR methods is two-fold; first, GSMR performs MR adjusting for any residual correlation between selected genetic variants by default. Second, GSMR has a built-in method called HEIDI (heterogeneity in dependent instruments)-outlier that performs heterogeneity tests in the near-independent genetic instruments and remove potentially pleiotropic instruments (i.e., where there is evidence of heterogeneity at p<0.01). Details of the GSMR and HEIDI method have been published previously (Z. Zhu, et al., Causal associations between risk factors and common diseases inferred from GWAS summary data. Nat. Commun. 9, 224 (2018)).

    [0422] Summary statistics generated by COVID-19 Human Genetics Initiative (COVID-HGI) (round 3; https://www.covidl9hg.org/results/) for COVID-19 vs. population, hospitalized COVID-19 vs. population and hospitalized COVID-19 vs. non-hospitalized COVID-19 were used for IL17RA MR analysis. Te 1000 genomes phase 3 European population genotype data was used to derive the LD correlation matrix for this analysis. The phenotype definitions as provided by COVID-HGI are as follows. COVID-19 vs. population: Case, individuals with laboratory confirmation of SARS-CoV-2 infection, EHR/ICD coding/Physician-confirmed COVID-19, or self-reported COVID-19 positive; control, everybody that is not a case. Hospitalized COVID-19 vs. population: case, hospitalized, laboratory confirmed SARS-CoV-2 infection or hospitalization due to COVID-19-related symptoms; control, everybody that is not a case, e.g., population. Hospitalized COVID-19 vs. non-hospitalized COVID-19: case, hospitalized, laboratory confirmed SARS-CoV-2 infection or hospitalization due to COVID-19-related symptoms; control, laboratory confirmed SARS-CoV-2 infection and not hospitalized 21 days after the test.

    [0423] Infections and Treatments for IL17A Treatment Studies

    [0424] The WA-1 strain (BEI resources) of SARS-CoV-2 was used for all experiments. All live virus experiments were performed in a BSL3 lab. SARS-CoV-2 stocks were passaged in Vero E6 cells (ATCC) and titer was determined via plaque assay on Vero E6 cells as previously described (A. N. Honko, et al., Rapid Quantification and Neutralization Assays for Novel Coronavirus SARS-CoV-2 Using Avicel RC-591 Semi-Solid Overlay, doi:10.20944/preprints202005.0264.v1). Briefly, virus was diluted 1:10.sup.2-1:10.sup.6 and incubated for 1 hour on Vero E6 cells before an overlay of Avicel and complete DMEM (Sigma Aldrich, SLM-241) was added. After incubation at 37° C. for 72 hours, the overlay was removed and cells were fixed with 10% formalin, stained with crystal violet, and counted for plaque formation. SARS-CoV-2 infections of A549-ACE2 cells were done at a MOT of 0.05 for 24 hours. Inhibitors and cytokines were added concurrently with virus. All infections were done in technical triplicate. Cells were treated with the following compounds: Remdesivir (SELLECK CHEMICALS LLC, 58932) and IL-17A (Millipore-Sigma, SRP0675).

    [0425] RNA Extraction, RT, and Quantitative RT-PCR for IL17 Å Treatment Studies

    [0426] Total RNA from samples was extracted using the Direct-zol RNA kit (Zymogen, R2060) and quantified using the NanoDrop 2000c (ThermoFisher). cDNA was generated using 500 ng for infected A549-ACE2 cells with Superscript III reverse transcription (ThermoFisher, 18080-044) and oligo(dT).sub.12-18 (ThermoFisher, 18418-012) and random hexamer primers (ThermoFisher, S0142). Quantitative RT-PCR reactions were performed on a CFX384 (BioRad) and delta cycle threshold (ACt) was determined relative to RPL13 Å levels. Viral detection levels and target host genes in treated samples were normalized to water-treated controls. The SYBR green qPCR reactions contained 5 μl of 2× Maxima SYBR green/Rox qPCR Master Mix (ThermoFisher; K0221), 2 μl of diluted cDNA, and 1 nmol of both forward and reverse primers, in a total volume of 10 μl. The reactions were run as follows: 50° C. for 2 minutes and 95° C. for 10 minutes, followed by 40 cycles of 95° C. for 5 seconds and 62° C. for 30 seconds. Primer efficiencies were around 100%. Dissociation curve analysis after the end of the PCR confirmed the presence of a single and specific product. qRT-PCR primers were used against the SARS-CoV-2 E gene

    TABLE-US-00003 (PF_042_nCoV_E_F: ACAGGTACGTTAATAGTTAATAGCGT; PF_042_nCOV_E_R: ATATTGCAGCAGTACGCACACA), the CXCL8 gene (CXCL8 For: ACTGAGAGTGATTGAGAGTGGAC; CXCL8 Rev: AACCCTCTGCACCCAGTTTTC), and the RPL13A gene (RPL13A For: CCTGGAGGAGAAGAGGAAAGAGA; RPL13A Rev: TTGAGGACCTCTGTGTATTTGTCAA).

    [0427] Transfections for IL17A Treatment Studies

    [0428] HEK293T cells were seeded 5×10.sup.5 cells/well (in 6 well plate) or 3×10.sup.6 cell/10 cm.sup.2 plates. Next day, 2 μg or 10 μg of plasmids was transfected using X-tremeGENE 9 DNA Transfection Reagent (Roche) in 6 well plate or 10 cm.sup.2 plates respectively. For IL-17A (Millipore-Sigma, SRP0675) incubation in cells, 0.5 μg of IL-17A was treated either pre- or post-transfection and incubated at 37° C. After 48 hours, cells were collected by trypsinization. For IL-17A incubation with cell lysates, transfected cell lysates were incubated with presence of 0.5 and 5 μg/ml IL-17A at 4° C. on rotation overnight. Plasmids pLVX-EF1alpha-SARS-CoV-2-orf8-2×Strep-IRES-Puro (Orf8) and pLVX-EF1alpha-eGFP-2×Strep-IRES-Puro (EGFP-Strep) were a gift from Nevan Krogan. (Addgene plasmid #141390, 141395) (Gordon, et al. A SARS-CoV-2 protein interaction map reveals targets for drug repurposing. Nature (2020)). pLVX-EF1alpha-IRES-Puro (Vector) was obtained from Takara/Clontech.

    [0429] SARS-CoV-2 Orf8 and IL17RA Co-Immunoprecipitation

    [0430] Transfected and treated HEK293T cells were pelleted and washed in cold D-PBS and later resuspended in Flag-IP Buffer (50 mM Tris HCl, pH 7.4, with 150 mM NaCl, 1 mM EDTA, and 1% NP-40) with 1×HALT (ThermoFisher Scientific, 78429), incubated with buffer for 15 minutes on ice then centrifuged at 13,000 rpm for 5 minutes. The supernatant was collected and 1 mg of protein was used for Immunoprecipitation (IP) with 100 μl Streptactin Sepharose (IBA, 2-1201-010) on a rotor overnight at 4° C. Immunoprecipitates were washed 5 times with Flag-IP buffer and eluted with 1×Buffer E (100 mM Tris-Cl, 150 mM NaCl, 1 mM EDTA, 2.5 mM Desthiobiotin). Eluate was diluted with 1×-NuPAGE (ThermoFisher Scientific, #NP0008) LDS Sample Buffer with 2.5% β-Mercaptoethanol and blotted for targeted antibodies. Antibodies used were Strep Tag II (Qiagen, #34850), B-Actin (Sigma, #A5316), and IL17RA (Cell Signaling, #12661S).

    [0431] Computational Docking of mPGES-2 and Nsp7

    [0432] A model for human mPGES-2 dimer was constructed by homology using MODELER (A. Sali, T. L. Blundell, Comparative protein modelling by satisfaction of spatial restraints. J. Mol. Biol. 234, 779-815 (1993)) from the crystal structure of Macaca fascularis mPGES-2 (PDB 1Z9H (T. Yamada, et al., Crystal structure and possible catalytic mechanism of microsomal prostaglandin E synthase type 2 (mPGES-2). J. Mol. Biol. 348, 1163-1176 (2005)), 98% sequence identity) bound to indomethacin. Indomethacin was removed from the structure utilized for docking. The structure of SARS-CoV-2 Nsp7 was extracted from PDB 7BV2 (W. Yin, et al., Structural basis for inhibition of the RNA-dependent RNA polymerase from SARS-CoV-2 by remdesivir. Science. 368, 1499-1504 (2020)). Docking models were produced using ClusPro (D. Kozakov, et al., The ClusPro web server for protein-protein docking. Nat. Protoc. 12, 255-278 (2017)), Zdock (B. G. Pierce, et al., ZDOCK server: interactive docking prediction of protein-protein complexes and symmetric multimers. Bioinformatics. 30, 1771-1773 (2014)), Hdock (Y. Yan, et al., The HDOCK server for integrated protein-protein docking. Nat. Protoc. 15, 1829-1852 (2020)), Gramm-X (A. Tovchigrechko, I. A. Vakser, GRAMM-X public web server for protein-protein docking. Nucleic Acids Res. 34, W310-4 (2006)), SwarmDock (M. Torchala, I. H. Moal, R. A. G. Chaleil, J. Fernandez-Recio, P. A. Bates, SwarmDock: a server for flexible protein-protein docking. Bioinformatics. 29, 807-809 (2013)) and PatchDock (D. Schneidman-Duhovny, et al., PatchDock and SymmDock: servers for rigid and symmetric docking. Nucleic Acids Res. 33, W363-7 (2005)) with SOAP-PP score (G. Q. Dong, et al., Optimized atomic statistical potentials: assessment of protein interfaces and loops. Bioinformatics. 29, 3158-3166 (2013)). For each protocol, up to 100 top scoring models were extracted (fewer for those that do not report>100 models); for PatchDock, models with SOAP-PP Z-scores greater than 3.0 were used (FIG. 5A). The 420 models were clustered at 4.0 Å RMSD, resulting in 127 clusters. The two largest clusters, comprising 192 models, are related by the dimer symmetry. All other clusters contain fewer than 15 models.

    [0433] Referring to FIG. 5A, the structure of Nsp7 was docked against a homology model of the mPGES-2 dimer (yellow and pink) using a number of docking programs. The number of good scoring models produced by each docking protocol is shown.

    [0434] Referring to FIG. 5B, the combined localization density of all 420 good scoring models is shown.

    [0435] Referring to FIG. 5C, the top two clusters of solutions (cyan volume) are symmetry-related and localize to the lobe of mPGES-2 adjacent to the indomethacin binding site (red). Ribbon models of the top scoring models from PatchDock (left) and ZDock (right) represent the two distinct binding modes contained in this cluster of solutions.

    [0436] Assessment of Positive Selection Signatures in SIGMAR1

    [0437] SIGMAR1 protein alignments were generated from whole genome sequences of 359 mammals curated by the Zoonomia consortium. Protein alignments were generated with TOGA (https://github.com/hillerlab/TOGA), and missing sequence gaps were refined with CACTUS (J. Armstrong, et al., Progressive alignment with Cactus: a multiple-genome aligner for the thousand-genome era (2019), p. 730531; B. Paten, et al., Cactus: Algorithms for genome multiple sequence alignment. Genome Res. 21, 1512-1528 (2011)). Branches undergoing positive selection were detected with the branch-site test aBSREL (M. D. Smith, et al., Less Is More: An Adaptive Branch-Site Random Effects Model for Efficient Detection of Episodic Diversifying Selection. Mol. Biol. Evol. 32, 1342-1353 (2015)) implemented in the HyPhy package (M. D. Smith, et al., Less Is More: An Adaptive Branch-Site Random Effects Model for Efficient Detection of Episodic Diversifying Selection. Mol. Biol. Evol. 32, 1342-1353 (2015); S. L. K. Pond, et al., HyPhy: hypothesis testing using phylogenies. Bioinformatics. 21, 676-679 (2004)). PhyloP was used to detect codons undergoing accelerated evolution along branches detected as undergoing positive selection by aBSREL relative to the neutral evolution rate in mammals, determined using phyloFit on third nucleotide positions of codons which are assumed to evolve neutrally. P-values from phyloP were corrected for multiple tests using the Benjamini-Hochberg method (K. S. Pollard, et al., Detection of nonneutral substitution rates on mammalian phylogenies. Genome Res. 20, 110-121 (2010)). PhyloFit and phyloP are both part of the PHAST package v1.4 (M. J. Hubisz, et al., PHAST and RPHAST: phylogenetic analysis with space/time models. Brief Bioinform. 12, 41-51 (2011); R. Ramani, et al., PhastWeb: a web interface for evolutionary conservation scoring of multiple sequence alignments using phastCons and phyloP. Bioinformatics. 35, 2320-2322 (2019)).

    [0438] Comparative SARS-CoV-1 Inhibition by Amiodarone

    [0439] SARS-CoV-1 (Urbani) drug screens were performed with Vero E6 cells (ATCC #1568, Manassas, VA) cultured in DMEM (Quality Biological), supplemented with 10% (v/v) heat inactivated fetal bovine serum (Sigma), 1% (v/v) penicillin/streptomycin (Gemini Bio-products), and 1% (v/v) L-glutamine (2 mM final concentration, Gibco). Cells were plated in opaque 96 well plates one day prior to infection. Drugs were diluted from stock to 50 μM and an 8-point 1:2 dilution series prepared in duplicate in Vero Media. Every compound dilution and control was normalized to contain the same concentration of drug vehicle (e.g., DMSO). Cells were pre-treated with drug for 2 hours (h) at 37° C. (5% CO.sub.2) prior to infection with SARS-CoV-1 at MOI 0.01. In addition to plates that were infected, parallel plates were left uninfected to monitor cytotoxicity of drug alone. All plates were incubated at 37° C. (5% CO.sub.2) for 3 days before performing CellTiter-Glo (CTG) assays as per the manufacturer's instruction (Promega, Madison, WI). Luminescence was read on a BioTek Synergy HTX plate reader (BioTek Instruments Inc., Winooski, VT) using the Gen5 software (v7.07, Biotek Instruments Inc., Winooski, VT).

    [0440] Real-World Data Source and Analysis

    [0441] This study used de-identified patient-level records from HealthVerity's Marketplace dataset, a nationally representative dataset covering>300 million unique patients with medical and pharmacy records from over 60 healthcare data sources in the US. The current study used data from 738,933 patients with documented COVID-19 infection between Mar. 1, 2020 to Aug. 17, 2020, defined as a positive or presumptive positive viral lab test result or an International Classification of Diseases, 10.sup.th Revision, Clinical Modification (ICD-10-CM) diagnosis code of U07.1 (COVID-19).

    [0442] For this population, medical claims, pharmacy claims, laboratory data, and hospital chargemaster data containing diagnoses, procedures, medications, and COVID-19 laboratory results from both inpatient and outpatient settings were analyzed. Claims data included open (unadjudicated) claims sourced in near-real time from practice management and billing systems, claims clearinghouses and laboratory chains, as well as closed (adjudicated) claims encompassing all major US payer types (commercial, Medicare, Medicaid). For inpatient treatment evaluations, linked hospital chargemaster data containing records of all billable procedures, medical services, and treatments administered in hospital settings were used. Linkage of patient-level records across these data types provides a longitudinal view of baseline health status, medication use, and COVID-19 progression for each patient under study. Data for this study covered the period of Dec. 1, 2018 through Aug. 17, 2020. All analyses were conducted with the Aetion Evidence Platform version r4.6.

    [0443] This study was approved by the New England IRB (#1-9757-1). Medical records constitute protected health information and can be made available to qualified individuals upon reasonable request.

    [0444] Observation of Hospitalization Outcomes in Outpatient New Users of Indomethacin (Treatment Arm) Vs. Celecoxib (Active Comparator) Using Real-World Data

    [0445] An incident (new) user, active comparator design (W. A. Ray, Evaluating medication effects outside of clinical trials: new-user designs. Am. J. Epidemiol. 158, 915-920 (2003); S. Schneeweiss, A basic study design for expedited safety signal evaluation based on electronic healthcare data. Pharmacoepidemiol. Drug Saf 19, 858-868 (2010)) was used to assess the risk of hospitalization among newly diagnosed COVID-19 patients who were subsequently treated with indomethacin or the comparator agent, celecoxib. Patients were required to have COVID-19 infection recorded in an outpatient setting during the study period of Mar. 1, 2020 to Aug. 17, 2020 and occurring in the 21 days prior to (and including) the date of indomethacin or celecoxib treatment initiation. Prevalent users of prescription-only NSAIDs (any prescription fill for indomethacin, celecoxib, ketoprofen, meloxicam, sulindac, or piroxicam 60 days prior) and patients hospitalized in the 21 days prior to and including the date of treatment initiation were excluded from this analysis.

    [0446] Using RSS, patients treated with indomethacin were matched at a 1:1 ratio to controls randomly selected among patients treated with celecoxib, with direct matching on calendar date of treatment (±7 days), age (±5 years), sex, Charlson comorbidity index (exact) (H. Quan, et al., Coding algorithms for defining comorbidities in ICD-9-CM and ICD-10 administrative data. Med. Care. 43, 1130-1139 (2005)), time since confirmed COVID-19 (±5 days), and disease severity based on the highest-intensity COVID-19-related health service in the 7 days prior to and including the date of treatment initiation (lab service only vs. outpatient medical visit vs. emergency department visit) and symptom profile in the 21 days prior to and including the date of treatment initiation (recorded symptoms vs. none). This risk set sampled population was further matched on a propensity score (PS) (P. R. Rosenbaum, D. B. Rubin, The central role of the propensity score in observational studies for causal effects. Biometrika. 70, 41-55 (1983)) estimated using logistic regression with 24 demographic and clinical risk factors, including covariates related to baseline medical history and COVID-19 severity in the 21 days prior to treatment (see Table 7A-I). Balance between indomethacin and celecoxib treatment groups was evaluated by comparison of absolute standardized differences in covariates, with an absolute standardized difference of less than 0.2 indicating good balance between the treatment groups (P. C. Austin, Balance diagnostics for comparing the distribution of baseline covariates between treatment groups in propensity-score matched samples. Stat. Med. 28, 3083-3107 (2009)).

    [0447] The primary analysis was an intention-to-treat design, with follow-up beginning 1 day after indomethacin or celecoxib initiation and ending on the earliest occurrence of 30 days of follow-up reached or end of patient data. Odds ratios for the primary outcome of all-cause inpatient hospitalization were estimated for the RSS+PS matched population as well as for the RSS matched population. The primary outcome definition required a record of inpatient hospital admission with a resulting inpatient stay; as a sensitivity, a broader outcome definition captured any hospital visit (defined with revenue and place of service codes).

    TABLE-US-00004 TABLE 7A TABLE OF CONTENTS Table 3B-I Name Description Data dictionary Description of all column headings NSAID matching Matching criteria and cohort values for the comparison of new, outpatient users of indomethacin and celecoxib NSAID cohort Absolute standard differences balance of the propensity score risk factors for the RSS-only and RSS-and-PS-matched comparisons of new, outpatient users of indomethacin and celecoxib NSAID outcomes Outcomes of the comparisons of new, outpatient users of indomethacin and celecoxib. Computed by the Action Evidence Platform r4.6 AP matching Matching criteria and cohort values for the comparison of new, inpatient users of typical and atypical antipsychotics AP cohort balance Absolute standard differences of the propensity score risk factors for the RSS-only and RSS-and-PS-matched comparisons of new, inpatient users of typical and atypical antipsychotics AP outcomes Outcomes of the comparisons of new, inpatient users of typical and atypical antipsychotics. Computed by the Action Evidence Platform r4.6 Drug list table of drugs included in clinical comparisons

    TABLE-US-00005 TABLE 7B DATA DICTIONARY Column name Description Characteristic Demographic or clinical factor assessed in patients for matching Category Type of risk factor Time period assessed Time period assessed in records to determine value of indicated factor Used for RSS Boolean variable indicating the matching use of this characteristic in risk set sampling Criteria for RSS Description of matching requirements match Used for PS matching Boolean variable indicating the use of this characteristic in propensity score matching Criteria for PS match Description of data type used in propensity score matching Value and indicated For a given RSS-only matched distribution in RSS cohort of users of XXXX drug only XXXX cohort with number of members YYYY, (n = YYY) the number of patients in cohort with a positive identification for the listed risk factor. Where appropriate, distribution as described in the characteristic column is included as well. Value and indicated For a given RSS-and-PS matched distribution in RSS cohort of users of XXXX and PS XXXX cohort drug with number of members (n = YYYY) YYYY, the number of patients in cohort with a positive identification for the listed risk factor. Where appropriate, distribution as described in the characteristic column is included as well. Absolute Standard For the indicated variable, the Difference (RSS absolute standard difference only) between the experimental and comparator groups of the RSS- only cohort. Absolute standard difference is defined here: https://doi.org/10.1002/sim.3697 Absolute Standard For the indicated variable, the Difference (RSS and absolute standard difference PS matched) between the experimental and comparator groups of the RSS- and-PS-matched cohort. Absolute standard difference is defined here: https://doi.org/10.1002/sim.3697 RSS only XXXX In results section these headings cohort indicate the value of a given variable for the RSS-only cohort defined by use of drug XXXX RSS and PS XXXX In results section these headings cohort indicate the value of a given variable for the RSS-and-PS-matched cohort defined by use of drug XXXX

    TABLE-US-00006 TABLE 7C NSAID MATCHING Value and Value and Value and Value and indicated indicated indicated indicated distribution distribution distribution distribution in RSS in RSS in RSS in RSS only only and PS and PS Time Used for Used for Criteria indomethacin celecoxib indomethacin celecoxib period RSS Criteria for PS for PS cohort cohort cohort cohort Characteristic Category assessed matching RSS match matching match (n = 153) (n = 153) (n = 103) (n = 103) Month of Demographic Date of Yes Direct (1:1) treatment treatment matching on initiation initiation calendar date of treatment initiation, +/−7 days . . . March/ Demographic Date of — — — — 58 (37.9%) 58 (37.9%) 34 (33.0%) 34 (33.0%) April 2020 treatment initiation . . . May Demographic Date of — — — — 50 (32.7%) 51 (33.3%) 35 (34.0%) 34 (33.0%) 2020 treatment initiation . . . June Demographic Date of — — — — 22 (14.4%) 21 (13.7%) 17 (16.5%) 16 (15.5%) 2020 treatment initiation . . . July/ Demographic Date of — — — — 23 (15.0%) 23 (15.0%) 17 (16.5%) 19 (18.4%) August treatment 2020 initiation Age Demographic Date of Yes Direct (1:1) Yes Age as treatment matching on continuous initiation age, +/−5 numeric years variable . . . mean Demographic Date of — — — — 52.88 (11.65) 53.24 (12.07) 53.74 (11.89) 52.95 (12.72) (sd) treatment initiation . . . median Demographic Date of — — — — 54 [46, 61] 54 [46.50, 62] 54 [47, 61] 55 [46, 63] [IQR] treatment initiation Gender Demographic Date of Yes Direct (1:1) Yes Categorical treatment matching on initiation gender . . . Female Demographic Date of — — — — 65 (42.5%) 65 (42.5%) 41 (39.8%) 50 (48.5%) treatment initiation . . . Male Demographic Date of — — — — 88 (57.5%) 88 (57.5%) 62 (60.2%) 53 (51.5%) treatment initiation U.S. Demographic Date of No — Yes Categorical Region treatment initiation . . . Northeast Demographic Date of — — — — 68 (44.4%) 74 (48.4%) 46 (44.7%) 48 (46.6%) treatment initiation . . . Midwest/ Demographic Date of — — — — 43 (28.1%) 40 (26.1%) 29 (28.2%) 27 (26.2%) West treatment initiation . . . South Demographic Date of — — — — 42 (27.5%) 39 (25.5%) 28 (27.2%) 28 (27.2%) treatment initiation No. of Baseline 90 days No Yes Continuous medical health prior to numeric encounters resource date of variable utilization confirmed COVID19 . . . mean Baseline 90 days — — — — 4.78 (4.63) 6.88 (9.02) 4.71 (4.78) 4.71 (4.35) (sd) health prior to resource date of utilization confirmed COVID19 . . . median Baseline 90 days — — — — 3 [2, 6] 4 [2, 8] 3 [1, 6] 3 [2, 6] [IQR] health prior to resource date of utilization confirmed COVID19 No. of Baseline 90 days No Yes Continuous pharmacy health prior to numeric claims resource date of variable utilization confirmed COVID19 . . . mean Baseline 90 days — — — — 5.97 (5.04) 6.92 (5.41) 6.25 (5.47) 6.25 (4.82) (sd) health prior to resource date of utilization confirmed COVID19 . . . median Baseline 90 days — — — — 5 [3, 7.50] 6 [3, 9] 5 [3, 8] 5 [3, 8] [IQR] health prior to resource date of utilization confirmed COVID19 No. of Baseline 90 days No Yes Continuous unique health prior to numeric medications resource date of variable dispensed utilization confirmed COVID19 . . . mean Baseline 90 days — — — — 8.02 (5.51) 7.81 (4.64) 7.27 (4.81) 7.40 (4.54) (sd) health prior to resource date of utilization confirmed COVID19 . . . median Baseline 90 days — — — — 7 [4, 11] 7 [4.50, 10] 7 [3, 10] 6 [4, 9] [IQR] health prior to resource date of utilization confirmed COVID19 Charlson Baseline 90 days Yes Direct (1:1) Yes Continuous comorbidity comorbidities prior to matching on numeric index and date of Charlson variable comedications confirmed comorbidity COVID19 score in 90 days prior, categorized (0-1, 2-3, 4-5, 6+). . . . mean Baseline 90 days — — — — 0.36 (0.82) 0.43 (0.81) 0.38 (0.90) 0.32 (0.56) (sd) comorbidities prior to and date of comedications confirmed COVID19 . . . median Baseline 90 days — — — — 0 [0, 1] 0 [0, 1] 0 [0, 1] 0 [0, 1] [IQR] comorbidities prior to and date of comedications confirmed COVID19 Chronic Baseline 90 days No — Yes Dichotomous 18 (11.8%) 19 (12.4%) 11 (10.7%) 12 (11.7%) pulmonary comorbidities prior to disease and date of comedications confirmed COVID19 Cardiovascular Baseline 90 days No — Yes Dichotomous 45 (29.4%) 53 (34.6%) 32 (31.1%) 29 (28.2%) disease comorbidities prior to and date of comedications confirmed COVID19 . . . Arrhythmia Baseline 90 days No — Yes Dichotomous 11 (7.2%) 16 (10.5%) 10 (9.7%) 10 (9.7%) comorbidities prior to and date of comedications confirmed COVID19 . . . Hyper- Baseline 90 days No — Yes Dichotomous 63 (41.2%) 76 (49.7%) 45 (43.7%) 44 (42.7%) ension comorbidities prior to and date of comedications confirmed COVID19 Diabetes Baseline 90 days No — Yes Dichotomous 24 (15.7%) 28 (18.3%) 17 (16.5%) 17 (16.5%) comorbidities prior to and date of comedications confirmed COVID19 Immuno- Baseline 90 days No — Yes Dichotomous 35 (22.9%) 28 (18.3%) 20 (19.4%) 19 (18.4%) suppressive comorbidities prior to condition and date of comedications confirmed COVID19 Any Baseline 90 days No — Yes Dichotomous 8 (5.2%) 6 (3.9%) 4 (3.9%) 3 (2.9%) respiratory comorbidities prior to support and date of or comedications confirmed supplemental COVID19 oxygen use Tobacco Baseline 90 days No — Yes Dichotomous 7 (4.6%) 17 (11.1%) 6 (5.8%) 5 (4.9%) use comorbidities prior to recorded and date of comedications confirmed COVID19 Kidney Baseline 90 days No — Yes Dichotomous 5 (3.3%) 4 (2.6%) 4 (3.9%) 2 (1.9%) or liver comorbidities prior to disease and date of comedications confirmed COVID19 Overweight Baseline 90 days No — Yes Dichotomous 27 (17.6%) 38 (24.8%) 17 (16.5%) 19 (18.4%) or obese comorbidities prior to and date of comedications confirmed COVID19 Use of Baseline 90 days No — Yes Dichotomous 10 (6.5%) 11 (7.2%) 3 (2.9%) 7 (6.8%) any comorbidities prior to antithrombotic and date of therapy comedications confirmed COVID19 Use of Baseline 90 days No — Yes Dichotomous 37 (24.2%) 47 (30.7%) 31 (30.1%) 27 (26.2%) statin comorbidities prior to medication and date of comedications confirmed COVID19 Use of Baseline 90 days No — Yes Dichotomous 39 (25.5%) 46 (30.1%) 29 (28.2%) 26 (25.2%) any comorbidities prior to steroid and date of medication comedications confirmed COVID19 Symptom COVID19 21 days Yes Direct (1:1) Yes Dichotomous, 32 (20.9%) 34 (22.2%) 20 (19.4%) 20 (19.4%) profile, severity and prior to matching on moderate moderate utilization treatment symptom to severe to severe initiation profile in 21 COVID- symptoms (inclusive) days pre- 19 signs or treatment, symptoms symptomatic VS asymptomatic. Note this RSS matching criteria uses a broader set of all possible signs and symptoms, whereas the PS inputs and results shown in columns H- K use a narrower definition. Time COVID19 Date of Yes Direct (1:1) Yes Continuous from severity and confirmed matching on numeric documented utilization COVID19 time from variable COVID19 to date documented to drug of COVID19 initiation, treatment infection to no. days initiation treatment (inclusive) initiation, +/− 5 days . . . mean COVID19 Date of — — — — 9.61 (7.01) 9.75 (6.94) 8.99 (7.06) 9.73 (7.06) (sd) severity and confirmed utilization COVID19 to date of treatment initiation (inclusive) . . . median COVID19 Date of — — — — 8 [3.50, 15.50] 9 [4, 15] 7 [2, 15] 8 [4, 15] [IQR] severity and confirmed utilization COVID19 to date of treatment initiation (inclusive) Any COVID19 21 days No — Yes Dichotomous 39 (25.5%) 40 (26.1%) 23 (22.3%) 23 (22.3%) emergency severity and prior to department or utilization treatment hospital initiation interaction (inclusive) COVID19 COVID19 7 days Yes Direct (1:1) No — — — — — health severity and prior to matching on resource utilization treatment highest utilization initiation recorded (inclusive) health resource utilization in the 7 days prior (inclusive), categorized (laboratory only, outpatient medical visit, emergency department or hospital encounter)

    TABLE-US-00007 TABLE 7D NSAID COHORT BALANCE Absolute Absolute Standard Standard Difference Difference (RSS (RSS and Variable only) PS matched) Month of treatment initiation 0.021 0.055 Age 0.030 0.064 Gender 0.000 0.177 U.S. Region 0.079 0.047 No. of medical encounters 0.294 0.000 No. of pharmacy claims 0.180 0.000 No. of unique medications dispensed 0.041 0.027 Charlson comorbidity index 0.088 0.078 Chronic pulmonary disease 0.020 0.031 Cardiovascular disease (any) 0.112 0.064 . . . Arrhythmia 0.115 0.000 . . . Hypertension 0.171 0.020 Diabetes 0.070 0.000 Immunosuppressive condition 0.113 0.025 Any respiratory support or 0.063 0.054 supplemental oxygen use Positive tobacco user 0.245 0.043 Kidney or liver disease 0.039 0.116 Overweight or obese 0.176 0.051 Use of any antithrombotic therapy 0.026 0.181 Use of statin medication 0.147 0.086 Use of any steroid medication 0.102 0.066 Moderate to severe COVID-19 0.032 0.000 signs or symptoms Time from documented COVID19 0.019 0.105 to drug initiation, no. days Any emergency department or hospital 0.015 0.000 interaction, 21 days prior Average standardized absolute 0.092 0.054 mean difference

    TABLE-US-00008 TABLE 7E NSAID OUTCOMES RSS RSS only RSS and PS RSS indo- only indo- and PS methacin celecoxib methacin celecoxib Cohort cohort cohort cohort cohort Treatment indo- celecoxib indo- celecoxib methacin methacin Treatment classification Experi- Referent Experi- Referent mental mental Matching criteria RSS RSS RSS RSS only only and PS and PS Number of patients 153 153 103 103 Number of confirmed 1 7 1 3 inpatient stays Risk of confirmed 6.54 45.75 9.71 29.13 inpatient stays per 1000 patients Risk ratio vs referent 0.14 NA 0.33 NA of confirmed inpatient stay 95% confidence 0.02 NA 0.04, 3.15 NA interval of risk ratio vs referent of confirmed outpatient stay, lower bound 95% confidence 1.15 NA 0.04, 3.15 NA interval of risk ratio vs referent of confirmed outpatient stay, upper bound Odds ratio of confirmed 0.14 NA 0.33 NA inpatient stay (0.04, versus referent 3.15) 95% confidence 0.02 NA 0.04 NA interval of odds ratio of confirmed inpatient stay versus referent, lower bound 95% confidence 1.13 NA 3.15 NA interval of odds ratio of confirmed inpatient stay versus referent, upper bound p-value of odds 0.065 NA 0.336 NA ratio of confirmed inpatient stay versus referent Number of patients 4 15 3 7 with any hospital visit Risk of any hospital 26.14 98.04 29.13 67.96 visit per 1000 patients Risk ratio vs referent 0.27 NA 0.43 NA of any hospital visit 95% confidence 0.09 NA 0.11 NA interval of risk ratio vs referent of any hospital visit, lower bound 95% confidence 0.79 NA 1.61 NA interval of risk ratio vs referent of any hospital visit, upper bound Odds ratio of any 0.25 NA 0.41 NA hospital visit versus referent 95% confidence 0.08 NA 0.1 NA interval of odds ratio of any hospital visit versus referent, lower bound 95% confidence 0.76 NA 1.64 NA interval of odds ratio of any hospital visit versus referent, upper bound p-value of odds ratio of any 0.015 NA 0.208 NA hospital visit versus referent

    TABLE-US-00009 TABLE 7F AP MATCHING Value and Value and Value and Value and indicated indicated indicated indicated distribution distribution distribution distribution in RSS only in RSS only in RSS and in RSS and Used Used Criteria typical atypical PS typical PS atypical Time period for RSS for PS for PS AP cohort AP cohort AP cohort AP cohort Characteristic Category assessed matching Criteria for RSS match matching match (n = 265) (n = 265) (n = 186) (n = 186) Month of Demographic Date of treatment Yes Direct (1:1) matching on calendar date Yes Categorical treatment initiation of treatment initiation, +/−7 days initiation . . . March/April 2020 Demographic Date of treatment — — — — 124 (46.8%) 126 (47.5%) 77 (41.4%) 80 (43.0%) initiation . . . May 2020 Demographic Date of treatment — — — — 68 (25.7%) 67 (25.3%) 47 (25.3%) 50 (26.9%) initiation . . . June 2020 Demographic Date of treatment — — — — 26 (9.8%) 26 (9.8%) 22 (11.8%) 22 (11.8%) initiation . . . July/Aug 2020 Demographic Date of treatment — — — — 47 (17.7%) 46 (17.4%) 40 (21.5%) 34 (18.3%) initiation Age Demographic Date of treatment Yes Direct (1:1) matching on age, +/−5 Yes Age as initiation years continuous numeric variable . . . mean (sd) Demographic Date of treatment — — — — 69.93 (17.50) 69.83 (17.36) 68.83 (18.33) 69.19 (17.99) initiation . . . median [IQR] Demographic Date of treatment — — — — 72 [61, 82] 71 [62, 82] 71 [60, 81.25] 70 [61.75, 82] initiation Gender Demographic Date of treatment Yes Direct (1:1) matching on gender Yes Categorical initiation . . . Female Demographic Date of treatment — — — — 106 (40.0%) 106 (40.0%) 69 (37.1%) 69 (37.1%) initiation . . . Male Demographic Date of treatment — — — — 159 (60.0%) 159 (60.0%) 117 (62.9%) 117 (62.9%) initiation U.S. Region Demographic Date of treatment No — Yes Categorical initiation . . . Northeast Demographic Date of treatment — — — — 134 (50.6%) 116 (43.8%) 83 (44.6%) 83 (44.6%) initiation . . . Midwest/West Demographic Date of treatment — — — — 54 (20.4%) 75 (28.3%) 48 (25.8%) 47 (25.3%) initiation . . . South Demographic Date of treatment — — — — 77 (29.1%) 74 (27.9%) 55 (29.6%) 56 (30.1%) initiation No. of medical Baseline 90 days prior to No — Yes Continuous encounters health hospitalization, not numeric resource including date of variable utilization hospitalization . . . mean (sd) Baseline 90 days prior to — — — — 14.17 (21.51) 16.08 (23.75) 15.90 (22.57) 13.19 (20.39) health hospitalization, not resource including date of utilization hospitalization . . . median [IQR] Baseline 90 days prior to — — — — 4 [1, 19] 6 [2, 19] 5 [1,21] 5 [1, 16] health hospitalization, not resource including date of utilization hospitalization No. of unique Baseline 90 days prior to No — Yes Continuous medications health hospitalization, not numeric dispensed resource including date of variable utilization hospitalization . . . mean (sd) Baseline 90 days prior to — — — — 3.80 (5.21) 2.63 (4.39) 3.37 (4.74) 3.06 (4.77) health hospitalization, not resource including date of utilization hospitalization . . . median [IQR] Baseline 90 days prior to — — — — 1 [0, 7] 0 [0, 4] 1 [0, 6] 0 [0, 5] health hospitalization, not resource including date of utilization hospitalization Charlson Baseline 90 days prior to Yes Direct (1:1) matching on Charlson Yes Continuous comorbidity comorbidities hospitalization, not comorbidity score in 90 days prior, numeric index and including date of categorized (0-1, 2-3, 4-5, 6+). variable comedications hospitalization . . . mean (sd) Baseline 90 days prior to — — — — 1.76 (2.40) 1.70 (2.19) 1.80 (2.39) 1.48 (2.09) comorbidities hospitalization, not and including date of comedications hospitalization . . . median [IQR] Baseline 90 days prior to — — — — 1 [0, 3] 1 [0, 3] 1 [0, 3] 1 [0, 2] comorbidities hospitalization, not and including date of comedications hospitalization Cancer Baseline 90 days prior to No — Yes Dichotomous 14 (5.3%) 15 (5.7%) 11 (5.9%) 10 (5.4%) comorbidities hospitalization, not and including date of comedications hospitalization Chronic Baseline 90 days prior to No — Yes Dichotomous 39 (14.7%) 57 (21.5%) 32 (17.2%) 31 (16.7%) pulmonary comorbidities hospitalization, not disease and including date of comedications hospitalization Cardiovascular Baseline 90 days prior to No — Yes Dichotomous 145 (54.7%) 133 (50.2%) 99 (53.2%) 91 (48.9%) disease (any) comorbidities hospitalization, not and including date of comedications hospitalization . . . Arrhythmia Baseline 90 days prior to No — Yes Dichotomous 60 (22.6%) 49 (18.5%) 43 (23.1%) 36 (19.4%) comorbidities hospitalization, not and including date of comedications hospitalization . . . Hypertension Baseline 90 days prior to No — Yes Dichotomous 153 (57.7%) 137 (51.7%) 104 (55.9%) 100 (53.8%) comorbidities hospitalization, not and including date of comedications hospitalization Dementia Baseline 90 days prior to No — Yes Dichotomous 60 (22.6%) 62 (23.4%) 40 (21.5%) 34 (18.3%) comorbidities hospitalization, not and including date of comedications hospitalization Diabetes Baseline 90 days prior to No — Yes Dichotomous 68 (25.7%) 66 (24.9%) 47 (25.3%) 39 (21.0%) comorbidities hospitalization, not and including date of comedications hospitalization Tobacco use Baseline 90 days prior to No — Yes Dichotomous 37 (14.0%) 37 (14.0%) 26 (14.0%) 25 (13.4%) recorded comorbidities hospitalization, not and including date of comedications hospitalization Kidney or liver Baseline 90 days prior to No — Yes Dichotomous 58 (21.9%) 54 (20.4%) 44 (23.7%) 37 (19.9%) disease comorbidities hospitalization, not and including date of comedications hospitalization Immunosuppressive Baseline 90 days prior to No — Yes Dichotomous 38 (14.3%) 36 (13.6%) 30 (16.1%) 23 (12.4%) condition comorbidities hospitalization, not and including date of comedications hospitalization Overweight or Baseline 90 days prior to No — Yes Dichotomous 30 (11.3%) 25 (9.4%) 21 (11.3%) 20 (10.8%) obese comorbidities hospitalization, not and including date of comedications hospitalization Use of any Baseline 90 days prior to No — Yes Dichotomous 186 (70.2%) 204 (77.0%) 141 (75.8%) 139 (74.7%) antithrombotic comorbidities hospitalization to therapy* and date of treatment comedications initiation (includes both pre-admission and in-hospital, pre-treatment periods). Use of statin Baseline 90 days prior to No — Yes Dichotomous 63 (23.8%) 38 (14.3%) 35 (18.8%) 33 (17.7%) medication comorbidities hospitalization, not and including date of comedications hospitalization Use of any Baseline 90 days prior to No — Yes Dichotomous 60 (22.6%) 66 (24.9%) 47 (25.3%) 49 (26.3%) steroid comorbidities hospitalization to medication* and date of treatment comedications initiation (includes both pre-admission and in-hospital, pre-treatment periods). Moderate-to- Pre- 21 days prior to No — Yes Dichotomous 139 (52.5%) 135 (50.9%) 96 (51.6%) 93 (50.0%) severe COVID-19 admission hospitalization signs/symptoms COVID-19 recorded pre- onset and admission utilization (inclusive) Any emergency Pre- 21 days prior to No — Yes Dichotomous 93 (35.1%) 96 (36.2%) 68 (36.6%) 66 (35.5%) department or admission hospitalization inpatient COVID-19 encounter in pre- onset and admission period utilization (exclusive) Use of any Pre- 21 days prior to No — Yes Dichotomous 27 (10.2%) 36 (13.6%) 19 (10.2%) 25 (13.4%) experimental admission hospitalization to COVID-19 COVID-19 date of treatment therapy (HCQ, onset and initiation (includes Remdesivir, IL- utilization both pre-admission 6/23, etc) in pre- and in-hospital, admission or pre- pre-treatment treatment periods). periods* Urban hospital Hospital days 0-1 of No — Yes Dichotomous 227 (85.7%) 249 (94.0%) 172 (92.5%) 173 (93.0%) setting facility & hospitalization admitting characteristics Teaching Hospital days 0-1 of No — Yes Dichotomous 158 (59.6%) 143 (54.0%) 103 (55.4%) 109 (58.6%) hospital facility & hospitalization admitting characteristics Hospital with Hospital days 0-1 of No — Yes Dichotomous 180 (67.9%) 145 (54.7%) 112 (60.2%) 116 (62.4%) 300+ beds facility & hospitalization admitting characteristics Transfer from Hospital days 0-1 of No — Yes Dichotomous 48 (18.1%) 47 (17.7%) 33 (17.7%) 32 (17.2%) SNF/hospital facility & hospitalization admitting characteristics Emergency Hospital days 0-1 of No — Yes Dichotomous 179 (67.5%) 179 (67.5%) 127 (68.3%) 131 (70.4%) department or facility & hospitalization ambulance admitting encounter on day characteristics of admission Emergency or Hospital days 0-1 of No — Yes Dichotomous 220 (83.0%) 217 (81.9%) 153 (82.3%) 152 (81.7%) trauma admitting facility & hospitalization type admitting characteristics Admitting Hospital days 0-1 of No — Yes Dichotomous 32 (12.1%) 28 (10.6%) 21 (11.3%) 22 (11.8%) diagnosis for facility & hospitalization delirium or other admitting altered mental characteristics status No. of days since Pre- hospital admission Yes Direct (1:1) matching on time from Yes Continuous hospital treatment date to the date of documented COVID 19 infection to numeric admission characteristics treatment initiation treatment initiation, no. days variable categories (0-1, 2-3, 4-5, 6-9, 10-14, 15-19, 20+) . . . mean (sd) Pre- hospital admission — — — — 3.07 (1.86) 3.19 (1.81) 3.09 (1.91) 3.14 (1.73) treatment date to the date of characteristics treatment initiation . . . median [IQR] Pre- hospital admission — — — — 2 [2, 3] 3 [2, 3] 2 [2, 3] 3 [2, 3] treatment date to the date of characteristics treatment initiation Use of any Pre- hospital admission No — Yes Dichotomous 157 (59.2%) 173 (65.3%) 119 (64.0%) 124 (66.7%) antibiotic treatment date to the date of characteristics treatment initiation On supplemental Pre- hospital admission Yes Direct (1:1) matching on highest level Yes Dichotomous, 20 (7.5%) 19 (7.2%) 11 (5.9%) 18 (9.7%) oxygen at treatment date to the date of of respiratory support in 2 days pre- oxygen treatment characteristics treatment initiation treatment (inclusive), no oxygen vs status at supplementary oxygen. Note this RSS treatment matching criteria uses a 2 day index date lookback window, whereas the PS inputs and results shown in columns H-K assess oxygen status on the treatment index date only. In ICU at Pre- hospital admission No — Yes Dichotomous 54 (20.4%) 60 (22.6%) 38 (20.4%) 42 (22.6%) treatment treatment date to the date of characteristics treatment initiation No. unique Pre- hospital admission No — Yes Continuous department codes treatment date to the date of numeric observed characteristics treatment initiation variable . . . mean (sd) Pre- hospital admission — — — — 12.46 (4.92) 12.93 (4.95) 12.43 (5.10) 12.73 (4.96) treatment date to the date of characteristics treatment initiation . . . median [IQR] Pre- hospital admission — — — — 12 [9, 15.50] 13 [9, 16] 12 [9, 16] 12.50 [9, 16] treatment date to the date of characteristics treatment initiation

    TABLE-US-00010 TABLE 7G AP COHORT BALANCE Absolute Absolute Standard Standard Difference Difference (RSS (RSS and PS Variable only) matched) Month of treatment initiation 0.016 0.083 Age 0.006 0.020 Gender 0.000 0.000 U.S. Region 0.191 0.014 No. of medical encounters 0.084 0.126 No. of unique medications dispensed 0.244 0.064 Charlson Comorbidity Index 0.026 0.141 Cancer 0.017 0.023 Chronic pulmonary disease 0.177 0.014 Cardiovascular disease (any) 0.091 0.086 Arrhythmia 0.103 0.092 Hypertension 0.122 0.043 Dementia 0.018 0.081 Diabetes 0.017 0.102 Tobacco use recorded 0.000 0.016 Kidney or liver disease 0.037 0.091 Immunosuppressive condition 0.022 0.108 Overweight or obese 0.062 0.017 Use of any antithrombotic therapy (anticoags, 0.155 0.025 antiplatelets, antifibrinolytics) Use of statin medication 0.242 0.028 Use of any steroid medication 0.053 0.025 Moderate-to-severe COVID-19 signs/symptoms 0.030 0.032 recorded pre-admission (inclusive) Any emergency department or inpatient 0.024 0.022 encounter in pre-admission period (exclusive) Use of any experimental COVID-19 therapy 0.105 0.100 (HCQ, Remdesivir, IL-6/23, etc) in pre- admission or pre-treatment periods* Urban hospital setting 0.277 0.021 Teaching hospital 0.114 0.065 Hospital with 300+ beds 0.274 0.044 Transfer from SNF or hospital 0.010 0.014 Emergency department or ambulance encounter 0.000 0.047 on day of admission Emergency or trauma admitting type 0.030 0.014 Admitting diagnosis for delirium or other altered 0.048 0.017 mental status No. of days since hospital admission 0.064 0.027 Use of any antibiotic in-hospital 0.125 0.057 Supplemental oxygen use at treatment 0.014 0.141 In ICU at treatment 0.055 0.052 No. unique department codes observed in- 0.095 0.060 hospital Average standardized absolute mean difference 0.082 0.053

    TABLE-US-00011 TABLE 7H AP OUTCOMES RSS only RSS only RSS and PS RSS and PS typical atypical typical atypical anti- anti- anti- anti- psychotic psychotic psychotic psychotic Cohort cohort cohort cohort cohort Treatment typical atypical typical atypical anti- anti- anti- anti- psychotic psychotic psychotic psychotic Treatment Experi- Referent Experi- Referent classification mental mental Matching criteria RSS only RSS only RSS and PS RSS and PS Number of patients 265 265 186 186 Number of 19 32 13 26 patients requiring mechanical ventilation Risk of 71.7 120.75 69.89 139.78 mechanical ventilation per 1000 patients Risk ratio vs 0.59 Referent 0.5 Referent referent of mechanical ventilation 95% confidence 0.35 Referent 0.27 Referent interval of risk ratio vs referent of mechanical ventilation, lower bound 95% confidence 1.02 Referent 0.94 Referent interval of risk ratio vs referent of mechanical ventilation, upper bound Odds ratio 0.56 Referent 0.46 Referent of mechanical ventilation versus referent 95% confidence i 0.31 Referent 0.23 Referent nterval of odds ratio of mechanical ventilation versus referent, lower bound 95% confidence 1.02 Referent 0.93 Referent interval of odds ratio of mechanical ventilation versus referent, upper bound p-value of 0.058 Referent 0.031 Referent odds ratio of mechanical ventilation versus referent

    TABLE-US-00012 TABLE 7I DRUG LIST Experimental or Drug Comparison Class Comparator Notes Indomethacin NSAIDS NSAID experimental celecoxib NSAIDS NSAID comparator haloperidol antipsychotics typical experimental chlorpromazine antipsychotics typical experimental fluphenazine antipsychotics typical experimental aripiprazole antipsychotics atypical comparator olanzapine antipsychotics atypical comparator quetiapine antipsychotics atypical comparator risperidone antipsychotics atypical comparator brexpiprazole antipsychotics atypical comparator paliperidone antipsychotics atypical comparator

    [0448] Observation of Mechanical Ventilation Outcomes in Inpatient New Users of Typical Antipsychotics (Treatment Arm) Vs. Atypical Antipsychotics (Active Comparator) Using Real-World Data

    [0449] An incident user, active comparator design (W. A. Ray, Evaluating medication effects outside of clinical trials: new-user designs. Am. J Epidemiol. 158, 915-920 (2003); S. Schneeweiss, A basic study design for expedited safety signal evaluation based on electronic healthcare data. Pharmacoepidemiol. Drug Saf 19, 858-868 (2010)) was used to assess the risk of mechanical ventilation among hospitalized COVID-19 patients treated with typical or atypical antipsychotics in an inpatient setting. See Table 7A-I for a list of drugs included in each category. To permit assessment of day-level in-hospital confounders and outcomes, this analysis was restricted to hospitalized patients observable in hospital chargemaster data. Prevalent users of typical or atypical antipsychotics (any prescription fill or chargemaster-documented use in 60 days prior) and patients with evidence of mechanical ventilation in the 21 days prior to and including the date of treatment initiation were excluded from this analysis.

    [0450] Using RSS, hospitalized patients treated with typical antipsychotics were matched at a 1:1 ratio to controls randomly selected among patients treated with atypical antipsychotics, with direct matching (1:1 fixed ratio) on calendar date of treatment (±7 days), age (±5 years), sex, Charlson comorbidity index (exact) (H. Quan, et al., Coding algorithms for defining comorbidities in ICD-9-CM and ICD-10 administrative data. Med. Care. 43, 1130-1139 (2005)), time since hospital admission, and disease severity as defined with a simplified version of the World Health Organization's ordinal scale for clinical improvement (WHO R&D Blueprint novel Coronavirus: COVID-19 Therapeutic Trial Synopsis. World Health Organization, 2020, (available at https://www.who.int/blueprint/priority-diseases/key-action/COVID-19_Treatment_Trial_Design_Master_Protocol_synopsis_Final_18022020.pdf)). This risk set sampled population was further matched on a PS estimated using logistic regression with 36 demographic and clinical risk factors, including covariates related to baseline medical history, admitting status, and disease severity at treatment. Balance between typical and atypical treatment groups was evaluated by comparison of absolute standardized differences in covariates, with an absolute standardized difference of less than 0.2 indicating good balance between the treatment groups (P. C. Austin, Balance diagnostics for comparing the distribution of baseline covariates between treatment groups in propensity-score matched samples. Stat. Med. 28, 3083-3107 (2009)).

    [0451] The primary analysis was an intention-to-treat design, with follow-up beginning 1 day after the date of typical or atypical antipsychotic treatment initiation, and ending on the earliest occurrence of 30 days of follow-up reached, discharge from hospital, or end of patient data. Odds ratios for the primary outcome of inpatient mechanical ventilation were estimated for the RSS+PS matched population as well as for the RSS matched population.

    Results

    [0452] Conserved Coronavirus Proteins Often Retain the Same Cellular Localization

    [0453] As protein localization can provide important information regarding function, the cellular localization of individually expressed coronavirus proteins was assessed, in addition to mapping their interactions (FIG. 6A) Immunofluorescence localization analysis of all 2×Strep-tagged SARS-CoV-2, SARS-CoV-1, and MERS-CoV proteins highlights similar patterns of localization for the vast majority of shared protein homologs in HelaM cells (FIG. 6B). This supports the hypothesis that conserved proteins share functional similarities. A notable exception is Nsp13, which appears to localize to the cytoplasm for SARS-CoV-2 and SARS-CoV-1; however, MERS-CoV Nsp13 appears to localize to the mitochondria (FIG. 6B and FIG. 7-12 and Table 8 Å-D). To assess the localization of SARS-CoV-2 proteins in the context of infected cells, antibodies against SARS-CoV-2 proteins were raised and validated with the individually-expressed 2×Strep-tagged proteins. Using the 14 antibodies with confirmed specificity, it was observed that localization of viral proteins in infected Caco-2 cells sometimes differed from their localization when expressed individually (FIG. 6B and FIG. 13 and Table 8 Å-D). This likely results from recruitment of viral proteins and complexes into replication compartments, as well as remodeling of the secretory pathway during viral infection. For proteins such as Nsp1 and Orf3a, which are not known to be involved in viral replication, their localization is consistent both when expressed individually and in the context of viral infection (FIG. 6C and FIG. 6D).

    [0454] Referring to FIG. 6A, an overview of experimental design to determine localization of Strep-tagged SARS-CoV-2, SARS-CoV-1, and MERS-CoV proteins in HeLaM cells (left) or of viral proteins upon SARS-CoV-2 infection in Caco-2 cells (right) is shown.

    [0455] Referring to FIG. 6B, relative localization for all coronavirus proteins across viruses expressed individually (blue color bar; * indicates viral proteins of high sequence divergence) or in SARS-CoV-2 infected cells (colored box outlines) is shown.

    [0456] Referring to FIG. 6C and FIG. 6D, the localization of Nsp1 and Orf3a expressed individually (FIG. 6C) or during infection (FIG. 6D) for representative images of all tagged constructs and viral proteins imaged during infection are shown. See FIG. 7-13, respectively. Scale bars=10 μm.

    TABLE-US-00013 TABLE 8A LOCALIZATION EXP REPORTER Viral Diffuse Punctate Virus Protein cytoplasm cytoplasmic ER Golgi PM Endosomes Mitochondria Notes SARS_CoV_2 NSP1 6 1 Construct is expressed at very low levels. SARS_CoV_2 NSP2 4 3 Some enrichment at lamellipodia. SARS_CoV_2 NSP4 7 SARS_CoV_2 NSP5 (wt) 5 2 Some enrichment at lamellipodia. SARS_CoV_2 NSP5_C148A 5 2 Some enrichment at lamellipodia. SARS_CoV_2 NSP6 4 3 SARS_CoV_2 NSP7 5 2 Some enrichment at lamellipodia. SARS_CoV_2 NSP8 6 1 Some enrichment at lamellipodia. SARS_CoV_2 NSP9 7 Some enrichment at lamellipodia. SARS_CoV_2 NSP10 4 3 Strong enrichment at surface when expressed at high levels. SARS_CoV_2 NSP11 4 3 Some enrichment at lamellipodia. SARS_CoV_2 NSP12 3 4 Some enrichment at lamellipodia. SARS_CoV_2 NSP13 6 1 Some enrichment at lamellipodia. SARS_CoV_2 NSP14 6 1 Some enrichment at lamellipodia. SARS_CoV_2 NSP15 5 2 Some enrichment at lamellipodia. SARS_CoV_2 NSP16 6 1 Some enrichment at lamellipodia. SARS_CoV_2 Orf3A 1 1 1 4 Levels at surface increase with expression. At very low levels see puncta which most likely localise to nuclear envelope SARS_CoV_2 Orf3B 7 Only a very small number of cells showing expression. SARS_CoV_2 Orf6 2 1 4 Predominantly Golgi staining with small puncta most likely associated with the ER. SARS_CoV_2 Orf7A 1 6 Lots of small membrane bound puncta in addition to Golgi staining. SARS_CoV_2 Orf7B 4 2 1 At low levels in the ER. As expression increases becomes more cytoplasmic. SARS_CoV_2 Orf8 4 3 Some nuclear envelope staining. SARS_CoV_2 Orf9B 2 5 Cytoplasmic localisation increases with expression. SARS_CoV_2 Orf9C 7 SARS_CoV_2 Orf10 7 Some nuclear envelope localisation SARS_CoV_2 M 2 5 At high levels observe protein at PM and tubular structures emanating from ER and Golgi. SARS_CoV_2 E 2 5 ER localisation increases with expression. SARS_CoV_2 N 6 1 Some enrichment at lamellipodia. SARS_CoV_2 S 2 1 4 SARS_CoV_1 NSP1 6 1 Construct is expressed at very low levels. SARS_CoV_1 NSP2 6 1 Some enrichment at lamellipodia. SARS_CoV_1 NSP3 Not determined. SARS_CoV_1 NSP4 7 SARS_CoV_1 NSP5 (wt) 6 1 Some enrichment at lamellipodia. SARS_CoV_1 NSP5_C148A 6 1 Some enrichment at lamellipodia. SARS_CoV_1 NSP6 4 3 SARS_CoV_1 NSP7 6 1 Some enrichment at lamellipodia. SARS_CoV_1 NSP8 6 1 Some enrichment at lamellipodia. SARS_CoV_1 NSP9 5 2 Some enrichment at lamellipodia. SARS_CoV_1 NSP10 2 5 Strong enrichment at surface when expressed at high levels. SARS_CoV_1 NSP11 6 1 Some enrichment at lamellipodia. SARS_CoV_1 NSP12 5 2 Some enrichment at lamellipodia. SARS_CoV_1 NSP13 6 1 Some enrichment at lamellipodia. SARS_CoV_1 NSP14 6 1 Some enrichment at lamellipodia. SARS_CoV_1 NSP15 5 2 Some enrichment at lamellipodia. SARS_CoV_1 NSP16 6 1 Some enrichment at lamellipodia. SARS_CoV_1 Orf3A 1 1 1 4 Levels at surface increase with expression. At very low levels see puncta which localise to nuclear SARS_CoV_1 Orf3B 7 Only a very small number of cells showing expression. Some nuclear staining in addition to cytoplasmic staining. SARS_CoV_1 Orf6 1 5 1 Doughnut or ring like structure associated with ER. SARS_CoV_1 Orf7A 1 6 Lots of small membrane bound puncta in addition to Golgi staining. SARS_CoV_1 Orf7B 3 2 1 1 SARS_CoV_1 Orf8A 7 Nuclear envelope staining. SARS_CoV_1 Orf8B 6 1 SARS_CoV_1 Orf9B 2 5 Cytoplasmic localisation increases with expression. SARS_CoV_1 Orf9C 7 SARS_CoV_1 M 2 5 At high levels observe protein at PM and tubular structures emanating from ER and Golgi. SARS_CoV_1 E 2 5 ER localisation increases with expression. SARS_CoV_1 N 6 1 Some enrichment at lamellipodia. SARS_CoV_1 S 2 1 4 MERS NSP1 7 Construct is expressed at very low levels. MERS NSP2 6 1 Some enrichment at lamellipodia. MERS NSP3 (wt) 7 MERS NSP3_C740A 7 MERS NSP4 7 Present on nuclear envelop at high expression levels MERS NSP5 (wt) 3 4 Some enrichment at lamellipodia. MERS NSP5_C148A 5 2 Some enrichment at lamellipodia. MERS NSP6 5 2 MERS NSP7 4 3 Some enrichment at lamellipodia. MERS NSP8 6 1 Expressed at very high levels. MERS NSP9 5 2 Some enrichment at lamellipodia. MERS NSP10 5 2 Strong enrichment at surface when expressed at high levels. MERS NSP11 5 2 Some enrichment at lamellipodia. MERS NSP12 2 5 Some cells mainly show cytoplasmic staining and others ER. MERS NSP13 1 6 Some enrichment at lamellipodia. MERS NSP14 6 1 Some enrichment at lamellipodia. MERS NSP15 6 1 Some enrichment at lamellipodia. MERS NSP16 6 1 Some enrichment at lamellipodia. MERS Orf3 2 5 At low levels predominantly localised to Golgi. As expression increases more found at ER. MERS Orf4A 5 2 MERS Orf4B 7 Nuclear staining in small number of cells. MERS Orf5 1 1 5 In addition to Golgi staining there are small puncta found in the cytoplasm possibly associated with ER. MERS Orf8B 3 4 In addition to ER labelling there are doughnut shaped structures found in the cytoplasm possibly associated with ER. MERS M 2 5 At high levels observe protein at PM and tubular structures emanating from ER and Golgi. MERS E 2 5 ER localisation increases with expression. MERS N 7 1 MERS S 2 1 4

    TABLE-US-00014 TABLE 8B LOCALIZATION EXP ANTIBODY Diffuse Punctate Virus Viral Protein cytoplasm cytoplasmic ER Golgi PM Endosomes Mitochondria SARS_CoV_2 NSP1 XXX SARS_CoV_2 NSP2 X XXX X SARS_CoV_2 NSP5 X XX X SARS_CoV_2 NSP7 XXX X SARS_CoV_2 NSP8 X XX SARS_CoV_2 NSP9 X XX SARS_CoV_2 NSP10 X XX SARS_CoV_2 NSP11/12 (did NOT work) SARS_CoV_2 NSP14 (high X X X background), difficult to judge) SARS_CoV_2 NSP16 (did NOT work) SARS_CoV_2 ORF3A X X XXX XXX SARS_CoV_2 ORF6 X XX X SARS_CoV_2 ORF7A (did NOT work) SARS_CoV_2 ORF7B X XX X SARS_CoV_2 ORF8 (weak/no specific staining) SARS_CoV_2 ORF9A (B) XX XXX SARS_CoV_2 ORF9B (C Did not work) SARS_CoV_2 M (sheep) X (vesicular) X XX SARS_CoV_2 N XXX SARS_CoV_2 S (could not do) xxx: strong, xx: moderate, x: weak verified with marker

    TABLE-US-00015 TABLE 8C LOCALIZATION PREDICTIONS Viral Cell Endoplasmic Golgi Lysosome/ Virus protein ID Localisation Localisation Type Nucleus Cytoplasm Extracellular Mitochondrion membrane reticulum Plastid apparatus Vacuole Peroxisome SARS_CoV_2 nsp1 Cytoplasm/PM Cytoplasm Soluble 0.1428 0.4626 0.077 0.0742 0.0022 0.003 0.2155 0.0018 0.0133 0.0076 SARS_CoV_2 nsp2 Cytoplasm/PM Cytoplasm Soluble 0.0635 0.3293 0.0143 0.2246 0.0202 0.0157 0.1975 0.0136 0.1051 0.0162 SARS_CoV_2 nsp3 Endoplasmic Membrane 0.001 0.0004 0 0.0002 0.1113 0.7312 0.0002 0.0903 0.0651 0.0002 reticulum SARS_CoV_2 nsp4 ER Cell Membrane 0 0 0.0001 0.0001 0.4961 0.0139 0 0.1846 0.3053 0 membrane SARS_CoV_2 nsp5 Cytoplasm/PM Cytoplasm Soluble 0.0267 0.374 0.2223 0.2344 0.0109 0.0058 0.0735 0.0018 0.0081 0.0427 SARS_CoV_2 nsp6 ER/Golgi Golgi Membrane 0 0 0 0 0.1479 0.2928 0 0.3995 0.1597 0 apparatus SARS_CoV_2 nsp7 Cytoplasm/PM Cytoplasm Soluble 0.2118 0.451 0.2854 0.0187 0.0055 0.0079 0.0002 0.0027 0.0168 0 SARS_CoV_2 nsp8 Cytoplasm/PM Cytoplasm Soluble 0.1572 0.5112 0.0112 0.0229 0.0243 0.029 0.0474 0.0167 0.0427 0.1374 SARS_CoV_2 nsp9 Cytoplasm Mitochondrion Soluble 0.0075 0.0541 0.0976 0.7034 0.0047 0.0046 0.1002 0.0007 0.0019 0.0253 SARS_CoV_2 nsp10 Cytoplasm/PM Extracellular Soluble 0.0362 0.1582 0.7092 0.058 0.0008 0.0009 0.0211 0.0005 0.0152 0 SARS_CoV_2 nsp11 Cytoplasm/PM Cytoplasm Soluble 0.0802 0.6554 0.028 0.0367 0.0309 0.0261 0.0189 0.028 0.0322 0.0636 SARS_CoV_2 nsp12 PM/Cytoplasm Cytoplasm Soluble 0.0802 0.6554 0.028 0.0367 0.0309 0.0261 0.0189 0.028 0.0322 0.0636 SARS_CoV_2 nsp13 Cytoplasm/PM Cytoplasm Soluble 0.2251 0.7146 0.0076 0.0132 0.0009 0.0011 0.0066 0.0027 0.007 0.0212 SARS_CoV_2 nsp14 Cytoplasm/PM Cytoplasm Soluble 0.0265 0.4667 0.3393 0.0543 0.0362 0.0132 0.018 0.0054 0.0375 0.0028 SARS_CoV_2 nsp15 Cytoplasm/PM Cytoplasm Soluble 0.0264 0.5939 0.1216 0.0665 0.0346 0.0105 0.0492 0.0089 0.084 0.0044 SARS_CoV_2 nsp16 Cytoplasm/PM Cytoplasm Soluble 0.0739 0.5956 0.1259 0.0822 0.013 0.0089 0.0301 0.0033 0.0247 0.0422 SARS_CoV_2 orf3a Endosomes/ Cell Membrane 0.0017 0.0018 0.0021 0.0081 0.3085 0.2825 0.0187 0.0873 0.2843 0.005 PM/ER/Golgi membrane SARS_CoV_2 orf3b Golgi Extracellular Soluble 0.0441 0.0654 0.8442 0.0369 0.0006 0.003 0.0053 0.0002 0.0001 0 SARS_CoV_2 orf6 Golgi/ Mitochondrion Membrane 0.0944 0.0836 0.043 0.3963 0.0045 0.2919 0.0023 0.0415 0.0211 0.0214 Punctate.cytoplasm/ ER SARS_CoV_2 orf7a Golgi/ Endoplasmic Membrane 0 0 0.0435 0 0.2771 0.4259 0 0.15 0.1034 0 Punctate.cytoplasm reticulum SARS_CoV_2 orf7b Cytoplasm/ Extracellular Soluble 0 0 0.6715 0 0.0807 0.223 0 0.0061 0.0186 0 ER/PM SARS_CoV_2 orf8 ER/Golgi Extracellular Soluble 0 0 1 0 0 0 0 0 0 0 SARS_CoV_2 orf9b Mitochondria/ Cytoplasm Soluble 0.315 0.3329 0.0494 0.2466 0.0036 0.0023 0.038 0.0013 0.0097 0.0011 Cytoplasm SARS_CoV_2 orf10 ER Extracellular Soluble 0.0036 0.0236 0.583 0.2761 0.0151 0.0515 0.0076 0.0137 0.0257 0.0002 SARS_CoV_2 M Golgi/ER Endoplasmic Membrane 0.0001 0 0 0.0063 0.0531 0.6787 0.0001 0.2525 0.0069 0.0024 reticulum SARS_CoV_2 E Golgi/ER Golgi Membrane 0.0002 0.0001 0.0005 0.0047 0.1943 0.2792 0.0008 0.4642 0.0558 0.0002 apparatus SARS_CoV_2 N Cytoplasm/PM Cytoplasm Soluble 0.1641 0.8223 0.0016 0.0013 0.0024 0.0006 0.0006 0.0004 0.0008 0.0059 SARS_CoV_2 S PM/ER/Golgi Cell Membrane 0 0 0.0358 0.0001 0.861 0.0764 0.0001 0.0152 0.0114 0 membrane SARS_CoV_2 Protein Cytoplasm? Cell Soluble 0.0425 0.0819 0.2981 0.0324 0.4042 0.0349 0.0137 0.0125 0.0453 0.0345 14 membrane MERS nsp1 Cytoplasm Mitochondrion Soluble 0.0414 0.3415 0.0181 0.3929 0.0034 0.0027 0.1068 0.0006 0.0027 0.0898 MERS nsp2 Cytoplasm/PM Cytoplasm Soluble 0.0227 0.7471 0.0157 0.0039 0.0112 0.013 0.0037 0.0005 0.0374 0.1448 MERS nsp3 ER Endoplasmic Membrane 0.0003 0 0 0.0001 0.1541 0.7351 0.0001 0.0532 0.0568 0.0003 reticulum MERS nsp3_C740A ER Endoplasmic Membrane 0.0003 0 0 0.0001 0.1582 0.7347 0.0001 0.05 0.0563 0.0002 reticulum MERS nsp4 ER Lysosome/ Membrane 0 0 0.0001 0.0002 0.308 0.0564 0 0.2675 0.3678 0 Vacuole MERS nsp5 PM/Cytoplasm Cytoplasm Soluble 0.0238 0.3952 0.2154 0.2102 0.0119 0.0077 0.0707 0.0019 0.0109 0.0524 MERS nsp5_C148A Cytoplasm/PM Cytoplasm Soluble 0.0242 0.4124 0.2004 0.2122 0.0103 0.0066 0.0685 0.0017 0.0092 0.0546 MERS nsp6 ER/Golgi Golgi Membrane 0 0 0 0.0001 0.2288 0.238 0 0.3353 0.1979 0 apparatus MERS nsp7 Cytoplasm/PM Cytoplasm Soluble 0.2028 0.4393 0.3043 0.0127 0.0052 0.0111 0.0001 0.0033 0.021 0 MERS nsp8 Cytoplasm/PM Cytoplasm Soluble 0.095 0.5973 0.0169 0.0141 0.0232 0.0124 0.0169 0.0222 0.1355 0.0665 MERS nsp9 Cytoplasm/PM Cytoplasm Soluble 0.1298 0.4833 0.0817 0.2594 0.004 0.0011 0.006 0.0003 0.0022 0.0322 MERS nsp10 Cytoplasm/PM Cytoplasm Soluble 0.1321 0.4525 0.3243 0.0648 0.002 0.0003 0.0195 0.0002 0.0041 0.0003 MERS nsp11 Cytoplasm/PM Extracellular Soluble 0.1388 0.0938 0.4007 0.0684 0.0097 0.0551 0.0134 0.0396 0.1803 0.0002 MERS nsp12 ER/Cytoplasm Cytoplasm Soluble 0.0695 0.7999 0.0101 0.0156 0.0119 0.0153 0.0042 0.0109 0.0223 0.0403 MERS nsp13 Mitochondria/ Cytoplasm Soluble 0.2662 0.6154 0.0035 0.0376 0.0009 0.0017 0.0467 0.0071 0.0088 0.012 PM MERS nsp14 Cytoplasm/PM Cytoplasm Soluble 0.0389 0.4338 0.372 0.0393 0.038 0.0091 0.0085 0.0038 0.0483 0.0083 MERS nsp15 Cytoplasm/PM Cytoplasm Soluble 0.0111 0.5548 0.1849 0.0686 0.0426 0.0106 0.0411 0.0051 0.0697 0.0115 MERS nsp16 Cytoplasm/PM Cytoplasm Soluble 0.0668 0.5771 0.1171 0.1087 0.0173 0.0101 0.019 0.002 0.011 0.0709 MERS orf3 Golgi/ER Extracellular Soluble 0.0009 0.0063 0.8522 0.0037 0.0046 0.0766 0.0005 0.0139 0.0414 0.0001 MERS orf4a Cytoplasm/PM Extracellular Soluble 0.1353 0.1664 0.4515 0.1801 0.0194 0.0083 0.0104 0.01 0.0166 0.002 MERS orf4b Cytoplasm Nucleus Soluble 0.7193 0.2717 0.0022 0.0022 0.0016 0.0003 0.0002 0.0003 0.0004 0.0018 MERS orf5 Golgi/ER/ Cell Membrane 0.0013 0.0002 0.0003 0.0069 0.435 0.168 0.0738 0.0754 0.2365 0.0027 Punctate.cytoplasm membrane MERS orf8b ER/ Mitochondrion Soluble 0.151 0.1586 0.0011 0.4053 0.0031 0.02 0.0341 0.0142 0.0008 0.2117 Punctate.cytoplasm MERS M Golgi/ER Endoplasmic Membrane 0.0004 0 0 0.002 0.1512 0.3733 0.0002 0.1958 0.2769 0.0001 reticulum MERS E Golgi/ER Golgi Membrane 0.0025 0.0013 0.0268 0.0803 0.2152 0.1817 0.0029 0.404 0.0844 0.0007 apparatus MERS N Cytoplasm/PM Cytoplasm Soluble 0.2302 0.7106 0.0043 0.0095 0.0092 0.0018 0.0089 0.0041 0.0052 0.0164 MERS S PM/ER/Golgi Cell Membrane 0 0 0.0091 0.0001 0.9012 0.059 0 0.0251 0.0055 0 membrane SARS_CoV_1 nsp1 Cytoplasm/PM Cytoplasm Soluble 0.1375 0.4535 0.0756 0.0878 0.0022 0.0033 0.221 0.0013 0.0106 0.0073 SARS_CoV_1 nsp2 Cytoplasm/PM Cytoplasm Soluble 0.1926 0.6754 0.0058 0.0051 0.0238 0.0042 0.0069 0.0022 0.0182 0.066 SARS_CoV_1 nsp3 Endoplasmic Membrane 0.0012 0 0 0.0002 0.1023 0.7627 0.0001 0.0787 0.0542 0.0005 reticulum SARS_CoV_1 nsp4 ER Cell Membrane 0 0 0.0002 0.0001 0.4294 0.0398 0 0.1692 0.3613 0 membrane SARS_CoV_1 nsp5 Cytoplasm/PM Cytoplasm Soluble 0.0247 0.3879 0.2182 0.2269 0.0102 0.0055 0.0732 0.0016 0.0077 0.0441 SARS_CoV_1 nsp6 ER/Golgi Golgi Membrane 0 0 0 0 0.16 0.2951 0 0.3887 0.1561 0 apparatus SARS_CoV_1 nsp7 Cytoplasm/PM Cytoplasm Soluble 0.2054 0.4641 0.2816 0.0171 0.0055 0.0073 0.0001 0.0026 0.0163 0 SARS_CoV_1 nsp8 Cytoplasm/PM Cytoplasm Soluble 0.1116 0.5879 0.0102 0.0174 0.0153 0.0123 0.0523 0.0061 0.0336 0.1532 SARS_CoV_1 nsp9 Cytoplasm/PM Mitochondrion Soluble 0.0096 0.0648 0.087 0.7042 0.0038 0.0038 0.0996 0.0006 0.0017 0.025 SARS_CoV_1 nsp10 PM/Cytoplasm Extracellular Soluble 0.0386 0.1676 0.6966 0.0548 0.0007 0.001 0.0217 0.0005 0.0185 0 SARS_CoV_1 nsp11 Cytoplasm/PM Extracellular Soluble 0.031 0.1003 0.3883 0.1191 0.0032 0.0021 0.2754 0.0035 0.0762 0.001 SARS_CoV_1 nsp12 Cytoplasm/PM Cytoplasm Soluble 0.0755 0.6164 0.0296 0.0353 0.033 0.027 0.0202 0.0288 0.0354 0.0988 SARS_CoV_1 nsp13 Cytoplasm/PM Cytoplasm Soluble 0.2188 0.6512 0.0119 0.0456 0.0016 0.0015 0.0281 0.0059 0.0105 0.0249 SARS_CoV_1 nsp14 Cytoplasm/PM Cytoplasm Soluble 0.0239 0.4537 0.353 0.0534 0.0371 0.0131 0.018 0.0058 0.0391 0.0027 SARS_CoV_1 nsp15 Cytoplasm/PM Cytoplasm Soluble 0.0309 0.5892 0.1558 0.0571 0.029 0.0102 0.04 0.0069 0.0759 0.005 SARS_CoV_1 nsp16 Cytoplasm/PM Cytoplasm Soluble 0.0835 0.6592 0.0452 0.1241 0.0039 0.0032 0.0269 0.0015 0.0075 0.0449 SARS_CoV_1 orf3a Endosomes/ Lysosome/ Membrane 0.0038 0.0061 0.0056 0.0197 0.1833 0.2503 0.0704 0.064 0.3838 0.013 PM/ER/Golgi Vacuole SARS_CoV_1 orf3b Cytoplasm Mitochondrion Soluble 0.1842 0.0969 0.2131 0.417 0.0023 0.0012 0.0803 0.0008 0.0021 0.0021 SARS_CoV_1 orf6 ER/Golgi/ Extracellular Soluble 0.0474 0.0566 0.4547 0.2286 0.0289 0.0859 0.0443 0.0097 0.043 0.0008 Punctate.cytoplasm SARS_CoV_1 orf7a Golgi/ Endoplasmic Membrane 0 0 0.046 0 0.2457 0.5195 0 0.1501 0.0386 0 Punctate.cytoplasm reticulum SARS_CoV_1 orf7b Cytoplasm/ Endoplasmic Soluble 0 0 0.3566 0 0.1089 0.4074 0 0.0888 0.0382 0 ER/Golgi/PM reticulum SARS_CoV_1 orf8a ER Extracellular Soluble 0 0 1 0 0 0 0 0 0 0 SARS_CoV_1 orf8b Cytoplasm/PM Mitochondrion Soluble 0.0298 0.3311 0.2398 0.3947 0.0018 0.0009 0.0012 0.0002 0.0003 0.0001 SARS_CoV_1 orf9b Mitochondria/ Cytoplasm Soluble 0.3145 0.3327 0.052 0.2153 0.008 0.0046 0.0516 0.0028 0.0172 0.0013 Cytoplasm SARS_CoV_1 orf9c Cytoplasm Extracellular Soluble 0.1527 0.2688 0.3169 0.2104 0.0103 0.0098 0.0143 0.0068 0.0067 0.0033 SARS_CoV_1 M Golgi/ER Endoplasmic Membrane 0.0005 0 0.0001 0.0018 0.2185 0.3524 0.0005 0.1442 0.2817 0.0002 reticulum SARS_CoV_1 E Golgi/ER Golgi Membrane 0.0005 0.0003 0.0018 0.0045 0.2636 0.1873 0.0022 0.4122 0.1272 0.0004 apparatus SARS_CoV_1 N Cytoplasm/PM Cytoplasm Soluble 0.2015 0.7728 0.006 0.0012 0.0078 0.0014 0.0008 0.0015 0.0021 0.005 SARS_CoV_1 S PM/ER/Golgi Cell Membrane 0 0 0.0532 0.0001 0.8413 0.0789 0.0002 0.0139 0.0123 0 membrane

    TABLE-US-00016 TABLE 8D UNIPROT ANNOTATION UNIPROT LOCATION INFO Experimental signal other loc LocSigDB (http://genome.unmc.edu/LocSigDB/index.html) protein Location uniprot link peptide signals uniprot location Signal Coordinates Localization Virus NSP1 Cytoplasm/ https://covid- \— \— \— Yx{2}[VILFWCM] 67-71, 117-121, 153- Lysosome SARS_CoV_2 PM 19.uniprot.org/ 157 uniprotkb/P0DTC1 Kx{3}Q 10-15 Lysosome SARS_CoV_2 [HK]x{1}K 44-47 Endoplasmic SARS_CoV_2 reticulum Lx{2}KN 121-126 Golgi (early SARS_CoV_2 post -golgi comparments) NSP2 Cytoplasm/ https://covid- \— \— \— [DE]x{3}L[LI] 545-551 Lysosome|melanosome SARS_CoV_2 PM 19.uniprot.org/ Ex{3}LL 545-551 Lysosome SARS_CoV_2 uniprotkb/P0DTC1 Yx{2}[VILFWCM] 233-237, 316-320, Lysosome SARS_CoV_2 441-445, 537-541, 619-623 Kx{3}Q 317-322, 492-497 Lysosome SARS_CoV_2 Dx{1}E 615-618 Endoplasmic SARS_CoV_2 reticulum [HK]x{1}K 110-113, 237-240, Endoplasmic SARS_CoV_2 276-279, 333-336, reticulum 443-446, 454-457, 519-522, 532-535 NSP3 https://covid- \— \— Host membrane: Multi- [DE]x{3}L[LI] 308-314 Lysosome|melanosome SARS_CoV_2 19.uniprot.org/ pass membrane protein, Ex{3}LL 308-314 Lysosome SARS_CoV_2 uniprotkb/P0DTC1 Host cytoplasm Yx{2}[VILFWCM] 18-22, 87-91, 103- Lysosome SARS_CoV_2 107, 213-217, 317- 321, 356-360, 365- 369, 438-442, 588- 592, 693-697, 840- 844, 958-962, 1018- 1022, 1483-1487, 1513-1517, 1535- 1539, 1566-1570, 1573-1577, 1579- 1583, 1743-1747, 1859-1863 Kx{3}Q 376-381, 935-940, Lysosome SARS_CoV_2 962-967, 977-982, 1838-1843 GYx{2}[VILFWCM] 17-22, 212-217 Lysosome SARS_CoV_2 EED 158-161 Nucleus SARS_CoV_2 Dx{1}E 112-115, 117-120, Endoplasmic SARS_CoV_2 729-732, 1827-1830, reticulum 1844-1847 [HK]x{1}K 233-236, 413-416, Endoplasmic SARS_CoV_2 530-533, 587-590, reticulum 788-791, 834-837, 837-840, 1017-1020, 1728-1731, 1790- 1793 Yx{4}LL 857-864, 1353-1360 Golgi SARS_CoV_2 NSP4 ER https://covid- \— \— Host membrane: Multi- [DE]x{3}L[LI] 275-281 Lysosome|melanosome SARS_CoV_2 19.uniprot.org/ pass membrane protein, Yx{2}[VILFWCM] 62-66, 158-162, 198- Lysosome SARS_CoV_2 uniprotkb/P0DTC1 Host cytoplasm 202, 207-211, 264- Localizes in virally- 268, 315-319, 327- induced cytoplasmic 331, 351-355, 358- double-membrane vesicles 362, 362-366, 397- 401, 407-411, 443- 447, 460-464, 467- 471 GYx{2}I 61-66 Lysosome SARS_CoV_2 GYx{2}[VILFWCM] 61-66 Lysosome SARS_CoV_2 Dx{1}E 233-236 Endoplasmic SARS_CoV_2 reticulum [HK]x{1}K 466-469 Endoplasmic SARS_CoV_2 reticulum NSP5 Cytoplasm/ \— \— \— \— Yx{2}[VILFWCM] 54-58, 101-105, 154- Lysosome SARS_CoV_2 PM 158, 182-186, 209- 213, 239-243 Kx{3}Q 269-274 Lysosome SARS_CoV_2 SPS 121-124 Nucleus SARS_CoV_2 Dx{1}E 176-179 Endoplasmic SARS_CoV_2 reticulum [HK]x{1}K 88-91, 100-103 Endoplasmic SARS_CoV_2 reticulum NSP6 ER/Golgi https://covid- \— \— Host membrane: Multi- Yx{2}[VILFWCM] 80-84, 175-179, 196- Lysosome SARS_CoV_2 19.uniprot.org/ pass membrane protein 200, 214-218, 224- uniprotkb/P0DTC1 228, 234-238, 242- 246 [HK]x{1}K 61-64, 109-112 Endoplasmic SARS_CoV_2 reticulum Lx{2}KN 260-265 Golgi (early SARS_CoV_2 post -golgi comparments) NSP7 Cytoplasm/ https://covid- \— \— Host cytoplasm, host Kx{3}Q 27-32 Lysosome SARS_CoV_2 PM 19.uniprot.org/ perinuclear region uniprotkb/P0DTC1 nsp7, nsp8, nsp9 and nsp10 are localized in cytoplasmic foci, largely perinuclear. Late in infection, they merge into confluent complexes NSP8 Cytoplasm/ https://covid- \— S Host cytoplasm, host Yx{2}[VILFWCM] 12-16 Lysosome SARS_CoV_2 PM 19.uniprot.org/ perinuclear region Kx{3}Q 61-66 Lysosome SARS_CoV_2 uniprotkb/P0DTC1 nsp7, nsp8, nsp9 and KKLKK 36-41 Nucleus SARS_CoV_2 nsp10 are localized in Dx{1}E 30-33 Endoplasmic SARS_CoV_2 cytoplasmic foci, largely reticulum perinuclear. Late in [HK]x{1}K 37-40 Endoplasmic SARS_CoV_2 infection, they merge into reticulum confluent complexes NSP9 Cytoplasm https://covid- \— \— Host cytoplasm, host Yx{2}[VILFWCM] 66-70, 87-91 Lysosome SARS_CoV_2 19.uniprot.org/ perinuclear region [HK]x{1}K 84-87 Endoplasmic SARS_CoV_2 uniprotkb/P0DTC1 nsp7, nsp8, nsp9 and reticulum nsp10 are localized in cytoplasmic foci, largely perinuclear. Late in infection, they merge into confluent complexes NSP10 Cytoplasm/ https://covid- \— \— Host cytoplasm, host Yx{2}[VILFWCM] 76-80, 96-100 Lysosome SARS_CoV_2 PM 19.uniprot.org/ perinuclear region Dx{1}E 64-67 Endoplasmic SARS_CoV_2 uniprotkb/P0DTC1 nsp7, nsp8, nsp9 and reticulum nsp10 are localized in [HK]x{1}K 93-96 Endoplasmic SARS_CoV_2 cytoplasmic foci, largely reticulum perinuclear. Late in infection, they merge into confluent complexes NSP11 Cytoplasm/ \— \— \— \— \— \— \— SARS_CoV_2 PM NSP12 PM/ \— \— \— \— [DE]x{3}L[LI] 61-67, 465-471 Lysosome|melanosome SARS_CoV_2 Cytoplasm Yx{2}[VILFWCM] 32-36, 69-73, 87-91, Lysosome SARS_CoV_2 149-153, 163-167, 175-179, 237-241, 265-269, 479-483, 516-520, 595-599, 606-610, 619-623, 728-732, 746-750, 826-830, 877-881, 903-907, 921-925 Kx{3}Q 288-293, 871-876 Lysosome SARS_CoV_2 Dx{1}E 608-611 Endoplasmic SARS_CoV_2 reticulum [HK]x{1}K 572-575 Endoplasmic SARS_CoV_2 reticulum Yx{4}LL 265-272 Golgi SARS_CoV_2 SVM 904-907 Plasma SARS_CoV_2 membrane YEDQ 521-525 Plasma SARS_CoV_2 membrane NSP13 Cytoplasm/ \— \— \— \— Yx{2}[VILFWCM] 31-35, 224-228, 246- Lysosome SARS_CoV_2 PM 250, 253-257, 269- 273, 277-281, 306- 310, 324-328, 355- 359, 396-400, 476- 480, 541-545, 582- 586 Kx{3}Q 271-276 Lysosome SARS_CoV_2 PPx{2}R 174-179 Nucleus SARS_CoV_2 Dx{1}E 160-163 Endoplasmic SARS_CoV_2 reticulum [HK]x{1}K 345-348, 460-463, Endoplasmic SARS_CoV_2 465-468 reticulum NSP14 Cytoplasm/ \— \— \— \— Yx{2}[VILFWCM] 50-54, 68-72, 153- Lysosome SARS_CoV_2 PM 157, 223-227, 236- 240, 259-263, 295- 299, 464-468, 497- 501, 510-514, 516- 520 Kx{3}Q 60-65, 338-343 Lysosome SARS_CoV_2 GYx{2}[VILFWCM] 67-72 Lysosome SARS_CoV_2 Dx{1}E 89-92, 344-347 Endoplasmic SARS_CoV_2 reticulum [HK]x{1}K 31-34, 454-457 Endoplasmic SARS_CoV_2 reticulum YKGL 153-157 Golgi SARS_CoV_2 NSP15 Cytoplasm/ \— \— \— \— Yx{2}[VILFWCM] 32-36, 179-183, 237- Lysosome SARS_CoV_2 PM 241, 324-328, 342- 346 Kx{3}Q 204-209 Lysosome SARS_CoV_2 Dx{1}E 39-42 Endoplasmic SARS_CoV_2 reticulum NSP16 Cytoplasm/ \— \— \— \— Yx{2}[VILFWCM] 47-51, 181-185, 228- Lysosome SARS_CoV_2 PM 232, 242-246 Kx{3}Q 24-29, 214-219 Lysosome SARS_CoV_2 [HK]x{1}K 135-138 Endoplasmic SARS_CoV_2 reticulum E Golgi/ER https://covid- \— The Host Golgi apparatus [DE]x{3}L[LI]  7-13 Lysosome|melanosome SARS_CoV_2 19.uniprot.org/ cytoplasmic membrane: Single-pass Yx{2}[VILFWCM] 1-5, 58-62 Lysosome SARS_CoV_2 uniprotkb/P0DTC4 tail type III membrane protein functions as a Golgi complex- targeting signal M Golgi/ER https://covid- \— \— Virion membrane: Multi- [DE]x{3}L[LI] 11-17, 114-120, 214- Lysosome|melanosome SARS_CoV_2 19.uniprot.org/ pass membrane protein 220 uniprotkb/P0DTC5 Host Golgi apparatus Ex{3}LL 11-17, 114-120 Lysosome SARS_CoV_2 membrane: Multi-pass membrane protein Largely embedded in the Yx{2}[VILFWCM] 177-181 Lysosome SARS_CoV_2 lipid bilayer Kx{3}Q 14-19 Lysosome SARS_CoV_2 N Cytoplasm/ https://covid- \— \— Virion [DE]x{3}L[LI] 347-353 Lysosome|melanosome SARS_CoV_2 PM 19.uniprot.org/ Host endoplasmic Yx{2}[VILFWCM] 297-301, 359-363 Lysosome SARS_CoV_2 uniprotkb/P0DTC9 reticulum-Golgi intermediate compartment Host Golgi apparatus Kx{3}Q 236-241, 255-260, Lysosome SARS_CoV_2 298-303, 404-409 Located inside the virion, Dx{1}E 287-290 Endoplasmic SARS_CoV_2 complexed with the viral reticulum RNA. Probably associates with ER-derived membranes where it participates in viral RNA synthesis and virus budding SKK 254-257 Endoplasmic SARS_CoV_2 reticulum [HK]x{1}K 58-61, 99-102, 369- Endoplasmic SARS_CoV_2 372, 372-375 reticulum ORF3a Endosomes/ https://covid- \— \— Virion Yx{2}[VILFWCM] 90-94, 108-112, 144- Lysosome SARS_CoV_2 PM/ER/ 19.uniprot.org/ 148, 153-157, 159- Golgi uniprotkb/P0DTC3 163, 210-214, 232- 236 Host Golgi apparatus Kx{3}Q 65-70 Lysosome SARS_CoV_2 membrane: Multi-pass membrane protein Host cell membrane: SARS_CoV_2 Multi-pass membrane protein Secreted SARS_CoV_2 Host cytoplasm SARS_CoV_2 The cell surface expressed SARS_CoV_2 protein can undergo endocytosis. The protein is secreted in association with membranous structures ORF6 Golgi/ https://covid- \— \— Host endoplasmic Yx{2}[VILFWCM] 48-52 Lysosome SARS_CoV_2 UM/ER 19.uniprot.org/ reticulum membrane uniprotkb/P0DTC6 Host Golgi apparatus Dx{1}E 52-55 Endoplasmic SARS_CoV_2 membrane reticulum Host cytoplasm Lx{2}KN 34-39 Golgi (early SARS_CoV_2 post -golgi comparments) Localizes to virus-induced SARS_CoV_2 vesicular structures called double membrane vesicles ORF7a Golgi/UM https://covid- positions \— Virion Yx{2}[VILFWCM] 19-23, 96-100 Lysosome SARS_CoV_2 19.uniprot.org/ 1-15 Host endoplasmic Kx{3}Q 71-76 Lysosome SARS_CoV_2 uniprotkb/P0DTC7 reticulum membrane: Single-pass membrane protein Host endoplasmic KRK 116-119 Nucleus SARS_CoV_2 reticulum-Golgi intermediate compartment membrane: Single-pass type I membrane protein Host Golgi apparatus [HK]x{1}K 116-119 Endoplasmic SARS_CoV_2 membrane: Single-pass reticulum membrane protein ORF8 ER/Golgi https://covid- positions \— \— Yx{2}[VILFWCM] 41-45, 45-49, 72-76, Lysosome SARS_CoV_2 19.uniprot.org/ 1-15 104-108, 110-114 uniprotkb/P0DTC8 Kx{3}Q 67-72 Lysosome SARS_CoV_2 ORF9b Mitochondria/ https://covid- \— 45-54: Virion Yx{2}[VILFWCM] 41-45 Lysosome SARS_CoV_2 Cytoplasm 19.uniprot.org/ nuclear Host cytoplasmic vesicle SARS_CoV_2 uniprotkb/P0DTC2 export membrane: Peripheral signal membrane protein Host cytoplasm SARS_CoV_2 Host endoplasmic SARS_CoV_2 reticulum Host nucleus SARS_CoV_2 Host mitochondrion SARS_CoV_2 Binds non-covalently to SARS_CoV_2 intracellular lipid bilayers ORF10 ER https://covid- \— \— \— Yx{2}[VILFWCM] 2-6, 13-17 Lysosome SARS_CoV_2 19.uniprot.org/ GYx{2}[VILFWCM] 1-6 Lysosome SARS_CoV_2 uniprotkb/A0A663DJA2 S PM/ER/ https://covid- positions \— Virion membrane [DE]x{3}L[LI] 747-753, 917-923 Lysosome|melanosome SARS_CoV_2 Golgi 19.uniprot.org/ 1-12 Host endoplasmic Ex{3}LL 747-753 Lysosome SARS_CoV_2 uniprotkb/P0DTC2 reticulum-Golgi intermediate compartment membrane Host cell membrane Yx{2}[VILFWCM] 199-203, 364-368, Lysosome SARS_CoV_2 448-452, 452-456, 488-492, 507-511, 611-615, 755-759, 836-840, 1046-1050, 1137-1141, 1208- 1212, 1214-1218 GYx{2}I 198-203 Lysosome SARS_CoV_2 Kx{3}Q 309-314 Lysosome SARS_CoV_2 GYx{2}[VILFWCM] 198-203, 1045-1050 Lysosome SARS_CoV_2 Dx{1}E 177-180, 1259-1262 Endoplasmic SARS_CoV_2 reticulum [HK]x{1}K 534-537 Endoplasmic SARS_CoV_2 reticulum ORF3b Golgi \— \— \— \— \— \— \— SARS_CoV_2 ORF7b Cytoplasm/ https://covid- \— \— Host membrane: Single- Yx{2}[VILFWCM]  9-13 Lysosome SARS_CoV_2 ER/PM 19.uniprot.org/ pass membrane protein uniprotkb/P0DTC8 Protein ? \— \— \— \— Yx{2}[VILFWCM] 4-8 Lysosome SARS_CoV_2 14 Kx{3}Q 14-19 Lysosome SARS_CoV_2 NSP1 Cytoplasm/ https://covid- \— \— \— Yx{2}[VILFWCM] 67-71, 117-121 Lysosome SARS_CoV_1 PM 19.uniprot.org/ Kx{3}Q 10-15 Lysosome SARS_CoV_1 uniprotkb/P0C6U8 Dx{1}E 155-158 Endoplasmic SARS_CoV_1 reticulum [HK]x{1}K 44-47 Endoplasmic SARS_CoV_1 reticulum Lx{2}KN 121-126 Golgi (early SARS_CoV_1 post -golgi comparments) NSP2 Cytoplasm/ https://covid- \— \— \— [DE]x{3}L[LI] 545-551 Lysosome|melanosome SARS_CoV_1 PM 19.uniprot.org/ Ex{3}LL 545-551 Lysosome SARS_CoV_1 uniprotkb/P0C6U8 Yx{2}[VILFWCM] 233-237, 316-320, Lysosome SARS_CoV_1 537-541, 619-623 Kx{3}Q 481-486, 544-549, Lysosome SARS_CoV_1 614-619 Dx{1}E 53-56, 195-198, 615- Endoplasmic SARS_CoV_1 618 reticulum [HK]x{1}K 100-103, 110-113, Endoplasmic SARS_CoV_1 333-336, 614-617 reticulum NSP3 \— https://covid- \— \— Host membrane: Multi- [DE]x{3}L[LI] 286-292 Lysosome|melanosome SARS_CoV_1 19.uniprot.org/ pass membrane protein Ex{3}LL 286-292 Lysosome SARS_CoV_1 uniprotkb/P0C6U8 Yx{2}[VILFWCM] 19-23, 104-108, 139- Lysosome SARS_CoV_1 143, 191-195, 250- 254, 295-299, 334- 338, 343-347, 564- 568, 669-673, 694- 698, 794-798, 935- 939, 995-999, 1048- 1052, 1460-1464, 1490-1494, 1543- 1547, 1550-1554, 1556-1560, 1720- 1724, 1836-1840, 1877-1881 Kx{3}Q 377-382, 912-917, Lysosome SARS_CoV_1 1317-1322 GYx{2}[VILFWCM] 18-23, 190-195 Lysosome SARS_CoV_1 EED 114-117, 160-163 Nucleus SARS_CoV_1 SVx{5}QL 837-846 Peroxisomes SARS_CoV_1 Dx{1}E 111-114, 117-120, Endoplasmic SARS_CoV_1 706-709, 1821-1824 reticulum SKK 461-464 Endoplasmic SARS_CoV_1 reticulum [HK]x{1}K 224-227, 387-390, Endoplasmic SARS_CoV_1 506-509, 563-566, reticulum 714-717, 765-768, 811-814, 814-817, 1705-1708, 1767- 1770 Yx{4}LL 834-841 Golgi SARS_CoV_1 NSP4 ER https://covid- \— \— Host membrane: Multi- [DE]x{3}L[LI] 259-265 Lysosome|melanosome SARS_CoV_1 19.uniprot.org/ pass membrane protein Yx{2}[VILFWCM] 25-29, 46-50, 142- Lysosome SARS_CoV_1 uniprotkb/P0C6U8 146, 182-186, 191- 195, 248-252, 299- 303, 311-315, 335- 339, 342-346, 346- 350, 381-385, 427- 431, 444-448, 451- 455 GYx{2}I 45-50 Lysosome SARS_CoV_1 GYx{2}[VILFWCM] 45-50 Lysosome SARS_CoV_1 Dx{1}E 217-220 Endoplasmic SARS_CoV_1 reticulum [HK]x{1}K 450-453 Endoplasmic SARS_CoV_1 reticulum NSP5 Cytoplasm/ \— \— \— \— Yx{2}[VILFWCM] 54-58, 101-105, 154- Lysosome SARS_CoV_1 PM 158, 182-186, 209- 213, 239-243 Kx{3}Q 269-274 Lysosome SARS_CoV_1 SPS 121-124 Nucleus SARS_CoV_1 Dx{1}E 176-179 Endoplasmic SARS_CoV_1 reticulum [HK]x{1}K 100-103 Endoplasmic SARS_CoV_1 reticulum CAAL 265-269 Plasma SARS_CoV_1 membrane NSP6 ER/Golgi https://covid- \— \— Host membrane: Multi- [DE]x{3}L[LI] 195-201 Lysosome|melanosome SARS_CoV_1 19.uniprot.org/ pass membrane protein Ex{3}LL 195-201 Lysosome SARS_CoV_1 uniprotkb/P0C6U8 Yx{2}[VILFWCM] 80-84, 175-179, 196- Lysosome SARS_CoV_1 200, 214-218, 219- 223, 224-228, 234- 238, 242-246 GYx{2}[VILFWCM] 218-223 Lysosome SARS_CoV_1 [HK]x{1}K 2-5, 61-64 Endoplasmic SARS_CoV_1 reticulum NSP7 Cytoplasm/ https://covid- \— \— Host cytoplasm, host Kx{3}Q 27-32 Lysosome SARS_CoV_1 PM 19.uniprot.org/ perinuclear region uniprotkb/P0C6U8 nsp7, nsp8, nsp9 and nsp10 are localized in cytoplasmic foci, largely perinuclear. Late in infection, they merge into confluent complexes NSP8 Cytoplasm/ https://covid- \— \— Host cytoplasm, host Kx{3}Q 61-66 Lysosome SARS_CoV_1 PM 19.uniprot.org/ perinuclear region KKLKK 36-41 Nucleus SARS_CoV_1 uniprotkb/P0C6U8 nsp7, nsp8, nsp9 and Dx{1}E 30-33 Endoplasmic SARS_CoV_1 nsp10 are localized in reticulum cytoplasmic foci, largely [HK]x{1}K 37-40 Endoplasmic SARS_CoV_1 perinuclear. Late in reticulum infection, they merge into confluent complexes NSP9 Cytoplasm/ https://covid- \— \— Host cytoplasm, host Yx{2}[VILFWCM] 66-70, 87-91 Lysosome SARS_CoV_1 PM 19.uniprot.org/ perinuclear region [HK]x{1}K 84-87 Endoplasmic SARS_CoV_1 uniprotkb/P0C6U8 nsp7, nsp8, nsp9 and reticulum nsp10 are localized in cytoplasmic foci, largely perinuclear. Late in infection, they merge into confluent complexes NSP10 PM/ https://covid- \— \— Host cytoplasm, host Yx{2}[VILFWCM] 76-80, 96-100 Lysosome SARS_CoV_1 Cytoplasm 19.uniprot.org/ perinuclear region Dx{1}E 64-67 Endoplasmic SARS_CoV_1 uniprotkb/P0C6U8 nsp7, nsp8, nsp9 and reticulum nsp10 are localized in [HK]x{1}K 93-96 Endoplasmic SARS_CoV_1 cytoplasmic foci, largely reticulum perinuclear. Late in infection, they merge into confluent complexes NSP11 Cytoplasm/ \— \— \— \— \— \— \— SARS_CoV_1 PM NSP12 Cytoplasm/ \— \— \— \— [DE]x{3}L[LI] 61-67, 465-471 Lysosome|melanosome SARS_CoV_1 PM Ex{3}LL 61-67 Lysosome SARS_CoV_1 Yx{2}[VILFWCM] 32-36, 69-73, 87-91, Lysosome SARS_CoV_1 149-153, 163-167, 175-179, 237-241, 479-483, 516-520, 595-599, 606-610, 619-623, 728-732, 746-750, 826-830, 877-881, 903-907, 921-925 Kx{3}Q 288-293, 871-876 Lysosome SARS_CoV_1 Dx{1}E 60-63, 608-611, 738- Endoplasmic SARS_CoV_1 741 reticulum [HK]x{1}K 572-575 Endoplasmic SARS_CoV_1 reticulum SVM 904-907 Plasma SARS_CoV_1 membrane YEDQ 521-525 Plasma SARS_CoV_1 membrane NSP13 Cytoplasm/ \— \— \— \— Yx{2}[VILFWCM] 31-35, 224-228, 246- Lysosome SARS_CoV_1 PM 250, 253-257, 269- 273, 277-281, 306- 310, 324-328, 355- 359, 396-400, 476- 480, 541-545, 582- 586 Kx{3}Q 271-276 Lysosome SARS_CoV_1 PPx{2}R 174-179 Nucleus SARS_CoV_1 Dx{1}E 160-163 Endoplasmic SARS_CoV_1 reticulum [HK]x{1}K 345-348, 460-463, Endoplasmic SARS_CoV_1 465-468 reticulum NSP14 Cytoplasm/ \— \— \— \— Yx{2}[VILFWCM] 50-54, 68-72, 153- Lysosome SARS_CoV_1 PM 157, 223-227, 236- 240, 295-299, 464- 468, 497-501, 510- 514, 516-520 Kx{3}Q 60-65, 338-343 Lysosome SARS_CoV_1 GYx{2}[VILFWCM] 67-72 Lysosome SARS_CoV_1 Dx{1}E 89-92, 125-128 Endoplasmic SARS_CoV_1 reticulum [HK]x{1}K 31-34, 373-376, 454- Endoplasmic SARS_CoV_1 457 reticulum YKGL 153-157 Golgi SARS_CoV_1 NSP15 Cytoplasm/ \— \— \— \— Yx{2}[VILFWCM] 7-11, 32-36, 237-241, Lysosome SARS_CoV_1 PM 324-328, 342-346 Kx{3}Q 155-160, 204-209 Lysosome SARS_CoV_1 Dx{1}E 39-42, 199-202 Endoplasmic SARS_CoV_1 reticulum NSP16 Cytoplasm/ \— \— \— \— [DE]x{3}L[LI] 276-282 Lysosome|melanosome SARS_CoV_1 PM Yx{2}[VILFWCM] 47-51, 181-185, 228- Lysosome SARS_CoV_1 232, 242-246, 272- 276 Kx{3}Q 24-29, 214-219 Lysosome SARS_CoV_1 [HK]x{1}K 158-161, 214-217 Endoplasmic SARS_CoV_1 reticulum ORF3a Endosomes/ https://covid- \— \— Virion Yx{2}[VILFWCM] 73-77, 90-94, 108- Lysosome SARS_CoV_1 PM/ER/ 19.uniprot.org/ 112, 144-148, 153- Golgi uniprotkb/P59632 157, 159-163, 199- 203, 210-214 Host Golgi apparatus Kx{3}Q 180-185 Lysosome SARS_CoV_1 membrane: Multi-pass membrane protein Host cell membrane: [HK]x{1}K 131-134, 178-181 Endoplasmic SARS_CoV_1 Multi-pass membrane reticulum protein Secreted SARS_CoV_1 Host cytoplasm SARS_CoV_1 ORF3b Cytoplasm https://covid- \— 80-138: Host nucleus, host Yx{2}[VILFWCM] 62-66 Lysosome SARS_CoV_1 19.uniprot.org/ Mitochondrial nucleolus uniprotkb/P59633 targeting region 134-154: Host mitochondrion SKK 39-42 Endoplasmic SARS_CoV_1 Nucleolar reticulum targeting region 135-153: [HK]x{1}K 134-137 Endoplasmic SARS_CoV_1 Bipartite reticulum nuclear localization signal ORF6 ER/Golgi/ https://covid- \— 54-63: Host endoplasmic Yx{2}[VILFWCM] 48-52 Lysosome SARS_CoV_1 UM 19.uniprot.org/ Critical reticulum membrane uniprotkb/P59634 for Host Golgi apparatus Dx{1}E 52-55 Endoplasmic SARS_CoV_1 disrupting membrane reticulum nuclear Host cytoplasm Lx{2}KN 43-48 Golgi (early SARS_CoV_1 import post -golgi comparments) Localizes to virus-induced SARS_CoV_1 vesicular structures called double membrane vesicles ORF7a Golgi/UM https://covid- positions \— Virion Yx{2}[VILFWCM] 19-23, 97-101 Lysosome SARS_CoV_1 19.uniprot.org/ 1-15 Host endoplasmic KRK 117-120 Nucleus SARS_CoV_1 uniprotkb/P59635 reticulum membrane: Single-pass membrane protein Host endoplasmic [HK]x{1}K 117-120 Endoplasmic SARS_CoV_1 reticulum-Golgi reticulum intermediate compartment membrane: Single-pass type I membrane protein Host Golgi apparatus SARS_CoV_1 membrane: Single-pass membrane protein ORF7b Cytoplasm/ https://covid- \— \— Host membrane: Single- Yx{2}[VILFWCM]  8-12 Lysosome SARS_CoV_1 ER/Golgi/ 19.uniprot.org/ pass membrane protein PM uniprotkb/Q7TFA1 Dx{1}E 34-37 Endoplasmic SARS_CoV_1 reticulum ORF8a ER https://www.uniprot.org/ \— \— \— \— \— \— SARS_CoV_1 uniprot/Q19QW2 ORF8b Cytoplasm/ https://covid- \— \— Host cytoplasm \— \— \— SARS_CoV_1 PM 19.uniprot.org/ Host nucleus SARS_CoV_1 uniprotkb/O80H93 ORF9b Mitochondria/ https:/covid- \— 46-54: Virion Yx{2}[VILFWCM] 42-46 Lysosome SARS_CoV_1 Cytoplasm 19.uniprot.org/ nuclear uniprotkb/P59636 export signal ORF9c Cytoplasm \— \— \— \— Yx{2}[VILFWCM] 4-8 Lysosome SARS_CoV_1 Kx{3}Q 14-19 Lysosome SARS_CoV_1 M Golgi/ER https://covid- \— \— Virion membrane: Multi- [DE]x{3}L[LI] 10-16, 113-119, 213- Lysosome|melanosome SARS_CoV_1 19.uniprot.org/ pass membrane protein 219 uniprotkb/P59596 Host Golgi apparatus Ex{3}LL 10-16, 113-119 Lysosome SARS_CoV_1 membrane: Multi-pass membrane protein Yx{2}[VILFWCM] 176-180 Lysosome SARS_CoV_1 E Golgi/ER https://covid- \— \— Host cytoplasmic vesicle [DE]x{3}L[LI]  9-13 Lysosome|melanosome SARS_CoV_1 19.uniprot.org/ membrane: Peripheral uniprotkb/P59637 membrane protein Host cytoplasm Yx{2}[VILFWCM] 1-5, 58-62 Lysosome SARS_CoV_1 Host endoplasmic SARS_CoV_1 reticulum Host nucleus SARS_CoV_1 Host mitochondrion SARS_CoV_1 Host endoplasmic SARS_CoV_1 reticulum-Golgi intermediate compartment Host Golgi apparatus SARS_CoV_1 membrane N Cytoplasm/ https://covid- \— \— Virion [DE]x{3}L[LI] 348-354 Lysosome|melanosome SARS_CoV_1 PM 19.uniprot.org/ Host endoplasmic Yx{2}[VILFWCM] 298-302, 360-364 Lysosome SARS_CoV_1 uniprotkb/P59595 reticulum-Golgi intermediate compartment Host Golgi apparatus Kx{3}Q 237-242, 256-261, Lysosome SARS_CoV_1 299-304 Host cytoplasm, host SKK 255-258 Endoplasmic SARS_CoV_1 perinuclear region reticulum Located inside the virion, [HK]x{1}K 59-62, 100-103, 370- Endoplasmic SARS_CoV_1 complexed with the viral 373, 373-376 reticulum RNA. Probably associates with ER-derived membranes where it participates in viral RNA synthesis and virus budding S PM/ER/ https://covid- positions \— Virion membrane [DE]x{3}L[LI] 729-735 Lysosome|melanosome SARS_CoV_1 Golgi 19.uniprot.org/ 1-13 Host endoplasmic Ex{3}LL 729-735 Lysosome SARS_CoV_1 uniprotkb/P59594 reticulum-Golgi intermediate compartment membrane Host cell membrane Yx{2}[VILFWCM] 62-66, 199-203, 351- Lysosome SARS_CoV_1 355, 439-443, 474- 478, 493-497, 597- 601, 659-663, 737- 741, 818-822, 1028- 1032, 1119-1123, 1190-1194, 1196- 1200 GYx{2}I 198-203 Lysosome SARS_CoV_1 Kx{3}Q 296-301, 910-915 Lysosome SARS_CoV_1 GYx{2}[VILFWCM] 198-203, 1027-1032 Lysosome SARS_CoV_1 Dx{1}E 1241-1244 Endoplasmic SARS_CoV_1 reticulum [HK]x{1}K 187-190, 444-447 Endoplasmic SARS_CoV_1 reticulum Yx{4}LL 659-666 Golgi SARS_CoV_1 NSP1 Cytoplasm https:/www.uniprot.org/ \— \— \— Yx{2}[VILFWCM] 55-59, 70-74, 154- Lysosome MERS uniprot/K9N7C7 158 Dx{1}E 50-53, 132-135, 172- Endoplasmic MERS 175 reticulum [HK]x{1}K 178-181 Endoplasmic MERS reticulum NSP2 Cytoplasm/ https:/www.uniprot.org/ \— \— \— Yx{2}[VILFWCM] 20-24, 56-60, 93-97, Lysosome MERS PM uniprot/K9N7C7 238-242, 359-363, 366-370, 384-388, 403-407, 433-437, 552-556, 622-626, 642-646 Kx{3}Q 560-565 Lysosome MERS EED 635-638 Nucleus MERS Dx{1}E 34-37, 44-47, 174- Endoplasmic MERS 177 reticulum SKK 575-578 Endoplasmic MERS reticulum [HK]x{1}K 118-121, 524-527, Endoplasmic MERS 558-561 reticulum NSP3 ER https:/www.uniprot.org/ \— \— Host membrane; Multi- [DE]x{3}L[LI] 775-781, 793-799, Lysosome|melanosome MERS uniprot/K9N7C7 pass membrane protein 1044-1050, 1522- 1528, 1808-1814 Host cytoplasm Yx{2}[VILFWCM] 367-371, 373-377, Lysosome MERS 415-419, 431-435, 530-534, 566-570, 700-704, 783-787, 837-841, 1037-1041, 1055-1059, 1175- 1179, 1364-1368, 1370-1374, 1415- 1419, 1500-1504, 1513-1517, 1629- 1633, 1658-1662, 1681-1685, 1839- 1843 Kx{3}Q 312-317, 326-331, Lysosome MERS 1781-1786 GYx{2}[VILFWCM] 565-570 Lysosome MERS Dx{1}E 114-117, 124-127, Endoplasmic MERS 149-152, 235-238, reticulum 1766-1769 [HK]x{1}K 245-248, 296-299, Endoplasmic MERS 440-443, 767-770, reticulum 932-935, 1066-1069, 1133-1136, 1211- 1214, 1642-1645 Lx{2}KN 648-653 Golgi (early MERS post -golgi comparments) NSP3_C740A ER \— \— \— \— [DE]x{3}L[LI] 775-781, 793-799, Lysosome|melanosome MERS 1044-1050, 1522- 1528, 1808-1814 Yx{2}[VILFWCM] 367-371, 373-377, Lysosome MERS 415-419, 431-435, 530-534, 566-570, 700-704, 783-787, 837-841, 1037-1041, 1055-1059, 1175- 1179, 1364-1368, 1370-1374, 1415- 1419, 1500-1504, 1513-1517, 1629- 1633, 1658-1662, 1681-1685, 1839- 1843 Kx{3}Q 312-317, 326-331, Lysosome MERS 1781-1786 GYx{2}[VILFWCM] 565-570 Lysosome MERS Dx{1}E 114-117, 124-127, Endoplasmic MERS 149-152, 235-238, reticulum 1766-1769 [HK]x{1}K 245-248, 296-299, Endoplasmic MERS 440-443, 767-770, reticulum 932-935, 1066-1069, 1133-1136, 1211- 1214, 1642-1645 Lx{2}KN 648-653 Golgi (early MERS post -golgi comparments) NSP4 ER https:/www.uniprot.org/ \— \— Host membrane; Multi- Yx{2}[VILFWCM] 31-35, 140-144, 148- Lysosome MERS uniprot/K9N7C7 pass membrane protein 152, 188-192, 227- 231, 284-288, 318- 322, 349-353, 355- 359, 373-377, 436- 440, 448-452, 458- 462 Host cytoplasm Dx{1}E 167-170 Endoplasmic MERS reticulum SKK 405-408 Endoplasmic MERS reticulum [HK]x{1}K 310-313, 457-460 Endoplasmic MERS reticulum NSP5 PM/ \— \— \— \— Yx{2}[VILFWCM] 54-58, 185-189, 202- Lysosome MERS Cytoplasm 206, 212-216, 273- 277 Kx{3}Q 191-196 Lysosome MERS Dx{1}E Dec-15   Endoplasmic MERS reticulum NSP5_C148A Cytoplasm/ \— \— \— \— Yx{2}[VILFWCM] 54-58, 185-189, 202- Lysosome MERS PM 206, 212-216, 273- 277 Kx{3}Q 191-196 Lysosome MERS Dx{1}E Dec-15   Endoplasmic MERS reticulum NSP6 ER/Golgi https:/www.uniprot.org/ \— \— Host membrane; Multi- Yx{2}[VILFWCM] 22-26, 80-84, 119- Lysosome MERS uniprot/K9N7C7 pass membrane protein 123, 166-170, 193- 197, 216-220, 226- 230 Kx{3}Q 247-252 Lysosome MERS [HK]x{1}K 61-64 Endoplasmic MERS reticulum NSP7 Cytoplasm/ https:/www.uniprot.org/ \— \— host perinuclear region \— \— \— MERS PM uniprot/K9N7C7 Note: nsp7, nsp8, nsp9 and nsp10 are localized in cytoplasmic foci, largely perinuclear. Late in infection, they merge into confluent complexes NSP8 Cytoplasm/ https:/www.uniprot.org/ \— \— host perinuclear region Yx{2}[VILFWCM] 145-149 Lysosome MERS PM uniprot/K9N7C7 Note: nsp7, nsp8, nsp9 and Dx{1}E 164-167 Endoplasmic MERS nsp10 are localized in reticulum cytoplasmic foci, largely [HK]x{1}K 52-55, 81-84 Endoplasmic MERS perinuclear. Late in reticulum infection, they merge into confluent complexes NSP9 Cytoplasm/ https:/www.uniprot.org/ \— \— host perinuclear region Yx{2}[VILFWCM] 31-35, 49-53, 84-88 Lysosome MERS PM uniprot/K9N7C7 Note: nsp7, nsp8, nsp9 and nsp10 are localized in cytoplasmic foci, largely perinuclear. Late in infection, they merge into confluent complexes NSP10 Cytoplasm/ https:/www.uniprot.org/ \— \— host perinuclear region Yx{2}[VILFWCM] 27-31 Lysosome MERS PM uniprot/K9N7C7 Note: nsp7, nsp8, nsp9 and Dx{1}E 64-67 Endoplasmic MERS nsp10 are localized in reticulum cytoplasmic foci, largely [HK]x{1}K 91-94 Endoplasmic MERS perinuclear. Late in reticulum infection, they merge into confluent complexes NSP11 Cytoplasm/ \— \— \— \— [DE]x{3}L[LI] Sep-15  Lysosome|melanosome MERS PM Ex{3}LL Sep-15  Lysosome MERS NSP12 Golgi/ https:/www.uniprot.org/ \— \— \— Yx{2}[VILFWCM] 71-75, 89-93, 124- Lysosome MERS Cytoplasm uniprot/K9N7C7 128, 150-154, 176- 180, 239-243, 349- 353, 421-425, 480- 484, 517-521, 596- 600, 607-611, 620- 624, 667-671, 729- 733, 746-750, 878- 882, 893-897, 904- 908, 922-926 Kx{3}Q 289-294 Lysosome MERS Dx{1}E 718-721, 875-878 Endoplasmic MERS reticulum [HK]x{1}K 41-44, 110-113, 348- Endoplasmic MERS 351, 573-576 reticulum SVM 905-908 Plasma MERS membrane NSP13 Mitochondria/ https:/www.uniprot.org/ \— \— \— [DE]x{3}L[LI] 160-166 Lysosome|melanosome MERS PM uniprot/K9N7C7 Ex{3}LL 160-166 Lysosome MERS Yx{2}[VILFWCM] 31-35, 70-74, 93-97, Lysosome MERS 246-250, 253-257, 277-281, 306-310, 324-328, 343-347, 541-545 PPx{2}R 174-179 Nucleus MERS SPS 100-103 Nucleus MERS [HK]x{1}K 171-174, 392-395 Endoplasmic MERS reticulum NSP14 Cytoplasm/ https:/www.uniprot.org/ \— \— \— Yx{2}[VILFWCM] 26-30, 51-55, 69-73, Lysosome MERS PM uniprot/K9N7C7 180-184, 224-228, 233-237, 237-241, 260-264, 296-300, 462-466, 495-499, 508-512, 514-518 GYx{2}[VILFWCM] 68-73, 232-237 Lysosome MERS Dx{1}E 90-93, 126-129, 293- Endoplasmic MERS 296 reticulum [HK]x{1}K 32-35, 301-304 Endoplasmic MERS reticulum NSP15 Cytoplasm/ https:/www.uniprot.org/ \— \— \— Yx{2}[VILFWCM] 81-85, 104-108, 145- Lysosome MERS PM uniprot/K9N7C7 149, 153-157, 176- 180, 234-238, 339- 343 Dx{1}E 87-90, 205-208 Endoplasmic MERS reticulum [HK]x{1}K 141-144 Endoplasmic MERS reticulum NSP16 Cytoplasm/ https:/www.uniprot.org/ \— \— \— Yx{2}[VILFWCM] 47-51, 181-185, 228- Lysosome MERS PM uniprot/K9N7C7 232, 242-246, 299- 303 [HK]x{1}K 253-256 Endoplasmic MERS reticulum E Golgi/ER \— \— \— \— Yx{2}[VILFWCM] 65-69 Lysosome MERS M Golgi/ER https://www.uniprot.org/ \— \— Virion membrane [DE]x{3}L[LI] 113-119 Lysosome MERS uniprot/K9N7A1 Host Golgi apparatus Ex{3}LL 113-119 Lysosome MERS membrane Yx{2}[VILFWCM] 159-163 Lysosome MERS Dx{1}E 210-213 Endoplasmic MERS reticulum [HK]x{1}K 146-149 Endoplasmic MERS reticulum N Cytoplasm/ \— \— \— \— Yx{2}[VILFWCM] 43-47, 214-218, 343- Lysosome MERS PM 347, 357-361 Kx{3}Q 312-317, 363-368 Lysosome MERS [HK]x{1}K 49-52, 228-231, 246- Endoplasmic MERS 249, 363-366, 366- reticulum 369 Lx{2}KN 336-341 Golgi (early MERS post -golgi comparments) S PM/ER/ https://www.uniprot.org/ \— \— Virion membrane; Single- [DE]x{3}L[LI] 383-389, 991-997 Lysosome|melanosome MERS Golgi uniprot/K9N5Q8 pass type I membrane protein Host endoplasmic Yx{2}[VILFWCM] 17-21, 63-67, 70-74, Lysosome MERS reticulum-Golgi 143-147, 183-187, intermediate compartment 200-204, 230-234, membrane UniRule 269-273, 286-290, annotation; Single-pass 291-295, 350-354, type I membrane protein 437-441, 496-500, UniRule annotation 522-526, 634-638, 647-651, 703-707, 776-780, 823-827, 908-912, 931-935, 1152-1156, 1210- 1214, 1263-1267, 1279-1283, 1291- 1295, 1297-1301 Host cell membrane Kx{3}Q 594-599 Lysosome MERS UniRule annotation; Single-pass type I membrane protein UniRule annotation YPAF 143-147 Lysosome MERS GYx{2}[VILFWCM] 907-912, 930-935 Lysosome MERS SPS 132-135 Nucleus MERS Dx{1}E 354-357, 663-666, Endoplasmic MERS 1343-1346 reticulum [HK]x{1}K 1099-1102, 1329- Endoplasmic MERS 1332 reticulum Yx{4}LL 408-415 Golgi MERS ORF3 Golgi/ER https://www.uniprot.org/ positions \— Host endoplasmic Dx{1}E 75-78 Endoplasmic MERS uniprot/K9N796 1-23 reticulum reticulum Yx{2}[VILFWCM] 34-38, 54-58 Lysosome MERS ORF4a Cytoplasm/ https://www.uniprot.org/ \— \— Host cytoplasm [DE]x{3}L[LI] 1-7 Lysosome|melanosome MERS PM uniprot/K9N54V0 YTPL 31-35 Lysosome MERS Yx{2}[VILFWCM] 2-6, 18-22, 31-35 Lysosome MERS ORF4b Cytoplasm https://www.uniprot.org/ \— 22-38: Host nucleus Yx{2}[VILFWCM] 55-59, 237-241 Lysosome MERS uniprot/K9N643 Nuclear host nucleolus MERS localization host cytoplasm MERS motif ORF5 Golgi/ https://www.uniprot.org/ \— \— host membrane Yx{2}[VILFWCM] 71-75, 76-80, 121- Lysosome MERS ER/UM uniprot/K9N7D2 125, 173-177 host Golgi apparatus [HK]x{1}K 147-150 Endoplasmic MERS reticulum ORF8b ER/UM https://www.uniprot.org/ \— \— \— \— \— \— MERS uniprot/A0A2D0Y3F8

    [0457] The localization of our Strep-tagged constructs to sequence based predicted localization was compared, and found to generally agree with the observed localization of the individually expressed proteins (FIG. 6E and Table 6A-D provided in U.S. Provisional Application No. 63/091,929 filed on Oct. 15, 2020, expressly incorporated by reference herein). This agreement suggests that sequence elements may target the proteins to each cellular compartment. Most orthologous proteins show the same localization across the viruses (FIG. 6B). Moreover, changes in localization, as observed for some viral proteins across strains, do not coincide with strong changes in viral-host protein interactions (FIG. 6F). Overall, these results suggest that changes in protein localization are unlikely to be a major source of differences in host targeting mechanisms.

    [0458] Referring to FIG. 6E, the localization of all coronavirus proteins as predicted based on a machine learning algorithm or determined experimentally for Strep-tagged construct is shown.

    [0459] Referring to FIG. 6F, the prey overlap per bait measured as Jaccard index comparing SARS-CoV-2 vs. SARS-CoV-1 (red dots) and SARS-CoV-2 vs. MERS-CoV (blue dots) for all viral baits (All), viral baits found in the same cellular compartment (Yes) and viral baits found in different compartments (No), when comparing predicted vs. experimental localization is shown.

    [0460] Comparison of Host Targeted Processes Identifies Conserved Mechanisms with Divergent Implementations

    [0461] To study the conservation of targeted host factors and processes, a clustering approach was first used to compare the overlap in protein interactions for the three viruses (FIG. 2A). 7 clusters of viral-host interactions corresponding to those that are specific to each or shared among the viruses were defined. The largest pairwise overlap was observed between SARS-CoV-1 and SARS-CoV-2 (FIG. 2A), as expected from their closer evolutionary relationship. A functional enrichment analysis (FIG. 2B and Table 9 Å-J) highlighted host processes that are targeted through interactions conserved across all three viruses including ribosome biogenesis and regulation of RNA metabolism. Conserved interactions between SARS-CoV-1 and SARS-CoV-2, but not MERS-CoV, were enriched in endosomal and Golgi vesicle transport (FIG. 2B). Despite the small fraction (7.1%) of interactions conserved between SARS-CoV-1 and MERS-CoV, but not SARS-CoV-2, these were strongly enriched in translation initiation and myosin complex proteins (FIG. 2B).

    [0462] Referring to FIG. 2B, GO enrichment analysis of each cluster from FIG. 2B is shown, with the top six most significant terms per cluster. Color indicates −log 10(q) and number of genes with significant (q<0.05; white) or non-significant enrichment (q>0.05; grey) is shown.

    TABLE-US-00017 TABLE 9A CLUSTER 1 Description GeneRatio BgRatio pvalue p.adjust geneID GO_EUKARYOTIC_ 10/36 15/18046 7.53E−25 5.09E−22 8665/8667/ 48S_PREINITIATION_ 8666/8669/ COMPLEX 3646/8661/ 10480/8663/ 27335/51386 GO_EUKARYOTIC_ 10/36 16/18046 2.01E−24 5.09E−22 8665/8667/ TRANSLATION_ 8666/8669/ INITIATION_FACTOR_3_ 3646/8661/ COMPLEX 10480/8663/ 27335/ 51386 GO_FORMATION_ 10/36 16/18046 2.01E−24 5.09E−22 8665/8667/ OF_CYTOPLASMIC_ 8666/8669/ TRANSLATION_ 3646/8661/ INITIATION_ 10480/ COMPLEX 8663/ 27335/ 51386 GO_TRANSLATION_ 10/36 18/18046 1.09E−23 2.08E−21 8665/8667/ PREINITIATION_ 8666/8669/ COMPLEX 3646/8661/ 10480/ 8663/ 27335/ 51386 GO_CYTOPLASMIC_ 10/36 31/18046 1.09E−20 1.66E−18 8665/8667/ TRANSLATIONAL_ 8666/8669/ INITIATION 3646/8661/ 10480/ 8663/ 27335/ 51386 GO_TRANSLATION_ 10/36 51/18046 3.06E−18 3.88E−16 8665/8667/ INITIATION_ 8666/8669/ FACTOR_ACTIVITY 3646/8661/ 10480/ 8663/ 27335/ 51386 GO_TRANSLATION_ 11/36 85/18046 7.07E−18 7.68E−16 10985/8665/ FACTOR_ 8667/8666/ ACTIVITY_RNA_ 8669/3646/ BINDING 8661/ 10480/ 8663/ 27335/ 51386 GO_TRANSLATION_ 11/36 109/18046 1.23E−16 1.17E−14 10985/8 REGULATOR_ 665/8667/ ACTIVITY_ 8666/ NUCLEIC_ACID_ 8669/ BINDING 3646/ 8661/ 10480/ 8663/ 27335/ 51386 GO_RIBO- 15/36 419/18046 8.55E−16 7.23E−14 55127/8665/ NUCLEOPROTEIN_ 8667/8666/ COMPLEX_ 8669/3646/ BIOGENESIS 8661/ 10480/ 8663/27335/ 51386/ 4931/9816/ 5822/57647 GO_TRANSLATION_ 11/36 140/18046 2.09E−15 1.59E−13 10985/8665/ REGULATOR_ACTIVITY 8667/8666/ 8669/3646/ 8661/10480/ 8663/27335/ 51386 GO_CYTOPLASMIC_ 10/36 99/18046 3.50E−15 2.42E−13 8665/8667/866 TRANSLATION 6/8669/3646/ 8661/10480/ 8663/ 27335/51386 GO_RIBONUCLEOPROTEIN_ 11/36 193/18046 7.48E−14 4.75E−12 8665/8667/ COMPLEX_ 8666/8669/ SUBUNIT_ORGANIZATION 3646/8661/ 10480/8663/ 27335/51386/ 5822 GO_TRANSLATIONAL_ 10/36 192/18046 2.94E−12 1.72E−10 8665/8667/ INITIATION 8666/8669/ 3646/8661/ 10480/8663/ 27335/51386 GO_ACTIN_FILAMENT_ 8/36 190/18046 3.06E−09 1.67E−07 7168/7111/ BINDING 7171/2314/ 79784/3 99687/4646/ 4644 GO_ACTIN_FILAMENT_ 7/36 143/18046 1.17E−08 5.92E−07 7168/140465/ BASED_MOVEMENT 7111/ 7171/79784/ 4646/4644 GO_VIRAL_TRANSLATION 4/36 15/18046 1.79E−08 8.52E−07 8665/8666/ 8661/51386 GO_MYOSIN_COMPLEX 5/36 55/18046 7.66E−08 3.43E−06 140465/79784/ 399687/4646/ 4644 GO_ACTOMYOSIN 5/36 79/18046 4.79E−07 2.03E−05 7168/7171/ 79784/ 399687/4644 GO_UNCONVENTIONAL_ 3/36 10/18046 8.67E−07 3.47E−05 140465/4646/ MYOSIN_COMPLEX 4644 GO_MUSCLE_FILAMENT_ 4/36 39/18046 1.04E−06 3.97E−05 7168/140465/ SLIDING 7111/7171 GO_ACTIN_BINDING 8/36 428/18046 1.58E−06 5.74E−05 7168/7111/ 7171/2314/ 79784/399687/ 4646/4644 GO_ACTIN_FILAMENT 5/36 119/18046 3.67E−06 0.000126891 7168/7111/ 7171/4646/ 4644 GO_MICROFILAMENT_ 3/36 22/18046 1.09E−05 0.000361938 79784/4646/ MOTOR_ACTIVITY 4644 GO_MYOFILAMENT 3/36 27/18046 2.06E−05 0.000654302 7168/7111/ 7171 GO_TRANSLATION_ 3/36 32/18046 3.48E−05 0.001057861 8665/10480/ INITIATION_ 8663 FACTOR_BINDING GO_MATURATION_OF_ 3/36 35/18046 4.57E−05 0.001336711 55127/5822/ SSU_RRNA_FROM_ 57647 TRICISTRONIC_RRNA_ TRANSCRIPT_SSU_RRNA_ 5_8S_RRNA_LSU_RRNA GO_MUSCLE_CONTRACTION 6/36 362/18046 7.32E−05 0.0020634 8106/7168/ 140465/7111/ 7171/79784 GO_STRUCTURAL_ 3/36 43/18046 8.52E−05 0.002314901 7168/ CONSTITUENT_ 140465/7171 OF_MUSCLE GO_ACTIN_MEDIATED_ 4/36 121/18046 9.60E−05 0.002468609 7168/140465/ CELL_CONTRACTION 7111/ 7171 GO_CONTRACTILE_FIBER 5/36 235/18046 9.73E−05 0.002468609 5663/7168/ 140465/ 7111/7171 GO_MATURATION_ 3/36 47/18046 0.000111299 0.002732219 55127/ OF_SSU_RRNA 5822/57647 GO_MOTOR_ACTIVITY 4/36 136/18046 0.000150757 0.003585197 140465/ 79784/ 4646/4644 GO_IRES_DEPENDENT_ 2/36 10/18046 0.000172377 0.003858207 8665/8661 VIRAL_ TRANSLATIONAL_ INITIATION GO_REGULATION_ 2/36 10/18046 0.000172377 0.003858207 3646/8663 OF_MRNA_ BINDING GO_REGULATION_ 2/36 12/18046 0.000252186 0.005483238 3646/8663 OF_RNA_BINDING GO_RIBOSOME_BIOGENESIS 5/36 290/18046 0.00025949 0.005485334 55127/ 4931/9816/ 5822/57647 GO_MUSCLE_SYSTEM_ 6/36 470/18046 0.000303193 0.006235933 8106/7168/ PROCESS 140465/7111/ 7171/79784 GO_RIBOSOMAL_SMALL_ 3/36 68/18046 0.000334246 0.00669371 55127/5822/ SUBUNIT_BIOGENESIS 57647 GO_ACTIN_FILAMENT_ 3/36 74/18046 0.000428805 0.008367202 7168/7171/ BUNDLE 79784 GO_POSITIVE_REGULATION 4/36 182/18046 0.000458168 0.008716652 5663/3646/ OF_BINDING 8663/4931 GO_INCLUSION_BODY 3/36 78/18046 0.000500491 0.009289594 5663/8106/ 9816 GO_REGULATION_OF_ 3/36 79/18046 0.000519536 0.009413494 8667/3646/ TRANSLATIONAL_ 27335 INITIATION GO_ACTOMYOSIN_ 4/36 194/18046 0.000582726 0.010078513 7168/7111/ STRUCTURE_ 79784/ ORGANIZATION 399687 GO_VIRAL_GENE_ 4/36 194/18046 0.000582726 0.010078513 8665/8666/ EXPRESSION 8661/51386 GO_MYOSIN_II_COMPLEX 2/36 20/18046 0.000718737 0.012154636 140465/79784 GO_REGULATION_ 5/36 381/18046 0.000898813 0.014869496 5663/5195/ OF_BINDING 3646/8663/ 4931 GO_RRNA_METABOLIC_ 4/36 221/18046 0.000948179 0.015352431 55127/4931/ PROCESS 5822/57647 GO_90S_PRERIBOSOME 2/36 32/18046 0.001848268 0.029302757 55127/5822 GO_SMOOTH_ 2/36 34/18046 0.002085251 0.032385224 5663/4644 ENDOPLASMIC_ RETICULUM GO_FIBRILLAR_CENTER 3/36 130/18046 0.002192275 0.032712189 55127/5195/ 51386 GO_RIBONUCLEOPROTEIN_ 3/36 130/18046 0.002192275 0.032712189 10985/ COMPLEX_BINDING 27335/4931 GO_REGULATION_OF_ 5/36 484/18046 0.002579566 0.036640943 10985/8667/ CELLULAR_ 3646/8663/ AMIDE_METABOLIC_ 27335 PROCESS GO_AGGRESOME 2/36 38/18046 0.002600014 0.036640943 5663/9816 GO_SMALL_SUBUNIT_ 2/36 38/18046 0.002600014 0.036640943 55127/5822 PROCESSOME GO_ADP_BINDING 2/36 39/18046 0.002737128 0.037871892 399687/4646 GO_AZUROPHIL_GRANULE 3/36 155/18046 0.00360493 0.04898842 5663/10043/ 54472

    TABLE-US-00018 TABLE 9B CLUSTER 2 Description GeneRatio BgRatio pvalue p.adjust geneID GO_RIBOSOME_BIOGENESIS 21/110 290/18046 5.36E−17 9.42E−14 9136/6838/10199/ 9875/10775/23517/ 10153/10607/ 1662/9790/55035/ 25983/134430/ 11340/10200/ 79954/55759/ 65083/56915/ 51010/26574 GO_RRNA_METABOLIC_ 18/110 221/18046 1.41E−15 1.24E−12 9136/10199/9875/ PROCESS 10775/23517/ 10607/1662/9790/ 55035/25983/ 134430/11340/ 10200/79954/ 55759/65083/56915/ 51010 GO_RIBONUCLEOPROTEIN_ 22/110 419/18046 7.55E−15 4.43E−12 25980/9136/6838/ COMPLEX_BIOGENESIS 10199/9875/ 10775/23517/10153/ 10607/1662/ 9790/55035/25983/ 134430/11340/ 10200/79954/ 55759/65083/ 56915/51010/ 26574 GO_NCRNA_PROCESSING 18/110 378/18046 1.39E−11 6.10E−09 9136/10199/9875/ 10775/23517/ 10607/1662/9790/ 55035/25983/ 134430/11340/ 10200/79954/55759/ 65083/56915/ 51010 GO_NCRNA_METABOLIC_ 19/110 471/18046 6.21E−11 2.18E−08 9136/10199/9875/ PROCESS 10775/23517/ 10607/1662/9790/ 55035/56257/ 25983/134430/ 11340/10200/79954/ 55759/65083/ 56915/51010 GO_CILIARY_BASAL_ 10/110 95/18046 3.06E−10 8.98E−08 5116/5566/5577/ BODY_PLASMA_ 5108/9662/55755/ MEMBRANE_DOCKING 10142/11190/ 22994/22981 GO_PRERIBOSOME 9/110 77/18046 9.52E−10 2.39E−07 9136/10199/10607/ 9790/25983/ 134430/79954/ 55759/65083 GO_SMALL_SUBUNIT_ 7/110 38/18046 2.78E−09 6.12E−07 9136/10199/10607/ PROCESSOME 25983/134430/ 79954/65083 GO_REGULATION_OF_MRNA_ 12/110 199/18046 3.17E−09 6.20E−07 79675/26986/8531/ CATABOLIC_PROCESS 8761/23367/ 4343/26058/8087/ 9513/11340/ 56915/51010 GO_RIBONUCLEOPROTEIN_ 10/110 130/18046 6.76E−09 1.19E−06 26046/8531/1460/ COMPLEX_BINDING 23367/90850/ 25875/6731/6728/ 6729/55759 GO_MATURATION_OF_ 6/110 26/18046 9.32E−09 1.49E−06 9875/23517/11340/ 5_8S_RRNA 10200/55759/ 51010 GO_NUCLEAR_EXOSOME_ 5/110 16/18046 3.18E−08 4.66E−06 23517/11340/ RNASE_COMPLEX 10200/56915/ 51010 GO_90S_PRERIBOSOME 6/110 32/18046 3.56E−08 4.82E−06 10199/10607/ 9790/134430/ 55759/65083 GO_MEMBRANE_DOCKING 10/110 179/18046 1.43E−07 1.79E−05 5116/5566/5577/ 5108/9662/55755/ 10142/11190/ 22994/22981 GO_EXORIBONUCLEASE_ 5/110 26/18046 4.56E−07 5.01E−05 23517/11340/ COMPLEX 10200/56915/ 51010 GO_MICROTUBULE_ 5/110 26/18046 4.56E−07 5.01E−05 10426/10844/2801/ NUCLEATION 51199/10142 GO_REGULATION_OF_MRNA_ 12/110 325/18046 6.90E−07 7.14E−05 79675/26986/8531/ METABOLIC_PROCESS 8761/23367/ 4343/26058/808 7/9513/11340/ 56915/51010 GO_REGULATION_OF_CELL_ 10/110 214/18046 7.45E−07 7.28E−05 5116/5566/5577/ CYCLE_G2_M_PHASE_ 5108/9662/55755/ TRANSITION 10142/11190/ 22994/22981 GO_RNA_CATABOLIC_ 13/110 404/18046 1.09E−06 0.000100685 79675/26986/8531/ PROCESS 8761/23367/ 4343/26058/23517/ 8087/9513/11340/ 56915/51010 GO_MRNA_3_UTR_BINDING 7/110 90/18046 1.27E−06 0.000111771 26986/8531/8761/ 23367/8087/ 9513/11340 GO_CELL_CYCLE_G2_M_ 10/110 271/18046 6.19E−06 0.000518826 5116/5566/5577/ PHASE_TRANSITION 5108/9662/55755/ 10142/11190/ 22994/22981 GO_MICROTUBULE_ 6/110 76/18046 6.91E−06 0.000543595 10426/10844/ POLYMERIZATION 2801/51199/55755/ 10142 GO_MATURATION_OF_ 4/110 21/18046 7.22E−06 0.000543595 9875/11340/ 5_8S_RRNA_FROM_ 55759/51010 TRICISTRONIC_RRNA_ TRANSCRIPT_SSU_RRNA_ 5_8S_RRNA_LSU_RRNA GO_REGULATION_OF_CELL_ 13/110 482/18046 7.51E−06 0.000543595 5116/5566/5577/ CYCLE_PHASE_TRANSITION 5108/9662/55755/ 10142/11190/ 22994/22981/ 26058/1642/ 56257 GO_SNRNA_METABOLIC_ 5/110 45/18046 7.73E−06 0.000543595 23517/56257/ PROCESS 11340/56915/ 51010 GO_MICROTUBULE_ 7/110 133/18046 1.71E−05 0.001155066 2801/5108/ ORGANIZING_ 9662/ CENTER_ORGANIZATION 51199/55755/ 11190/22994 GO_CAMP_DEPENDENT_ 3/110 10/18046 2.56E−05 0.001554821 5576/5566/5577 PROTEIN_ KINASE_COMPLEX GO_MICROTUBULE_ 3/110 10/18046 2.56E−05 0.001554821 5108/51199/ ANCHORING_AT_ 22981 CENTROSOME GO_NUCLEAR_ 3/110 10/18046 2.56E−05 0.001554821 11340/56915/ TRANSCRIBED_ 51010 MRNA_CATABOLIC_ PROCESS_ EXONUCLEOLYTIC_3_5 GO_MICROBODY_ 5/110 60/18046 3.21E−05 0.001883182 3615/11001/ MEMBRANE 8540/ 2181/84896 GO_CYTOPLASMIC_STRESS_ 5/110 63/18046 4.07E−05 0.002264705 26986/8761/23367/ GRANULE 4343/26058 GO_PROTEIN_LOCALIZATION 4/110 32/18046 4.12E−05 0.002264705 2804/5108/11190/ TO_MICROTUBULE_ 22994 ORGANIZING_CENTER GO_MICROTUBULE_ 3/110 12/18046 4.66E−05 0.002482798 5108/51199/ ANCHORING_AT_ 22981 MICROTUBULE_ ORGANIZING_ CENTER GO_MICROTUBULE 11/110 421/18046 5.25E−05 0.00264541 10426/10844/ 6902/10513/5116/ 2801/51199/ 55755/51361/ 22981/55829 GO_NCRNA_CATABOLIC_ 4/110 34/18046 5.26E−05 0.00264541 23517/11340/ PROCESS 56915/51010 GO_CIS_GOLGI_NETWORK 5/110 68/18046 5.90E−05 0.002718958 286451/2801/ 2804/10142/26229 GO_RIBOSOMAL_SMALL_ 5/110 68/18046 5.90E−05 0.002718958 6838/10607/9790/ SUBUNIT_BIOGENESIS 25983/79954 GO_MATURATION_OF_SSU_ 4/110 35/18046 5.92E−05 0.002718958 10607/9790/ RRNA_FROM_ 25983/79954 TRICISTRONIC_RRNA_ TRANSCRIPT_SSU_RRNA_ 5_8S_RRNA_LSU_RRNA GO_CENTRIOLE_CENTRIOLE_ 3/110 13/18046 6.03E−05 0.002718958 9662/51199/ COHESION 11190 GO_MICROTUBULE_ 6/110 114/18046 6.99E−05 0.003074733 10426/10844/ POLYMERIZATION_ 2801/51199/ OR_DEPOLYMERIZATION 55755/10142 GO_CYTOPLASMIC_ 3/110 14/18046 7.64E−05 0.003277085 11340/ EXOSOME_RNASE_ 56915/ COMPLEX 51010 GO_ 4/110 38/18046 8.22E−05 0.003443648 1459/1460/ PHOSPHATIDYLCHOLINE_ 1457/ BIOSYNTHETIC_PROCESS 2181 GO_RNA_SURVEILLANCE 3/110 15/18046 9.51E−05 0.003888504 11340/56915/ 51010 GO_CILIUM_ORGANIZATION 10/110 381/18046 0.000112518 0.00449817 5116/5566/5577/ 5108/9662/55755/ 10142/11190/ 22994/22981 GO_ACTIVATION_ 3/110 18/18046 0.000168219 0.006575502 5576/5566/5577 OF_PROTEIN_ KINASE_A_ACTIVITY GO_REGULATION_ 11/110 484/18046 0.000180131 0.006888039 26046/26986/ OF_CELLULAR_ 8531/23367/ AMIDE_METABOLIC_ 4343/9470/ PROCESS 26058/90850/ 8087/9513/25983 GO_MATURATION_OF_ 4/110 47/18046 0.000190485 0.007129015 10607/9790/ SSU_RRNA 25983/79954 GO_RRNA_CATABOLIC_ 3/110 19/18046 0.000198875 0.007287949 11340/56915/ PROCESS 51010 GO_PROTEIN_KINASE_ 4/110 49/18046 0.000224166 0.007914213 5576/5566/5577/ A_BINDING 10142 GO_CENTRIOLE 6/110 141/18046 0.000224963 0.007914213 10426/5116/5108/ 9662/51199/ 11190 GO_GOLGI_ORGANIZATION 6/110 142/18046 0.000233737 0.008061652 2801/2804/9659/ 10142/64689/ 51361 GO_GAMMA_TUBULIN_ 3/110 21/18046 0.000270553 0.008979313 10426/10844/ COMPLEX 55755 GO_PERICENTRIOLAR_ 3/110 21/18046 0.000270553 0.008979313 5108/51199/ MATERIAL 55755 GO_CYTOPLASMIC_ 4/110 53/18046 0.000304068 0.009904742 10426/ MICROTUBULE_ 10844/5108/ ORGANIZATION 51361 GO_POSITIVE_REGULATION_ 6/110 153/18046 0.000349203 0.011168142 1459/5116/5566/ OF_INTRACELLULAR_ 5108/22994/ PROTEIN_TRANSPORT 26229 GO_RIBOSOME_BINDING 4/110 57/18046 0.00040258 0.012645311 90850/25875/ 6731/6728 GO_PROTEIN_ 4/110 58/18046 0.000430385 0.013281524 2804/5108/ LOCALIZATION_ 11190/ TO_CYTOSKELETON 22994 GO_REGULATION_OF_ 7/110 227/18046 0.000482586 0.014635663 1459/5116/5566/ INTRACELLULAR_ 5108/56850/ PROTEIN_TRANSPORT 22994/26229 GO_RIBONUCLEOPROTEIN_ 7/110 229/18046 0.000508497 0.01467639 26986/8761/ GRANULE 23367/4343/ 26058/ 8087/9513 GO_CELLULAR_ 3/110 26/18046 0.000517303 0.01467639 5576/5566/5577 RESPONSE_TO_ GLUCAGON_STIMULUS GO_GAMMA_TUBULIN_ 3/110 26/18046 0.000517303 0.01467639 10426/10844/ BINDING 55755 GO_MICROTUBULE_ 3/110 26/18046 0.000517303 0.01467639 5108/51199/ ANCHORING 22981 GO_SMALL_NUCLEOLAR_ 3/110 27/18046 0.000579393 0.016177018 9136/10199/ RIBONUCLEOPROTEIN_ 10775 COMPLEX GO_ACID_THIOL_LIGASE_ 3/110 30/18046 0.000793603 0.021476108 8803/11001/ ACTIVITY 2181 GO_SNRNA_3_END_ 3/110 30/18046 0.000793603 0.021476108 11340/56915/ PROCESSING 51010 GO_POSITIVE_REGULATION_ 8/110 326/18046 0.000864162 0.022872592 1459/5116/5566/ OF_CELLULAR_PROTEIN_ 5108/11190/22994/ LOCALIZATION 26229/2181 GO_RENAL_SYSTEM_ 5/110 121/18046 0.000871213 0.022872592 5576/5566/5577/ PROCESS 4643/1312 GO_POSITIVE_REGULATION_ 3/110 33/18046 0.001052412 0.02722342 51199/55755/ OF_MICROTUBULE_ 10142 POLYMERIZATION_ OR_DEPOLYMERIZATION GO_POSITIVE_REGULATION_ 5/110 129/18046 0.001160757 0.029590902 26986/8531/ OF_TRANSLATION 23367/8087/9513 GO_CILIARY_BASE 3/110 35/18046 0.001251353 0.030273116 5576/5566/5577 GO_NUCLEAR_ 3/110 35/18046 0.001251353 0.030273116 11340/56915/ TRANSCRIBED_MRNA_ 51010 CATABOLIC_PROCESS_ EXONUCLEOLYTIC GO_POSITIVE_REGULATION_ 3/110 35/18046 0.001251353 0.030273116 26986/23367/ OF_VIRAL_GENOME_ 1642 REPLICATION GO_NUCLEAR_ 4/110 77/18046 0.00125636 0.030273116 26986/11340/ TRANSCRIBED_MRNA_ 56915/51010 CATABOLIC_PROCESS_ DEADENYLATION_ DEPENDENT_DECAY GO_RENAL_WATER_ 3/110 36/18046 0.001359091 0.031875216 5576/5566/5577 HOMEOSTASIS GO_SNRNA_PROCESSING 3/110 36/18046 0.001359091 0.031875216 11340/56915/ 51010 GO_MICROBODY 5/110 135/18046 0.001420656 0.032880711 3615/11001/8540/ 2181/84896 GO_RESPONSE_TO_ 3/110 37/18046 0.001472489 0.033637768 5576/5566/5577 GLUCAGON GO_CALCIUM_ 2/110 10/18046 0.001604815 0.03573253 490/27032 TRANSMEMBRANE_ TRANSPORTER_ACTIVITY_ PHOSPHORYLATIVE_ MECHANISM GO_CAMP_DEPENDENT_ 2/110 10/18046 0.001604815 0.03573253 5576/5577 PROTEIN_KINASE_ REGULATOR_ACTIVITY GO_AMMONIUM_ION_ 6/110 206/18046 0.001646653 0.035763652 1459/1460/1457/ METABOLIC_PROCESS 5447/2181/1312 GO_ 4/110 83/18046 0.001659036 0.035763652 1459/1460/1457/ PHOSPHATIDYLCHOLINE_ 2181 METABOLIC_PROCESS GO_TRANSLATION_ 5/110 140/18046 0.001668098 0.035763652 26986/23367/ REGULATOR_ACTIVITY 9470/8087/9513 GO_POSITIVE_REGULATION_ 6/110 207/18046 0.00168754 0.035763652 1459/5116/5566/ OF_INTRACELLULAR_ 5108/22994/ TRANSPORT 26229 GO_LIGASE_ACTIVITY_ 3/110 40/18046 0.001847707 0.038691864 8803/11001/2181 FORMING_CARBON_ SULFUR_BONDS GO_LEUCINE_ZIPPER_ 2/110 11/18046 0.001953643 0.039499517 23085/26574 DOMAIN_BINDING GO_MEDIUM_CHAIN_FATTY_ 2/110 11/18046 0.001953643 0.039499517 11001/2181 ACID_COA_LIGASE_ ACTIVITY GO_NEGATIVE_ 2/110 11/18046 0.001953643 0.039499517 5576/5577 REGULATION_ OF_CAMP_DEPENDENT_ PROTEIN_KINASE_ACTIVITY GO_RNA_PHOSPHODIESTER_ 5/110 148/18046 0.002127914 0.042534098 4343/10775/11340/ BOND_HYDROLYSIS 56915/51010 GO_GOLGI_STACK 5/110 150/18046 0.002256012 0.043235401 286451/2802/2801/ 2804/10142 GO_RNA_PHOSPHODIESTER_ 3/110 43/18046 0.002277594 0.043235401 11340/56915/ BOND_HYDROLYSIS_ 51010 EXONUCLEOLYTIC GO_PROTEIN_FOLDING 6/110 220/18046 0.002292386 0.043235401 1459/1460/1457/ 6902/7841/ 131118 GO_MICROTUBULE_MINUS_ 2/110 12/18046 0.002335056 0.043235401 10426/10844 END_BINDING GO_POSITIVE_REGULATION_ 2/110 12/18046 0.002335056 0.043235401 2801/64689 OF_UBIQUITIN_PROTEIN_ LIGASE_ACTIVITY GO_RNA_7_ 2/110 12/18046 0.002335056 0.043235401 23367/9470 METHYLGUANOSINE_ CAP_BINDING GO_SNORNA_3_END_ 2/110 12/18046 0.002335056 0.043235401 56915/51010 PROCESSING GO_POSITIVE_REGULATION_ 5/110 156/18046 0.002674059 0.048150038 26986/8531/ OF_CELLULAR_AMIDE_ 23367/8087/9513 METABOLIC_PROCESS GO_NEGATIVE_REGULATION_ 6/110 228/18046 0.002738195 0.048150038 23367/4343/ OF_CELLULAR_AMIDE_ 9470/26058/ METABOLIC_PROCESS 8087/9513 GO_LONG_CHAIN_FATTY_ 2/110 13/18046 0.002748651 0.048150038 11001/2181 ACID_COA_ LIGASE_ACTIVITY GO_PROTEIN_KINASE_A_ 2/110 13/18046 0.002748651 0.048150038 5576/5577 CATALYTIC_ SUBUNIT_BINDING GO_TRANSLATION_ 2/110 13/18046 0.002748651 0.048150038 26986/23367 ACTIVATOR_ACTIVITY GO_REGULATION_OF_ 3/110 46/18046 0.002764726 0.048150038 5898/8087/9513 FILOPODIUM_ASSEMBLY

    TABLE-US-00019 TABLE 9C CLUSTER 3 Description GeneRatio BgRatio pvalue p.adjust geneID GO_UBIQUITIN_LIGASE_ 7/54 284/18046 2.09E−05 0.021996873 51646/57610/ COMPLEX 10296/10048/ 80232/64795/54994

    TABLE-US-00020 TABLE 9D CLUSTER 4 Description GeneRatio BgRatio pvalue p.adjust geneID GO_TELOMERE_ 6/120 27/18046 2.01E−08 2.43E−05 5976/5422/ MAINTENANCE_ 5557/5558/ VIA_SEMI_CONSERVATIVE_ 23649/1763 REPLICATION GO_GDP_BINDING 8/120 74/18046 3.16E−08 2.43E−05 5878/7879/4218/ 5862/10890/51552/ 387/22931 GO_RAB_PROTEIN_SIGNAL_ 8/120 75/18046 3.51E−08 2.43E−05 5878/7879/4218/5862/ TRANSDUCTION 10890/51552/5861/ 22931 GO_GOLGI_VESICLE_ 14/120 367/18046 1.54E−07 7.98E−05 10897/10945/ TRANSPORT 1781/90522/ 23041/26958/57222/ 28952/54520/4218/ 10890/51552/5861/ 10960 GO_DNA_POLYMERASE_ 5/120 22/18046 2.88E−07 0.000119247 5422/5557/5558/ COMPLEX 23649/1763 GO_RAS_PROTEIN_SIGNAL_ 14/120 447/18046 1.63E−06 0.000564801 10146/9908/5962/ TRANSDUCTION 382/117178/ 5878/7879/4218/ 5862/10890/51552/ 387/5861/22931 GO_COATED_VESICLE 11/120 290/18046 3.76E−06 0.001081198 8546/10897/10945/ 90522/26958/ 161/57222/1173/ 4218/51552/10960 GO_CELL_CYCLE_DNA_ 6/120 64/18046 4.17E−06 0.001081198 5976/5422/5557/ REPLICATION 5558/23649/1763 GO_CELLULAR_TRANSITION_ 7/120 110/18046 8.71E−06 0.002006511 22/523/25800/23516/ METAL_ION_HOMEOSTASIS 10463/28982/28952 GO_GTPASE_ACTIVITY 11/120 323/18046 1.04E−05 0.002163487 382/5878/7879/4218/ 5862/10890/51552/ 387/5861/2787/22931 GO_ENDOSOMAL_ 9/120 228/18046 2.17E−05 0.00400846 8546/382/28952/ TRANSPORT 54520/23085/7879/ 4218/10890/51552 GO_ENDOPLASMIC_ 7/120 129/18046 2.47E−05 0.00400846 10897/10945/ RETICULUM_GOLGI_ 90522/26958/ INTERMEDIATE_ 57222/5862/10960 COMPARTMENT GO_GOLGI_ASSOCIATED_ 8/120 178/18046 2.51E−05 0.00400846 10897/10945/90522/ VESICLE 26958/57222/ 4218/51552/10960 GO_REPLISOME 4/120 27/18046 2.90E−05 0.004150096 5422/5557/5558/ 23649 GO_TRANSITION_METAL_ 7/120 133/18046 3.00E−05 0.004150096 22/523/25800/23516/ ION_HOMEOSTASIS 10463/28982/28952 GO_ENDOPLASMIC_ 8/120 207/18046 7.33E−05 0.009498922 10897/10945/ RETICULUM_TO_ 1781/90522/26958/ GOLGI_VESICLE_ 57222/5861/ MEDIATED_TRANSPORT 10960 GO_ENDOCYTIC_VESICLE_ 7/120 160/18046 9.71E−05 0.011308379 79971/161/1173/ MEMBRANE 7879/4218/10890/949 GO_VACUOLAR_MEMBRANE 11/120 414/18046 0.000100218 0.011308379 8546/10548/ 2040/523/161/ 1173/5878/7879/ 5862/51552/949 GO_DNA_REPLICATION_ 4/120 37/18046 0.000103646 0.011308379 5422/5557/5558/ INITIATION 23649 GO_ANTIGEN_PROCESSING_ 8/120 227/18046 0.000139042 0.014411745 8546/5714/1781/161/ AND_PRESENTATION 1173/3416/ 7879/10890 GO_ENDOPLASMIC_ 3/120 16/18046 0.000150747 0.014788353 57142/10890/22931 RETICULUM_ TUBULAR_NETWORK_ ORGANIZATION GO_ENDOCYTIC_VESICLE 9/120 296/18046 0.000162191 0.014788353 79971/161/1173/382/ 7879/4218/10890/ 51552/949 GO_SECRETORY_GRANULE_ 9/120 298/18046 0.000170572 0.014788353 2040/196527/161/ MEMBRANE 5878/7879/10890/ 51552/387/22931 GO_NUCLEAR_ 4/120 42/18046 0.000171211 0.014788353 5422/5557/5558/ REPLICATION_FORK 23649 GO_MYOSIN_V_BINDING 3/120 17/18046 0.000182163 0.014974885 4218/10890/51552 GO_TRANSITION_METAL_ 6/120 125/18046 0.000187818 0.014974885 22/523/25800/23516/ ION_TRANSPORT 10463/28982 GO_LIPID_DROPLET 5/120 82/18046 0.000216849 0.016615957 10280/1727/5878/ 7879/23111 GO_ENDOCYTIC_RECYCLING 4/120 45/18046 0.000224432 0.016615957 382/28952/54520/ 51552 GO_RETROGRADE_VESICLE_ 5/120 86/18046 0.000270997 0.019371637 10945/26958/57222/ MEDIATED_TRANSPORT_ 5861/10960 GOLGI_TO_ ENDOPLASMIC_RETICULUM GO_GUANYL_NUCLEOTIDE_ 10/120 396/18046 0.000314413 0.02172592 382/5878/7879/4218/ BINDING 5862/10890/51552/ 387/5861/22931 GO_ENDOPLASMIC_ 3/120 21/18046 0.00034944 0.023367362 57142/10890/22931 RETICULUM_ TUBULAR_NETWORK GO_DNA_DEPENDENT_DNA_ 6/120 146/18046 0.000433554 0.028086201 5976/5422/5557/ REPLICATION 5558/23649/1763 GO_ENDOPLASMIC_ 4/120 57/18046 0.000559585 0.034128969 57142/10890/ RETICULUM_ 10960/22931 ORGANIZATION GO_POST_GOLGI_ 5/120 101/18046 0.000569486 0.034128969 23041/28952/ VESICLE_MEDIATED_ 54520/10890/ TRANSPORT 51552 GO_CLATHRIN_ADAPTOR_ 3/120 25/18046 0.000592688 0.034128969 8546/161/1173 COMPLEX GO_ENDOPLASMIC_ 3/120 25/18046 0.000592688 0.034128969 57142/10890/22931 RETICULUM_ SUBCOMPARTMENT GO_ENDOMEMBRANE_ 10/120 436/18046 0.0006663 0.036683711 196527/57142/ SYSTEM_ 26993/7879/5862/ ORGANIZATION 10890/5861/ 10960/26092/22931 GO_MAINTENANCE_OF_ 5/120 105/18046 0.000679769 0.036683711 10945/9908/28952/ PROTEIN_LOCATION 2200/2201 GO_ATPASE_ACTIVITY 10/120 438/18046 0.000690142 0.036683711 22/481/1781/ 79572/10146/5976/ 1763/3416/ 10632/2963 GO_PIGMENT_GRANULE 5/120 106/18046 0.000709675 0.036778921 2040/5878/7879/ 5862/5861 GO_ZINC_ION_TRANSPORT 3/120 27/18046 0.000746478 0.037742667 25800/23516/10463 GO_RNA_POLYMERASE_ 5/120 112/18046 0.00091026 0.044927838 5422/5557/5558/ COMPLEX 23649/2963 GO_RETROGRADE_ 3/120 30/18046 0.001021201 0.049231367 28952/54520/4218 TRANSPORT_ ENDOSOME_TO_PLASMA_ MEMBRANE

    TABLE-US-00021 TABLE 9E CLUSTER 5 Description GeneRatio BgRatio pvalue p.adjust geneID GO_DNA_DEALKYLATION_ 3/113 10/18046 2.78E−05 0.03091315 10973/51008/84164 INVOLVED_IN_DNA_REPAIR GO_CHAPERONE_BINDING 6/113 102/18046 4.36E−05 0.03091315 4189/7157/8975/3337/ 11080/26520 GO_FATTY_ACID_ 6/113 104/18046 4.86E−05 0.03091315 2475/33/10005/3295/ CATABOLIC_PROCESS 11001/10999 GO_CELLULAR_LIPID_ 8/113 212/18046 5.66E−05 0.03091315 2475/33/10005/ CATABOLIC_PROCESS 3295/11001/10999/ 26090/284161 GO_COENZYME_BINDING 9/113 287/18046 8.09E−05 0.03091315 9517/33/7296/ 55034/10243/1727/ 23530/64757/5033 GO_FATTY_ACID_BETA_ 5/113 71/18046 8.25E−05 0.03091315 2475/33/10005/3295/ OXIDATION 11001 GO_ORGANELLE_ 10/113 382/18046 0.000143908 0.043242626 79971/25923/79586/ SUBCOMPARTMENT 23256/2530/55717/ 55968/3482/2590/6786 GO_MONOCARBOXYLIC_ 6/113 128/18046 0.000153888 0.043242626 2475/33/10005/ ACID_CATABOLIC_ 3295/11001/10999 PROCESS GO_MANNOSE_BINDING 3/113 19/18046 0.000215323 0.049194879 81562/3482/3998 GO_PROTEIN_ 8/113 266/18046 0.000270323 0.049194879 23534/6774/ LOCALIZATION_ 7704/51366/7157/ TO_NUCLEUS 163590/10527/55027 GO_NUCLEAR_ENVELOPE_ 4/113 51/18046 0.000290316 0.049194879 79188/55968/5520/26993 ORGANIZATION GO_OUTER_MEMBRANE 7/113 204/18046 0.000298904 0.049194879 140707/54708/2475/1727/ 64757/51566/23098 GO_CELL_CYCLE_G2_M_ 8/113 271/18046 0.000306374 0.049194879 7157/4361/5520/9113/ PHASE_TRANSITION 5704/55722/26993/5715 GO_ORGANIC_ACID_ 8/113 271/18046 0.000306374 0.049194879 2475/33/10005/3295/ CATABOLIC_PROCESS 11001/10999/51449/501

    TABLE-US-00022 TABLE 9F CLUSTER 6 Description GeneRatio BgRatio pvalue p.adjust geneID GO_STRUCTURAL_ 6/74 28/18046 1.36E−09 1.49E−06 10204/8021/ CONSTITUENT_OF_ 23636/53371/ NUCLEAR_PORE 4927/9818 GO_PROTEIN_TARGETING_ 7/74 101/18046 1.85E−07 0.000101221 9512/23203/ TO_MITOCHONDRION 10531/26519/ 90580/26515/ 26520 GO_NCRNA_EXPORT_FROM_ 5/74 38/18046 4.57E−07 0.000166955 8021/23636/ NUCLEUS 53371/ 4927/9818 GO_PROTEIN_ 7/74 141/18046 1.78E−06 0.000457903 9512/23203/ LOCALIZATION_ 10531/26519/ TO_MITOCHONDRION 90580/26515/ 26520 GO_NUCLEAR_PORE 6/74 92/18046 2.09E−06 0.000457903 10204/8021/ 23636/53371/ 4927/9818 GO_MULTI_ORGANISM_ 5/74 62/18046 5.45E−06 0.000996971 8021/23636/ LOCALIZATION 53371/4927/ 9818 GO_PROTEIN_TARGETING 10/74 428/18046 9.39E−06 0.001347342 9512/23203/ 10531/5189/ 252983/26519/ 90580/26515/ 26520/53371 GO_PROTEIN_INSERTION_ 3/74 11/18046 1.07E−05 0.001347342 26519/90580/ INTO_ 26520 MITOCHONDRIAL_INNER_ MEMBRANE GO_MITOCHONDRIAL_ 8/74 260/18046 1.11E−05 0.001347342 9512/23203/ PROTEIN_COMPLEX 26519/90580/ 55735/26515/ 26520/51116 GO_PROTEIN_IMPORT 7/74 192/18046 1.36E−05 0.001391633 10204/5189/ 8021/23636/ 53371/4927/ 9818 GO_HOST_ 5/74 75/18046 1.40E−05 0.001391633 8021/23636/ CELLULAR_COMPONENT 53371/ 4927/9818 GO_REGULATION_ 5/74 79/18046 1.80E−05 0.001644711 8021/23636/ OF_CELLULAR_ 53371/ RESPONSE_TO_HEAT 4927/9818 GO_PROTEIN_SUMOYLATION 5/74 81/18046 2.03E−05 0.001715002 8021/23636/53371/ 4927/9818 GO_REGULATION_OF_ 5/74 87/18046 2.88E−05 0.002222589 8021/23636/ CARBOHYDRATE_ 53371/4927/ CATABOLIC_PROCESS 9818 GO_ORGANELLE_ENVELOPE_ 5/74 88/18046 3.04E−05 0.002222589 2671/26519/90580/ LUMEN 26515/26520 GO_MRNA_TRANSPORT 6/74 151/18046 3.60E−05 0.002469664 10204/8021/23636/ 53371/4927/9818 GO_INNER_MITOCHONDRIAL_ 4/74 47/18046 4.07E−05 0.002623514 26519/90580/ MEMBRANE_ 55735/26520 ORGANIZATION GO_ESTABLISHMENT_ 3/74 17/18046 4.32E−05 0.002632126 26519/90580/ OF_PROTEIN_ 26520 LOCALIZATION_TO_ MITOCHONDRIAL_MEMBRANE GO_IMPORT_INTO_NUCLEUS 6/74 164/18046 5.72E−05 0.0032999 10204/8021/ 23636/53371/ 4927/9818 GO_REGULATION_OF_ 5/74 105/18046 7.10E−05 0.003892571 10204/8021/ NUCLEOCYTOPLASMIC_ 23636/ TRANSPORT 53371/9818 GO_MITOCHONDRIAL_ 7/74 258/18046 8.96E−05 0.00445808 9512/23203/ TRANSPORT 10531/26519/ 90580/26515/ 26520 GO_MRNA_EXPORT_FROM_ 5/74 111/18046 9.24E−05 0.00445808 8021/23636/ NUCLEUS 53371/4927/9818 GO_REGULATION_OF_ 4/74 58/18046 9.35E−05 0.00445808 10204/23636/ PROTEIN_IMPORT 53371/9818 GO_REGULATION_OF_ 5/74 116/18046 0.000113831 0.005203046 8021/23636/ POSTTRANSCRIPTIONAL_ 53371/ GENE_SILENCING 4927/9818 GO_REGULATION_ 5/74 118/18046 0.000123389 0.005414302 8021/23636/ OF_NUCLEOTIDE_ 53371/ METABOLIC_PROCESS 4927/9818 GO_REGULATION_OF_ATP_ 5/74 121/18046 0.000138865 0.005577514 8021/23636/ METABOLIC_PROCESS 53371/4927/9818 GO_VIRAL_GENE_ 6/74 194/18046 0.000144237 0.005577514 22954/8021/ EXPRESSION 23636/53371/ 4927/9818 GO_ADP_METABOLIC_ 5/74 122/18046 0.00014434 0.005577514 8021/23636/53371/ PROCESS 4927/9818 GO_NUCLEAR_EXPORT 6/74 195/18046 0.000148338 0.005577514 10204/8021/23636/ 53371/4927/9818 GO_ESTABLISHMENT_OF_ 6/74 196/18046 0.00015253 0.005577514 10204/8021/ RNA_LOCALIZATION 23636/53371/ 4927/9818 GO_NUCLEOTIDE_ 5/74 134/18046 0.00022379 0.007919271 8021/23636/53371/ PHOSPHORYLATION 4927/9818 GO_RNA_EXPORT_FROM_ 5/74 136/18046 0.000239741 0.008218637 8021/23636/53371/ NUCLEUS 4927/9818 GO_FLEMMING_BODY 3/74 31/18046 0.000273955 0.00910694 11064/55165/ 23636 GO_CENTRIOLE 5/74 141/18046 0.00028341 0.009144139 8481/8924/55165/ 145508/49856 GO_CELLULAR_RESPONSE_ 5/74 142/18046 0.000292823 0.009177922 8021/23636/53371/ TO_HEAT 4927/9818 GO_RNA_LOCALIZATION 6/74 229/18046 0.000352829 0.010751487 10204/8021/23636/ 53371/4927/9818 GO_PYRUVATE_METABOLIC_ 5/74 150/18046 0.00037694 0.011175752 8021/23636/53371/ PROCESS 4927/9818 GO_NUCLEOSIDE_ 5/74 154/18046 0.000425286 0.011962536 8021/23636/ DIPHOSPHATE_ 53371/4927/ METABOLIC_PROCESS 9818 GO_REGULATION_OF_GENE 5/74 154/18046 0.000425286 0.011962536 8021/23636/53371/ SILENCING 4927/9818 GO_NUCLEOBASE_ 6/74 240/18046 0.000452662 0.012414247 10204/8021/ CONTAINING_COMPOUND_ 23636/53371/ TRANSPORT 4927/9818 GO_REGULATION_ 5/74 157/18046 0.000464512 0.01242854 8021/23636/ OF_GENERATION_OF_ 53371/ PRECURSOR_METABOLITES_ 4927/9818 AND_ENERGY GO_HIPPO_SIGNALING 3/74 38/18046 0.000503668 0.01315534 6789/6788/60485 GO_NEGATIVE_REGULATION_ 3/74 40/18046 0.000586424 0.014960644 6789/6788/60485 OF_ORGAN_GROWTH GO_UBIQUITIN_LIKE_ 4/74 96/18046 0.000650796 0.016225522 8924/22954/ PROTEIN_BINDING 29761/23636 GO_PROTEIN_TRIMERIZATION 3/74 42/18046 0.000677399 0.016513494 23636/53371/9818 GO_PROTEIN_LOCALIZATION_ 6/74 266/18046 0.000776573 0.018519573 10204/8021/ TO_NUCLEUS 23636/53371/ 4927/9818 GO_PROTEIN_ 3/74 46/18046 0.000885264 0.020358488 26519/90580/ INSERTION_INTO_ 26520 MITOCHONDRIAL_MEMBRANE GO_CHAPERONE_MEDIATED_ 2/74 11/18046 0.0008908 0.020358488 26519/26520 PROTEIN_TRANSPORT GO_RESPONSE_TO_HEAT 5/74 183/18046 0.000928986 0.020797914 8021/23636/53371/ 4927/9818 GO_POSITIVE_REGULATION_ 5/74 184/18046 0.00095192 0.020885115 23476/57153/22954/ OF_I_KAPPAB_KINASE_NF_ 29110/23636 KAPPAB_SIGNALING GO_HEPATOCYTE_APOPTOTIC_ 2/74 12/18046 0.001066124 0.022932111 6789/6788 PROCESS GO_NEGATIVE_REGULATION_ 4/74 111/18046 0.001120296 0.02363394 10505/6789/6788/ OF_DEVELOPMENTAL_ 60485 GROWTH GO_MITOCHONDRIAL_ 2/74 13/18046 0.001256622 0.026009714 9512/23203 PROTEIN_PROCESSING GO_CARBOHYDRATE_ 5/74 198/18046 0.001319193 0.026799156 8021/23636/53371/ CATABOLIC_PROCESS 4927/9818 GO_REGULATION_OF_PROTEIN_ 4/74 119/18046 0.001449261 0.028140401 10204/23636/ LOCALIZATION_TO_NUCLEUS 53371/9818 GO_ENDOCARDIUM_ 2/74 14/18046 0.001462172 0.028140401 6789/6788 DEVELOPMENT GO_POSITIVE_REGULATION_ 2/74 14/18046 0.001462172 0.028140401 6789/6788 OF_EXTRINSIC_APOPTOTIC_ SIGNALING_PATHWAY_VIA_ DEATH_DOMAIN_RECEPTORS GO_REGULATION_ 5/74 204/18046 0.00150506 0.028466402 8021/23636/ OF_CARBOHYDRATE_ 53371/ METABOLIC_PROCESS 4927/9818 GO_PROTEIN_INSERTION_ 3/74 62/18046 0.002104496 0.03912935 26519/90580/ INTO_MEMBRANE 26520 GO_VIRAL_LIFE_CYCLE 6/74 328/18046 0.002261425 0.040133817 22954/8021/ 23636/ 53371/4927/ 9818 GO_INNER_MITOCHONDRIAL_ 4/74 135/18046 0.002299199 0.040133817 26519/90580/ MEMBRANE_PROTEIN_ 55735/26515 COMPLEX GO_MITOCHONDRIAL_ 4/74 135/18046 0.002299199 0.040133817 26519/90580/ MEMBRANE_ 55735/26520 ORGANIZATION GO_POSITIVE_REGULATION_ 3/74 64/18046 0.002304859 0.040133817 6789/6788/60485 OF_FAT_CELL_ DIFFERENTIATION

    TABLE-US-00023 TABLE 9G MERS Description GeneRatio BgRatio pvalue p adjust geneID GO_RIBOSOME_BIOGENESIS 37/289 290/18046 8.90E−23 2.93E−19 55127/11340/4931/ 9875/10775/23517/ 10153/10607/1662/ 9816/5822/55035/55027/ 134430/10200/79954/ 55759/65083/27341/ 29889/23212/117246/ 55661/10969/26574/ 51013/10199/9136/ 79066/57647/88745/ 92856/51187/51116/ 51118/65003/708 GO_RIBONUCLEOPROTEIN_ 41/289 419/18046 9.47E−21 1.56E−17 55127/11340/8663/ COMPLEX_BIOGENESIS 10480/4931/9875/10775/ 23517/10153/10607/ 1662/9816/5822/ 55035/55027/134430/ 10200/79954/55759/ 65083/27341/29889/ 23212/117246/55661/ 10969/26574/51013/ 10199/9136/79066/ 57647/88745/92856/ 96764/51187/23405/ 51116/51118/65003/ 708 GO_RRNA_METABOLIC_ 29/289 221/18046 2.19E−18 2.40E−15 55127/115752/11340/ PROCESS 4931/9875/10775/ 23517/10607/1662/ 5822/55035/134430/ 10200/79954/55759/ 65083/27341/23212/ 117246/55661/10969/ 51013/10199/9136/ 79066/57647/88745/ 92856/51118 GO_NCRNA_PROCESSING 33/289 378/18046 2.16E−15 1.78E−12 55127/4087/11340/ 4931/9875/10775/ 23517/10607/1662/5822/ 55035/134430/10200/ 79954/55759/65083/ 27341/23212/117246/ 55661/10969/51013/ 10199/9136/8575/ 79670/79066/57647/ 88745/92856/81890/ 23405/51118 GO_NCRNA_METABOLIC_ 36/289 471/18046 6.72E−15 4.42E−12 55127/4087/115752/ PROCESS 11340/4931/9875/ 10775/23517/10607/ 1662/5822/55035/134430/ 10200/79954/55759/ 65083/27341/23212/ 117246/55661/ 10969/51013/2617/ 10199/9136/8575/79670/ 56257/79066/57647/ 88745/92856/81890/ 23405/51118 GO_PRERIBOSOME 16/289  77/18046 7.03E−14 3.85E−11 55127/10607/5822/ 134430/79954/55759/ 65083/27341/23212/ 117246/10969/10199/ 9136/88745/92856/ 51118 GO_90S_PRERIBOSOME 10/289  32/18046 4.49E−11 2.11E−08 55127/10607/5822/ 134430/55759/65083/ 27341/10199/88745/ 92856 GO_RIBONUCLEOPROTEIN_ 16/289 130/18046 2.92E−10 1.04E−07 26046/10985/2475/ COMPLEX_BINDING 85451/25875/4931/ 55759/29789/4830/ 6731/6728/3508/6729/ 23107/708/7917 GO_SMALL_SUBUNIT_ 10/289  38/18046 3.02E−10 1.04E−07 55127/10607/5822/ PROCESSOME 134430/79954/65083/ 10199/9136/92856/ 51118 GO_MITOCHONDRIAL_  9/289  28/18046 3.24E−10 1.04E−07 7818/64969/23107/ SMALL_RIBOSOMAL_ 64951/51650/28957/ SUBUNIT 51116/64960/64965 GO_PROTEIN_ 22/289 266/18046 3.48E−10 1.04E−07 23534/51194/6774/ LOCALIZATION_TO_ 7704/51366/7157/ NUCLEUS 163590/51512/4931/ 10527/55035/55027/ 23212/5594/3839/3840/ 3841/23633/9972/ 3838/3836/10762 GO_NUCLEAR_IMPORT_  8/289  20/18046 4.19E−10 1.15E−07 23534/51194/3839/ SIGNAL_RECEPTOR_ 3840/3841/23633/ ACTIVITY 3838/3836 GO_CELL_CYCLE_G2_M_ 22/289 271/18046 4.96E−10 1.25E−07 5116/5566/5577/1063/ PHASE_TRANSITION 5108/9662/55755/ 10142/11190/22981/ 22994/7157/5518/ 4361/5520/9113/5704/ 55722/121441/51512/ 26993/5715 GO_REGULATION_OF_CELL_ 19/289 214/18046 1.77E−09 4.15E−07 5116/5566/5577/1063/ CYCLE_G2_M_PHASE_ 5108/9662/55755/ TRANSITION 10142/11190/22981/ 22994/7157/5518/ 4361/5704/55722/ 121441/51512/5715 GO_CILIARY_BASAL_BODY_ 13/289  95/18046 3.76E−09 8.25E−07 5116/5566/5577/5108/ PLASMA_MEMBRANE_ 9662/55755/10142/ DOCKING 11190/22981/22994/ 5518/55722/121441 GO_IMPORT_INTO_NUCLEUS 16/289 164/18046 9.07E−09 1.86E−06 23534/51194/6774/ 51366/7157/10527/ 55027/5594/3839/3840/ 3841/23633/9972/ 3838/3836/10762 GO_TRANSLATIONAL_ 13/289 105/18046 1.30E−08 2.52E−06 2935/7818/64432/ TERMINATION 64969/23107/64951/ 29088/51650/28957/ 51116/64960/64965/ 65003 GO_MITOCHONDRIAL_ 12/289  89/18046 1.79E−08 3.28E−06 7818/64432/64969/ TRANSLATIONAL_ 23107/64951/29088/ TERMINATION 51650/28957/51116/ 64960/64965/65003 GO_RIBOSOME_BINDING 10/289  57/18046 2.11E−08 3.66E−06 10985/2475/25875/ 29789/6731/6728/3508/ 23107/708/7917 GO_NUCLEOCYTOPLASMIC_  8/289  31/18046 2.25E−08 3.70E−06 23534/51194/3839/ CARRIER_ACTIVITY 3840/3841/23633/ 3838/3836 GO_MEMBRANE_DOCKING 16/289 179/18046 3.17E−08 4.96E−06 23256/8673/5116/ 5566/5577/5108/9662/ 55755/10142/11190/ 22981/22994/5518/ 55722/6814/121441 GO_MITOCHONDRIAL_ 14/289 137/18046 4.33E−08 6.48E−06 2617/7818/64432/ TRANSLATION 64969/23107/64951/ 29088/51650/28957/ 51116/64960/64965/ 65003/708 GO_NUCLEAR_TRANSPORT 22/289 347/18046 4.66E−08 6.67E−06 23534/23225/51194/ 6774/5566/51366/ 7157/51512/10527/ 55027/65083/26993/ 23212/5594/3839/3840/ 3841/23633/9972/ 3838/3836/10762 GO_PROTEIN_IMPORT 16/289 192/18046 8.47E−08 1.16E−05 23534/51194/6774/ 51366/7157/10527/ 55027/5594/3839/3840/ 3841/23633/9972/ 3838/3836/10762 GO_MATURATION_OF_5_8S_  7/289  26/18046 1.27E−07 1.68E−05 11340/9875/23517/ RRNA 10200/55759/23212/ 117246 GO_ORGANELLAR_ 11/289  87/18046 1.40E−07 1.77E−05 7818/64969/23107/ RIBOSOME 64951/29088/51650/ 28957/51116/64960/ 64965/65003 GO_NUCLEAR_  7/289  27/18046 1.70E−07 2.07E−05 3839/3840/3841/23633/ LOCALIZATION_SEQUENCE_ 9972/3838/3836 BINDING GO_TRANSLATIONAL_ 13/289 135/18046 2.66E−07 3.13E−05 26046/7818/64432/ ELONGATION 64969/23107/64951/ 29088/51650/28957/ 51116/64960/64965/ 65003 GO_MITOCHONDRIAL_GENE_ 14/289 165/18046 4.42E−07 5.02E−05 2617/7818/64432/ EXPRESSION 64969/23107/64951/ 29088/51650/28957/ 51116/64960/64965/ 65003/708 GO_NLS_BEARING_PROTEIN_  6/289  20/18046 5.14E−07 5.64E−05 3839/3840/3841/23633/ IMPORT_INTO_NUCLEUS 3838/3836 GO_REGULATION_OF_ 16/289 227/18046 8.27E−07 8.74E−05 1459/5116/5566/5108/ INTRACELLULAR_PROTEIN_ 9648/22994/51366/ TRANSPORT 7157/10956/27248/ 3998/51512/26229/ 26993/5594/10055 GO_SIGNAL_SEQUENCE_  8/289  48/18046 8.50E−07 8.74E−05 6729/3839/3840/3841/ BINDING 23633/9972/3838/ 3836 GO_REGULATION_OF_ 20/289 348/18046 9.18E−07 9.14E−05 23256/8673/1459/ INTRACELLULAR_ 5116/5566/5108/9648/ TRANSPORT 22994/51366/7157/ 10956/27248/3998/ 51512/26229/26993/ 5595/5594/10055/9972 GO_MATURATION_OF_SSU_  7/289  35/18046 1.15E−06 0.000111298 55127/10607/5822/ RRNA_FROM_TRICISTRONIC_ 79954/23212/57647/ RRNA_TRANSCRIPT_SSU_ 88745 RRNA_5_8S_RRNA_LSU_RRNA GO_RIBOSOMAL_LARGE_  9/289  68/18046 1.32E−06 0.000123902 4931/9875/55027/ SUBUNIT_BIOGENESIS 55759/23212/117246/ 10969/51187/65003 GO_NUCLEAR_PORE 10/289  92/18046 2.15E−06 0.0001967 23225/10527/3839/ 3840/3841/23633/9972/ 3838/3836/10762 GO_SMALL_RIBOSOMAL_  9/289  73/18046 2.42E−06 0.000215305 7818/64969/23107/ SUBUNIT 64951/51650/28957/ 51116/64960/64965 GO_EXORIBONUCLEASE_  6/289  26/18046 2.82E−06 0.000243727 115752/11340/4931/ COMPLEX 23517/10200/51013 GO_REGULATION_OF_CELL_ 23/289 482/18046 3.40E−06 0.000286405 5116/5566/5577/1063/ CYCLE_PHASE_TRANSITION 5108/9662/55755/ 10142/11190/22981/ 22994/7157/5518/ 4361/5704/55722/26058/ 2071/121441/51512/ 1642/5715/56257 GO_NUCLEAR_EXOSOME_  5/289  16/18046 3.85E−06 0.000316248 11340/4931/23517/ RNASE_COMPLEX 10200/51013 GO_RIBOSOME 15/289 228/18046 4.29E−06 0.000344037 10985/9513/7818/ 64432/64969/23107/ 64951/29088/51187/ 51650/28957/51116/ 64960/64965/65003 GO_MODULATION_BY_  5/289  18/18046 7.35E−06 0.000575455 3839/3840/3841/ VIRUS_OF_HOST_CELLULAR_ 3838/3836 PROCESS GO_RNA_CATABOLIC_ 20/289 404/18046 8.78E−06 0.000671283 55802/2475/5518/ PROCESS 5520/5704/26058/115752/ 11340/23112/2935/ 23517/8087/9513/ 51013/5715/27258/ 6050/79670/79066/ 246243 GO_MATURATION_OF_SSU_  7/289  47/18046 9.13E−06 0.000682503 55127/10607/5822/ RRNA 79954/23212/57647/ 88745 GO_RIBOSOMAL_SUBUNIT 13/289 186/18046 9.82E−06 0.000700525 9513/7818/64969/ 23107/64951/29088/ 51187/51650/28957/ 51116/64960/64965/ 65003 GO_MICROTUBULE_ 11/289 133/18046 9.83E−06 0.000700525 2801/5108/9662/9648/ ORGANIZING_CENTER_ 51199/55755/11190/ ORGANIZATION 55968/22994/55722/ 79884 GO_MODULATION_BY_VIRUS  6/289  32/18046 1.02E−05 0.000700525 3839/3840/3841/23633/ OF_HOST_MORPHOLOGY_ 3838/3836 OR_PHYSIOLOGY GO_PROTEIN_LOCALIZATION_  6/289  32/18046 1.02E−05 0.000700525 5108/11190/55968/ TO_MICROTUBULE_ 22994/55722/121441 ORGANIZING_CENTER GO_PROTEIN_KINASE_A_  7/289  49/18046 1.21E−05 0.00081418 5576/5566/5577/10142/ BINDING 5573/26993/8227 GO_CAMP_DEPENDENT_  4/289  10/18046 1.25E−05 0.00081418 5576/5566/5577/5573 PROTEIN_KINASE_COMPLEX GO_RIBOSOMAL_SMALL_  8/289  68/18046 1.26E−05 0.00081418 55127/10607/5822/ SUBUNIT_BIOGENESIS 79954/27341/23212/ 57647/88745 GO_MATURATION_OF_5_8S_  5/289  21/18046 1.68E−05 0.001061202 11340/9875/55759/ RRNA_FROM_TRICISTRONIC_ 23212/117246 RRNA_TRANSCRIPT_SSU_ RRNA_5_8S_RRNA_LSU_RRNA GO_HOST_CELLULAR_  8/289  75/18046 2.62E−05 0.00162323 23225/3998/3839/ COMPONENT 23633/9972/3838/3836/ 10762 GO_POSITIVE_REGULATION_ 11/289 153/18046 3.67E−05 0.002232359 1459/5116/5566/5108/ OF_INTRACELLULAR_ 22994/51366/7157/ PROTEIN_TRANSPORT 51512/26229/5594/ 10055 GO_PROTEIN_LOCALIZATION_  7/289  58/18046 3.76E−05 0.00224621 5108/11190/55968/ TO_CYTOSKELETON 22994/55722/121441/ 6242 GO_CATALYTIC_ACTIVITY_ 18/289 380/18046 4.42E−05 0.00259851 115752/10775/23517/ ACTING_ON_RNA 1662/117246/55661/ 2617/3508/79670/ 56257/79066/57647/ 27037/96764/81890/ 64848/23405/246243 GO_HELICASE_ACTIVITY 11/289 157/18046 4.65E−05 0.002680741 4361/10111/10973/ 2071/23517/1662/55661/ 3508/57647/64848/ 23405 GO_MODULATION_BY_  5/289  26/18046 5.08E−05 0.002880233 3839/3840/3841/3838/ SYMBIONT_OF_HOST_ 3836 CELLULAR_PROCESS GO_CELLULAR_PROTEIN_ 13/289 219/18046 5.49E−05 0.003057822 2935/7818/64432/ COMPLEX_DISASSEMBLY 64969/23107/64951/ 29088/51650/28957/ 51116/64960/64965/ 65003 GO_MULTI_ORGANISM_  7/289  62/18046 5.82E−05 0.003136764 23225/3839/23633/ LOCALIZATION 9972/3838/3836/10762 GO_RIBOSOME_ASSEMBLY  7/289  62/18046 5.82E−05 0.003136764 5822/27341/23212/ 51187/51116/65003/ 708 GO_MODIFICATION_BY_  6/289  43/18046 5.93E−05 0.003147448 3839/3840/3841/ SYMBIONT_OF_HOST_ 23633/3838/3836 MORPHOLOGY_OR_ PHYSIOLOGY GO_STRUCTURAL_ 11/289 162/18046 6.18E−05 0.003227572 7818/64432/64969/ CONSTITUENT_OF_RIBOSOME 64951/29088/51187/ 51650/51116/64960/ 64965/65003 GO_REGULATION_OF_GOLGI_  4/289  15/18046 7.65E−05 0.003911288 9659/10142/5595/5594 ORGANIZATION GO_MITOCHONDRIAL_ 20/289 471/18046 7.73E−05 0.003911288 79586/33/7157/23597/ MATRIX 4833/5163/2617/501/ 7818/64969/23107/ 64951/29088/51650/ 28957/51116/64960/ 64965/65003/708 GO_MITOCHONDRIAL_ 14/289 260/18046 8.20E−05 0.004086201 5163/55750/26520/ PROTEIN_COMPLEX 7818/64969/23107/ 64951/29088/51650/ 28957/51116/64960/ 64965/65003 GO_ATPASE_ACTIVITY 19/289 438/18046 8.83E−05 0.004336726 4643/4627/4361/10111/ 23078/5704/10973/ 84896/57130/2071/ 4931/23517/1662/ 29789/55661/3508/ 57647/64848/23405 GO_GOLGI_ORGANIZATION 10/289 142/18046 9.83E−05 0.004755113 25923/81562/2801/ 9659/9648/10142/ 55968/3998/5595/5594 GO_OUTER_MEMBRANE 12/289 204/18046 0.000115307 0.005496314 140707/54708/2475/ 1727/64757/51566/ 2181/55750/25875/ 23098/4830/81890 GO_AMINO_ACID_BETAINE_  4/289  17/18046 0.000130061 0.006111016 33/5447/501/223 METABOLIC_PROCESS GO_POSITIVE_REGULATION_ 12/289 207/18046 0.000132325 0.006129826 8673/1459/5116/5566/ OF_INTRACELLULAR_ 5108/22994/51366/ TRANSPORT 7157/51512/26229/ 5594/10055 GO_ACTIVATION_OF_  4/289  18/18046 0.000165122 0.007542861 5576/5566/5577/5573 PROTEIN_KINASE_A_ ACTIVITY GO_ATPASE_ACTIVITY_ 14/289 286/18046 0.000222337 0.009935687 4643/4627/4361/10111/ COUPLED 5704/10973/2071/ 23517/1662/55661/ 3508/57647/64848/ 23405 GO_REGULATION_OF_ 13/289 252/18046 0.000223545 0.009935687 1459/1457/5566/9113/ CELLULAR_PROTEIN_ 5704/10956/8975/ CATABOLIC_PROCESS 27248/25898/5887/ 9817/7874/7917 GO_NUCLEAR_ENVELOPE 19/289 472/18046 0.000231141 0.010136285 79188/23225/51194/ 1063/5108/7157/3482/ 163590/169714/10527/ 5595/3839/3840/ 3841/23633/9972/ 3838/3836/10762 GO_ENDOMEMBRANE_ 18/289 436/18046 0.000248416 0.010750509 25923/79188/81562/ SYSTEM_ORGANIZATION 2801/9659/9648/ 10142/55968/4627/5518/ 5520/3998/163590/ 26993/5595/5594/ 8266/7917 GO_PROTEIN_CONTAINING_ 15/289 326/18046 0.00026092 0.011145006 8673/79443/2935/ COMPLEX_DISASSEMBLY 7818/64432/64969/ 23107/64951/29088/ 51650/28957/51116/ 64960/64965/65003 GO_REGULATION_OF_  7/289  79/18046 0.00027209 0.011473122 23225/2475/3337/5595/ CELLULAR_RESPONSE_TO_ 5594/9972/10762 HEAT GO_ENDOPLASMIC_  6/289  57/18046 0.000292804 0.012190288 25923/81562/3998/ RETICULUM_ 163590/8266/7917 ORGANIZATION GO_PERICENTRIOLAR_  4/289  21/18046 0.000310958 0.012784281 5108/51199/55755/ MATERIAL 121441 GO_LONG_CHAIN_FATTY_  8/289 107/18046 0.000325199 0.013096082 33/10005/3295/11001/ ACID_METABOLIC_PROCESS 2181/10999/80142/ 5595 GO_NUCLEIC_ACID_ 14/289 297/18046 0.000326506 0.013096082 55802/4361/10111/ PHOSPHODIESTER_BOND_ 115752/11340/2071/ HYDROLYSIS 10775/1642/23212/ 51013/88745/23405/ 246243/3836 GO_REGULATION_OF_MRNA_ 11/289 199/18046 0.000377092 0.014942851 55802/2475/5704/ CATABOLIC_PROCESS 26058/11340/23112/ 8087/9513/51013/5715/ 79066 GO_PRERIBOSOME_LARGE_  4/289  23/18046 0.000448619 0.016772199 55759/23212/117246/ SUBUNIT_PRECURSOR 10969 GO_CAMP_DEPENDENT_  3/289  10/18046 0.000448754 0.016772199 5576/5577/5573 PROTEIN_KINASE_ REGULATOR_ACTIVITY GO_DNA_DEALKYLATION_  3/289  10/18046 0.000448754 0.016772199 10973/51008/84164 INVOLVED_IN_DNA_REPAIR GO_MICROTUBULE_  3/289  10/18046 0.000448754 0.016772199 5108/51199/22981 ANCHORING_AT_ CENTROSOME GO_REGULATION_OF_  3/289  10/18046 0.000448754 0.016772199 11190/55968/55722 PROTEIN_LOCALIZATION_ TO_CENTROSOME GO_INTERACTION_WITH_ 11/289 204/18046 0.000465127 0.017181914 8673/3956/1642/3839/ HOST 3840/3841/23633/ 9972/3838/3836/ 7037 GO_MODIFICATION_OF_  8/289 113/18046 0.000470165 0.017181914 3482/64848/3839/3840/ MORPHOLOGY_OR_ 3841/23633/3838/ PHYSIOLOGY_OF_OTHER_ 3836 ORGANISM_INVOLVED_IN_ SYMBIOTIC_INTERACTION GO_CELLULAR_RESPONSE_  9/289 142/18046 0.000477016 0.017240714 23225/2475/5566/ TO_HEAT 7157/3337/5595/5594/ 9972/10762 GO_DNA_GEOMETRIC_  8/289 114/18046 0.000498758 0.017830591 7157/4361/10111/ CHANGE 10973/2071/1642/5887/ 3508 GO_NEGATIVE_REGULATION_  3/289  11/18046 0.000609741 0.021563857 5576/5577/5573 OF_CAMP_DEPENDENT_ PROTEIN_KINASE_ACTIVITY GO_GOLGI_STACK  9/289 150/18046 0.000709222 0.024206774 79586/23256/286451/ 2530/2802/2801/ 10142/55968/2590 GO_CELLULAR_RESPONSE_  4/289  26/18046 0.000729337 0.024206774 5576/5566/5577/5573 TO_GLUCAGON_STIMULUS GO_MICROTUBULE_  4/289  26/18046 0.000729337 0.024206774 5108/9648/51199/22981 ANCHORING GO_MICROTUBULE_  4/289  26/18046 0.000729337 0.024206774 10844/2801/51199/10142 NUCLEATION GO_REGULATION_OF_  4/289  26/18046 0.000729337 0.024206774 10111/5595/5594/7874 TELOMERE_CAPPING GO_PROTEIN_EXIT_FROM_  5/289  45/18046 0.000735986 0.024206774 9648/10956/27248/ ENDOPLASMIC_RETICULUM 6400/55829 GO_PROTEASOMAL_PROTEIN_ 18/289 478/18046 0.000735992 0.024206774 4189/26046/114088/ CATABOLIC_PROCESS 5566/55968/5704/ 10956/8975/27248/6400/ 55829/1642/5715/ 25898/5887/9817/ 7874/7917 GO_RESPONSE_TO_HEAT 10/289 183/18046 0.000754533 0.024570882 23225/2475/5566/7157/ 3337/11080/5595/ 5594/9972/10762 GO_MICROTUBULE_  3/289  12/18046 0.000803382 0.025905145 5108/51199/22981 ANCHORING_AT_ MICROTUBULE_ORGANIZING_ CENTER GO_POSITIVE_REGULATION_ 14/289 326/18046 0.000820039 0.025942557 1459/5116/5566/5108/ OF_CELLULAR_PROTEIN_ 11190/22994/51366/ LOCALIZATION 7157/51512/26229/ 2181/5594/245812/ 10055 GO_REGULATION_OF_ 10/289 185/18046 0.000820318 0.025942557 5566/5704/10956/ PROTEASOMAL_PROTEIN_ 8975/27248/25898/5887/ CATABOLIC_PROCESS 9817/7874/7917 GO_REGULATION_OF_ 14/289 328/18046 0.000869901 0.027248614 9517/23256/1459/6774/ AUTOPHAGY 2475/5566/2801/ 79443/7157/8975/ 526/523/5595/9817 GO_RESPONSE_TO_AMINO_  5/289  47/18046 0.000900302 0.027934845 10985/2475/79726/5595/ ACID_STARVATION 5594 GO_PROTEIN_C_TERMINUS_ 10/289 189/18046 0.000966074 0.029517111 7704/1063/9662/11190/ BINDING 7157/4361/2071/ 10055/3839/7874 GO_ENDOPLASMIC_  4/289  28/18046 0.000974071 0.029517111 10956/27248/6400/ RETICULUM_TO_CYTOSOL_ 55829 TRANSPORT GO_MACROAUTOPHAGY 13/289 295/18046 0.000988285 0.029517111 9517/23256/8673/1459/ 1457/2475/5566/ 79443/55968/7157/ 526/523/5595 GO_NEGATIVE_REGULATION_ 12/289 259/18046 0.000999869 0.029517111 23256/1459/1457/6774/ OF_CELLULAR_CATABOLIC_ 2475/2801/7157/ PROCESS 10956/27248/79066/ 7874/7917 GO_CARNITINE_METABOLIC_  3/289  13/18046 0.001032067 0.029517111 33/5447/223 PROCESS GO_CENTRIOLE_CENTRIOLE_  3/289  13/18046 0.001032067 0.029517111 9662/51199/11190 COHESION GO_LONG_CHAIN_FATTY_  3/289  13/18046 0.001032067 0.029517111 11001/2181/10999 ACID_COA_LIGASE_ACTIVITY GO_MEIOTIC_SPINDLE_  3/289  13/18046 0.001032067 0.029517111 2801/4627/5518 ORGANIZATION GO_PROTEIN_KINASE_A_  3/289  13/18046 0.001032067 0.029517111 5576/5577/5573 CATALYTIC_SUBUNIT_ BINDING GO_ERAD_PATHWAY  7/289  99/18046 0.001065618 0.030213958 4189/10956/8975/27248/ 6400/55829/7917 GO_NEGATIVE_REGULATION_  6/289  73/18046 0.001109729 0.030827086 1459/1457/10956/27248/ OF_PROTEOLYSIS_INVOLVED_ 7874/7917 IN_CELLULAR_PROTEIN_ CATABOLIC_PROCESS GO_PROTEIN_  4/289  29/18046 0.001115817 0.030827086 10956/55768/6400/23324 DEGLYCOSYLATION GO_REGULATION_OF_ERAD_  4/289  29/18046 0.001115817 0.030827086 10956/8975/27248/7917 PATHWAY GO_POSITIVE_REGULATION_  8/289 129/18046 0.001124734 0.030827086 2475/8663/8087/9513/ OF_TRANSLATION 5595/5594/23107/ 708 GO_DOUBLE_STRANDED_  6/289  74/18046 0.001191694 0.03204572 8087/8575/51663/23567/ RNA_BINDING 23405/7037 GO_PRODUCTION_OF_SMALL_  5/289  50/18046 0.001195976 0.03204572 7157/4087/8575/79670/ RNA_INVOLVED_IN_GENE_ 23405 SILENCING_BY_RNA GO_PROCESS_UTILIZING_ 18/289 499/18046 0.001198426 0.03204572 9517/23256/8673/1459/ AUTOPHAGIC_MECHANISM 1457/6774/2475/ 5566/2801/79443/55968/ 7157/8975/2011/ 526/523/5595/9817 GO_CHAPERONE_BINDING  7/289 102/18046 0.001269345 0.033668357 4189/7157/8975/3337/ 11080/26520/8266 GO_MATURATION_OF_LSU_  3/289  14/18046 0.001298044 0.033883065 9875/55759/117246 RRNA_FROM_TRICISTRONIC_ RRNA_TRANSCRIPT_SSU_ RRNA_5_8S_RRNA_LSU_RRNA GO_ORGANELLE_  3/289  14/18046 0.001298044 0.033883065 2801/5595/5594 INHERITANCE GO_NUCLEAR_ENVELOPE_  5/289  51/18046 0.001308859 0.033896351 79188/55968/5518/ ORGANIZATION 5520/26993 GO_ORGANELLE_ 15/289 382/18046 0.001331687 0.034218102 79971/25923/79586/ SUBCOMPARTMENT 23256/286451/2530/ 55717/2802/2801/ 9648/10142/55968/ 3482/2590/6786 GO_MESODERM_  6/289  76/18046 0.001369455 0.034647212 79971/5566/7296/4087/ MORPHOGENESIS 2296/5573 GO_RNA_HELICASE_ACTIVITY  6/289  76/18046 0.001369455 0.034647212 23517/1662/55661/ 3508/57647/64848 GO_NUCLEAR_TRANSCRIBED_  6/289  77/18046 0.001465583 0.036796197 55802/11340/23112/ MRNA_CATABOLIC_PROCESS_ 51013/27258/79670 DEADENYLATION_ DEPENDENT_DECAY GO_REGULATION_OF_  7/289 105/18046 0.00150236 0.037433803 5566/51366/7157/51512/ NUCLEOCYTOPLASMIC_ 26993/5594/9972 TRANSPORT GO_UBIQUITIN_DEPENDENT_  6/289  78/18046 0.001566767 0.038745089 4189/10956/27248/ ERAD_PATHWAY 6400/55829/7917 GO_LIPID_IMPORT_INTO_  3/289  15/18046 0.001603429 0.038777037 11001/2181/10999 CELL GO_PRE_MIRNA_PROCESSING  3/289  15/18046 0.001603429 0.038777037 8575/79670/23405 GO_PROTEIN_LOCALIZATION_  3/289  15/18046 0.001603429 0.038777037 4931/55035/23212 TO_NUCLEOLUS GO_DNA_DEALKYLATION  4/289  33/18046 0.001828322 0.043818276 10973/51008/84164/ 7874 GO_TELOMERE_CAPPING  5/289  55/18046 0.001840252 0.043818276 4361/10111/5595/5594/ 7874 GO_REGULATION_OF_  9/289 172/18046 0.001851852 0.043818276 9517/23256/2475/5566/ MACROAUTOPHAGY 79443/7157/526/ 523/5595 GO_TRANSLATION_  8/289 140/18046 0.001895642 0.044375357 10985/2475/8663/10480/ REGULATOR_ACTIVITY 2935/8087/9513/708 GO_STRIATED_MUSCLE_  6/289  81/18046 0.001902379 0.044375357 205428/6774/1482/2 CELL_PROLIFERATION 296/5573/5594 GO_REGULATION_OF_ 17/289 484/18046 0.002153723 0.049884473 26046/10985/6774/ CELLULAR_AMIDE_ 2475/85451/26058/ METABOLIC_PROCESS 8663/23112/2935/5163/ 8087/9513/5595/ 5594/79066/23107/708

    TABLE-US-00024 TABLE 9H SARS-COV-1 Description GeneRatio BgRatio pvalue p.adjust geneID GO_EUKARYOTIC_48S_ 13/356  15/18046 5.59E−21 1.93E−17 8665/8667/8666/8669/ PREINITIATION_COMPLEX 3646/8661/10480/ 8663/27335/51386/ 8664/8662/8668 GO_EUKARYOTIC_ 13/356  16/18046 2.93E−20 3.37E−17 8665/8667/8666/8669/ TRANSLATION_INITIATION_ 3646/8661/10480/ FACTOR_3_COMPLEX 8663/27335/51386/ 8664/8662/8668 GO_FORMATION_OF_ 13/356  16/18046 2.93E−20 3.37E−17 8665/8667/8666/8669/ CYTOPLASMIC_ 3646/8661/10480/ TRANSLATION_INITIATION_ 8663/27335/51386/ COMPLEX 8664/8662/8668 GO_TRANSLATION_ 13/356  18/18046 4.32E−19 3.74E−16 8665/8667/8666/8669/ PREINITIATION_COMPLEX 3646/8661/10480/ 8663/27335/51386/ 8664/8662/8668 GO_CYTOPLASMIC_ 14/356  31/18046 2.05E−16 1.42E−13 8665/8667/8666/8669/ TRANSLATIONAL_ 3646/8661/10480/ INITIATION 8663/27335/51386/ 8664/8662/8668/2475 GO_TRANSLATION_ 16/356  51/18046 1.44E−15 8.31E−13 8665/8667/9470/8666/ INITIATION_FACTOR_ 8669/3646/8661/ ACTIVITY 10480/8663/27335/ 51386/8664/8662/ 8668/1967/4528 GO_TRANSLATION_ 19/356 109/18046 3.98E−13 1.97E−10 23367/26986/8665/ REGULATOR_ACTIVITY_ 8667/9470/8666/8669/ NUCLEIC_ACID_BINDING 3646/8661/10480/ 8663/27335/51386/ 8664/8662/8668/1967/ 10985/4528 GO_TRANSLATION_FACTOR_ 17/356  85/18046 6.70E−13 2.90E−10 8665/8667/9470/8666/ ACTIVITY_RNA_BINDING 8669/3646/8661/ 10480/8663/27335/ 51386/8664/8662/ 8668/1967/10985/4528 GO_TRANSLATION_ 20/356 140/18046 4.50E−12 1.73E−09 23367/26986/8665/ REGULATOR_ACTIVITY 8667/9470/8666/8669/ 3646/8661/10480/ 8663/27335/51386/ 8664/8662/8668/1967/ 2475/10985/4528 GO_RIBONUCLEOPROTEIN_ 32/356 419/18046 6.55E−11 2.26E−08 55127/9136/6838/ COMPLEX_BIOGENESIS 26156/10569/8665/ 8667/8666/8669/3646/ 8661/10480/8663/27335/ 51386/8664/8662/ 8668/10199/1662/ 9790/57647/11340/ 79954/26574/25983/ 56915/51010/65003/ 27340/55027/23195 GO_CYTOPLASMIC_ 16/356  99/18046 9.63E−11 3.03E−08 8531/25873/8665/8667/ TRANSLATION 8666/8669/3646/ 8661/10480/8663/ 27335/51386/8664/ 8662/8668/2475 GO_TRANSLATIONAL_ 20/356 192/18046 1.46E−09 4.22E−07 23367/26986/25873/ INITIATION 8665/8667/9470/8666/ 8669/3646/8661/ 10480/8663/27335/ 51386/8664/8662/ 8668/1967/2475/4528 GO_ENDOPLASMIC_ 16/356 129/18046 5.31E−09 1.41E−06 10945/90522/26958/ RETICULUM_GOLGI_ 57222/2801/2804/ INTERMEDIATE_ 399687/64689/10960/ COMPARTMENT 126003/23392/22820/ 5034/811/23071/56886 GO_CENTRIOLE 16/356 141/18046 1.94E−08 4.78E−06 10426/80184/1070/ 9738/54535/219844/ 5116/11116/5108/9857/ 9662/11190/51199/ 8924/84461/4218 GO_CILIARY_BASAL_BODY_ 13/356  95/18046 4.48E−08 1.03E−05 1781/80184/9738/ PLASMA_MEMBRANE_ 5116/11116/5566/5108/ DOCKING 9662/55755/10142/ 11190/22994/22981 GO_MYOSIN_COMPLEX 10/356  55/18046 1.05E−07 2.26E−05 140465/4643/79784/ 399687/4645/4646/ 22998/4644/4627/4649 GO_VIRAL_TRANSLATION  6/356  15/18046 2.43E−07 4.95E−05 8665/8666/8661/51386/ 8664/8662 GO_REGULATION_OF_ 28/356 484/18046 4.07E−07 7.81E−05 26046/6774/79072/ CELLULAR_AMIDE_ 8531/23367/26986/ METABOLIC_PROCESS 4343/23185/57690/ 8667/9470/3646/26058/ 90850/8663/27335/ 8664/8662/64215/ 25983/1967/2475/ 10985/811/84300/55245/ 4528/63935 GO_RIBONUCLEOPROTEIN_ 16/356 193/18046 1.49E−06 0.000270292 10569/8665/8667/8666/ COMPLEX_SUBUNIT_ 8669/3646/8661/ ORGANIZATION 10480/8663/27335/ 51386/8664/8662/ 8668/65003/23195 GO_RIBONUCLEOPROTEIN_ 13/356 130/18046 1.80E−06 0.000311839 26046/8531/1460/ COMPLEX_BINDING 23367/90850/27335/ 25875/6731/6728/2475/ 10985/4528/27044 GO_MEMBRANE_DOCKING 15/356 179/18046 2.77E−06 0.000455315 1781/80184/9738/ 5116/11116/5566/5108/ 9662/55755/10142/ 11190/22994/22981/ 4218/4905 GO_INCLUSION_BODY 10/356  78/18046 3.01E−06 0.000468184 5663/8106/2876/4928/ 9531/5704/9529/ 10273/5424/9463 GO_MICROFILAMENT_  6/356  22/18046 3.23E−06 0.000468184 4643/79784/4645/4646/ MOTOR_ACTIVITY 4644/4627 GO_ACTOMYOSIN 10/356  79/18046 3.39E−06 0.000468184 3983/7168/7171/79784/ 399687/22998/4644/ 4627/9531/2275 GO_REGULATION_OF_ 10/356  79/18046 3.39E−06 0.000468184 3281/23225/4928/8480/ CELLULAR_RESPONSE_ 8021/2475/9531/ TO_HEAT 26973/9529/53371 GO_GOLGI_VESICLE_ 22/356 367/18046 4.14E−06 0.000551029 10945/1781/90522/ TRANSPORT 23041/26958/57222/ 1523/2802/2801/2804/ 399687/64689/4644/ 54520/4218/10960/ 126003/2181/10342/ 4905/22820/9463 GO_CELLULAR_RESPONSE_ 13/356 142/18046 4.85E−06 0.000621324 3281/10569/5566/ TO_HEAT 23225/4928/8480/8021/ 2475/9531/26973/ 9529/10273/53371 GO_ACTIN_FILAMENT_ 15/356 190/18046 5.77E−06 0.000711995 55219/3983/2934/ BINDING 7168/7111/7171/4643/ 2314/79784/399687/ 4645/4646/4644/ 4627/9463 GO_PROTEIN_FOLDING 16/356 220/18046 8.08E−06 0.000963703 267/1459/1460/1457/ 53938/64215/5034/ 811/5824/30001/23071/ 56886/9601/9531/ 26973/9529 GO_MICROTUBULE_  6/356  26/18046 9.32E−06 0.000993614 5195/11116/5108/9857/ ANCHORING 51199/22981 GO_MICROTUBULE_  6/356  26/18046 9.32E−06 0.000993614 10426/10844/2801/ NUCLEATION 10142/51199/10048 GO_POSITIVE_REGULATION_ 12/356 129/18046 9.54E−06 0.000993614 79072/8531/23367/ OF_TRANSLATION 26986/23185/3646/ 8663/8664/2475/84300/ 55245/63935 GO_CADHERIN_BINDING 20/356 330/18046 9.69E−06 0.000993614 5663/23367/26156/ 90102/10755/5962/ 2802/2801/23085/4627/ 3646/26058/26136/ 9689/28969/10985/ 9531/3069/27044/2011 GO_RESPONSE_TO_ 17/356 249/18046 9.77E−06 0.000993614 490/8531/3281/10569/ TEMPERATURE_STIMULUS 5566/23225/1967/ 4928/8480/8021/2475/ 30001/9531/26973/ 9529/10273/53371 GO_REGULATION_OF_MRNA_ 15/356 199/18046 1.01E−05 0.000997691 79072/79675/8531/ CATABOLIC_PROCESS 8761/23367/26986/ 4343/57690/26058/ 11340/56915/51010/ 8021/2475/5704 GO_OUTER_MEMBRANE 15/356 204/18046 1.36E−05 0.001305356 5663/4580/140707/ 10280/1727/64757/ 25875/23111/2181/ 65991/2475/9868/ 54884/55626/51566 GO_RESPONSE_TO_HEAT 14/356 183/18046 1.69E−05 0.001574582 3281/10569/5566/ 23225/1967/4928/8480/ 8021/2475/9531/ 26973/9529/10273/ 53371 GO_RIBOSOME_BIOGENESIS 18/356 290/18046 1.96E−05 0.001741034 55127/9136/6838/ 26156/10199/1662/9790/ 57647/11340/79954/ 26574/25983/56915/ 51010/65003/27340/ 55027/23195 GO_NUCLEAR_TRANSPORT 20/356 347/18046 2.01E−05 0.001741034 10526/9670/6774/5663/ 64328/8106/10569/ 54535/5566/23225/ 51692/4928/8480/ 8021/30000/55027/ 811/9531/5494/53371 GO_PROTEIN_DISULFIDE_  5/356  18/18046 2.01E−05 0.001741034 169714/5034/30001/ ISOMERASE_ACTIVITY 23071/9601 GO_SNRNA_3_END_  6/356  30/18046 2.25E−05 0.00189567 25896/11340/56915/ PROCESSING 51010/203522/26512 GO_SNRNA_METABOLIC_  7/356  45/18046 2.61E−05 0.002147788 25896/56257/11340/ PROCESS 56915/51010/203522/ 26512 GO_IRES_DEPENDENT_  4/356  10/18046 2.85E−05 0.002215389 8665/8661/8664/8662 VIRAL_TRANSLATIONAL_ INITIATION GO_UNCONVENTIONAL_  4/356  10/18046 2.85E−05 0.002215389 140465/4646/4644/ MYOSIN_COMPLEX 4649 GO_PROTEIN_IMPORT 14/356 192/18046 2.88E−05 0.002215389 10526/9670/6774/5663/ 8504/5195/51025/ 4928/8021/30000/ 55027/5824/9531/53371 GO_CYTOPLASMIC_STRESS_  8/356  63/18046 3.19E−05 0.002396938 10146/8761/23367/ GRANULE 9908/26986/4343/ 23185/26058 GO_NUCLEAR_EXPORT 14/356 195/18046 3.42E−05 0.002518156 64328/8106/10569/ 54535/5566/23225/ 51692/4928/8480/8021/ 811/9531/5494/53371 GO_MATURATION_OF_SSU_  6/356  35/18046 5.66E−05 0.004039362 55127/9790/57647/ RRNA_FROM_TRICISTRONIC_ 79954/25983/27340 RRNA_TRANSCRIPT_SSU_ RRNA_5_8S_RRNA_LSU_RRNA GO_DNA_POLYMERASE_  5/356  22/18046 5.80E−05 0.004039362 23649/5422/5557/5558/ COMPLEX 5424 GO_PROCESS_UTILIZING_ 24/356 499/18046 5.84E−05 0.004039362 10548/823/6774/5663/ AUTOPHAGIC_MECHANISM 1459/1460/23367/ 1457/8897/5566/2801/ 8975/54472/26073/ 4218/65991/2475/ 9373/9868/9531/2011/ 10273/23557/55626 GO_POSITIVE_REGULATION_ 12/356 156/18046 6.37E−05 0.004319498 79072/8531/23367/ OF_CELLULAR_AMIDE_ 26986/23185/3646/ METABOLIC_PROCESS 8663/8664/2475/84300/ 55245/63935 GO_SNRNA_PROCESSING  6/356  36/18046 6.67E−05 0.004422116 25896/11340/56915/ 51010/203522/26512 GO_REGULATION_OF_ 12/356 157/18046 6.78E−05 0.004422116 6774/5663/23225/3416/ GENERATION_OF_ 55829/4928/8480/ PRECURSOR_METABOLITES_ 8021/2475/84300/ AND_ENERGY 405/53371 GO_TRANSITION_METAL_  6/356  37/18046 7.84E−05 0.005016227 1317/540/27032/25800/ ION_TRANSMEMBRANE_ 23516/57181 TRANSPORTER_ACTIVITY GO_PHOSPHATIDYLCHOLINE_  6/356  38/18046 9.15E−05 0.005649461 137964/56994/1459/ BIOSYNTHETIC_PROCESS 1460/1457/2181 GO_SMALL_SUBUNIT_  6/356  38/18046 9.15E−05 0.005649461 55127/9136/10199/ PROCESSOME 79954/25983/27340 GO_REGULATION_OF_CELL_ 14/356 214/18046 9.39E−05 0.005694299 1781/80184/9738/5116/ CYCLE_G2_M_PHASE_ 11116/5566/5108/ TRANSITION 9662/55755/10142/ 11190/22994/22981/ 5704 GO_CELL_CYCLE_G2_M_ 16/356 271/18046 0.000102072 0.006025499 1781/80184/9738/4660/ PHASE_TRANSITION 5116/11116/5566/ 5108/9662/55755/ 10142/11190/22994/ 22981/5704/54850 GO_ACTIN_FILAMENT_  8/356  74/18046 0.000102836 0.006025499 3983/7168/7171/79784/ BUNDLE 22998/4627/9531/ 2275 GO_RIBOSOME_BINDING  7/356  57/18046 0.000124134 0.007152189 90850/27335/25875/ 6731/6728/2475/10985 GO_TOR_COMPLEX  4/356  14/18046 0.000127463 0.007155666 9675/9894/23367/2475 GO_ACTIN_BINDING 21/356 428/18046 0.000128334 0.007155666 55219/3983/10755/ 2934/7168/7111/5962/ 7171/4643/2314/79784/ 399687/4645/4646/ 22998/4644/4627/ 10296/2275/4649/9463 GO_RRNA_METABOLIC_ 14/356 221/18046 0.000132032 0.007245019 55127/9136/26156/ PROCESS 10199/1662/9790/57647/ 11340/79954/25983/ 56915/51010/27340/ 23195 GO_CELL_REDOX_  8/356  77/18046 0.000136406 0.0072547 2876/169714/55829/ HOMEOSTASIS 80142/5034/30001/ 23071/9601 GO_PRERIBOSOME  8/356  77/18046 0.000136406 0.0072547 55127/9136/26156/ 10199/9790/79954/ 25983/27340 GO_REGULATION_OF_  8/356  79/18046 0.000163447 0.008338772 23367/8667/3646/ TRANSLATIONAL_INITIATION 27335/8662/1967/ 2475/4528 GO_REPLISOME  5/356  27/18046 0.000164026 0.008338772 23649/5422/5557/5558/ 5424 GO_TELOMERE_  5/356  27/18046 0.000164026 0.008338772 23649/5422/5557/5558/ MAINTENANCE_VIA_ 5424 SEMI_CONSERVATIVE_ REPLICATION GO_NUCLEAR_ENVELOPE 22/356 472/18046 0.000185158 0.009276703 10526/5663/55219/ 64328/5422/1070/2627/ 5108/4646/4008/ 23225/10280/169714/ 64215/4928/8480/ 8021/811/9587/54884/ 53371/84514 GO_POSITIVE_REGULATION_ 11/356 153/18046 0.000232256 0.011470111 5663/64328/1459/ OF_INTRACELLULAR_ 80184/5116/5566/5108/ PROTEIN_TRANSPORT 22994/26229/9531/ 5494 GO_ENDOPLASMIC_ 13/356 207/18046 0.000248095 0.012079767 10945/1781/90522/ RETICULUM_TO_GOLGI_ 26958/57222/2801/ VESICLE_MEDIATED_ 2804/64689/10960/ TRANSPORT 126003/10342/4905/ 22820 GO_REGULATION_OF_MRNA_ 17/356 325/18046 0.000266984 0.012818957 79072/79675/8531/ METABOLIC_PROCESS 8761/23367/8106/ 26986/4343/57690/ 26058/11340/56915/ 51010/4928/8021/2475/ 5704 GO_MATURATION_OF_SSU_  6/356  47/18046 0.00030663 0.01448285 55127/9790/57647/ RRNA 79954/25983/27340 GO_MICROTUBULE_ 10/356 133/18046 0.000310018 0.01448285 1070/9738/2801/5108/ ORGANIZING_CENTER_ 9662/55755/11190/ ORGANIZATION 22994/51199/26973 GO_REGULATION_OF_  8/356  87/18046 0.000319423 0.014723257 6774/5663/23225/4928/ CARBOHYDRATE_ 8480/8021/405/53371 CATABOLIC_PROCESS GO_NCRNA_3_END_  6/356  48/18046 0.000344685 0.015678618 25896/11340/56915/ PROCESSING 51010/203522/26512 GO_MOTOR_ACTIVITY 10/356 136/18046 0.000370764 0.016141843 1781/10513/140465/ 4643/79784/4645/4646/ 4644/4627/4649 GO_90S_PRERIBOSOME  5/356  32/18046 0.000377372 0.016141843 55127/26156/10199/ 9790/27340 GO_PROTEIN_LOCALIZATION_  5/356  32/18046 0.000377372 0.016141843 2804/5108/10464/11190/ TO_MICROTUBULE_ 22994 ORGANIZING_CENTER GO_TRANSLATION_  5/356  32/18046 0.000377372 0.016141843 23367/8665/10480/8663/ INITIATION_FACTOR_BINDING 8662 GO_RIBOSOMAL_SMALL_  7/356  68/18046 0.000378215 0.016141843 55127/6838/9790/57647/ SUBUNIT_BIOGENESIS 79954/25983/27340 GO_INTRAMOLECULAR_  6/356  49/18046 0.000386339 0.016287476 169714/80142/5034/ OXIDOREDUCTASE_ACTIVITY 30001/23071/9601 GO_NCRNA_METABOLIC_ 21/356 471/18046 0.000465221 0.019376745 55127/25896/9136/ PROCESS 26156/55621/10199/ 1662/9790/56257/ 57647/11340/79954/ 25983/56915/51010/ 27340/27044/203522/ 55699/23195/26512 GO_VIRAL_GENE_ 12/356 194/18046 0.000488403 0.020100116 25873/23225/8665/ EXPRESSION 8666/8661/51386/8664/ 8662/4928/8480/8021/ 53371 GO_ION_TRANSMEMBRANE_  5/356  34/18046 0.000504876 0.020533599 481/490/493/540/ TRANSPORTER_ACTIVITY_ 27032 PHOSPHORYLATIVE_ MECHANISM GO_NCRNA_PROCESSING 18/356 378/18046 0.00054824 0.021883989 55127/25896/9136/ 26156/55621/10199/ 1662/9790/57647/ 11340/79954/25983/ 56915/51010/27340/ 203522/23195/26512 GO_ACTIN_FILAMENT_ 10/356 143/18046 0.000551868 0.021883989 7168/140465/7111/ BASED_MOVEMENT 7171/4643/79784/ 10142/4646/4644/4627 GO_MYOSIN_II_COMPLEX  4/356  20/18046 0.000561794 0.021883989 140465/79784/22998/ 4627 GO_PROTEASOMAL_PROTEIN_ 21/356 478/18046 0.0005634 0.021883989 26046/5663/201595/ CATABOLIC_PROCESS 267/79699/10755/ 5566/8975/8924/10296/ 64795/2876/55829/ 11101/23392/9373/ 56886/5704/9529/10273/ 54850 GO_CILIUM_ORGANIZATION 18/356 381/18046 0.000601202 0.023092824 1781/80184/9738/ 219844/3983/5116/ 11116/2934/5566/5108/ 9662/10464/55755/ 10142/11190/22994/ 22981/4218 GO_NEGATIVE_REGULATION_ 14/356 259/18046 0.000662952 0.02460442 493/6774/5663/8531/ OF_CELLULAR_CATABOLIC_ 1459/23367/26986/ PROCESS 1457/10755/2801/ 26073/51025/2475/ 9529 GO_REGULATION_OF_ATP_  9/356 121/18046 0.000664738 0.02460442 6774/5663/23225/4928/ METABOLIC_PROCESS 8480/8021/84300/405/ 53371 GO_CALMODULIN_BINDING 12/356 201/18046 0.000669433 0.02460442 490/493/29966/5116/ 4643/79784/55755/ 4645/4646/4644/4627/ 23352 GO_POSITIVE_REGULATION_ 12/356 201/18046 0.000669433 0.02460442 5663/2934/7168/55755/ OF_SUPRAMOLECULAR_ 10142/22998/51199/ FIBER_ORGANIZATION 382/2876/2475/ 79709/9463 GO_GAMMA_TUBULIN_  4/356  21/18046 0.000683258 0.02460442 10426/10844/80184/ COMPLEX 55755 GO_POSITIVE_REGULATION_  4/356  21/18046 0.000683258 0.02460442 64328/5566/9531/5494 OF_PROTEIN_EXPORT_FROM_ NUCLEUS GO_MICROTUBULE_  7/356  76/18046 0.0007457 0.026576131 10426/10844/2801/ POLYMERIZATION 55755/10142/51199/ 10048 GO_RNA_3_END_PROCESSING 10/356 150/18046 0.000800776 0.027132745 25896/8106/26986/ 10569/51692/11340/ 56915/51010/203522/ 26512 GO_MACROAUTOPHAGY 15/356 295/18046 0.000808835 0.027132745 823/5663/1459/1460/ 23367/1457/8897/5566/ 26073/2475/9373/ 9868/9531/23557/ 55626 GO_ACTIN_FILAMENT_  3/356  10/18046 0.000824107 0.027132745 2934/2314/4627 SEVERING GO_CALCIUM_  3/356  10/18046 0.000824107 0.027132745 490/493/27032 TRANSMEMBRANE_ TRANSPORTER_ACTIVITY_ PHOSPHORYLATIVE_ MECHANISM GO_ER_MEMBRANE_  3/356  10/18046 0.000824107 0.027132745 9694/23065/56851 PROTEIN_COMPLEX GO_MICROTUBULE_  3/356  10/18046 0.000824107 0.027132745 5108/51199/22981 ANCHORING_AT_ CENTROSOME GO_NUCLEAR_TRANSCRIBED_  3/356  10/18046 0.000824107 0.027132745 11340/56915/51010 MRNA_CATABOLIC_PROCESS_ EXONUCLEOLYTIC_3_5 GO_REGULATION_OF_MRNA_  3/356  10/18046 0.000824107 0.027132745 3646/8663/8664 BINDING GO_MRNA_TRANSPORT 10/356 151/18046 0.000842884 0.027489154 8106/9908/1070/10569/ 23225/51692/4928/ 8480/8021/53371 GO_NCRNA_EXPORT_FROM_  5/356  38/18046 0.000853866 0.027587044 23225/4928/8480/8021/ NUCLEUS 53371 GO_POSITIVE_REGULATION_ 12/356 207/18046 0.000866497 0.02773594 5663/64328/1459/ OF_INTRACELLULAR_ 80184/5116/5566/5962/ TRANSPORT 5108/22994/26229/ 9531/5494 GO_ADP_BINDING  5/356  39/18046 0.000963791 0.030567201 399687/4646/4627/ 1727/26973 GO_PROTEIN_SUMOYLATION  7/356  81/18046 0.001090727 0.034278573 54472/23225/4928/ 8480/8021/405/53371 GO_TORC2_COMPLEX  3/356  11/18046 0.001116632 0.034776544 9675/9894/2475 GO_MICROBODY_MEMBRANE  6/356  60/18046 0.001153579 0.035606456 8504/5195/3615/2181/ 5824/51 GO_RNA_CATABOLIC_ 18/356 404/18046 0.001174671 0.035936625 79072/79675/8531/ PROCESS 8761/23367/26986/ 4343/25873/57690/ 3646/26058/11340/ 56915/51010/8021/ 2475/5704/27044 GO_PHOSPHATIDYLCHOLINE_  7/356  83/18046 0.001259481 0.03819322 137964/56994/1459/ METABOLIC_PROCESS 1460/1457/949/2181 GO_NUCLEAR_REPLICATION_  5/356  42/18046 0.001356897 0.040789508 23649/5422/5557/5558/ FORK 5424 GO_PROTEIN_N_TERMINUS_  8/356 109/18046 0.001429241 0.042593833 1459/1457/5195/382/ BINDING 3646/5824/11130/51 GO_MICROBODY  9/356 135/18046 0.001446999 0.042621737 8504/219743/5195/ 4644/3615/3416/2181/ 5824/51 GO_MICROTUBULE_  3/356  12/18046 0.001467164 0.042621737 5108/51199/22981 ANCHORING_AT_ MICROTUBULE_ ORGANIZING_CENTER GO_REGULATION_OF_RNA_  3/356  12/18046 0.001467164 0.042621737 3646/8663/8664 BINDING GO_NEGATIVE_REGULATION_ 15/356 314/18046 0.001508493 0.042700284 493/6774/5663/8531/ OF_CATABOLIC_PROCESS 1459/23367/26986/ 1457/64784/10755/ 2801/26073/51025/ 2475/9529 GO_REGULATION_OF_CELL_ 20/356 482/18046 0.0015108 0.042700284 493/1781/80184/9738/ CYCLE_PHASE_TRANSITION 8737/5116/11116/ 5566/5962/5108/9662/ 55755/10142/11190/ 22994/22981/26058/ 56257/5704/9587 GO_CELL_SUBSTRATE_ 18/356 414/18046 0.001541786 0.042700284 823/10146/26986/ JUNCTION 90102/2934/5576/5962/ 7171/2314/4627/4008/ 382/51056/26136/ 5034/811/2275/2274 GO_PDZ_DOMAIN_BINDING  7/356  86/18046 0.001550175 0.042700284 490/493/5663/10755/ 23085/4905/51 GO_RETROGRADE_VESICLE_  7/356  86/18046 0.001550175 0.042700284 10945/26958/57222/ MEDIATED_TRANSPORT_ 10960/4905/22820/ GOLGI_TO_ENDOPLASMIC_ 9463 RETICULUM GO_REGULATION_OF_ 13/356 252/18046 0.001557894 0.042700284 5663/1459/1457/79699/ CELLULAR_PROTEIN_ 10755/5566/5962/ CATABOLIC_PROCESS 8975/2876/84300/ 5704/9529/10273 GO_REGULATION_OF_ 17/356 381/18046 0.001570807 0.042700284 5663/267/1460/5195/ BINDING 5566/2801/382/3646/ 8663/8664/56257/ 57326/5824/4140/2011/ 10273/23557 GO_IMPORT_INTO_NUCLEUS 10/356 164/18046 0.001576641 0.042700284 10526/9670/6774/5663/ 4928/8021/30000/ 55027/9531/53371 GO_UBIQUITIN_LIGASE_ 14/356 284/18046 0.001601861 0.042700284 267/84231/79699/4008/ COMPLEX 51646/57610/10296/ 10048/80232/64795/ 54994/10238/10273/ 54850 GO_MITOCHONDRIAL_  9/356 137/18046 0.001602733 0.042700284 10240/79072/84545/ TRANSLATION 64969/65003/84300/ 55245/4528/55699 GO_MRNA_EXPORT_FROM_  8/356 111/18046 0.001605738 0.042700284 8106/10569/23225/ NUCLEUS 51692/4928/8480/8021/ 53371 GO_MITOCHONDRIAL_GENE_ 10/356 165/18046 0.00164969 0.043534193 10240/79072/60493/ EXPRESSION 84545/64969/65003/ 84300/55245/4528/ 55699 GO_MITOTIC_SPINDLE_POLE  4/356  27/18046 0.001825239 0.047776996 55755/51199/51646/ 8480 GO_TAU_PROTEIN_BINDING  5/356  45/18046 0.00185715 0.047776996 26574/4140/2011/4139/ 10273 GO_ALPHA_LINOLENIC_ACID_  3/356  13/18046 0.001879569 0.047776996 9415/60481/51 METABOLIC_PROCESS GO_CENTRIOLE_CENTRIOLE_  3/356  13/18046 0.001879569 0.047776996 9662/11190/51199 COHESION GO_NUCLEAR_INCLUSION_  3/356  13/18046 0.001879569 0.047776996 8106/4928/10273 BODY GO_REGULATION_OF_ 12/356 227/18046 0.001903619 0.048035119 5663/64328/1459/ INTRACELLULAR_PROTEIN_ 80184/5116/5566/ TRANSPORT 5108/22994/26229/ 9531/5494/53371

    TABLE-US-00025 TABLE 9I SARS-COV-2 Description GeneRatio BgRatio pvalue p.adjust geneID GO_PROTEIN_TARGETING 30/374 428/18046 6.46E−09 2.40E−05 8546/9512/2040/23203/ 10531/1459/25873/51125/ 80273/219743/9648/5189/ 252983/11001/3416/26519/ 90580/26515/26520/8540/ 7879/131118/6731/6728/ 6729/53371/26521/55823/ 10956/9868 GO_PROTEIN_TARGETING_ 13/374 101/18046 1.66E−07 0.000309267 9512/23203/10531/1459/ TO_MITOCHONDRION 80273/26519/90580/26515/ 26520/131118/26521/55823/ 9868 GO_MITOCHONDRIAL_ 20/374 260/18046 5.36E−07 0.000664267 9512/23203/80273/10295/ PROTEIN_COMPLEX 1763/26519/90580/55735/ 26515/26520/10632/131118/ 51116/64969/23107/26521/ 9868/617/51103/4715 GO_NCRNA_EXPORT_FROM_  8/374  38/18046 8.97E−07 0.000817847 23225/8021/23636/53371/ NUCLEUS 4927/9818/4928/8480 GO_STRUCTURAL_  7/374  28/18046 1.26E−06 0.000817847 10204/8021/23636/53371/ CONSTITUENT_OF_ 4927/9818/4928 NUCLEAR_PORE GO_ENDOMEMBRANE_ 26/374 436/18046 1.53E−06 0.000817847 196527/57142/26993/11113/ SYSTEM_ORGANIZATION 2801/2804/9659/9648/10142/ 64689/51361/23325/7879/ 5862/10890/5861/10960/ 26092/22931/91754/55823/ 25777/1861/27243/9529/ 50999 GO_CELLULAR_RESPONSE_ 14/374 142/18046 1.54E−06 0.000817847 10569/3281/5566/23225/ TO_HEAT 3066/8021/23636/53371/ 4927/9818/3162/4928/8480/ 9529 GO_RETROGRADE_  7/374  30/18046 2.10E−06 0.000973987 56850/10311/28952/54520/ TRANSPORT_ENDOSOME_ 57020/4218/23339 TO_PLASMA_MEMBRANE GO_GDP_BINDING 10/374  74/18046 2.86E−06 0.000997832 5898/5878/7879/4218/5862/ 10890/51552/387/22931/ 6729 GO_MRNA_TRANSPORT 14/374 151/18046 3.20E−06 0.000997832 26993/5976/9908/10569/ 10204/23225/51692/8021/ 23636/53371/4927/9818/ 4928/8480 GO_MRNA_EXPORT_FROM_ 12/374 111/18046 3.29E−06 0.000997832 26993/5976/10569/23225/ NUCLEUS 51692/8021/23636/53371/ 4927/9818/4928/8480 GO_SNRNA_METABOLIC_  8/374  45/18046 3.48E−06 0.000997832 92105/57508/25896/56257/ PROCESS 11340/56915/51010/23404 GO_VESICLE_MEDIATED_ 11/374  93/18046 3.49E−06 0.000997832 51125/56850/10311/28952/ TRANSPORT_TO_THE_ 54520/57020/150684/2181/ PLASMA_MEMBRANE 4218/10890/23339 GO_CELL_CYCLE_G2_M_ 19/374 271/18046 4.08E−06 0.001067475 23476/5714/26993/10270/ PHASE_TRANSITION 11113/5116/11116/5566/ 5577/1063/9662/11064/ 55755/10142/11190/22981/ 8481/9978/54850 GO_CILIARY_BASAL_BODY_ 11/374  95/18046 4.31E−06 0.001067475 5116/11116/5566/5577/9662/ PLASMA_MEMBRANE_ 11064/55755/10142/11190/ DOCKING 22981/8481 GO_MEMBRANE_DOCKING 15/374 179/18046 5.04E−06 0.001145849 5116/11116/5566/5577/9662/ 11064/55755/10142/11190/ 22981/8481/7879/4218/ 10890/55823 GO_REGULATION_OF_ 10/374  79/18046 5.24E−06 0.001145849 3281/23225/8021/23636/ CELLULAR_RESPONSE_ 53371/4927/9818/4928/ TO_HEAT 8480/9529 GO_ERAD_PATHWAY 11/374  99/18046 6.46E−06 0.001284765 8975/29761/55829/1861/ 10956/80020/27248/80267/ 55757/7993/7466 GO_ENDOPLASMIC_ 20/374 306/18046 6.56E−06 0.001284765 79709/11001/2200/1861/ RETICULUM_LUMEN 8614/1291/4240/10956/ 79070/143888/80020/27248/ 23071/80267/64374/55757/ 10525/51661/60681/7466 GO_CENTRIOLE 13/374 141/18046 7.64E−06 0.001304812 10426/5116/11116/9857/ 9662/51199/11190/8481/ 8924/55165/145508/49856/ 4218 GO_PROTEIN_ 13/374 141/18046 7.64E−06 0.001304812 9512/23203/10531/1459/ LOCALIZATION_TO_ 80273/26519/90580/26515/ MITOCHONDRION 26520/131118/26521/55823/ 9868 GO_SNRNA_PROCESSING  7/374  36/18046 7.72E−06 0.001304812 92105/57508/25896/11340/ 56915/51010/23404 GO_GOLGI_ORGANIZATION 13/374 142/18046 8.26E−06 0.001335199 11113/2801/2804/9659/ 9648/10142/64689/51361/ 5862/5861/10960/9529/ 50999 GO_CUL2_RING_UBIQUITIN_  5/374  15/18046 9.42E−06 0.001459813 150684/8453/79699/9978/ LIGASE_COMPLEX 6923 GO_CELL_DIVISION_SITE  9/374  70/18046 1.37E−05 0.002032541 10426/10844/11113/5962/ 382/55165/5898/387/3688 GO_PROTEIN_FOLDING 16/374 220/18046 1.49E−05 0.002134264 10283/1459/1460/80273/ 6902/53938/2782/7841/ 131118/1861/56605/55768/ 23071/64374/9529/7466 GO_TELOMERE_  6/374  27/18046 1.56E−05 0.002146989 5976/5422/5557/5558/ MAINTENANCE_VIA_SEMI_ 23649/1763 CONSERVATIVE_ REPLICATION GO_GLYCOPROTEIN_ 23/374 412/18046 1.79E−05 0.002382707 2801/64689/440138/5861/ METABOLIC_PROCESS 7841/9653/26574/29880/ 5046/10956/79070/143888/ 79586/55768/90161/6388/ 23071/80267/23509/55757/ 54480/23333/79053 GO_ENDOSOMAL_ 16/374 228/18046 2.32E−05 0.002937493 8546/56850/23085/9648/ TRANSPORT 382/10311/28952/54520/ 57020/23325/7879/4218/ 10890/51552/23339/27243 GO_HOST_CELLULAR_  9/374  75/18046 2.41E−05 0.002937493 4343/23225/8021/23636/ COMPONENT 53371/4927/9818/4928/8480 GO_RNA_LOCALIZATION 16/374 229/18046 2.45E−05 0.002937493 26993/5976/9908/10569/ 10204/23225/51692/51010/ 23404/8021/23636/53371/ 4927/9818/4928/8480 GO_  5/374  18/18046 2.55E−05 0.002967549 29880/79070/143888/55757/ GLUCOSYLTRANSFERASE_ 79053 ACTIVITY GO_RNA_EXPORT_FROM_ 12/374 136/18046 2.66E−05 0.002995921 26993/5976/10569/23225/ NUCLEUS 51692/8021/23636/53371/ 4927/9818/4928/8480 GO_RESPONSE_TO_HEAT 14/374 183/18046 2.91E−05 0.00315232 10569/3281/5566/23225/ 3066/8021/23636/53371/ 4927/9818/3162/4928/8480/ 9529 GO_SNRNA_3_END_  6/374  30/18046 2.97E−05 0.00315232 57508/25896/11340/56915/ PROCESSING 51010/23404 GO_NUCLEAR_TRANSCRIBED_  4/374  10/18046 3.45E−05 0.003568014 11340/56915/51010/23404 MRNA_CATABOLIC_PROCESS_ EXONUCLEOLYTIC_3_5 GO_MULTI_ORGANISM_  8/374  62/18046 4.02E−05 0.004041208 23225/8021/23636/53371/ LOCALIZATION 4927/9818/4928/8480 GO_REGULATION_OF_CELL_ 15/374 214/18046 4.22E−05 0.00412939 23476/5714/5116/11116/ CYCLE_G2_M_PHASE_ 5566/5577/1063/9662/11064/ TRANSITION 55755/10142/11190/22981/ 8481/9978 GO_CYTOPLASMIC_STRESS_  8/374  63/18046 4.52E−05 0.004313284 26986/10146/8761/23367/ GRANULE 4343/9908/23185/26058 GO_CHAPERONE_MEDIATED_  4/374  11/18046 5.34E−05 0.004842662 26519/26520/26521/1861 PROTEIN_TRANSPORT GO_UDP_  4/374  11/18046 5.34E−05 0.004842662 29880/79070/143888/55757 GLUCOSYLTRANSFERASE_ ACTIVITY GO_ENDOPLASMIC_  5/374  21/18046 5.76E−05 0.00489194 7905/57142/10193/10890/ RETICULUM_TUBULAR_ 22931 NETWORK GO_NUCLEAR_EXPORT 14/374 195/18046 5.84E−05 0.00489194 26993/5976/10569/5566/ 10204/23225/51692/8021/ 23636/53371/4927/9818/ 4928/8480 GO_VIRAL_LIFE_CYCLE 19/374 328/18046 5.88E−05 0.00489194 2040/26986/23367/22954/ 23225/3416/7879/5861/949/ 8021/23636/53371/4927/ 9818/4928/8480/3688/5817/ 27243 GO_I_KAPPAB_KINASE_NF_ 17/374 273/18046 5.92E−05 0.00489194 23476/57153/79753/9188/ KAPPAB_SIGNALING 8737/7088/23085/29110/ 28952/22954/387/23636/ 3162/286827/2150/79671/ 54602 GO_ESTABLISHMENT_OF_ 14/374 196/18046 6.17E−05 0.004913479 26993/5976/9908/10569/ RNA_LOCALIZATION 10204/23225/51692/8021/ 23636/53371/4927/9818/ 4928/8480 GO_PROTEIN_KINASE_A_  7/374  49/18046 6.30E−05 0.004913479 26993/10270/5576/5566/ BINDING 5577/5962/10142 GO_PROTEASOMAL_PROTEIN_ 24/374 478/18046 6.47E−05 0.004913479 5714/5566/8975/10193/ CATABOLIC_PROCESS 10612/8924/150684/29761/ 2876/55829/11101/8453/ 79699/9978/1861/10956/ 80020/27248/80267/54850/ 55757/9529/7993/7466 GO_REGULATION_OF_ 21/374 388/18046 6.47E−05 0.004913479 1459/23077/5566/5962/ PROTEIN_CATABOLIC_ 8975/10193/28952/7337/ PROCESS 22954/150684/29761/3416/ 2876/7879/79699/9978/55823/ 10956/27248/8754/9529 GO_DNA_POLYMERASE_  5/374  22/18046 7.33E−05 0.005451949 5422/5557/5558/23649/1763 COMPLEX GO_ENDOPLASMIC_ 11/374 129/18046 7.84E−05 0.005715577 10897/57222/2801/2804/ RETICULUM_GOLGI_ 64689/537/5862/10960/ INTERMEDIATE_ 23071/55757/50999 COMPARTMENT GO_GOLGI_VESICLE_ 20/374 367/18046 8.78E−05 0.006279921 10897/51125/57222/2802/ TRANSPORT 2801/2804/9648/64689/ 28952/54520/57020/150684/ 2181/4218/10890/51552/ 5861/10960/10525/50999 GO_CENTRIOLE_CENTRIOLE_  4/374  13/18046 0.000111928 0.007731467 9662/23177/51199/11190 COHESION GO_MIDBODY 13/374 182/18046 0.000112363 0.007731467 11113/5962/1063/11064/ 382/51056/55165/5898/4218/ 387/51097/23636/23111 GO_REGULATION_OF_BONE_  5/374  24/18046 0.00011434 0.007731467 5447/537/2200/4015/202018 DEVELOPMENT GO_NUCLEAR_PORE  9/374  92/18046 0.000122379 0.008127307 10204/23225/8021/23636/ 53371/4927/9818/4928/8480 GO_CLEAVAGE_FURROW  7/374  55/18046 0.000133834 0.008732111 11113/5962/382/55165/5898/ 387/3688 GO_ENDOPLASMIC_  5/374  25/18046 0.000140511 0.009009631 7905/57142/10193/10890/ RETICULUM_ 22931 SUBCOMPARTMENT GO_NUCLEOBASE_ 15/374 240/18046 0.000153305 0.009554297 26993/5976/9908/10569/ CONTAINING_COMPOUND_ 8737/10204/23225/51692/ TRANSPORT 8021/23636/53371/4927/ 9818/4928/8480 GO_CYTOPLASMIC_  4/374  14/18046 0.000154143 0.009554297 11340/56915/51010/23404 EXOSOME_RNASE_COMPLEX GO_RAB_PROTEIN_SIGNAL_  8/374  75/18046 0.000158809 0.009682153 5878/7879/4218/5862/10890/ TRANSDUCTION 51552/5861/22931 GO_MICROTUBULE_  5/374  26/18046 0.000171028 0.010096073 11116/9857/9648/51199/ ANCHORING 22981 GO_MICROTUBULE_  5/374  26/18046 0.000171028 0.010096073 10426/10844/2801/51199/ NUCLEATION 10142 GO_RNA_SURVEILLANCE  4/374  15/18046 0.000206769 0.011991982 11340/56915/51010/23404 GO_GOLGI_TO_PLASMA_  7/374  59/18046 0.000209594 0.011991982 51125/28952/54520/57020/ MEMBRANE_TRANSPORT 150684/2181/10890 GO_FLAVIN_ADENINE_  8/374  79/18046 0.000228571 0.012879609 34/2108/2671/5447/8540/ DINUCLEOTIDE_BINDING 1727/80020/28976 GO_REGULATION_OF_ 15/374 252/18046 0.00026042 0.014455232 1459/5566/5962/8975/28952/ CELLULAR_PROTEIN_ 7337/150684/29761/2876/ CATABOLIC_PROCESS 79699/9978/55823/10956/ 27248/9529 GO_NUCLEAR_EXOSOME_  4/374  16/18046 0.000271202 0.014653625 11340/56915/51010/23404 RNASE_COMPLEX GO_PROTEIN_SUMOYLATION  8/374  81/18046 0.000271874 0.014653625 23225/8021/23636/53371/ 4927/9818/4928/8480 GO_NEGATIVE_REGULATION_  6/374  44/18046 0.000276234 0.014675895 29761/55829/10956/27248/ OF_RESPONSE_TO_ 10525/7466 ENDOPLASMIC_ RETICULUM_STRESS GO_REGULATION_OF_ 14/374 227/18046 0.000289442 0.014959797 2040/26993/1459/5116/5566/ INTRACELLULAR_PROTEIN_ 56850/9648/10204/23636/ TRANSPORT 53371/9818/55823/10956/ 27248 GO_GLYCOPROTEIN_ 18/374 341/18046 0.000289622 0.014959797 2801/64689/440138/7841/ BIOSYNTHETIC_PROCESS 9653/26574/29880/79070/ 143888/79586/90161/6388/ 80267/23509/55757/54480/ 23333/79053 GO_ENDOCYTIC_RECYCLING  6/374  45/18046 0.000313232 0.015877204 382/10311/28952/54520/ 57020/51552 GO_UNFOLDED_PROTEIN_ 10/374 127/18046 0.000315922 0.015877204 80273/55027/23195/1861/ BINDING 56605/27248/64374/55757/ 22937/51103 GO_PROTEIN_CONTAINING_ 16/374 286/18046 0.000329364 0.016332062 26993/5976/10569/56850/ COMPLEX_LOCALIZATION 201134/23225/51692/117178/ 4218/8021/23636/53371/ 4927/9818/4928/8480 GO_MITOCHONDRIAL_ 15/374 258/18046 0.000334811 0.016383706 9512/23203/10531/1459/ TRANSPORT 80273/26519/90580/26515/ 26520/10632/131118/26521/ 55823/30968/9868 GO_CYTOPLASMIC_  4/374  17/18046 0.000348877 0.016850308 8453/9978/6923/10956 UBIQUITIN_LIGASE_COMPLEX GO_NUCLEAR_ENVELOPE 22/374 472/18046 0.000367355 0.017400219 57142/5422/1063/10204/ 23225/57508/10280/26092/ 169714/8021/23636/53371/ 4927/9818/151188/25777/ 4928/8480/1861/27243/ 23333/27346 GO_REGULATION_OF_INTRA 18/374 348/18046 0.00036962 0.017400219 2040/92840/26993/1459/ CELLULAR_TRANSPORT 5116/5566/5962/56850/9648/ 10204/8021/23636/53371/ 9818/3162/55823/10956/ 27248 GO_FLEMMING_BODY  5/374  31/18046 0.00040576 0.018862786 11064/382/55165/5898/ 23636 GO_REGULATION_OF_ 11/374 157/18046 0.000440685 0.019853743 23225/3416/387/55829/8021/ GENERATION_OF_ 23636/53371/4927/9818/ PRECURSOR_ 4928/8480 METABOLITES_AND_ENERGY GO_REGULATION_OF_  8/374  87/18046 0.000443595 0.019853743 23225/8021/23636/53371/ CARBOHYDRATE_ 4927/9818/4928/8480 CATABOLIC_PROCESS GO_NCRNA_3_END_  6/374  48/18046 0.000447931 0.019853743 57508/25896/11340/56915/ PROCESSING 51010/23404 GO_RAS_PROTEIN_SIGNAL_ 21/374 447/18046 0.000448431 0.019853743 10146/9908/5962/382/25959/ TRANSDUCTION 117178/5898/5878/7879/ 4218/5862/10890/51552/ 387/5861/2782/22931/23636/ 3688/1786/2150 GO_MICROTUBULE_ 10/374 133/18046 0.000456974 0.019993963 2801/9662/23177/9648/ ORGANIZING_CENTER_ 51199/55755/11190/117178/ ORGANIZATION 23636/27243 GO_POSITIVE_REGULATION_ 12/374 184/18046 0.000470866 0.020362233 23476/57153/9188/8737/ OF_I_KAPPAB_KINASE_NF_ 29110/28952/22954/387/ KAPPAB_SIGNALING 23636/3162/2150/54602 GO_ORGANELLE_ENVELOPE_  8/374  88/18046 0.0004793 0.020379019 2671/23408/26519/90580/ LUMEN 26515/26520/26521/30968 GO_MICROTUBULE_ 10/374 134/18046 0.000484918 0.020379019 5116/2801/55755/49856/ CYTOSKELETON_ 387/23636/25777/8480/ ORGANIZATION_ 3688/27243 INVOLVED_IN_MITOSIS GO_REGULATION_OF_CELL_ 22/374 482/18046 0.000487694 0.020379019 23476/5714/8737/5116/ CYCLE_PHASE_TRANSITION 11116/5566/5577/5962/1063/ 9662/11064/55755/10142/ 11190/22981/8481/25959/ 252983/26058/56257/9978/ 9510 GO_NEGATIVE_REGULATION_  9/374 111/18046 0.000504692 0.020854991 57142/8737/10505/6789/ OF_DEVELOPMENTAL_ 6788/60485/23111/8614/ GROWTH 9518 GO_INNER_MITOCHONDRIAL_ 10/374 135/18046 0.000514265 0.021017057 80273/26519/90580/55735/ MEMBRANE_PROTEIN_ 26515/10632/131118/617/ COMPLEX 51103/4715 GO_RRNA_CATABOLIC_  4/374  19/18046 0.000549846 0.022164753 11340/56915/51010/23404 PROCESS GO_CADHERIN_BINDING 17/374 330/18046 0.000559172 0.022164753 57142/28969/23367/5318/ 55833/5962/2802/2801/ 23085/90102/8496/26058/ 10890/5861/7458/3688/2011 GO_NEGATIVE_REGULATION_  6/374  50/18046 0.000560228 0.022164753 8737/7088/28952/387/ OF_I_KAPPAB_KINASE_NF_ 286827/79671 KAPPAB_SIGNALING GO_NUCLEAR_ENVELOPE_  6/374  51/18046 0.000623995 0.024427762 26993/26092/91754/25777/ ORGANIZATION 1861/27243 GO_MYOSIN_BINDING  7/374  71/18046 0.000660835 0.02560048 22954/5898/4218/10890/ 51552/387/9368 GO_PORE_COMPLEX_  4/374  20/18046 0.000676144 0.025658981 196527/57142/51248/4928 ASSEMBLY GO_PROTEIN_KINASE_A_  4/374  20/18046 0.000676144 0.025658981 26993/10270/5566/10142 REGULATORY_SUBUNIT_ BINDING GO_REGULATION_OF_  9/374 116/18046 0.000695716 0.026135014 8737/23225/8021/23636/ POSTTRANSCRIPTIONAL_ 53371/4927/9818/4928/8480 GENE_SILENCING GO_ENDOPLASMIC_  7/374  72/18046 0.000719197 0.026746948 57222/2801/64689/537/ RETICULUM_GOLGI_ 5862/10960/50999 INTERMEDIATE_ COMPARTMENT_ MEMBRANE GO_RESPONSE_TO_ 14/374 249/18046 0.000728973 0.026842079 10569/3281/5566/23225/ TEMPERATURE_STIMULUS 3066/8021/23636/53371/ 4927/9818/3162/4928/8480/ 9529 GO_UBIQUITIN_LIKE_ 16/374 309/18046 0.000763632 0.027842614 57142/8737/5576/5566/5577/ PROTEIN_LIGASE_BINDING 8975/8924/29761/9470/ 5898/23111/8453/9978/ 6923/9529/7466 GO_POSITIVE_REGULATION_  7/374  74/18046 0.00084813 0.030623273 10146/9908/9662/49856/387/ OF_ORGANELLE_ASSEMBLY 23636/202018 GO_REGULATION_OF_MRNA_ 12/374 199/18046 0.000941327 0.033050086 5714/26986/8761/23367/ CATABOLIC_PROCESS 5976/4343/26058/11340/ 56915/51010/23404/8021 GO_REGULATION_OF_ATP_  9/374 121/18046 0.000942039 0.033050086 23225/387/8021/23636/ METABOLIC_PROCESS 53371/4927/9818/4928/8480 GO_CAMP_DEPENDENT_  3/374  10/18046 0.00095089 0.033050086 5576/5566/5577 PROTEIN_KINASE_COMPLEX GO_EXTRACELLULAR_  3/374  10/18046 0.00095089 0.033050086 2200/2201/10516 MATRIX_CONSTITUENT_ CONFERRING_ELASTICITY GO_TAU_PROTEIN_KINASE_  4/374  22/18046 0.000987988 0.034021538 23387/4140/2011/4139 ACTIVITY GO_RESPONSE_TO_ 15/374 288/18046 0.001042722 0.035576919 10897/8975/29761/55829/ ENDOPLASMIC_RETICULUM_ 1861/8614/10956/80020/ STRESS 27248/23071/80267/55757/ 10525/7993/7466 GO_RIBOSOME_BIOGENESIS 15/374 290/18046 0.001117506 0.03778186 9136/9188/10199/1662/ 25983/11340/79954/56915/ 51010/26574/51116/23404/ 4927/55027/23195 GO_UBIQUITIN_DEPENDENT_  7/374  78/18046 0.001160367 0.0387237 55829/10956/80020/27248/ ERAD_PATHWAY 80267/7993/7466 GO_ENDOPLASMIC_  4/374  23/18046 0.001176601 0.0387237 10956/27248/80267/55757 RETICULUM_QUALITY_ CONTROL_COMPARTMENT GO_MITOTIC_CYTOKINETIC_  4/374  23/18046 0.001176601 0.0387237 55165/387/23636/27243 PROCESS GO_POST_GOLGI_VESICLE_  8/374 101/18046 0.001194702 0.038974528 51125/28952/54520/57020/ MEDIATED_TRANSPORT 150684/2181/10890/51552 GO_PROTEIN_INSERTION_  3/374  11/18046 0.001287453 0.041635113 26519/90580/26520 INTO_MITOCHONDRIAL_ INNER_MEMBRANE GO_ATPASE_BINDING  7/374  80/18046 0.001346993 0.042832181 481/5962/29761/5898/26092/ 55829/7466 GO_ATPASE_REGULATOR_  5/374  40/18046 0.001349121 0.042832181 481/80273/26092/131118/ ACTIVITY 64374 GO_ESTABLISHMENT_OF_  6/374  59/18046 0.001359021 0.042832181 51125/56850/64689/2181/ PROTEIN_LOCALIZATION_TO_ 4218/10890 PLASMA_MEMBRANE GO_RESPONSE_TO_OXYGEN_ 18/374 391/18046 0.001414735 0.043960913 481/523/5714/3066/537/387/ LEVELS 2782/26355/8453/9978/ 6921/6923/3162/5352/8614/ 5327/10525/22937 GO_REGULATION_OF_GENE_ 10/374 154/18046 0.001418475 0.043960913 8737/23225/8021/23636/ SILENCING 53371/4927/9818/4928/ 8480/1786 GO_MICROBODY_MEMBRANE  6/374  60/18046 0.001484122 0.045241382 3615/5189/11001/8540/2181/ 55711 GO_NUCLEAR_INNER_  6/374  60/18046 0.001484122 0.045241382 10204/10280/26092/151188/ MEMBRANE 25777/23333 GO_NUCLEAR_MEMBRANE 15/374 299/18046 0.001512476 0.045730865 10204/23225/57508/10280/ 26092/169714/23636/53371/ 9818/151188/25777/4928/ 1861/23333/27346 GO_MAINTENANCE_OF_  8/374 105/18046 0.001534842 0.046032881 9908/28952/2200/2201/ PROTEIN_LOCATION 25777/10956/8733/202018 GO_LIPID_DROPLET  7/374  82/18046 0.001556286 0.046082687 10280/2181/1727/5878/7879/ 51097/23111 GO_NUCLEUS_  9/374 130/18046 0.001561285 0.046082687 57142/26993/26092/53371/ ORGANIZATION 91754/25777/4928/1861/ 27243 GO_POST_TRANSLATIONAL_ 17/374 363/18046 0.001586563 0.046460075 5714/28952/10489/150684/ PROTEIN_MODIFICATION 4218/5862/5861/2200/10238/ 8453/9978/6921/6923/ 8614/4240/54850/7466 GO_HEPATOCYTE_  3/374  12/18046 0.001690346 0.047266145 382/6789/6788 APOPTOTIC_PROCESS GO_HOPS_COMPLEX  3/374  12/18046 0.001690346 0.047266145 51361/23339/55823 GO_MAINTENANCE_OF_  3/374  12/18046 0.001690346 0.047266145 10956/8733/202018 PROTEIN_LOCALIZATION_IN_ ENDOPLASMIC_RETICULUM GO_POSITIVE_REGULATION_  3/374  12/18046 0.001690346 0.047266145 2801/64689/5861 OF_UBIQUITIN_PROTEIN_ LIGASE_ACTIVITY GO_SNORNA_3_END_  3/374  12/18046 0.001690346 0.047266145 56915/51010/23404 PROCESSING GO_STRUCTURAL_  3/374  12/18046 0.001690346 0.047266145 2200/2201/10516 MOLECULE_ACTIVITY_ CONFERRING_ELASTICITY GO_ATP_METABOLIC_ 15/374 303/18046 0.001722322 0.04743457 481/523/23225/10632/387/ PROCESS 8021/23636/53371/4927/ 9818/30968/4928/8480/ 51103/4715 GO_MITOTIC_SPINDLE_  8/374 107/18046 0.001731505 0.04743457 5116/2801/49856/387/23636/ ORGANIZATION 25777/8480/27243 GO_POSITIVE_REGULATION_ 19/374 431/18046 0.001734633 0.04743457 26986/23367/5976/4343/ OF_CATABOLIC_PROCESS 5962/8975/79443/29110/ 10193/28952/22954/26058/ 3416/7879/79699/9978/ 3162/55823/8754 GO_SPLICEOSOMAL_ 11/374 186/18046 0.001771706 0.048094702 10283/25980/26986/79753/ COMPLEX 5976/55131/10569/53938/ 154007/55599/58155 GO_REGULATION_OF_  7/374  84/18046 0.001790073 0.048241159 8975/29761/55829/10956/ RESPONSE_TO_ 27248/10525/7466 ENDOPLASMIC_RETICULUM_ STRESS GO_TRANSFERASE_ 12/374 215/18046 0.001821239 0.048727958 79709/440138/29880/79070/ ACTIVITY_TRANSFERRING_ 143888/79586/6388/23509/ HEXOSYL_GROUPS 55757/54480/23333/79053 GO_PROTEIN_PEPTIDYL_  5/374  43/18046 0.001876107 0.049540462 10283/53938/23307/51661/ PROLYL_ISOMERIZATION 60681 GO_EXORIBONUCLEASE_  4/374  26/18046 0.001891569 0.049540462 11340/56915/51010/23404 COMPLEX GO_GAMMA_TUBULIN_  4/374  26/18046 0.001891569 0.049540462 10426/10844/55755/8481 BINDING

    TABLE-US-00026 TABLE 9J TABLE OF CONTENTS Column Names Description Description The name of the enriched GO term GeneRatio Shows the number of genes in cluster or virus interactome that match the term in Description and the full size of genes in the set considered in the enrichment analysis BgRatio Shows the number of genes annotated in the term and the total number of genes in the universe of annotations pvalue p-value resulting from a hypergeometric test for enrichment of genes p.adjust The adjusted p-value geneID Entrez Gene ID of the genes in cluster or virus interactome that match Description. There will be as many genes here as the numerator in GeneRatio. Table 9A-I list significantly enriched GO terms. Tables labeled as “Cluster_x” represent the results associated with clusters defined in FIG. 2A. Cluster 7 does not have a sheet as there were no terms with adjusted p-value < 0.05. Tables labeled as MERS, SARS-COV-1, and SARS-COV-2 represent the results associated with the high-confidence interactors of the corresponding virus.

    [0463] Next, whether the conserved interactions were specific for certain viral proteins (FIG. 2C) was investigated, and it wasfound that some proteins (i.e., M, N, Nsp7/8/13) showed a disproportionately high fraction of shared interactions conserved across the three viruses. This suggests that the processes targeted by these proteins may be more essential and/or more likely to be required for other emerging coronaviruses. Such differences in conservation of interactions should be encoded, to some extent, in the degree of sequence differences. Comparing pairs of homologous proteins shared between SARS-CoV-2 and SARS-CoV-1 or MERS-CoV, a significant correlation was observed between sequence conservation and protein-protein interaction (PPI) similarity (calculated as Jaccard index) (FIG. 2D, r=0.58, p-value=0.0001). Without wishing to be bound by theoyr, this shows that the evolution of protein sequences strongly determines the divergence in the host interactors.

    [0464] Referring to FIG. 2C, the percentage of interactions for each viral protein belonging to each cluster identified in FIG. 2A is shown.

    [0465] Referring to FIG. 2D, a correlation between protein sequence similarity and PPI overlap (Jaccard index) comparing SARS-CoV-2 and SARS-CoV-1 (blue) or MERS-CoV (red) is shown. Interactions for PPI overlap are derived from the final thresholded list of interactions per virus.

    [0466] While studying the function of host proteins interacting with each virus it was noted that some shared cellular processes were targeted via different interactions across the viruses. To study this in more detail, the cellular processes significantly enriched in the interactomes of all three viruses (FIG. 14A and Table 9A-J) were identified, and ranked by the degree of overlapping proteins (FIG. 2E). This identified proteins related to the nuclear envelope, proteasomal catabolism, cellular response to heat, and regulation of intracellular protein transport as biological functions that are hijacked by these viruses through different human proteins. Additionally, it was found that up to 51% of protein interactions with a conserved human target occurred via a different (non-orthologous) viral protein (FIG. 2F) and, in some cases, the overlap of interactions for two non-orthologous virus baits was greater than that for the orthologous pair (FIG. 2G and FIG. 14B-C). For example, several interacting proteins of SARS-CoV-2 Nsp8 are also targeted by MERS-CoV Orf4a, and interactions of MERS-CoV Orf5 share interactors with SARS-CoV-2 Orf3a (FIG. 2G). In the case of Nsp8, some degree of structural homology was found between the C-terminal region of Nsp8 and a predicted structural model of Orf4a (FIG. 14D), indicative of a possible common interaction mechanism.

    [0467] Referring to FIG. 2E, GO biological process terms significantly enriched (q<0.05) for all three virus PPIs with Jaccard index indicating overlap of genes from each term for pairwise comparisons between SARS-CoV-1 and SARS-CoV-2 (purple), SARS-CoV-1 and MERS-CoV (green) and SARS-CoV-2 and MERS-CoV (orange).

    [0468] Referring to FIG. 2F, the fraction of shared preys between orthologous (blue) versus non-orthologous (red) viral protein baits is shown.

    [0469] Referring to FIG. 2G, a heatmap depicting overlap in PPIs (Jaccard index) between each bait from SARS-CoV-2 and MERS-CoV is shown. Baits in grey were not assessed, do not exist, or do not have high-confidence interactors in the compared virus. Non-orthologous bait interactions are highlighted with a red square. GO=Gene Ontology; PPI=protein-protein interaction; SARS2=SARS-CoV-2; SARS1=SARS-CoV-1; MERS=MERS-CoV.

    [0470] Referring to FIG. 14A, Gene Ontology (GO) enrichment analysis of the high-confidence interactors of the three viruses is shown. The top ten most significant terms are included per virus. Color indicates −log 10(q). Number indicates number of genes; white numbers denote significant enrichment (q<0.05), whereas grey numbers indicate non-significance (q>0.05).

    [0471] Referring to FIG. 14B, a heatmap depicting overlap in protein-protein interactions (Jaccard index) between all baits from SARS-CoV-1 and SARS-CoV-2 is shown. Baits in grey were not assessed, do not exist, or do not have high-confidence interactors in the alternate virus. Nonorthologous baits are highlighted with a red square.

    [0472] Referring to FIG. 14C, a heatmap depicting overlap in protein-protein interactions (Jaccard index) between all baits from SARS-CoV-1 and MERS-CoV is shown. Baits in grey were not assessed, do not exist, or do not have high-confidence interactors in the alternate virus. Non-orthologous baits are highlighted with a red square.

    [0473] Referring to FIG. 14D, the structure of the C-terminal region of SARS-CoV-2 Nsp8 (upper panel) and a predicted structural model of MERS-CoV Orf4a (lower panel) is shown. Red represents structurally similar regions as determined by Geometricus.

    [0474] In summary, it was found that sequence differences determine the degree of changes in viral-host interactions, and that often the same cellular process can be targeted via different viral and/or host proteins. Without wishing to be bound by theory, these results suggest some degree of plasticity in the way these viruses can control a given biological process in the host cell.

    [0475] Quantitative Differential Interaction Scoring (DIS) Identifies Interactions Conserved Between Coronaviruses

    [0476] The identification of virus-host interactions conserved across pathogenic coronaviruses provides the opportunity to reveal host targets that may remain essential for these and other emerging coronaviruses. For a quantitative comparison of each virus-human interaction from viral baits shared by all three viruses, a differential interaction score (DIS) was developed. DIS is calculated between any pair of viruses and is defined as the difference between the interaction scores (K) from each virus (FIG. 15A and Table 10A-B). This kind of comparative analysis is beneficial as it permits the recovery of conserved interactions that may fall just below strict cutoffs. For each comparison, DIS was calculated for interactions residing in certain clusters as defined in the previous analysis (see FIG. 2A). For example, for the SARS-CoV-2 to MERS-CoV comparison, a DIS was computed for interactions residing in all clusters except cluster 3, where interactions are either not found or scores were very low for both SARS-CoV-2 and MERS-CoV. A DIS of 0 indicates that the interaction is confidently shared between the two viruses being compared, while a DIS of +1 or −1 indicates that the host protein interaction is specific for the virus listed first or second, respectively.

    [0477] Referring to FIG. 15A, a flowchart depicting calculation of differential interactions scores (DIS) using the average between the Saint and MIST scores between every bait (i) and prey (j) to derive interaction score (K) is shown. The DIS is the difference between the interaction scores from each virus. The modified DIS (SARS-MERS) compares the average K from SARS-CoV-1 and SARS-CoV2 to that of MERS-CoV. Only viral bait proteins shared between all three viruses are included.

    TABLE-US-00027 TABLE 10A Bait_Prey Bait Prey MIST_MERS MIST_SARS1 MIST_SARS2 Saint_MERS Saint_SARS1 Saint_SARS2 BFDR_MERS BFDR_SARS1 BFDR_SARS2 E-O00203 E AP3B1 0.2698 0.60657 0.963550095 0 0.63 0.99 0.75 0.1 0 E-O15270 E SPTLC2 0.89523 0 0 0.97 0 0 0 NA NA E-O43505 E B4GAT1 0.71348 0 0 1 0 0 0 NA NA E-O60885 E BRD4 0.095039 0.68551 0.97848835 0 0 0.97 0.75 0.74 0 E-O75787 E ATP6AP2 0.86035 0 0 0.98 0 0 0 NA NA E-P01861 E IGHG4 0.99139 0 0 0.95 0 0 0.01 NA NA E-P25440 E BRD2 0 0.36688 0.906592876 0 0.63 1 NA 0.12 0 E-Q5T9L3 E WLS 0.90131 0 0 0.95 0 0 0.01 NA NA E-Q6DD88 E ATL3 0.98317 0 0 1 0 0 0 NA NA E-Q6UX04 E CWC27 0.03892 0.65353 0.89310916 0 0.98 0.66 0.75 0 0.03 E-Q86VM9 E ZC3H18 0 0.61758 0.796415039 0 0 0.97 NA 0.74 0 E-Q8IWA5 E SLC44A2 0 0 0.950342834 0 0 0.98 NA NA 0 E-Q8IZ52 E CHPF 0.80352 0 0 0.97 0 0 0.01 NA NA E-Q8WVM8 E SCFD1 0.72135 0.30634 0 0.95 0 0 0.01 0.74 NA E-Q8WY22 E BRI3BP 0.99124 0 0 1 0 0 0 NA NA E-Q92665 E MRPS31 0 0.86696 0 0 0.95 0 NA 0.01 NA E-Q9BTV4 E TMEM43 0.87527 0 0 1 0 0 0 NA NA E-Q9NPI6 E DCP1A 0.97974 0 0 1 0 0 0 NA NA E-Q9UBS3 E DNAJB9 0.97286 0 0 0.98 0 0 0 NA NA E-Q9ULP9 E TBC1D24 0 0.91651 0 0 0.97 0 NA 0.01 NA E-Q9Y5L0 E TNPO3 0.90977 0 0 0.99 0 0 0 NA NA M-O15321 M TM9SF1 0 0.99145 0.55254956 0 1 1 NA 0 0 M-O15397 M IPO8 0.83073 0.70698 0.582052482 0.31 1 0.98 0.22 0 0 M-O15431 M SLC31A1 0 0.74357 0.685510759 0 0.95 0 NA 0.01 0.69 M-O43156 M TTI1 0 0.98681 0 0 0.97 0 NA 0.01 NA M-O60779 M SLC19A2 0 0.98935 0.744933284 0 0.97 0.32 NA 0.01 0.23 M-O75027 M ABCB7 0 0.73924 0.598033368 0 1 0.65 NA 0 0.05 M-O75439 M PMPCB 0 0 0.985120198 0 0 1 NA NA 0 M-O94822 M LTN1 0.99367 0.92809 0.537310468 0.94 1 1 0.01 0 0 M-O94829 M IPO13 0.66055 0.99269 0.586881917 0.31 1 0.33 0.22 0 0.19 M-O95070 M YIF1A 0 0.48186 0.856000835 0 0.65 0.97 NA 0.09 0 M-O95674 M CDS2 0.98243 0.85794 0.529235842 0.96 1 1 0.01 0 0 M-O95864 M FADS2 0 0.96971 0.587168157 0 0.98 0.65 NA 0 0.05 M-P05026 M ATP1B1 0 0.99394 0.817625601 0 1 1 NA 0 0 M-P07384 M CAPN1 0.63285 0.82648 0.463123411 0 1 0.99 0.75 0 0 M-P11310 M ACADM 0 0.29729 0.724348569 0 0.63 0.97 NA 0.1 0 M-P13804 M ETFA 0 0.47824 0.718398295 0 1 0.97 NA 0 0 M-P20020 M ATP2B1 0.85897 0.88177 0.66909613 0.31 1 1 0.22 0 0 M-P23634 M ATP2B4 0 0.94562 0.429226053 0 0.67 0.32 NA 0.04 0.23 M-P24390 M KDELR1 0 0.72294 0.454194622 0 0.95 0.64 NA 0.01 0.08 M-P27105 M STOM 0 0.69334 0.752971772 0 0.98 0.98 NA 0 0 M-P33527 M ABCC1 0 0.97041 0 0 1 0 NA 0 NA M-P35670 M ATP7B 0 0.99058 0 0 0.98 0 NA 0 NA M-P38435 M GGCX 0 0.93354 0.789966998 0 1 0.96 NA 0 0.01 M-P38606 M ATP6V1A 0 0.36314 0.794938493 0 0.98 0.65 NA 0 0.05 M-P40763 M STAT3 0 0.87424 0 0 0.99 0 NA 0 NA M-P43003 M SLC1A3 0.97418 0.87471 0.688209246 0.31 1 0.98 0.22 0 0 M-P48556 M PSMD8 0 0.37311 0.881424779 0 0.63 0.65 NA 0.1 0.05 M-P49768 M PSEN1 0.98243 0.77968 0.538073775 0.31 0.98 0 0.22 0 0.69 M-P56589 M PEX3 0.61637 0.78566 0 0 0.98 0 0.75 0 NA M-P61803 M DAD1 0 0.91673 0.544853165 0 0.99 0.32 NA 0 0.23 M-P98194 M ATP2C1 0.98279 0.96438 0.437113101 0.62 1 1 0.09 0 0 M-Q00765 M REEP5 0 0.30793 0.913088507 0 0.33 1 NA 0.22 0 M-Q10713 M PMPCA 0 0 0.991059815 0 0 1 NA NA 0 M-Q13409 M DYNC1I2 0 0.75358 0.685510754 0 0.98 0.33 NA 0 0.19 M-Q13433 M SLC39A6 0.44339 0.92272 0.886153423 0.31 0.99 0.64 0.22 0 0.08 M-Q13505 M MTX1 0 0.7196 0.750438714 0 0.98 0.64 NA 0 0.08 M-Q14CZ7 M FASTKD3 0 0.99394 0.303183199 0 0.95 0 NA 0.01 0.69 M-Q15043 M SLC39A14 0.18378 0.72087 0.537571222 0 1 1 0.75 0 0 M-Q15386 M UBE3C 0 0.70952 0.265922883 0 0.67 0.64 NA 0.04 0.08 M-Q4KMQ2 M ANO6 0 0.86403 0.993904419 0 0.32 1 NA 0.28 0 M-Q53R41 M FASTKD1 0.58836 0.8606 0.622957566 0.97 1 1 0 0 0 M-Q5BJH7 M YIF1B 0.37122 0.98935 0.597949548 0 0.97 1 0.75 0.01 0 M-Q5H8A4 M PIGG 0.13645 0.98937 0.558367337 0 1 0.97 0.75 0 0 M-Q5JRX3 M PITRM1 0 0.0011109 0.952308232 0 0 1 NA 0.74 0 M-Q5T1Q4 M SLC35F1 0 0.98681 0 0 0.97 0 NA 0.01 NA M-Q5T9L3 M WLS 0.086274 0.99094 0.626982883 0 1 0.99 0.75 0 0 M-Q68DH5 M LMBRD2 0.98693 0.68551 0.244942963 0.95 0 0 0.01 0.74 0.69 M-Q6AI08 M HEATR6 0 0.82843 0 0 0.97 0 NA 0.01 NA M-Q6P3X3 M TTC27 0.74622 0.72081 0.362292246 1 1 0.33 0 0 0.19 M-Q6PJG6 M BRAT1 0 0.99113 0 0 1 0 NA 0 NA M-Q6PML9 M SLC30A9 0 0.47111 0.886323242 0 0.66 0.65 NA 0.07 0.05 M-Q7L8L6 M FASTKD5 0 0.71047 0.758365887 0 1 1 NA 0 0 M-Q7RTS9 M DYM 0 0.98935 0 0 0.97 0 NA 0.01 NA M-Q7Z3U7 M MON2 0 0.98147 0.685510175 0 0.98 0.32 NA 0 0.23 M-Q86UL3 M GPAT4 0.29976 0.84955 0.48498957 0.31 1 0.96 0.22 0 0.01 M-Q8N1F8 M STK11IP 0 0.99394 0 0 0.95 0 NA 0.01 NA M-Q8N5G2 M MACO1 0 0.9356 0 0 0.67 0 NA 0.04 NA M-Q8NDZ4 M DIPK2A 0.74768 0 0 1 0 0 0 NA NA M-Q8NEW0 M SLC30A7 0.58339 0.62216 0.766972437 0.64 0.97 1 0.08 0.01 0 M-Q8TBF5 M PIGX 0 0.99009 0.427323161 0 0.99 0.33 NA 0 0.19 M-Q8TCJ2 M STT3B 0 0.99097 0.01779039 0 1 0 NA 0 0.69 M-Q8TEM1 M NUP210 0.72584 0.029862 0 1 0 0 0 0.74 NA M-Q8WUD6 M CHPT1 0 0.89785 0.635974009 0 0.98 0.65 NA 0 0.05 M-Q8WY22 M BRI3BP 0 0.82488 0.574146705 0 1 1 NA 0 0 M-Q92604 M LPGAT1 0 0.98681 0.652520995 0 0.97 0.66 NA 0.01 0.04 M-Q92616 M GCN1 0.76728 0.54828 0 1 1 0 0 0 NA M-Q969V3 M NCLN 0.48416 0.77626 0.464252443 1 1 0.32 0 0 0.23 M-Q96AA3 M RFT1 0 0.80897 0.551265158 0 0.95 0.98 NA 0.01 0 M-Q96CW5 M TUBGCP3 0.55409 0.99335 0.753607002 0.33 1 1 0.18 0 0 M-Q96D53 M COQ8B 0 0.94235 0.80074032 0 1 0.99 NA 0 0 M-Q96EC8 M YIPF6 0.94049 0.97013 0.677288018 1 0.65 0.64 0 0.09 0.08 M-Q96ER3 M SAAL1 0 0.37631 0.769472929 0 0.98 1 NA 0 0 M-Q96HR9 M REEP6 0 0 0.955657163 0 0 0.65 NA NA 0.05 M-Q96HW7 M INTS4 0 0.81238 0.943304706 0 0.33 0.65 NA 0.21 0.05 M-Q99805 M TM9SF2 0 0.79474 0.410099202 0 0.67 0.33 NA 0.04 0.19 M-Q9BQ95 M ECSIT 0 0.98935 0 0 0.97 0 NA 0.01 NA M-Q9BQT8 M SLC25A21 0.43267 0.69462 0.880779937 0 0.65 0.65 0.75 0.09 0.05 M-Q9BSJ2 M TUBGCP2 0.89421 0.94558 0.83958055 0.97 1 1 0 0 0 M-Q9BTY2 M FUCA2 0 0.91171 0.440518376 0 0.98 0.32 NA 0 0.23 M-Q9BV40 M VAMP8 0.98738 0 0 1 0 0 0 NA NA M-Q9BW92 M TARS2 0.061949 0.37463 0.758110505 0 1 0.97 0.75 0 0 M-Q9BYC5 M FUT8 0.963 0 0 0.98 0 0 0 NA NA M-Q9C0D9 M SELENOI 0 0.98935 0.879776538 0 0.97 0 NA 0.01 0.69 M-Q9C0E2 M XPO4 0 0.94301 0.879776036 0 0.97 0 NA 0.01 0.69 M-Q9GZM5 M YIPF3 0.53419 0.92485 0.483341368 0 0.98 0.65 0.75 0 0.05 M-Q9H0V9 M LMAN2L 0.97612 0 0 0.98 0 0 0 NA NA M-Q9H2J7 M SLC6A15 0 0.99394 0.246796903 0 0.99 0 NA 0 0.69 M-Q9H583 M HEATR1 0.70638 0.75713 0 0.99 1 0 0 0 NA M-Q9H7F0 M ATP13A3 0 0.99199 0.487611844 0 1 0.97 NA 0 0 M-Q9H845 M ACAD9 0 0.84516 0 0 1 0 NA 0 NA M-Q9H8M5 M CNNM2 0 0.99394 0 0 0.99 0 NA 0 NA M-Q9NQC3 M RTN4 0 0.44481 0.873826097 0 1 1 NA 0 0 M-Q9NVH2 M INTS7 0 0.89434 0.808244829 0 0.97 0.64 NA 0.01 0.08 M-Q9NVI1 M FANCI 0.81327 0.72447 0.557293884 1 1 1 0 0 0 M-Q9NX47 M MARCH5 0.98243 0 0 0.99 0 0 0 NA NA M-Q9P2R7 M SUCLA2 0.66214 0.76644 0.419797298 0.95 1 0.98 0.01 0 0 M-Q9UBF2 M COPG2 0 0.91857 0.117335394 0 1 0.99 NA 0 0 M-Q9UBU6 M FAM8A1 0 0.88005 0.80448832 0 0.63 0.97 NA 0.1 0 M-Q9UDR5 M AASS 0 0.95492 0.765109504 0 0.65 0.98 NA 0.08 0 M-Q9UI26 M IPO11 0.99367 0.68215 0.649385462 0.99 1 1 0 0 0 M-Q9UKV5 M AMFR 0.27192 0.98708 0.043516186 0 1 1 0.75 0 0 M-Q9ULF5 M SLC39A10 0 0.73747 0 0 1 0 NA 0 NA M-Q9ULX6 M AKAP8L 0 0.34 0.751981385 0 0.98 1 NA 0 0 M-Q9Y312 M AAR2 0.56081 0.48301 0.801486724 0.31 0.66 0.99 0.22 0.05 0 M-Q9Y4R8 M TELO2 0.74925 0.91945 0.542406748 1 1 1 0 0 0 M-Q9Y5Y0 M FLVCR1 0 0.97851 0.640982121 0 0.98 0.65 NA 0 0.05 M-Q9Y6E2 M BZW2 0 0 0.756364362 0 0 0.97 NA NA 0 N-O43818 N RRP9 0.54769 0.90021 0.861168798 1 1 1 0 0 0 N-O75683 N SURF6 0.45451 0.70857 0.608432617 0.98 1 0.99 0 0 0 N-P11940 N PABPC1 0.48869 0.64471 0.736635929 1 1 1 0 0 0 N-P16989 N YBX3 0.40553 0.74013 0.654394207 0.62 1 1 0.09 0 0 N-P19784 N CSNK2A2 0.76302 0.78377 0.875048268 1 1 1 0 0 0 N-P67870 N CSNK2B 0.52768 0.70614 0.803607895 0.61 1 0.97 0.12 0 0 N-P68400 N CSNK2A1 0.87167 0.64361 0.981288441 1 0.99 0.32 0 0 0.23 N-Q13283 N G3BP1 0 0.92369 0.95331626 0 1 1 NA 0 0 N-Q13310 N PABPC4 0.52068 0.86606 0.846200046 1 1 1 0 0 0 N-Q15435 N PPP1R7 0.98385 0 0 1 0 0 0 NA NA N-Q6PKG0 N LARP1 0.512 0.742 0.73787466 1 1 1 0 0 0 N-Q86U42 N PABPN1 0.45331 0.71046 0.534817993 0.31 0.95 0.32 0.22 0.01 0.31 N-Q8NCA5 N FAM98A 0.53223 0.9296 0.921076719 0.64 1 1 0.08 0 0 N-Q8TAD8 N SNIP1 0.65313 0.71644 0.818230245 0.88 1 1 0.02 0 0 N-Q92900 N UPF1 0.11167 0.51968 0.753067271 0 0.97 1 0.75 0.01 0 N-Q9BQ75 N CMSS1 0.47647 0.83768 0.415963465 0.94 1 0 0.01 0 0.69 N-Q9HCE1 N MOV10 0.66104 0.61115 0.736672944 1 0.97 0.99 0 0.01 0 N-Q9UN86 N G3BP2 0 0.87669 0.958133672 0 1 1 NA 0 0 nsp1-O60220 nsp1 TIMM8A 0.70557 0 0 1 0 0 0 NA NA nsp1-P09884 nsp1 POLA1 0 0.68551 0.981264591 0 1 0.99 NA 0 0 nsp1-P40763 nsp1 STAT3 0.9586 0 0 0.99 0 0 0 NA NA nsp1-P42345 nsp1 MTOR 0.94974 0 0 0.67 0 0 0.04 NA NA nsp1-P49642 nsp1 PRIM1 0 0.65454 0.981268688 0 0.99 0.99 NA 0 0 nsp1-P49643 nsp1 PRIM2 0 0.649 0.993975192 0 1 1 NA 0 0 nsp1-Q05516 nsp1 ZBTB16 0.98489 0 0 1 0 0 0 NA NA nsp1-Q14181 nsp1 POLA2 0 0.99329 0.943678488 0 1 0.67 NA 0 0.03 nsp1-Q8NBJ5 nsp1 COLGALT1 0 0 0.794123974 0 0 1 NA NA 0 nsp1-Q99959 nsp1 PKP2 0 0 0.964585351 0 0 1 NA NA 0 nsp10-O94973 nsp10 AP2A2 0 0.77587 0.99112813 0 0.66 1 NA 0.06 0 nsp10-P28330 nsp10 ACADL 0.88002 0 0 1 0 0 0 NA NA nsp10-P55789 nsp10 GFER 0 0.46503 0.965372815 0 0.41 1 NA 0.17 0 nsp10-Q6Q0C0 nsp10 TRAF7 0 0.98559 0.993045461 0 1 0 NA 0 0.69 nsp10-Q969X5 nsp10 ERGIC1 0 0.86515 0.912239515 0 1 1 NA 0 0 nsp10-Q96CW1 nsp10 AP2M1 0 0.74596 0.982905884 0 0.33 0.98 NA 0.24 0 nsp10-Q9BZH6 nsp10 WDR11 0.97455 0 0 1 0 0 0 NA NA nsp10-Q9C026 nsp10 TRIM9 0.89351 0 0 0.66 0 0 0.05 NA NA nsp10-Q9HAV7 nsp10 GRPEL1 0 0.53137 0.986587081 0 0.99 0.98 NA 0 0 nsp11-O14734 nsp11 ACOT8 0.70954 0.3104 0.369791477 0.96 0.33 0.33 0.01 0.2 0.18 nsp11-O75347 nsp11 TBCA 0.47761 0.47563 0.768344701 0.78 0.67 0.93 0.03 0.05 0.01 nsp11-Q92624 nsp11 APPBP2 0.64641 0.85506 0.941018639 0.62 1 0.33 0.09 0 0.19 nsp11-Q9C0D3 nsp11 ZYG11B 0 0.89544 0.447833969 0 1 1 NA 0 0 nsp13-A7MCY6 nsp13 TBKBP1 0.68551 0.86537 0.985289524 0 0.32 1 0.75 0.28 0 nsp13-O14578 nsp13 CIT 0 0 0.887314876 0 0 1 NA NA 0 nsp13-O14639 nsp13 ABLIM1 0 0.74788 0 0 1 0 NA 0 NA nsp13-O14908 nsp13 GIPC1 0.22076 0.87091 0 0 0.98 0 0.75 0 NA nsp13-O60237 nsp13 PPP1R12B 0.22137 0.74867 0 0.31 0.67 0 0.22 0.04 NA nsp13-O60784 nsp13 TOM1 0.39582 0.81982 0.196041465 0.64 1 0.33 0.07 0 0.18 nsp13-O75381 nsp13 PEX14 0.68551 0.87952 0 0.31 0.66 0 0.22 0.05 NA nsp13-O75506 nsp13 HSBP1 0 0.52758 0.851502614 0 0.99 1 NA 0 0 nsp13-O95613 nsp13 PCNT 0.95289 0.95032 0.971855938 1 1 1 0 0 0 nsp13-O95684 nsp13 FGFR1OP 0.68551 0.86156 0.981570359 0 0.67 0.65 0.75 0.05 0.05 nsp13-P06396 nsp13 GSN 0.29922 0.74995 0 0.33 1 0 0.18 0 NA nsp13-P09493 nsp13 TPM1 0.76988 0.81095 0.197572818 1 1 0.33 0 0 0.18 nsp13-P13861 nsp13 PRKAR2A 0.87649 0.79998 0.897857211 1 1 1 0 0 0 nsp13-P14649 nsp13 MYL6B 0.77192 0.85675 0.303981322 0.98 1 0.33 0 0 0.18 nsp13-P17612 nsp13 PRKACA 0.84509 0.86768 0.880321174 0.98 1 1 0 0 0 nsp13-P28289 nsp13 TMOD1 0.414 0.71944 0.139654825 0.66 1 0.33 0.05 0 0.18 nsp13-P31323 nsp13 PRKAR2B 0.98498 0.88015 0.983191506 0.97 0.66 1 0 0.07 0 nsp13-P35241 nsp13 RDX 0 0.86694 0.912028315 0 0.97 1 NA 0.01 0 nsp13-P49454 nsp13 CENPF 0.91284 0.88015 0.873840643 0.97 0 1 0 0.74 0 nsp13-P67936 nsp13 TPM4 0.86851 0.88611 0.381089268 1 1 0.33 0 0 0.18 nsp13-Q04724 nsp13 TLE1 0 0.95538 0.96917283 0 0.98 1 NA 0 0 nsp13-Q04726 nsp13 TLE3 0 0.85217 0.933626993 0 1 1 NA 0 0 nsp13-Q08117 nsp13 TLE5 0 0.94933 0.962431031 0 0.65 0.66 NA 0.09 0.04 nsp13-Q08378 nsp13 GOLGA3 0.90861 0.88663 0.928738823 1 1 1 0 0 0 nsp13-Q08379 nsp13 GOLGA2 0.91185 0.90103 0.952311087 1 1 1 0 0 0 nsp13-Q12965 nsp13 MYO1E 0.87848 0.98702 0.685511322 1 1 0.33 0 0 0.18 nsp13-Q13045 nsp13 FLII 0.40852 0.74106 0.041584009 0.67 1 0.32 0.04 0 0.23 nsp13-Q14789 nsp13 GOLGB1 0.85988 0.88008 0.985604541 0.31 1 1 0.22 0 0 nsp13-Q15154 nsp13 PCM1 0.70364 0.75293 0.696288454 1 1 1 0 0 0 nsp13-Q16881 nsp13 TXNRD1 0.96667 0 0 1 0 0 0 NA NA nsp13-Q4V328 nsp13 GRIPAP1 0.87985 0.68552 0.989815969 0 1 1 0.75 0 0 nsp13-Q5VT06 nsp13 CEP350 0.30194 0.73848 0.86755993 0.33 0.67 1 0.19 0.04 0 nsp13-Q5VU43 nsp13 PDE4DIP 0.98858 0.87932 0.979124391 1 1 1 0 0 0 nsp13-Q5VUJ6 nsp13 LRCH2 0 0.7652 0 0 0.97 0 NA 0.01 NA nsp13-Q66GS9 nsp13 CEP135 0.8678 0.95899 0.975292134 0.66 0.98 1 0.05 0 0 nsp13-Q6ZVM7 nsp13 TOM1L2 0.47294 0.92681 0.28330576 0 1 0.32 0.75 0 0.23 nsp13-Q76N32 nsp13 CEP68 0.832 0 0.879704216 0.33 0 0.67 0.19 NA 0.03 nsp13-Q7Z406 nsp13 MYH14 0.54878 0.70986 0.079233549 1 1 0.33 0 0 0.17 nsp13-Q7Z7A1 nsp13 CNTRL 0 0 0.989917408 0 0 1 NA NA 0 nsp13-Q8IUD2 nsp13 ERC1 0.98713 0.90874 0.990718127 1 0.66 1 0 0.05 0 nsp13-Q8IWJ2 nsp13 GCC2 0.91146 0 0.987387119 0.98 0 1 0 NA 0 nsp13-Q8N3C7 nsp13 CLIP4 0 0.90389 0.966944672 0 0.65 0.99 NA 0.08 0 nsp13-Q8N4C6 nsp13 NIN 0.98681 0.68551 0.991583194 1 1 1 0 0 0 nsp13-Q8N8E3 nsp13 CEP112 0.84889 0.68551 0.964318835 0.33 0 0.65 0.19 0.74 0.05 nsp13-Q8NDN9 nsp13 RCBTB1 0.78594 0 0 0.99 0 0 0 NA NA nsp13-Q8TD10 nsp13 MIPOL1 0.88012 0.86835 0.98176996 1 1 1 0 0 0 nsp13-Q8WXW3 nsp13 PIBF1 0.59305 0.83029 0.610504389 0 0.67 0 0.75 0.04 0.69 nsp13-Q92614 nsp13 MYO18A 0.52971 0.87674 0.152846567 1 1 0.33 0 0 0.18 nsp13-Q92995 nsp13 USP13 0.8682 0.96538 0.987514452 0.31 0.98 1 0.22 0 0 nsp13-Q96CN9 nsp13 GCC1 0 0.65419 0.873361571 0 0 1 NA 0.74 0 nsp13-Q96II8 nsp13 LRCH3 0.3371 0.90876 0 0.33 1 0 0.18 0 NA nsp13-Q96N16 nsp13 JAKMIP1 0 0.97246 0.987966991 0 1 1 NA 0 0 nsp13-Q96SN8 nsp13 CDK5RAP2 0.9235 0.90815 0.939307247 1 1 1 0 0 0 nsp13-Q99996 nsp13 AKAP9 0.98986 0.87708 0.990813809 1 1 1 0 0 0 nsp13-Q9BQQ3 nsp13 GORASP1 0.98092 0.96911 0.986870312 0.31 0.99 1 0.22 0 0 nsp13-Q9BQS8 nsp13 FYCO1 0.97192 0 0.733173301 1 0 0.65 0 NA 0.05 nsp13-Q9BV19 nsp13 C1orf50 0 0.98609 0.932056845 0 0.95 1 NA 0.01 0 nsp13-Q9BV73 nsp13 CEP250 0.87853 0.97667 0.990717833 1 1 1 0 0 0 nsp13-Q9BZF9 nsp13 UACA 0.5526 0.81512 0.431068209 0.65 1 0.33 0.06 0 0.18 nsp13-Q9C0B0 nsp13 UNK 0.97076 0 0 0.97 0 0 0 NA NA nsp13-Q9H0E2 nsp13 TOLLIP 0.66286 0.85198 0.148955029 0.67 1 0 0.05 0 0.69 nsp13-Q9UHD2 nsp13 TBK1 0.68551 0.86537 0.993970596 0 0.32 1 0.75 0.28 0 nsp13-Q9UJC3 nsp13 HOOK1 0.85988 0.68551 0.994048081 0.31 1 1 0.22 0 0 nsp13-Q9ULV0 nsp13 MYO5B 0 0.72441 0 0 0.67 0 NA 0.04 NA nsp13-Q9UM54 nsp13 MYO6 0.69034 0.77867 0.178240322 1 1 0.33 0 0 0.17 nsp13-Q9UNZ2 nsp13 NSFL1C 0.98824 0 0 0.95 0 0 0.01 NA NA nsp13-Q9UPN4 nsp13 CEP131 0.69689 0.85879 0.583168141 1 1 0.99 0 0 0 nsp13-Q9UPQ0 nsp13 LIMCH1 0 0.89548 0 0 1 0 NA 0 NA nsp13-Q9Y216 nsp13 NINL 0.98456 0.68551 0.987790569 1 1 1 0 0 0 nsp13-Q9Y411 nsp13 MYO5A 0.60089 0.78808 0.199600266 0.98 1 0.33 0 0 0.18 nsp13-Q9Y608 nsp13 LRRFIP2 0.61069 0.77317 0.182792533 0.98 1 0.33 0 0 0.18 nsp14-O95071 nsp14 UBR5 0.75799 0 0 0.67 0 0 0.04 NA NA nsp14-O95714 nsp14 HERC2 0 0.97816 0 0 1 0 NA 0 NA nsp14-P04637 nsp14 TP53 0.81292 0 0 1 0 0 0 NA NA nsp14-P06280 nsp14 GLA 0 0.80341 0.841137578 0 1 1 NA 0 0 nsp14-P12268 nsp14 IMPDH2 0.73398 0.71448 0.989667608 0.64 0.97 1 0.08 0.01 0 nsp14-P30153 nsp14 PPP2R1A 0.72375 0.2207 0.433732356 1 0.18 0.72 0 0.43 0.02 nsp14-P49959 nsp14 MRE11 0.78836 0 0 1 0 0 0 NA NA nsp14-P63151 nsp14 PPP2R2A 0.7599 0.44327 0.365051744 0.99 0.25 0 0 0.38 0.69 nsp14-Q5QP82 nsp14 DCAF10 0.9884 0 0 1 0 0 0 NA NA nsp14-Q5T9A4 nsp14 ATAD3B 0.73349 0 0 1 0 0 0 NA NA nsp14-Q92878 nsp14 RAD50 0.90053 0 0 1 0 0 0 NA NA nsp14-Q96EN8 nsp14 MOCOS 0.99187 0 0 1 0 0 0 NA NA nsp14-Q96JN8 nsp14 NEURL4 0 0.87704 0 0 1 0 NA 0 NA nsp14-Q9NQX3 nsp14 GPHN 0.84378 0 0 1 0 0 0 NA NA nsp14-Q9NXA8 nsp14 SIRT5 0 0.99078 0.99363281 0 1 1 NA 0 0 nsp15- nsp15 IGHV3-72 0.9363 0 0 1 0 0 0 NA NA A0A0B4J1Y9 nsp15-P61970 nsp15 NUTF2 0 0 0.987886 0 0 0.97 NA NA 0 nsp15-P62330 nsp15 ARF6 0 0.713 0.988131492 0 1 1 NA 0 0 nsp15-Q9H4P4 nsp15 RNF41 0 0 0.993560817 0 0 1 NA NA 0 nsp16-A3KMH1 nsp16 VWA8 0.72836 0 0 0.97 0 0 0 NA NA nsp16-O14972 nsp16 VPS26C 0 0 0.989672314 0 0 0.97 NA NA 0.01 nsp16-O43933 nsp16 PEX1 0 0 0.993038775 0 0 1 NA NA 0 nsp16-O60232 nsp16 ZNRD2 0.23358 0.73317 0.459525316 0.02 0.88 0.88 0.54 0.01 0.01 nsp16-O60826 nsp16 CCDC22 0 0.55155 0.992439461 0 0.99 1 NA 0 0 nsp16-O75382 nsp16 TRIM3 0 0 0.939078269 0 0 1 NA NA 0 nsp16-O75564 nsp16 JRK 0 0 0.708146128 0 0 0.98 NA NA 0 nsp16-O75665 nsp16 OFD1 0 0 0.993704543 0 0 1 NA NA 0 nsp16-O95714 nsp16 HERC2 0 0 0.872117541 0 0 1 NA NA 0 nsp16-O95754 nsp16 SEMA4F 0 0 0.990804706 0 0 1 NA NA 0 nsp16-O95835 nsp16 LATS1 0.82894 0 0 0.94 0 0 0.01 NA NA nsp16-P11717 nsp16 IGF2R 0.87428 0 0 0.97 0 0 0 NA NA nsp16-P28838 nsp16 LAP3 0 0.9888 0.93521568 0 1 1 NA 0 0 nsp16-P43686 nsp16 PSMC4 0.75749 0 0 0.98 0 0 0 NA NA nsp16-P51530 nsp16 DNA2 0 0.79299 0.93085338 0 0.33 1 NA 0.2 0 nsp16-P51659 nsp16 HSD17B4 0.82439 0 0.310191794 0.98 0 0.31 0 NA 0.32 nsp16-P54802 nsp16 NAGLU 0.98997 0 0 1 0 0 0 NA NA nsp16-Q05086 nsp16 UBE3A 0 0 0.993205727 0 0 1 NA NA 0 nsp16-Q12923 nsp16 PTPN13 0 0.035145 0.82472846 0 0 1 NA 0.74 0 nsp16-Q13043 nsp16 STK4 0 0 0.936895908 0 0 1 NA NA 0 nsp16-Q13049 nsp16 TRIM32 0 0 0.988853916 0 0 1 NA NA 0 nsp16-Q13188 nsp16 STK3 0.68551 0 0.816118789 0 0 1 0.75 NA 0 nsp16-Q13438 nsp16 OS9 0.99193 0 0.059439168 1 0 0 0 NA 0.72 nsp16-Q15345 nsp16 LRRC41 0 0 0.988401417 0 0 0.97 NA NA 0.01 nsp16-Q15796 nsp16 SMAD2 0.96209 0 0 1 0 0 0 NA NA nsp16-Q53EZ4 nsp16 CEP55 0 0 0.712072426 0 0 1 NA NA 0 nsp16-Q567U6 nsp16 CCDC93 0 0.80434 0.99302779 0 0.97 1 NA 0.01 0 nsp16-Q5SVZ6 nsp16 ZMYM1 0 0.9891 0.994026056 0 1 1 NA 0 0 nsp16-Q5SZL2 nsp16 CEP85L 0 0.6041 0.993496095 0 0 1 NA 0.74 0 nsp16-Q5VUJ6 nsp16 LRCH2 0 0 0.962503191 0 0 1 NA NA 0 nsp16-Q63ZY3 nsp16 KANK2 0 0 0.991823966 0 0 1 NA NA 0 nsp16-Q6GYQ0 nsp16 RALGAPA1 0 0 0.977416641 0 0 0.98 NA NA 0 nsp16-Q6IEG0 nsp16 SNRNP48 0 0 0.787090668 0 0 0.99 NA NA 0 nsp16-Q6PJI9 nsp16 WDR59 0.91343 0 0 0.95 0 0 0.01 NA NA nsp16-Q6ZU80 nsp16 CEP128 0 0 0.893091909 0 0 1 NA NA 0 nsp16-Q6ZWJ1 nsp16 STXBP4 0 0 0.985046716 0 0 0.98 NA NA 0 nsp16-Q70EL1 nsp16 USP54 0 0 0.718980196 0 0 1 NA NA 0 nsp16-Q7Z3J2 nsp16 VPS35L 0 0.68551 0.99120106 0 0 0.99 NA 0.74 0 nsp16-Q7Z4G1 nsp16 COMMD6 0 0 0.993976899 0 0 0.95 NA NA 0.01 nsp16-Q86SQ0 nsp16 PHLDB2 0 0 0.831826435 0 0 1 NA NA 0 nsp16-Q86W92 nsp16 PPFIBP1 0 0 0.968360808 0 0 1 NA NA 0 nsp16-Q86X10 nsp16 RALGAPB 0 0 0.983214673 0 0 1 NA NA 0 nsp16-Q8IUD2 nsp16 ERC1 0 0.9266 0.921350502 0 1 1 NA 0 0 nsp16-Q8IWR1 nsp16 TRIM59 0.95769 0 0 0.66 0 0 0.05 NA NA nsp16-Q8N668 nsp16 COMMD1 0 0 0.961313726 0 0 0.66 NA NA 0.05 nsp16-Q8TEM1 nsp16 NUP210 0 0.98108 0.850755735 0 1 1 NA 0 0 nsp16-Q92995 nsp16 USP13 0.98234 0 0 1 0 0 0 NA NA nsp16-Q96DZ1 nsp16 ERLEC1 0.78671 0 0.384798111 1 0 0.97 0 NA 0.01 nsp16-Q96HP0 nsp16 DOCK6 0 0 0.990342796 0 0 1 NA NA 0 nsp16-Q96II8 nsp16 LRCH3 0 0 0.93763489 0 0 1 NA NA 0 nsp16-Q96IV0 nsp16 NGLY1 0.96057 0 0 1 0 0 0 NA NA nsp16-Q96RU2 nsp16 USP28 0.97728 0 0 0.97 0 0 0 NA NA nsp16-Q9BVQ7 nsp16 SPATA5L1 0 0 0.98126167 0 0 1 NA NA 0 nsp16-Q9GZQ3 nsp16 COMMD5 0 0 0.992994501 0 0 1 NA NA 0 nsp16-Q9H000 nsp16 MKRN2 0 0 0.71582382 0 0 1 NA NA 0 nsp16-Q9H0H0 nsp16 INTS2 0 0.31941 0.938340768 0 0.32 1 NA 0.28 0 nsp16-Q9H4B6 nsp16 SAV1 0 0 0.869610136 0 0 1 NA NA 0 nsp16-Q9NVH2 nsp16 INTS7 0 0 0.92002501 0 0 1 NA NA 0 nsp16-Q9NX08 nsp16 COMMD8 0 0 0.936985686 0 0 0.89 NA NA 0.01 nsp16-Q9P000 nsp16 COMMD9 0 0 0.983665198 0 0 0.99 NA NA 0 nsp16-Q9P209 nsp16 CEP72 0.96027 0 0.685510246 1 0 0 0 NA 0.72 nsp16-Q9P2D0 nsp16 IBTK 0 0 0.774163503 0 0 1 NA NA 0 nsp16-Q9P2S5 nsp16 WRAP73 0 0 0.98754455 0 0 1 NA NA 0 nsp16-Q9UBI1 nsp16 COMMD3 0 0 0.989352281 0 0 1 NA NA 0 nsp16-Q9UHD2 nsp16 TBK1 0 0 0.730696528 0 0 1 NA NA 0 nsp16-Q9UHP3 nsp16 USP25 0 0 0.980380642 0 0 1 NA NA 0 nsp16-Q9UKF6 nsp16 CPSF3 0 0.89275 0.731969888 0 1 1 NA 0 0 nsp16-Q9ULA0 nsp16 DNPEP 0.92879 0 0 1 0 0 0 NA NA nsp16-Q9UN81 nsp16 L1RE1 0 0 0.871349588 0 0 0.97 NA NA 0.01 nsp16-Q9Y2D8 nsp16 SSX2IP 0 0.99395 0.944408372 0 0 1 NA 0.74 0 nsp16-Q9Y2K2 nsp16 SIK3 0 0 0.977256516 0 0 1 NA NA 0 nsp16-Q9Y2S7 nsp16 POLDIP2 0.22683 0.7418 0.186930874 0 1 0.32 0.75 0 0.24 nsp16-Q9Y305 nsp16 ACOT9 0.95763 0 0 1 0 0 0 NA NA nsp16-Q9Y6G5 nsp16 COMMD10 0 0 0.992408318 0 0 1 NA NA 0 nsp2-O00186 nsp2 STXBP3 0.99168 0 0 1 0 0 0 NA NA nsp2-O00303 nsp2 EIF3F 0.53431 0.87273 0 1 1 0 0 0 NA nsp2-O00746 nsp2 NME4 0.80747 0.39111 0 0.95 0.32 0 0.01 0.28 NA nsp2-O14975 nsp2 SLC27A2 0.46144 0.42751 0.915803486 0.64 0.65 0.99 0.08 0.07 0 nsp2-O15372 nsp2 EIF3H 0.46627 0.71459 0.019650551 1 1 0 0 0 0.69 nsp2-O60573 nsp2 EIF4E2 0.51532 0.83022 0.806833749 1 1 1 0 0 0 nsp2-O75821 nsp2 EIF3G 0.34433 0.76953 0 1 1 0 0 0 NA nsp2-O75822 nsp2 EIF3J 0.56841 0.85594 0 0.99 1 0 0 0 NA nsp2-P00387 nsp2 CYB5R3 0.73714 0.2649 0 1 0 0 0 0.74 NA nsp2-P15954 nsp2 COX7C 0.9895 0 0.442430132 0.97 0 0 0.01 NA 0.69 nsp2-P16435 nsp2 POR 0.74761 0.45328 0.710961769 1 0.66 1 0 0.07 0 nsp2-P52306 nsp2 RAP1GDS1 0 0.92777 0.991635744 0 1 1 NA 0 0 nsp2-P60228 nsp2 EIF3E 0.54907 0.75501 0 1 1 0 0 0 NA nsp2-Q10471 nsp2 GALNT2 0.98389 0 0 0.97 0 0 0 NA NA nsp2-Q13423 nsp2 NNT 0.77519 0 0 0.97 0 0 0 NA NA nsp2-Q14152 nsp2 EIF3A 0.52249 0.86374 0 1 1 0 0 0 NA nsp2-Q15650 nsp2 TRIP4 0.87852 0 0 1 0 0 0 NA NA nsp2-Q2M389 nsp2 WASHC4 0 0 0.972115182 0 0 0.99 NA NA 0 nsp2-Q5SZL2 nsp2 CEP85L 0.86472 0 0 0.67 0 0 0.04 NA NA nsp2-Q5T1M5 nsp2 FKBP15 0 0.97855 0.988056696 0 0.63 1 NA 0.1 0 nsp2-Q5VT66 nsp2 MARC1 0.83301 0 0 0.99 0 0 0 NA NA nsp2-Q6NUN9 nsp2 ZNF746 0.96549 0.85087 0 1 0.66 0 0 0.05 NA nsp2-Q6Y7W6 nsp2 GIGYF2 0.76827 0.87377 0.767224555 1 1 1 0 0 0 nsp2-Q7L2H7 nsp2 EIF3M 0.62747 0.96342 0 1 1 0 0 0 NA nsp2-Q86UK7 nsp2 ZNF598 0.48357 0.76844 0.56549083 1 1 1 0 0 0 nsp2-Q8N3C0 nsp2 ASCC3 0.83183 0 0 1 0 0 0 NA NA nsp2-Q8N9N2 nsp2 ASCC1 0.98223 0 0 1 0 0 0 NA NA nsp2-Q8NBU5 nsp2 ATAD1 0.72843 0 0 1 0 0 0 NA NA nsp2-Q8TF46 nsp2 DIS3L 0.99038 0 0 1 0 0 0 NA NA nsp2-Q8WVC6 nsp2 DCAKD 0.77573 0 0 0.97 0 0 0.01 NA NA nsp2-Q96A26 nsp2 FAM162A 0.79955 0.014345 0.011155417 0.98 0 0 0 0.74 0.69 nsp2-Q96B26 nsp2 EXOSC8 0.79211 0 0 0.66 0 0 0.05 NA NA nsp2-Q96D09 nsp2 GPRASP2 0.98996 0 0 1 0 0 0 NA NA nsp2-Q99613 nsp2 EIF3C 0.9926 0.99317 0 1 1 0 0 0 NA nsp2-Q9BQ70 nsp2 TCF25 0.82229 0 0 1 0 0 0 NA NA nsp2-Q9C037 nsp2 TRIM4 0.35683 0.76789 0 0 0.98 0 0.75 0 NA nsp2-Q9H1I8 nsp2 ASCC2 0.88018 0 0 1 0 0 0 NA NA nsp2-Q9HD20 nsp2 ATP13A1 0.93754 0 0 0.98 0 0 0 NA NA nsp2-Q9UBQ5 nsp2 EIF3K 0.54617 0.73776 0 1 1 0 0 0 NA nsp2-Q9UH62 nsp2 ARMCX3 0.98889 0 0 0.95 0 0 0.01 NA NA nsp2-Q9UPQ9 nsp2 TNRC6B 0.73711 0 0 1 0 0 0 NA NA nsp2-Q9Y262 nsp2 EIF3L 0.46611 0.87362 0 1 1 0 0 0 NA nsp4-P13674 nsp4 P4HA1 0.90323 0 0.364154115 1 0 0.33 0 NA 0.19 nsp4-P14735 nsp4 IDE 0 0.98862 0.918031442 0 1 1 NA 0 0 nsp4-P49257 nsp4 LMAN1 0.76853 0.57914 0 1 0 0 0 0.74 NA nsp4-P62072 nsp4 TIMM10 0 0.043526 0.961471982 0 0 1 NA 0.74 0 nsp4-P62699 nsp4 YPEL5 0 0.99361 0 0 0.99 0 NA 0 NA nsp4-Q13586 nsp4 STIM1 0.97869 0 0 0.96 0 0 0.01 NA NA nsp4-Q2TAA5 nsp4 ALG11 0 0.60123 0.72745605 0 1 1 NA 0 0 nsp4-Q6VN20 nsp4 RANBP10 0 0.99277 0 0 1 0 NA 0 NA nsp4-Q7L5Y9 nsp4 MAEA 0 0.98917 0 0 0.98 0 NA 0 NA nsp4-Q8NBJ7 nsp4 SUMF2 0.99115 0 0 0.99 0 0 0 NA NA nsp4-Q8NFQ8 nsp4 TOR1AIP2 0.7969 0 0 1 0 0 0 NA NA nsp4-Q8TEM1 nsp4 NUP210 0.39242 0.0039899 0.710174697 1 0 1 0 0.74 0 nsp4-Q92643 nsp4 PIGK 0.82887 0.22696 0.421421444 1 0 0.66 0 0.74 0.03 nsp4-Q969N2 nsp4 PIGT 0.70908 0 0.353983625 1 0 0.33 0 NA 0.19 nsp4-Q96S59 nsp4 RANBP9 0 0.9935 0 0 1 0 NA 0 NA nsp4-Q9BSF4 nsp4 TIMM29 0 0 0.986980311 0 0 1 NA NA 0 nsp4-Q9H7D7 nsp4 WDR26 0 0.92941 0 0 1 0 NA 0 NA nsp4-Q9H871 nsp4 RMND5A 0 0.9774 0 0 0.98 0 NA 0 NA nsp4-Q9NVH1 nsp4 DNAJC11 0 0 0.726866873 0 0 1 NA NA 0 nsp4-Q9NWU2 nsp4 GID8 0 0.98069 0 0 1 0 NA 0 NA nsp4-Q9Y5J6 nsp4 TIMM10B 0 0 0.985104055 0 0 0.98 NA NA 0 nsp4-Q9Y5J7 nsp4 TIMM9 0 0 0.913806284 0 0 1 NA NA 0 nsp6-O75964 nsp6 ATP5MG 0.021184 0.42343 0.717265558 0 1 1 0.75 0 0 nsp6-P25685 nsp6 DNAJB1 0.83377 0 0 0.99 0 0 0 NA NA nsp6-Q15904 nsp6 ATP6AP1 0.41324 0 0.989106922 0.62 0 1 0.09 NA 0 nsp6-Q99720 nsp6 SIGMAR1 0 0.74095 0.842213253 0 1 1 NA 0 0 nsp6-Q9H7F0 nsp6 ATP13A3 0 0.27018 0.805525853 0 0 1 NA 0.74 0 nsp6-Q9UDY4 nsp6 DNAJB4 0.87935 0 0 0.66 0 0 0.05 NA NA nsp7-A8MTT3 nsp7 CEBPZOS 0.99309 0.98607 0.988878577 1 0.98 0.64 0 0 0.08 nsp7-O00116 nsp7 AGPS 0.63068 0.6251 0.826490325 0.53 1 1 0.13 0 0 nsp7-O14975 nsp7 SLC27A2 0.79874 0.28335 0.049938217 1 0.32 0 0 0.28 0.69 nsp7-O43169 nsp7 CYB5B 0.6157 0.41671 0.80351019 0.31 0.98 0.99 0.22 0 0 nsp7-O94766 nsp7 B3GAT3 0.8801 0.74743 0.585758918 0.67 0.66 0.97 0.04 0.05 0 nsp7-O95159 nsp7 ZFPL1 0.72814 0.089899 0 0.95 0.33 0 0.01 0.24 NA nsp7-O95573 nsp7 ACSL3 0.91283 0.61136 0.897068932 1 1 1 0 0 0 nsp7-P00387 nsp7 CYB5R3 0.078917 0.75124 0.956349351 0 1 1 0.75 0 0 nsp7-P11233 nsp7 RALA 0.57983 0.35486 0.750366485 0.66 0.99 0.97 0.06 0 0 nsp7-P21964 nsp7 COMT 0.57953 0.39728 0.745231765 0.94 1 0.66 0.01 0 0.04 nsp7-P51148 nsp7 RAB5C 0 0.54146 0.87908593 0 1 1 NA 0 0 nsp7-P51149 nsp7 RAB7A 0 0.48171 0.972724229 0 1 1 NA 0 0 nsp7-P61006 nsp7 RAB8A 0.094078 0.75447 0.895744596 0 1 0.65 0.75 0 0.05 nsp7-P61019 nsp7 RAB2A 0 0.55131 0.97919572 0 0.99 0.65 NA 0 0.05 nsp7-P61026 nsp7 RAB10 0.11387 0.40774 0.981443071 0 0.97 0.98 0.75 0.01 0 nsp7-P61106 nsp7 RAB14 0.38785 0.36825 0.750712826 0.31 1 1 0.22 0 0 nsp7-P61586 nsp7 RHOA 0 0.37112 0.829029399 0 0.98 0.65 NA 0 0.05 nsp7-P62820 nsp7 RAB1A 0 0.43828 0.935289593 0 1 0.99 NA 0 0 nsp7-P62873 nsp7 GNB1 0.027515 0.27496 0.839532136 0 0.33 0.98 0.75 0.24 0 nsp7-P63218 nsp7 GNG5 0.32569 0.31298 0.817631566 0 0.63 0.65 0.75 0.1 0.05 nsp7-Q12907 nsp7 LMAN2 0 0.74257 0.725773983 0 1 1 NA 0 0 nsp7-Q13724 nsp7 MOGS 0.80868 0.66843 0.782330987 1 1 1 0 0 0 nsp7-Q2TAA5 nsp7 ALG11 0 0.9002 0.465050352 0 1 0.65 NA 0 0.05 nsp7-Q53H12 nsp7 AGK 0.70589 0.40457 0.581229943 1 1 1 0 0 0 nsp7-Q5JTV8 nsp7 TOR1AIP1 0.037862 0.53637 0.74516805 0 0.95 0.65 0.75 0.01 0.05 nsp7-Q5VT66 nsp7 MARC1 0.52585 0.82997 0.939721024 0 1 1 0.75 0 0 nsp7-Q6P1M0 nsp7 SLC27A4 0.91017 0 0 1 0 0 0 NA NA nsp7-Q6P1Q0 nsp7 LETMD1 0.97824 0.79121 0.686459543 1 1 1 0 0 0 nsp7-Q6ZRP7 nsp7 QSOX2 0.96617 0.98889 0.794325146 0.97 1 0.67 0 0 0.03 nsp7-Q7LGA3 nsp7 HS2ST1 0.5733 0.80849 0.706466834 0 1 1 0.75 0 0 nsp7-Q8IUR0 nsp7 TRAPPC5 0 0.90869 0.877498541 0 0.95 0 NA 0.01 0.69 nsp7-Q8N183 nsp7 NDUFAF2 0 0.76562 0.981444858 0 0.63 0.98 NA 0.1 0 nsp7-Q8N2K0 nsp7 ABHD12 0.77849 0.2418 0.393580798 1 0 0.32 0 0.74 0.23 nsp7-Q8N9F7 nsp7 GDPD1 0.98701 0.87982 0 1 0 0 0 0.74 NA nsp7-Q8NBU5 nsp7 ATAD1 0.73826 0.59996 0.63242046 1 1 1 0 0 0 nsp7-Q8NBX0 nsp7 SCCPDH 0.96651 0.99217 0.978675119 0.66 1 0.97 0.06 0 0 nsp7-Q8WTV0 nsp7 SCARB1 0 0.98016 0.854406247 0 0.98 0.66 NA 0 0.03 nsp7-Q8WUY8 nsp7 NAT14 0.94047 0.77941 0.720285746 1 1 1 0 0 0 nsp7-Q8WVC6 nsp7 DCAKD 0.91629 0.6736 0.862452335 1 1 1 0 0 0 nsp7-Q96A26 nsp7 FAM162A 0.85168 0.87704 0.748773582 1 1 1 0 0 0 nsp7-Q96DA6 nsp7 DNAJC19 0.78729 0.877 0.981450126 0.64 0.66 0.98 0.08 0.06 0 nsp7-Q96ER9 nsp7 CCDC51 0 0.8562 0.685510484 0 0.98 0 NA 0 0.69 nsp7-Q96KC8 nsp7 DNAJC1 0 0.97979 0 0 0.98 0 NA 0 NA nsp7-Q9BQE4 nsp7 SELENOS 0.70106 0.72526 0.701764404 0.95 1 1 0.01 0 0 nsp7-Q9H7Z7 nsp7 PTGES2 0.97653 0.86482 0.764538331 1 1 0.99 0 0 0 nsp7-Q9NP72 nsp7 RAB18 0 0.42172 0.756605088 0 0.66 0.65 NA 0.06 0.05 nsp7-Q9NX40 nsp7 OCIAD1 0.90909 0.59218 0.690748962 1 1 1 0 0 0 nsp7-Q9NYP7 nsp7 ELOVL5 0 0.84898 0.685510854 0 0.97 0 NA 0.01 0.69 nsp7-Q9Y3D7 nsp7 PAM16 0.59373 0.9496 0.766727199 0 0.67 0.33 0.75 0.05 0.19 nsp7-Q9Y5J7 nsp7 TIMM9 0.77215 0.3231 0.074367865 0.66 0 0 0.05 0.74 0.69 nsp8-O00566 nsp8 MPHOSPH10 0.63142 0.79381 0.728559172 0.97 0.98 0.66 0 0 0.03 nsp8-O15381 nsp8 NVL 0.92746 0.36364 0 0.97 0.66 0 0 0.05 NA nsp8-O60287 nsp8 URB1 0.75107 0.62158 0.586595339 1 1 1 0 0 0 nsp8-O76094 nsp8 SRP72 0.50317 0.72069 0.739540656 1 1 1 0 0 0 nsp8-O95260 nsp8 ATE1 0 0.83722 0.804292637 0 1 1 NA 0 0 nsp8-O95373 nsp8 IPO7 0.73192 0 0 1 0 0 0 NA NA nsp8-O95707 nsp8 POP4 0.74158 0.86009 0.8670804 0.97 0.32 0.32 0.01 0.28 0.23 nsp8-O96028 nsp8 NSD2 0.49946 0.97503 0.864651959 0 0.65 0.65 0.75 0.09 0.05 nsp8-P09132 nsp8 SRP19 0.56792 0.85781 0.832502372 1 1 1 0 0 0 nsp8-P10644 nsp8 PRKAR1A 0.98253 0 0 0.99 0 0 0 NA NA nsp8-P42285 nsp8 MTREX 0.7549 0.50799 0.565305623 1 0.66 0.65 0 0.05 0.05 nsp8-P51114 nsp8 FXR1 0.8556 0.3336 0.336477658 1 1 1 0 0 0 nsp8-P51116 nsp8 FXR2 0.75416 0.35976 0.373677635 1 1 1 0 0 0 nsp8-P61011 nsp8 SRP54 0.39521 0.6574 0.755584148 0.76 0.65 0.99 0.03 0.08 0 nsp8-P82663 nsp8 MRPS25 0.60063 0.55893 0.826437119 0.95 0.32 1 0.01 0.28 0 nsp8-Q03701 nsp8 CEBPZ 0.7073 0.44586 0.52197305 1 1 1 0 0 0 nsp8-Q12788 nsp8 TBL3 0.74964 0.46634 0.380828129 1 1 1 0 0 0 nsp8-Q13206 nsp8 DDX10 0.75703 0.78016 0.755753594 1 1 1 0 0 0 nsp8-Q14146 nsp8 URB2 0.88233 0.56549 0.336186744 1 0.99 0.33 0 0 0.18 nsp8-Q14692 nsp8 BMS1 0.68604 0.7344 0.616523719 1 1 1 0 0 0 nsp8-Q15269 nsp8 PWP2 0.77802 0.39761 0.288654637 0.98 0.98 0.67 0 0 0.03 nsp8-Q15397 nsp8 PUM3 0.6236 0.72164 0.626646614 1 1 1 0 0 0 nsp8-Q16531 nsp8 DDB1 0.94832 0.29714 0.329839777 0.96 0.99 1 0.01 0 0 nsp8-Q4GOJ3 nsp8 LARP7 0.43919 0.79384 0.812479682 1 1 1 0 0 0 nsp8-Q76FK4 nsp8 NOL8 0.80515 0.63235 0.560442083 1 1 0.96 0 0 0.01 nsp8-Q7L2J0 nsp8 MEPCE 0.43695 0.78202 0.790978117 1 1 1 0 0 0 nsp8-Q7Z4Q2 nsp8 HEATR3 0.98736 0 0 0.95 0 0 0.01 NA NA nsp8-Q8IX01 nsp8 SUGP2 0.71554 0 0 0.95 0 0 0.01 NA NA nsp8-Q8IY37 nsp8 DHX37 0.50147 0.98962 0 0.66 1 0 0.05 0 NA nsp8-Q8N5D0 nsp8 WDTC1 0.99156 0.015561 0.407783421 1 0 0.96 0 0.74 0.01 nsp8-Q8N983 nsp8 MRPL43 0 0.99078 0 0 0.97 0 NA 0.01 NA nsp8-Q8NEJ9 nsp8 NGDN 0.56745 0.64081 0.71407894 0.64 0.98 1 0.08 0 0 nsp8-Q8NI36 nsp WDR36 0.77991 0.42551 0.47386872 0.98 1 1 0 0 0 nsp8-Q8TC07 nsp8 TBC1D15 0.98574 0 0 1 0 0 0 NA NA nsp8-Q96B26 nsp8 EXOSC8 0.5042 0.97866 0.990898225 0.64 0.98 1 0.08 0 0 nsp8-Q96FK6 nsp8 WDR89 0.69287 0.99353 0 0.99 0.99 0 0 0 NA nsp8-Q96159 nsp8 NARS2 0.88015 0.067044 0.78185035 0.62 0 1 0.09 0.74 0 nsp8-Q99547 nsp8 MPHOSPH6 0.75562 0.91098 0.974291683 0.94 0.33 0.32 0.01 0.21 0.23 nsp8-Q9BSC4 nsp8 NOL10 0.90318 0.80021 0.807819511 1 1 1 0 0 0 nsp8-Q9GZL7 nsp8 WDR12 0.83699 0.61793 0.562899877 1 0.97 0.65 0 0.01 0.05 nsp8-Q9H6F5 nsp8 CCDC86 0.56342 0.97057 0.736803661 0.64 0.97 1 0.07 0 0 nsp8-Q9H6R4 nsp8 NOL6 0.73249 0.3704 0.355297835 1 1 1 0 0 0 nsp8-Q9HD40 nsp8 SEPSECS 0.974 0.40352 0.809559247 0.31 0.32 1 0.22 0.28 0 nsp8-Q9NQT4 nsp8 EXOSC5 0.59082 0.64069 0.704291901 0.95 0.99 0.99 0.01 0 0 nsp8-Q9NQT5 nsp8 EXOSC3 0.5731 0.60253 0.774797319 0.95 0.98 1 0.01 0 0 nsp8-Q9NTK5 nsp8 OLA1 0.89068 0.013447 0.451456849 0.67 0 0.99 0.04 0.74 0 nsp8-Q9NY61 nsp8 AATF 0.65603 0.85156 0.783703681 0.95 1 1 0.01 0 0 nsp8-Q9UGI8 nsp8 TES 0 0.99046 0.685510876 0 1 0.33 NA 0 0.19 nsp8-Q9UHG3 nsp8 PCYOX1 0.99165 0 0 1 0 0 0 NA NA nsp8-Q9UL40 nsp8 ZNF346 0.26738 0.7147 0 0.14 0.98 0 0.39 0 NA nsp8-Q9ULT8 nsp8 HECTD1 0 0.82709 0.885504785 0 1 1 NA 0 0 nsp8-Q9ULX6 nsp8 AKAP8L 0.81872 0 0.213643659 0.95 0 0.64 0.01 NA 0.08 nsp8-Q9Y399 nsp8 MRPS2 0 0 0.972057569 0 0 0.65 NA NA 0.05 nsp8-Q9Y3A4 nsp8 RRP7A 0.79389 0.33638 0.341118627 0.97 0 0.32 0 0.74 0.23 nsp9-O00142 nsp9 TK2 0 0.98401 0.68551879 0 1 1 NA 0 0 nsp9-O00233 nsp9 PSMD9 0.99068 0 0 0.97 0 0 0.01 NA NA nsp9-P13984 nsp9 GTF2F2 0 0.59529 0.877426938 0 0.96 1 NA 0.01 0 nsp9-P21281 nsp9 ATP6V1B2 0.96322 0 0 0.66 0 0 0.05 NA NA nsp9-P35555 nsp9 FBN1 0 0.68551 0.992372395 0 0.32 1 NA 0.28 0 nsp9-P35556 nsp9 FBN2 0 0.99111 0.991012329 0 1 1 NA 0 0 nsp9-P35658 nsp9 NUP214 0.031562 0 0.962233264 0 0 1 0.75 NA 0 nsp9-P37198 nsp9 NUP62 0 0.16429 0.993010451 0 0 1 NA 0.74 0 nsp9-P38606 nsp9 ATP6V1A 0.97813 0 0 1 0 0 0 NA NA nsp9-P41250 nsp9 GARS 0.91459 0 0 0.94 0 0 0.01 NA NA nsp9-P49419 nsp9 ALDH7A1 0.89105 0 0 1 0 0 0 NA NA nsp9-P61962 nsp9 DCAF7 0 0.76041 0.969234024 0 1 1 NA 0 0 nsp9-P62310 nsp9 LSM3 0.87637 0 0 0.96 0 0 0.01 NA NA nsp9-Q14232 nsp9 EIF2B1 0 0.77978 0.992001364 0 0.98 0 NA 0 0.69 nsp9-Q15056 nsp9 EIF4H 0 0.32352 0.86901939 0 0 1 NA 0.74 0 nsp9-Q5SW79 nsp9 CEP170 0.88196 0 0 1 0 0 0 NA NA nsp9-Q6SZW1 nsp9 SARM1 0.82032 0 0 0.66 0 0 0.05 NA NA nsp9-Q7Z3B4 nsp9 NUP54 0 0 0.991624822 0 0 1 NA NA 0 nsp9-Q86YT6 nsp9 MIB1 0.9611 0.71417 0.89782233 1 1 1 0 0 0 nsp9-Q8IWP9 nsp9 CCDC28A 0.92122 0.089793 0 1 0.32 0 0 0.28 NA nsp9-Q8N0X7 nsp9 SPART 0 0.83931 0.962964129 0 1 1 NA 0 0 nsp9-Q8N1G2 nsp9 CMTR1 0 0.70971 0 0 0.67 0 NA 0.05 NA nsp9-Q8TD19 nsp9 NEK9 0.82535 0.77502 0.991972865 0.57 1 1 0.12 0 0 nsp9-Q96F45 nsp9 ZNF503 0.078984 0.5176 0.777581447 0 1 1 0.75 0 0 nsp9-Q96PM5 nsp9 RCHY1 0.80642 0 0 1 0 0 0 NA NA nsp9-Q99567 nsp9 NUP88 0 0 0.92724312 0 0 0.99 NA NA 0 nsp9-Q9BU61 nsp9 NDUFAF3 0.89629 0 0 0.95 0 0 0.01 NA NA nsp9-Q9BVL2 nsp9 NUP58 0 0 0.979586223 0 0 1 NA NA 0 nsp9-Q9NZL9 nsp9 MAT2B 0 0 0.978282655 0 0 1 NA NA 0 nsp9-Q9UBX5 nsp9 FBLN5 0.99375 0 0.992002193 0 0 0.96 0.75 NA 0.01 FoldChange.sub.— FoldChange.sub.— FoldChange.sub.— K_Interaction K_Interaction K_Interaction Cluster.sub.— DIS_SARS1.sub.— DIS_SARS2.sub.— DIS_SARS2.sub.— DIS_SARS.sub.— Bait_Prey MERS SARS1 SARS2 Score_MERS Score_SARS1 Score_SARS2 Cluster Assignments MERS MERS SARS1 MERS E-O00203 1.6 16.67 46.67 0.1349 0.618285 0.976775048 4 S2_S1 0.483385 0.841875048 0.358490048 0.662630024 E-O15270 30 0 0 0.932615 0 0 5 M −0.932615 −0.932615 NA −0.932615 E-O43505 40 0 0 0.85674 0 0 5 M −0.85674 −0.85674 NA −0.85674 E-O60885 1 3.33 26.67 0.0475195 0.342755 0.974244175 6 S2 NA 0.926724675 0.631489175 NA E-O75787 46.67 0 0 0.920175 0 0 5 M −0.920175 −0.920175 NA −0.920175 E-P01861 23.33 0 0 0.970695 0 0 5 M −0.970695 −0.970695 NA −0.970695 E-P25440 0 5.33 70 0 0.49844 0.953296438 4 S2_S1 0.49844 0.953296438 0.454856438 0.725868219 E-Q5T9L3 23.33 0 0 0.925655 0 0 5 M −0.925655 −0.925655 NA −0.925655 E-Q6DD88 116.67 0 0 0.991585 0 0 5 M −0.991585 −0.991585 NA −0.991585 E-Q6UX04 0.57 36.67 26.67 0.01946 0.816765 0.77655458 4 S2_S1 0.797305 0.75709458 −0.04021042 0.77719979 E-Q86VM9 0 10 26.67 0 0.30879 0.88320752 6 S2 NA 0.88320752 0.57441752 NA E-Q8IWA5 0 0 26.67 0 0 0.965171417 6 S2 NA 0.965171417 0.965171417 NA E-Q8IZ52 26.67 0 0 0.88676 0 0 5 M −0.88676 −0.88676 NA −0.88676 E-Q8WVM8 23.33 6.67 0 0.835675 0.15317 0 5 M −0.682505 −0.835675 NA −0.75909 E-Q8WY22 56.67 0 0 0.99562 0 0 5 M −0.99562 −0.99562 NA −0.99562 E-Q92665 0 20 0 0 0.90848 0 3 S1 0.90848 NA −0.90848 NA E-Q9BTV4 293.33 0 0 0.937635 0 0 5 M −0.937635 −0.937635 NA −0.937635 E-Q9NPI6 63.33 0 0 0.98987 0 0 5 M −0.98987 −0.98987 NA −0.98987 E-Q9UBS3 36.67 0 0 0.97643 0 0 5 M −0.97643 −0.97643 NA −0.97643 E-Q9ULP9 0 23.33 0 0 0.943255 0 3 S1 0.943255 NA −0.943255 NA E-Q9Y5L0 33.33 0 0 0.949885 0 0 5 M −0.949885 −0.949885 NA −0.949885 M-O15321 0 43.33 36.67 0 0.995725 0.77627478 4 S2_S1 0.995725 0.77627478 −0.21945022 0.88599989 M-O15397 13.33 116.67 30 0.570365 0.85349 0.781026241 2 S2_S1_M 0.283125 0.21066124141 −0.072463759 0.246893121 M-O15431 0 20 3.33 0 0.846785 0.34275538 3 S1 0.846785 NA −0.504029621 NA M-O43156 0 23.33 0 0 0.978405 0 3 S1 0.978405 NA −0.978405 NA M-O60779 0 23.33 13.33 0 0.979675 0.532466642 4 S2_S1 0.979675 0.532466642 −0.447208358 0.756070821 M-O75027 0 70 23.33 0 0.86962 0.624016684 4 S2_S1 0.86962 0.624016684 60.245603316 0.746818342 M-O75439 0 0 96.67 0 0 0.992560099 6 S2 NA 0.992560099 0.992560099 NA M-O94822 20 116.67 53.33 0.966835 0.964045 0.768655234 2 S2_S1_M −0.00279 0.198179766 −0.195389766 −0.100484883 M-O94829 10 43.33 16.67 0.485275 0.996345 0.458440959 1 S1_M 0.51107 0.026834042 −0.537904042 NA M-O95070 0 20 23.33 0 0.56593 0.913000418 4 S2_S1 0.56593 0.913000418 0.347070418 0.739465209 M-O95674 26.67 63.33 43.33 0.971215 0.92897 0.764617921 2 S2_S1_M −0.042245 −0.206597079 −0.164352079 −0.12442104 M-O95864 0 40 20 0 0.974855 0.618584079 4 S2_S1 0.974855 0.618584079 −0.356270922 0.796719539 M-P05026 0 50 36.67 0 0.99697 0.908812801 4 S2_S1 0.99697 0.908812801 −0.0881572 0.9528914 M-P07384 10 70 30 0.316425 0.91324 0.726561706 4 S2_S1 0.596815 0.410136706 −0.186678295 0.503475853 M-P11310 0 13.33 26.67 0 0.463645 0.847174285 4 S2_S1 0.463645 0.847174285 0.383529285 0.655409642 M-P13804 0 53.33 23.33 0 0.73912 0.844199148 4 S2_S1 0.73912 0.844199148 0.105079148 0.791659574 M-P20020 10 136.67 73.33 0.584485 0.940885 0.834548065 2 S2_S1_M 0.3564 0.250063065 −0.106336935 0.303231533 M-P23634 0 40 10 0 0.80781 0.374613027 3 S1 0.80781 NA −0.433196974 NA M-P24390 0 20 16.67 0 0.83647 0.547097311 4 S2_S1 0.83647 0.547097311 −0.289372689 0.691783656 M-P27105 0 26.67 30 0 0.83667 0.866485886 4 S2_S1 0.83667 0.866485886 0.029815886 0.851577943 M-P33527 0 130 0 0 0.985205 0 3 S1 0.985205 NA −0.985205 NA M-P35670 0 26.67 0 0 0.98529 0 3 S1 0.98529 NA −0.98529 NA M-P38435 0 43.33 20 0 0.96677 0.874983499 4 S2_S1 0.96677 0.874983499 −0.091786501 0.92087675 M-P38606 0 33.33 26.67 0 0.67157 0.722469247 4 S2_S1 0.67157 0.722469247 0.050899247 0.697019623 M-P40763 0 36.67 0 0 0.93212 0 3 S1 0.93212 NA −0.93212 NA M-P43003 13.33 50 30 0.64209 0.937355 0.834104623 2 S2_S1_M 0.295265 0.192014623 −0.103250377 0.243639812 M-P48556 0 16.67 20 0 0.501555 0.76571239 4 S2_S1 0.501555 0.76571239 0.26415739 0.633633695 M-P49768 13.33 26.67 10 0.646215 0.87984 0.269036888 1 S1_M 0.233625 −0.377178113 −0.610803113 NA M-P56589 10 30 0 0.308185 0.88283 0 3 S1 0.574645 NA −0.88283 NA M-P61803 0 33.33 13.33 0 0.953365 0.432426583 3 S1 0.953365 NA −0.520938418 NA M-P98194 16.67 93.33 76.67 0.801395 0.98219 0.718556551 2 S2_S1_M 0.180795 −0.08283845 −0.26363345 0.048978275 M-Q00765 0 20 106.67 0 0.318965 0.956544254 6 S2 NA 0.956544254 0.637579254 NA M-Q10713 0 0 93.33 0 0 0.995529908 6 S2 NA 0.995529908 0.995529908 NA M-Q13409 0 30 10 0 0.86679 0.507755377 4 S2_S1 0.86679 0.507755377 −0.359034623 0.687272689 M-Q13433 6.67 33.33 16.67 0.376695 0.95636 0.763076712 4 S2_S1 0.579665 0.386381712 −0.193283289 0.483023356 M-Q13505 0 40 16.67 0 0.8498 0.695219357 4 S2_S1 0.8498 0.695219357 −0.154580643 0.772509679 M-Q14CZ7 0 20 6.67 0 0.97197 0.1515916 3 S1 0.97197 NA −0.820378401 NA M-Q15043 3.33 80 50 0.09189 0.860435 0.768785611 4 S2_S1 0.768545 0.676895611 −0.091649380 0.722720306 M-Q15386 0 56.67 13.33 0 0.68976 0.452961442 4 S2_S1 0.68976 0.452961442 −0.236798559 0.571360721 M-Q4KMQ2 0 10 93.33 0 0.592015 0.99695221 4 S2_S1 0.592015 0.99695221 0.40493721 0.794483605 M-Q53R41 30 80 73.33 0.77918 0.9303 0.811478783 2 S2_S1_M 0.15112 0.032298783 −0.118821217 0.091709392 M-Q5BJH7 6.67 23.33 33.33 0.18561 0.979675 0.798974774 4 S2_S1 0.794065 0.613364774 −0.180700226 0.703714887 M-Q5H8A4 3.33 40 23.33 0.068225 0.994685 0.764183669 4 S2_S1 0.92646 0.695958669 −0.230501332 0.811209334 M-Q5JRX3 0 3.33 70 0 0.00055545 0.976154116 6 S2 NA 0.976154116 0.975598666 NA M-Q5T1Q4 0 23.33 0 0 0.978405 0 3 S1 0.978405 NA −0.978405 NA M-Q5T9L3 3.33 56.67 40 0.043137 0.99547 0.808491442 4 S2_S1 0.952333 0.765354442 −0.186978550 0.858843721 M-Q68DH5 23.33 3.33 3.33 0.968465 0.342755 0.122471482 5 M −0.62571 0.845993519 NA 0.735851759 M-Q6AI08 0 23.33 0 0 0.899215 0 3 S1 0.899215 NA −0.899215 NA M-Q6P3X3 66.67 116.67 16.67 0.87311 0.860405 0.346146123 1 S1_M −0.012705 −0.526963877 −0.514258877 NA M-Q6PJG6 0 36.67 0 0 0.995565 0 3 S1 0.995565 NA −0.995565 NA M-Q6PML9 0 23.33 20 0 0.565555 0.768161621 4 S2_S1 0.565555 0.768161621 0.202606621 0.666858311 M-Q7L8L6 0 123.33 73.33 0 0.855235 0.879182944 4 S2_S1 0.855235 0.879182944 0.023947944 0.867208972 M-Q7RTS9 0 23.33 0 0 0.979675 0 3 S1 0.979675 NA −0.979675 NA M-Q7Z3U7 0 30 6.67 0 0.980735 0.502755088 4 S2_S1 0.980735 0.502755088 −0.477979913 0.741745044 M-Q86UL3 6.67 70 20 0.30488 0.924775 0.722494785 4 S2_S1 0.619895 0.417614785 −0.202280215 0.518754893 M-Q8N1F8 0 20 0 0 0.97197 0 3 S1 0.97197 NA −0.97197 NA M-Q8N5G2 0 40 0 0 0.8028 0 3 S1 0.8028 NA −0.8028 NA M-Q8NDZ4 93.33 0 0 0.87384 0 0 5 M −0.87384 −0.87384 NA −0.87384 M-Q8NEW0 20 30 46.67 0.611695 0.79608 0.883486219 2 S2_S1_M 0.184385 0.271791219 0.087406219 0.228088109 M-Q8TBF5 0 33.33 13.33 0 0.990045 0.378661581 3 S1 0.990045 NA −0.61138342 NA M-Q8TCJ2 0 73.33 3.33 0 0.995485 0.008895195 3 S1 0.995485 NA −0.986589805 NA M-Q8TEM1 426.67 3.33 0 0.86292 0.014931 0 5 M −0.847989 −0.86292 NA −0.8554545 M-Q8WUD6 0 26.67 20 0 0.938925 0.642987005 4 S2_S1 0.938925 0.642987005 −0.295937996 0.790956002 M-Q8WY22 0 46.67 46.67 0 0.91244 0.787073353 4 S2_S1 0.91244 0.787073353 −0.125366648 0.849756676 M-Q92604 0 23.33 23.33 0 0.978405 0.656260498 4 S2_S1 0.978405 0.656260498 −0.322144503 0.817332749 M-Q92616 60 436.67 0 0.88364 0.77414 0 1 S1_M −0.1095 −0.88364 −0.77414 NA M-Q969V3 56.67 80 13.33 0.74208 0.88813 0.392126222 1 S1_M 0.14605 −0.349953779 −0.496003779 NA M-Q96AA3 0 20 26.67 0 0.879485 0.765632579 4 S2_S1 0.879485 0.765632579 −0.113852421 0.82255879 M-Q96CW5 16.67 90 76.67 0.442045 0.996675 0.876803501 2 S2_S1_M 0.55463 0.434758501 −0.119871490 0.494694251 M-Q96D53 0 50 33.33 0 0.971175 0.89537016 4 S2_S1 0.971175 0.89537016 −0.07580484 0.93327258 M-Q96EC8 40 20 13.33 0.970245 0.810065 0.658644009 2 S2_S1_M −0.16018 −0.311600991 −0.151420991 −0.235890496 M-Q96ER3 0 43.33 33.33 0 0.678155 0.884736465 4 S2_S1 0.678155 0.884736465 0.206581465 0.781445732 M-Q96HR9 0 0 23.33 0 0 0.802828582 6 S2 NA 0.802828582 0.802828582 NA M-Q96HW7 0 20 26.67 0 0.57119 0.796652353 4 S2_S1 0.57119 0.796652353 0.225462353 0.683921177 M-Q99805 0 63.33 16.67 0 0.73237 0.370049601 3 S1 0.73237 NA −0.362320399 NA M-Q9BQ95 0 23.33 0 0 0.979675 0 3 S1 0.979675 NA −0.979675 NA M-Q9BQT8 6.67 20 20 0.216335 0.67231 0.765389969 4 S2_S1 0.455975 0.549054969 0.093079969 0.502514984 M-Q9BSJ2 30 163.33 130 0.932105 0.97279 0.919790275 2 S2_S1_M 0.040685 −0.012314725 −0.052999725 0.014185138 M-Q9BTY2 0 40 13.33 0 0.945855 0.380259188 3 S1 0.945855 NA −0.565595812 NA M-Q9BV40 90 0 0 0.99369 0 0 5 M −0.99369 −0.99369 NA −0.99369 M-Q9BW92 3.33 40 26.67 0.0309745 0.687315 0.864055253 4 S2_S1 0.6563405 0.833080753 0.176740253 0.744710626 M-Q9BYC5 50 0 0 0.9715 0 0 5 M −0.9715 −0.9715 NA −0.9715 M-Q9C0D9 0 23.33 6.67 0 0.979675 0.439888269 3 S1 0.979675 NA −0.539786731 NA M-Q9C0E2 0 36.67 6.67 0 0.956505 0.439888018 3 S1 0.956505 NA −0.516616982 NA M-Q9GZM5 6.67 26.67 20 0.267095 0.952425 0.566670684 4 S2_S1 0.68533 0.299575684 −0.385754316 0.492452842 M-Q9H0V9 40 0 0 0.97806 0 0 5 M −0.97806 −0.97806 NA −0.97806 M-Q9H2J7 0 30 6.67 0 0.99197 0.123398452 3 S1 0.99197 NA −0.868571549 NA M-Q9H583 32 230 0 0.84819 0.878565 0 1 S1_M 0.030375 −0.84819 −0.878565 NA M-Q9H7F0 0 70 23.33 0 0.995995 0.728805922 4 S2_S1 0.995995 0.728805922 −0.267189078 0.862400461 M-Q9H845 0 60 0 0 0.92258 0 3 S1_M 0.92258 NA −0.92258 NA M-Q9H8M5 0 30 0 0 0.99197 0 3 S1 0.99197 NA −0.99197 NA M-Q9NQC3 0 60 106.67 0 0.722405 0.936913049 4 S2_S1 0.722405 0.936913049 0.214508040 0.829659024 M-Q9NVH2 0 26.67 16.67 0 0.93217 0.724122415 4 S2_S1 0.93217 0.724122415 −0.208047586 0.828146207 M-Q9NVI1 136.67 373.33 270 0.906635 0.862235 0.778646942 2 S2_S1_M −0.0444 −0.127988058 −0.083588058 −0.086194029 M-Q9NX47 40 0 0 0.986215 0 0 5 M −0.986215 −0.986215 NA −0.986215 M-Q9P2R7 23.33 50 30 0.80607 0.88322 0.699898649 2 S2_S1_M 0.07715 −0.106171351 −0.183321351 −0.014510676 M-Q9UBF2 0 70 40 0 0.959285 0.553667697 4 S2_S1 0.959285 0.553667697 −0.405617303 0.756476349 M-Q9UBU6 0 13.33 23.33 0 0.755025 0.88724416 4 S2_S1 0.755025 0.88724416 0.13221916 0.82113458 M-Q9UDR5 0 23.33 30 0 0.80246 0.872554752 4 S2_S1 0.80246 0.872554752 0.070094752 0.837507376 M-Q9UI26 30 93.33 40 0.991835 0.841075 0.824692731 2 S2_S1_M −0.15076 −0.167142269 −0.016382269 −0.158951135 M-Q9UKV5 6.67 63.33 33.33 0.13596 0.99354 0.521758093 4 S2_S1 0.85758 0.385798093 −0.471781907 0.621689047 M-Q9ULF5 0 56.67 0 0 0.868735 0 3 S1 0.868735 NA −0.868735 NA M-Q9ULX6 0 26.67 46.67 0 0.66 0.875990693 4 S2_S1 0.66 0.875990693 0.215990693 0.767995346 M-Q9Y312 13.33 30 43.33 0.435405 0.571505 0.895743362 2 S2_S1_M 0.1361 0.460338362 0.324238362 0.298219181 M-Q9Y4R8 46.67 196.67 70 0.874625 0.959725 0.771203374 2 S2_S1_M 0.0851 −0.103421626 −0.188521626 −0.009160813 M-Q9Y5Y0 0 36.67 23.33 0 0.979255 0.645491061 1 S2_S1 0.979255 0.645491061 −0.33376394 0.81237303 M-Q9Y6E2 0 0 23.33 0 0 0.863182181 6 S2 NA 0.863182181 0.863182181 NA N-O43818 83.33 116.67 130 0.773845 0.950105 0.930584399 2 S2_S1_M 0.17626 0.156739399 −0.019520601 0.1664997 N-O75683 40 56.67 33.33 0.717255 0.854285 0.799216309 2 S2_S1_M 0.13703 0.081961309 −0.055068691 0.109495654 N-P11940 60 53.33 73.33 0.744345 0.822355 0.868317965 2 S2_S1_M 0.07801 0.123972965 0.045962965 0.100991482 N-P16989 16.67 66.67 53.33 0.512765 0.870065 0.827197104 2 S2_S1_M 0.3573 0.314432104 −0.042867897 0.335866052 N-P19784 38.67 133.33 70 0.88151 0.891885 0.937524134 2 S2_S1_M 0.010375 0.056014134 0.045639134 0.033194567 N-P67870 12 43.33 23.33 0.56884 0.85307 0.886803948 2 S2_S1_M 0.28423 0.317963948 0.033733948 0.301096974 N-P68400 36.67 30 13.33 0.935835 0.816805 0.650644221 2 S2_S1_M −0.11903 −0.28519078 −0.16616078 −0.20211039 N-Q13283 0 633.33 150.33 0 0.961845 0.97665813 4 S2_S1 0.961845 0.97665813 0.01481313 0.969251565 N-Q13310 96.67 113.33 100 0.76034 0.93303 0.923100023 2 S2_S1_M 0.17269 0.162760023 −0.009929977 0.167725012 N-Q15435 53.33 0 0 0.991925 0 0 5 M −0.991925 −0.991925 NA −0.991925 N-Q6PKG0 103.33 82 86.67 0.756 0.871 0.86893733 2 S2_S1_M 0.115 0.11293733 −0.00206267 0.113968665 N-Q86U42 10 18 7.33 0.381655 0.83023 0.427408997 1 S1_M 0.448575 0.045753997 −0.402821004 NA N-Q8NCA5 20 46.67 36.67 0.586115 0.9648 0.96053836 2 S2_S1_M 0.378685 0.37442336 −0.004261641 0.37655418 N-Q8TAD8 14.67 19.33 66.67 0.766565 0.85822 0.909115123 2 S2_S1_M 0.091655 0.142550123 0.050895123 0.117102561 N-Q92900 3.33 26.67 56.67 0.055835 0.74484 0.876533636 4 S2_S1 0.689005 0.820698636 0.131693636 0.754851818 N-Q9BQ75 20 40 6.67 0.708235 0.91884 0.207981733 1 S1_M 0.210605 −0.500253268 −0.710858268 NA N-Q9HCE1 56.67 23.33 33.33 0.83052 0.790575 0.863336472 2 S2_S1_M −0.039945 0.032816472 0.072761472 0.003564264 N-Q9UN86 0 150.67 194.33 0 0.938345 0.979066836 4 S2_S1 0.938345 0.979066836 0.040721836 0.958705918 nsp1-O60220 143.33 0 0 0.852785 0 0 5 M −0.852785 −0.852785 NA −0.852785 nsp1-P09884 0 233.33 33.33 0 0.842755 0.985632296 4 S2_S1 0.842755 0.985632296 0.142877296 0.914193648 nsp1-P40763 50 0 0 0.9743 0 0 5 M −0.9743 −0.9743 NA −0.9743 nsp1-P42345 33.33 0 0 0.80987 0 0 5 M −0.80987 −0.80987 NA −0.80987 nsp1-P49642 0 70 33.33 0 0.82227 0.985634344 4 S2_S1 0.82227 0.985634344 0.163364344 0.903952172 nsp1-P49643 0 160 46.67 0 0.8245 0.996987596 4 S2_S1 0.8245 0.996987596 0.172487596 0.910743798 nsp1-Q05516 153.33 0 0 0.992445 0 0 5 M −0.992445 −0.992445 NA −0.992445 nsp1-Q14181 0 93.33 40 0 0.996645 0.806839244 4 S2_S1 0.996645 0.806839244 −0.189805756 0.901742122 nsp1-Q8NBJ5 0 0 73.33 0 0 0.897061987 6 S2 NA 0.897061987 0.897061987 NA nsp1-Q99959 0 0 430 0 0 0.982292676 6 S2 NA 0.982292676 0.982292676 NA nsp10-O94973 0 23.33 56.67 0 0.717935 0.995564065 4 S2_S1 0.717935 0.995564065 0.277629065 0.856749533 nsp10-P28330 120 0 0 0.94001 0 0 5 M −0.94001 −0.94001 NA −0.94001 nsp10-P55789 0 3.56 46.67 0 0.437515 0.982686408 6 S2 NA 0.982686408 0.545171408 NA nsp10-Q6Q0C0 0 123.33 10 0 0.992795 0.496522731 4 S2_S1 0.992795 0.496522731 −0.49627227 0.744658865 nsp10-Q969X5 0 193.33 146.67 0 0.932575 0.956119758 4 S2_S1 0.932575 0.956119758 0.023544758 0.944347379 nsp10-Q96CW1 0 16.67 30 0 0.53798 0.981452942 4 S2_S1 0.53798 0.981452942 0.443472942 0.759716471 nsp10-Q9BZH6 46.67 0 0 0.987275 0 0 5 M −0.987275 −0.987275 NA −0.987275 nsp10-Q9C026 30 0 0 0.776755 0 0 5 M −0.776755 −0.776755 NA −0.776755 nsp10-Q9HAV7 0 30 26.67 0 0.760685 0.983293541 4 S2_S1 0.760685 0.983293541 0.222608541 0.87198927 nsp11-O14734 30 30 20 0.83477 0.3202 0.349895739 5 M −0.51457 −0.484874262 NA −0.499722131 nsp11-O75347 5.45 30 14.67 0.628805 0.572815 0.849172351 2 S2_S1_M −0.05599 0.220367351 0.276357351 0.082188675 nsp11-Q92624 16.67 73.33 16.67 0.633205 0.92753 0.63550932 2 S2_S1_M 0.294325 0.002304319 −0.292020681 0.14831466 nsp11-Q9C0D3 0 46.67 76.67 0 0.94772 0.723916985 4 S2_S1 0.94772 0.723916985 −0.223803016 0.835818492 nsp13-A7MCY6 3.33 10 63.33 0.342755 0.592685 0.992644762 4 S2_S1 0.24993 0.649889762 0.399959762 0.449909881 nsp13-O14578 0 0 60 0 0 0.943657438 6 S2 NA 0.943657438 0.943657438 NA nsp13-O14639 0 53.33 0 0 0.87394 0 3 S1 0.87394 NA −0.87394 NA nsp13-O14908 3.33 66.67 0 0.11038 0.925455 0 3 S1 0.815075 NA −0.925455 NA nsp13-O60237 6.67 40 0 0.265685 0.709335 0 3 S1 0.44365 NA −0.709335 NA nsp13-O60784 20 153.33 16.67 0.51791 0.90991 0.263020733 1 S1_M 0.392 −0.254889268 −0.646889268 NA nsp13-O75381 6.67 30 0 0.497755 0.76976 0 1 S1_M 0.272005 −0.497755 −0.76976 NA nsp13-O75506 0 30 43.33 0 0.75879 0.925751307 4 S2_S1 0.75879 0.925751307 0.166961307 0.842270654 nsp13-O95613 923.33 1563.33 1810 0.976445 0.97516 0.985927969 2 S2_S1_M −0.001285 0.009482969 0.010767969 0.004098985 nsp13-O95684 3.33 30 20 0.342755 0.76578 0.81578518 4 S2_S1 0.423025 0.47303018 0.050005179 0.44802759 nsp13-P06396 16.67 46.67 0 0.31461 0.874975 0 3 S1 0.560365 NA −0.874975 NA nsp13-P09493 103.33 170 20 0.88494 0.905475 0.263786409 1 S1_M 0.020535 −0.621153591 −0.641688591 NA nsp13-P13861 156.67 103.33 200 0.938245 0.89999 0.948928606 2 S2_S1_M −0.038255 0.010683606 0.048938606 −0.013785697 nsp13-P14649 40 93.33 13.33 0.87596 0.928375 0.316990661 1 S1_M 0.052415 −0.558969339 −0.611384339 NA nsp13-P17612 33.33 60 53.33 0.912545 0.93384 0.940160587 2 S2_S1_M 0.021295 0.027615587 0.006320587 0.024455294 nsp13-P28289 26.67 103.33 13.33 0.537 0.85972 0.234827413 1 S1_M 0.32272 −0.302172588 −0.624892588 NA nsp13-P31323 30 20 66.67 0.97749 0.770075 0.991595753 2 S2_S1_M −0.207415 0.014105753 0.221520753 −0.096654624 nsp13-P35241 0 40 70 0 0.91847 0.956014158 4 S2_S1 0.91847 0.956014158 0.037544158 0.937242079 nsp13-P49454 53.33 6.67 200 0.94142 0.440075 0.936920322 7 S2_M −0.501345 −0.004499678 0.496845322 NA nsp13-P67936 150 223.33 40 0.934255 0.943055 0.355544634 1 S1_M 0.0088 −0.578710366 −0.587510366 NA nsp13-Q04724 0 33.33 43.33 0 0.96769 0.984586415 4 S2_S1 0.96769 0.984586415 0.016896415 0.976138208 nsp13-Q04726 0 86.67 180 0 0.926085 0.966813497 4 S2_S1 0.926085 0.966813497 0.040728497 0.946449248 nsp13-Q08117 0 20 23.33 0 0.799665 0.811215516 4 S2_S1 0.799665 0.811215516 0.011550516 0.805440258 nsp13-Q08378 285.33 193 850 0.954305 0.943315 0.964369412 2 S2_S1_M −0.01099 0.010064412 0.021054412 −0.000462794 nsp13-Q08379 353.33 483.33 773.33 0.955925 0.950515 0.976155544 2 S2_S1_M −0.00541 0.020230544 0.025640544 0.007410272 nsp13-Q12965 96.67 446.67 30 0.93924 0.99351 0.507755661 2 S2_S1_M 0.05427 −0.431484339 −0.485754339 −0.18860717 nsp13-Q13045 46.67 206.67 6.67 0.53926 0.87053 0.180792005 1 S1_M 0.33127 −0.358467996 −0.689737996 NA nsp13-Q14789 10 360 900 0.58494 0.94004 0.992802271 2 S2_S1_M 0.3551 0.407862271 0.052762271 0.381481135 nsp13-Q15154 290 470 260 0.85182 0.876465 0.848144227 2 S2_S1_M 0.024645 −0.003675773 −0.028320773 0.010484614 nsp13-Q16881 140 0 0 0.983335 0 0 5 M −0.983335 −0.983335 NA −0.983335 nsp13-Q4V328 6.67 136.67 310 0.439925 0.84276 0.994907985 2 S2_S1_M 0.402835 0.554982985 0.152147985 0.478908992 nsp13-Q5VT06 10 46.67 56.67 0.31597 0.70424 0.933779965 4 S2_S1 0.38827 0.617809965 0.229539965 0.503039983 nsp13-Q5VU43 206.67 120 236.67 0.99429 0.93966 0.989562196 2 S2_S1_M −0.05463 −0.004727804 0.049902196 −0.029678902 nsp13-Q5VUJ6 0 33.33 0 0 0.8676 0 3 S1 0.8676 NA −0.8676 NA nsp13-Q66GS9 26.67 40 63.33 0.7639 0.969495 0.987646067 2 S2_S1_M 0.205595 0.223746067 0.018151067 0.214670534 nsp13-Q6ZVM7 6.67 110 6.67 0.23647 0.963405 0.30165288 3 S1 0.726935 NA −0.66175212 NA nsp13-Q76N32 16.67 0 30 0.581 0 0.774852108 7 S2_M −0.581 0.193852108 0.774852108 NA nsp13-Q7Z406 266.67 880 63.33 0.77439 0.85493 0.204616775 1 S1_M 0.08054 −0.569773226 −0.650313226 NA nsp13-Q7Z7A1 0 0 50 0 0 0.994958704 6 S2 NA 0.994958704 0.994958704 NA nsp13-Q8IUD2 333.33 36.67 240 0.993565 0.78437 0.995359064 2 S2_S1_M −0.209195 0.001794064 0.210989064 −0.103700468 nsp13-Q8IWJ2 80 0 46.67 0.94573 0 0.99369356 7 S2_M −0.94573 0.04796356 0.99369356 NA nsp13-Q8N3C7 0 30 36.67 0 0.776945 0.978472336 4 S2_S1 0.776945 0.978472336 0.201527336 0.877708668 nsp13-Q8N4C6 43.33 360 690 0.993405 0.842755 0.995791597 2 S2_S1_M −0.15065 0.002386597 0.153036597 −0.074131701 nsp13-Q8N8E3 13.33 3.33 23.33 0.589445 0.342755 0.807159418 7 S2_M −0.24669 0.217714418 0.464404418 NA nsp13-Q8NDN9 36.67 0 0 0.88797 0 0 5 M −0.88797 −0.88797 NA −0.88797 nsp13-Q8TD10 83.33 86.67 180 0.94006 0.934175 0.99088498 2 S2_S1_M −0.005885 0.05082498 0.05670998 0.02246999 nsp13-Q8WXW3 6.67 43.33 6.67 0.296525 0.750145 0.305252195 3 S1 0.45362 NA −0.444892806 NA nsp13-Q92614 120 576.67 26.67 0.764855 0.93837 0.241423284 1 S1_M 0.173515 −0.523431717 −0.696946717 NA nsp13-Q92995 10 30 103.33 0.5891 0.97269 0.993757226 2 S2_S1_M 0.38359 0.404657226 0.021067226 0.394123613 nsp13-Q96CN9 0 4 96.67 0 0.327095 0.936680786 6 S2 NA 0.936680786 0.609585786 NA nsp13-Q96II8 26.67 230 0 0.33355 0.95438 0 3 S1 0.62083 NA −0.95438 NA nsp13-Q96N16 0 103.33 146.67 0 0.98623 0.993983496 4 S2_S1 0.98623 0.993983496 0.007753495 0.990106748 nsp13-Q96SN8 326.67 176 626.67 0.96175 0.954075 0.969653624 2 S2_S1_M −0.007675 0.007903623 0.015578623 0.000114312 nsp13-Q99996 548 573.33 1090 0.99493 0.93854 0.995406905 2 S2_S1_M −0.05639 0.000476905 0.056866905 −0.027956548 nsp13-Q9BQQ3 13.33 36.67 53.33 0.64546 0.979555 0.993435156 2 S2_S1_M 0.334095 0.347975156 0.013880156 0.341035078 nsp13-Q9BQS8 213.33 0 20 0.98596 0 0.691586651 7 S2_M −0.98596 −0.29437335 0.691586651 NA nsp13-Q9BV19 0 20 40 0 0.968045 0.966028423 4 S2_S1 0.968045 0.966028423 −0.002016578 0.967036711 nsp13-Q9BV73 256.67 1060 1510 0.939265 0.988335 0.995358917 2 S2_S1_M 0.04907 0.056093917 0.007023917 0.052581958 nsp13-Q9BZF9 60 293.33 20 0.6013 0.90756 0.380534105 1 S1_M 0.30626 −0.220765896 −0.527025896 NA nsp13-Q9C0B0 33.33 0 0 0.97038 0 0 5 M −0.97038 −0.97038 NA −0.97038 nsp13-Q9H0E2 26.67 60 3.33 0.66643 0.92599 0.074477515 1 S1_M 0.25956 −0.591952486 −0.851512486 NA nsp13-Q9UHD2 3.33 10 70 0.342755 0.592685 0.996985298 4 S2_S1 0.24993 0.654230298 0.404300298 0.452080149 nsp13-Q9UJC3 10 123.33 240 0.58494 0.842755 0.997024041 2 S2_S1_M 0.257815 0.412084041 0.154269041 0.33494952 nsp13-Q9ULV0 0 96.67 0 0 0.697205 0 3 S1 0.697205 NA −0.697205 NA nsp13-Q9UM54 533.33 414.67 136.67 0.84517 0.889335 0.254120161 1 S1_M 0.044165 −0.591049839 −0.635214839 NA nsp13-Q9UNZ2 23.33 0 0 0.96912 0 0 5 M −0.96912 −0.96912 NA −0.96912 nsp13-Q9UPN4 66.67 240 30 0.848445 0.929395 0.786584071 2 S2_S1_M 0.08095 −0.06186093 −0.14281093 0.009544535 nsp13-Q9UPQ0 0 86.67 0 0 0.94774 0 3 S1 0.94774 NA −0.94774 NA nsp13-Q9Y2I6 186.67 173.33 453.33 0.99228 0.842755 0.993895285 2 S2_S1_M −0.149525 0.001615284 0.151140285 −0.073954858 nsp13-Q9Y4I1 86.67 603.33 20 0.790445 0.89404 0.264800133 1 S1_M 0.103595 −0.525644867 −0.629239867 NA nsp13-Q9Y608 53.33 146.67 20 0.795345 0.886585 0.256396267 1 S1_M 0.09124 −0.538948734 −0.630188734 NA nsp14-O95071 83.33 0 0 0.713995 0 0 5 M −0.713995 −0.713995 NA −0.713995 nsp14-O95714 0 333.33 0 0 0.98908 0 3 S1 0.98908 NA −0.98908 NA nsp14-P04637 67.2 0 0 0.90646 0 0 5 M −0.90646 −0.90646 NA −0.90646 nsp14-P06280 0 156.67 256.67 0 0.901705 0.920568789 4 S2_S1 0.901705 0.920568789 0.018863789 0.911136895 nsp14-P12268 20 63.33 183.33 0.68699 0.84224 0.994833804 2 S2_S1_M 0.15525 0.307843804 0.152593804 0.231546902 nsp14-P30153 18.55 2.4 5.87 0.861875 0.20035 0.576866178 7 S2_M −0.661525 −0.285008822 0.376516178 NA nsp14-P49959 60 0 0 0.89418 0 0 5 M −0.89418 −0.89418 NA −0.89418 nsp14-P63151 13.33 5.33 6.67 0.87495 0.346635 0.182525872 5 M −0.528315 −0.692424128 NA −0.610369564 nsp14-Q5QP82 66.67 0 0 0.9942 0 0 5 M −0.9942 −0.9942 NA −0.9942 nsp14-Q5T9A4 400 0 0 0.866745 0 0 5 M −0.866745 −0.866745 NA −0.866745 nsp14-Q92878 88 0 0 0.950265 0 0 5 M −0.950265 −0.950265 NA −0.950265 nsp14-Q96EN8 133.33 0 0 0.995935 0 0 5 M −0.995935 −0.995935 NA −0.995935 nsp14-Q96JN8 0 173.33 0 0 0.93852 0 3 S1 0.93852 NA −0.93852 NA nsp14-Q9NQX3 60 0 0 0.92189 0 0 5 M −0.92189 −0.92189 NA −0.92189 nsp14-Q9NXA8 0 120 116.67 0 0.99539 0.996816405 4 S2_S1 0.99539 0.996816405 0.001426405 0.996103203 nsp15- 36.67 0 0 0.96815 0 0 5 M −0.96815 −0.96815 NA −0.96815 A0A0B4J1Y9 nsp15-P61970 0 0 23.33 0 0 0.978943 6 S2 NA 0.978943 0.978943 NA nsp15-P62330 0 36.67 70 0 0.8565 0.994065746 4 S2_S1 0.8565 0.994065746 0.137565746 0.925282873 nsp15-Q9H4P4 0 0 213.33 0 0 0.996780409 6 S2 NA 0.996780409 0.996780409 NA nsp16-A3KMH1 33.33 0 0 0.84918 0 0 5 M −0.84918 −0.84918 NA −0.84918 nsp16-O14972 0 0 23.33 0 0 0.979836157 6 S2 NA 0.979836157 0.979836157 NA nsp16-O43933 0 0 73.33 0 0 0.996519388 6 S2 NA 0.996519388 0.996519388 NA nsp16-O60232 0.9 6.29 5.91 0.12679 0.806585 0.669762658 4 S2_S1 0.679795 0.542972658 −0.136822342 0.611383829 nsp16-O60826 0 33.33 196.67 0 0.770775 0.996219731 4 S2_S1 0.770775 0.996219731 0.225444731 0.883497365 nsp16-O75382 0 0 66.67 0 0 0.969539135 6 S2 NA 0.969539135 0.969539135 NA nsp16-O75564 0 0 30 0 0 0.844073064 6 S2 NA 0.844073064 0.844073064 NA nsp16-O75665 0 0 106.67 0 0 0.996852272 6 S2 NA 0.996852272 0.996852272 NA nsp16-O95714 0 0 93.33 0 0 0.936058771 6 S2 NA 0.936058771 0.936058771 NA nsp16-O95754 0 0 50 0 0 0.995402353 6 S2 NA 0.995402353 0.995402353 NA nsp16-O95835 20 0 0 0.88447 0 0 5 M −0.88447 −0.88447 NA −0.88447 nsp16-P11717 33.33 0 0 0.92214 0 0 5 M −0.92214 −0.92214 NA −0.92214 nsp16-P28838 0 430 1383.33 0 0.9944 0.96760784 4 S2_S1 0.9944 0.96760784 −0.02679216 0.98100392 nsp16-P43686 43.33 0 0 0.868745 0 0 5 M −0.868745 −0.868745 NA −0.868745 nsp16-P51530 0 26.67 206.67 0 0.561495 0.96542669 4 S2_S1 0.561495 0.96542669 0.40393169 0.763460845 nsp16-P51659 26.4 0 10.93 0.902195 0 0.310095897 5 M −0.902195 −0.592099103 NA −0.747147052 nsp16-P54802 453.33 0 0 0.994985 0 0 5 M −0.994985 −0.994985 NA −0.994985 nsp16-Q05086 0 0 203.33 0 0 0.996602864 6 S2 NA 0.996602864 0.996602864 NA nsp16-Q12923 0 0.8 119.1 0 0.0175725 0.91236423 6 S2 NA 0.91236423 0.89479173 NA nsp16-Q13043 0 0 110 0 0 0.968447954 6 S2 NA 0.968447954 0.968447954 NA nsp16-Q13049 0 0 93.33 0 0 0.994426958 6 S2 NA 0.994426958 0.994426958 NA nsp16-Q13188 3.33 0 150 0.342755 0 0.908059395 6 S2 NA 0.565304395 0.908059395 NA nsp16-Q13438 36.67 0 3.33 0.995965 0 0.029719584 5 M −0.995965 −0.966245416 NA −0.981105208 nsp16-Q15345 0 0 23.33 0 0 0.979200709 6 S2 NA 0.979200709 0.979200709 NA nsp16-Q15796 46 0 0 0.981045 0 0 5 M −0.981045 −0.981045 NA −0.981045 nsp16-Q53EZ4 0 0 253.33 0 0 0.856036213 6 S2 NA 0.856036213 0.856036213 NA nsp16-Q567U6 0 23.33 170 0 0.88717 0.996513895 4 S2_S1 0.88717 0.996513895 0.109343895 0.941841948 nsp16-Q5SVZ6 0 260 766.67 0 0.99455 0.997013028 4 S2_S1 0.99455 0.997013028 0.002463028 0.995781514 nsp16-Q5SZL2 0 6.67 406.67 0 0.30205 0.996748048 6 S2 NA 0.996748048 0.694698048 NA nsp16-Q5VUJ6 0 0 243.33 0 0 0.981251596 6 S2 NA 0.981251596 0.98125159 NA nsp16-Q63ZY3 0 0 113.33 0 0 0.995911983 6 S2 NA 0.995911983 0.995911983 NA nsp16-Q6GYQ0 0 0 36.67 0 0 0.978708321 6 S2 NA 0.978708321 0.978708321 NA nsp16-Q6IEG0 0 0 33.33 0 0 0.888545334 6 S2 NA 0.888545334 0.888545334 NA nsp16-Q6PJI9 23.33 0 0 0.931715 0 0 5 M −0.931715 −0.931715 NA −0.931715 nsp16-Q6ZU80 0 0 60 0 0 0.946545955 6 S2 NA 0.946545955 0.946545955 NA nsp16-Q6ZWJ1 0 0 30 0 0 0.982523358 6 S2 NA 0.982523358 0.982523358 NA nsp16-Q70EL1 0 0 116.67 0 0 0.859490098 6 S2 NA 0.859490098 0.859490098 NA nsp16-Q7Z3J2 0 3.33 33.33 0 0.342755 0.99060053 6 S2 NA 0.99060053 0.64784553 NA nsp16-Q7Z4G1 0 0 20 0 0 0.97198845 6 S2 NA 0.97198845 0.97198845 NA nsp16-Q86SQ0 0 0 86.67 0 0 0.915913218 6 S2 NA 0.915913218 0.915913218 NA nsp16-Q86W92 0 0 223.33 0 0 0.984180404 6 S2 NA 0.984180404 0.984180404 NA nsp16-Q86X10 0 0 50 0 0 0.991607337 6 S2 NA 0.991607337 0.991607337 NA nsp16-Q8IUD2 0 356.67 2083.33 0 0.9633 0.960675251 4 S2_S1 0.9633 0.960675251 −0.002624749 0.961987626 nsp16-Q8IWR1 26.67 0 0 0.808845 0 0 5 M −0.808845 −0.808845 NA −0.808845 nsp16-Q8N668 0 0 26.67 0 0 0.810656863 6 S2 NA 0.810656863 0.810656863 NA nsp16-Q8TEM1 0 583.33 606.67 0 0.99054 0.925377868 4 S2_S1 0.99054 0.925377868 −0.065162133 0.957958934 nsp16-Q92995 653.33 0 0 0.99117 0 0 5 M −0.99117 −0.99117 NA −0.99117 nsp16-Q96DZ1 133.33 0 23.33 0.893355 0 0.677399056 7 S2_M −0.893355 −0.215955945 0.677399056 NA nsp16-Q96HP0 0 0 76.67 0 0 0.995171398 6 S2 NA 0.995171398 0.995171398 NA nsp16-Q96II8 0 0 290 0 0 0.968817445 6 S2 NA 0.968817445 0.968817445 NA nsp16-Q96IV0 70 0 0 0.980285 0 0 5 M −0.980285 −0.980285 NA −0.980285 nsp16-Q96RU2 30 0 0 0.97364 0 0 5 M −0.97364 −0.97364 NA −0.97364 nsp16-Q9BVQ7 0 0 43.33 0 0 0.990630835 6 S2 NA 0.990630835 0.990630835 NA nsp16-Q9GZQ3 0 0 43.33 0 0 0.996497251 6 S2 NA 0.996497251 0.996497251 NA nsp16-Q9H000 0 0 96.67 0 0 0.85791191 6 S2 NA 0.85791191 0.85791191 NA nsp16-Q9H0H0 0 10 186.67 0 0.319705 0.969170384 6 S2 NA 0.969170384 0.649465384 NA nsp16-Q9H4B6 0 0 233.33 0 0 0.934805068 6 S2 NA 0.934805068 0.934805068 NA nsp16-Q9NVH2 0 0 176.67 0 0 0.960012505 6 S2 NA 0.960012505 0.960012505 NA nsp16-Q9NX08 0 0 10.93 0 0 0.913492843 6 S2 NA 0.913492843 0.913492843 NA nsp16-Q9P000 0 0 36.67 0 0 0.986832599 6 S2 NA 0.986832599 0.986832599 NA nsp16-Q9P209 86.67 0 3.33 0.980135 0 0.342755123 5 M −0.980135 −0.637379877 NA −0.808757439 nsp16-Q9P2D0 0 0 180 0 0 0.887081752 6 S2 NA 0.887081752 0.887081752 NA nsp16-Q9P2S5 0 0 53.33 0 0 0.993772275 6 S2 NA 0.993772275 0.993772275 NA nsp16-Q9UBI1 0 0 40 0 0 0.994676141 6 S2 NA 0.994676141 0.994676141 NA nsp16-Q9UHD2 0 0 113.33 0 0 0.865348264 6 S2 NA 0.865348264 0.865348264 NA nsp16-Q9UHP3 0 0 100 0 0 0.990190321 6 S2 NA 0.990190321 0.990190321 NA nsp16-Q9UKF6 0 83.33 196.67 0 0.946375 0.865984944 4 S2_S1 0.946375 0.865984944 −0.080390056 0.906179972 nsp16-Q9ULA0 110 0 0 0.964395 0 0 5 M −0.964395 −0.964395 NA −0.964395 nsp16-Q9UN81 0 0 26.67 0 0 0.920674794 6 S2 NA 0.920674794 0.920674794 NA nsp16-Q9Y2D8 0 10 263.33 0 0.496975 0.972204186 4 S2_S1 0.496975 0.972204186 0.475229186 0.734589593 nsp16-Q9Y2K2 0 0 63.33 0 0 0.988628258 6 S2 NA 0.988628258 0.988628258 NA nsp16-Q9Y2S7 6.67 66.67 10 0.113415 0.8709 0.253465437 3 S1 0.757485 NA −0.617434563 NA nsp16-Q9Y305 83.33 0 0 0.978815 0 0 5 M −0.978815 −0.978815 NA −0.978815 nsp16-Q9Y6G5 0 0 53.33 0 0 0.996204159 6 S2 NA 0.996204159 0.996204159 NA nsp2-O00186 36.67 0 0 0.99584 0 0 5 M −0.99584 −0.99584 NA −0.99584 nsp2-O00303 69.33 183.33 0 0.767155 0.936365 0 1 S1_M 0.16921 −0.767155 −0.936365 NA nsp2-O00746 23.33 10 0 0.878735 0.355555 0 5 M −0.52318 −0.878735 NA −0.7009575 nsp2-O14975 20 30 46.67 0.55072 0.538755 0.952901743 2 S2_S1_M −0.011965 0.402181743 0.414146743 0.195108372 nsp2-O15372 43.43 28.67 3.33 0.733135 0.857295 0.009825276 1 S1_M 0.12416 −0.723309725 −0.847469725 NA nsp2-O60573 155 118.4 103.33 0.75766 0.91511 0.903416875 2 S2_S1_M 0.15745 0.145756875 −0.011693126 0.151603437 nsp2-O75821 23.43 33.09 0 0.672165 0.884765 0 1 S1_M 0.2126 −0.672165 −0.884765 NA nsp2-O75822 29.33 106.67 0 0.779205 0.92797 0 1 S1_M 0.148765 −0.779205 −0.92797 NA nsp2-P00387 36.67 6.67 0 0.86857 0.13245 0 5 M −0.73612 −0.86857 NA −0.802345 nsp2-P15954 26.67 0 10 0.97975 0 0.221215066 5 M −0.97975 −0.758534934 NA −0.869142467 nsp2-P16435 73.33 20 33.33 0.873805 0.55664 0.855480885 2 S2_S1_M −0.317165 −0.018324116 0.298840885 −0.167744558 nsp2-P52306 0 46.67 120 0 0.963885 0.995817872 4 S2_S1 0.963885 0.995817872 0.031932872 0.979851436 nsp2-P60228 92 44.89 0 0.774535 0.877505 0 1 S1_M 0.10297 −0.774535 −0.877505 NA nsp2-Q10471 30 0 0 0.976945 0 0 5 M −0.976945 −0.976945 NA −0.976945 nsp2-Q13423 36.67 0 0 0.872595 0 0 5 M −0.872595 −0.872595 NA −0.872595 nsp2-Q14152 51.11 71.3 0 0.761245 0.93187 0 1 S1_M 0.170625 −0.761245 −0.93187 NA nsp2-Q15650 180 0 0 0.93926 0 0 5 M −0.93926 −0.93926 NA −0.93926 nsp2-Q2M389 0 0 36.67 0 0 0.981057591 6 S2 NA 0.981057591 0.981057591 NA nsp2-Q5SZL2 40 0 0 0.76736 0 0 5 M −0.76736 −0.76736 NA −0.76736 nsp2-Q5T1M5 0 16.67 196.67 0 0.804275 0.994028348 4 S2_S1 0.804275 0.994028348 0.189753348 0.899151674 nsp2-Q5VT66 30 0 0 0.911505 0 0 5 M −0.911505 −0.911505 NA −0.911505 nsp2-Q6NUN9 70 36.67 0 0.982745 0.755435 0 1 S1_M −0.22731 −0.982745 −0.755435 NA nsp2-Q6Y7W6 79.08 126.82 403.33 0.884135 0.936885 0.883612278 2 S2_S1_M 0.05275 −0.000522722 −0.053272722 0.026113639 nsp2-Q7L2H7 253.33 260 0 0.813735 0.98171 0 1 S1_M 0.167975 −0.813735 −0.98171 NA nsp2-Q86UK7 36 45.44 38.5 0.741785 0.88422 0.782745415 2 S2_S1_M 0.142435 0.040960415 −0.101474585 0.091697707 nsp2-Q8N3C0 950 0 0 0.915915 0 0 5 M −0.915915 −0.915915 NA −0.915915 nsp2-Q8N9N2 130 0 0 0.991115 0 0 5 M −0.991115 −0.991115 NA −0.991115 nsp2-Q8NBU5 63.33 0 0 0.864215 0 0 5 M −0.864215 −0.864215 NA −0.864215 nsp2-Q8TF46 106.67 0 0 0.99519 0 0 5 M −0.99519 −0.99519 NA −0.99519 nsp2-Q8WVC6 26.67 0 0 0.872865 0 0 5 M −0.872865 −0.872865 NA −0.872865 nsp2-Q96A26 50 3.33 3.33 0.889775 0.0071725 0.005577709 5 M −0.8826025 −0.884197292 NA −0.883399896 nsp2-Q96B26 26.67 0 0 0.726055 0 0 5 M −0.726055 −0.726055 NA −0.726055 nsp2-Q96D09 193.33 0 0 0.99498 0 0 5 M −0.99498 −0.99498 NA −0.99498 nsp2-Q99613 46.67 40 0 0.9963 0.996585 0 1 S1_M 0.000285 −0.9963 −0.996585 NA nsp2-Q9BQ70 190 0 0 0.911145 0 0 5 M −0.911145 −0.911145 NA −0.911145 nsp2-Q9C037 10 120 0 0.178415 0.873945 0 3 SI 0.69553 NA −0.873945 NA nsp2-Q9H1I8 216.67 0 0 0.94009 0 0 5 M −0.94009 −0.94009 NA −0.94009 nsp2-Q9HD20 53.33 0 0 0.95877 0 0 5 M −0.95877 −0.95877 NA −0.95877 nsp2-Q9UBQ5 33 32 0 0.773085 0.86888 0 1 S1_M 0.095795 −0.773085 −0.86888 NA nsp2-Q9UH62 23.33 0 0 0.969445 0 0 5 M −0.969445 −0.969445 NA −0.969445 nsp2-Q9UPQ9 236 0 0 0.868555 0 0 5 M −0.868555 −0.868555 NA −0.868555 nsp2-Q9Y262 76 134 0 0.733055 0.93681 0 1 S1_M 0.203755 −0.733055 −0.93681 NA nsp4-P13674 50 0 16.67 0.951615 0 0.347077058 5 M −0.951615 −0.604537943 NA −0.778076471 nsp4-P14735 0 50 113.33 0 0.99431 0.959015721 4 S2_S1 0.99431 0.959015721 −0.035294279 0.976662861 nsp4-P49257 116.67 6.67 0 0.884265 0.28957 0 5 M −0.594695 −0.884265 NA −0.73948 nsp4-P62072 0 3.33 53.33 0 0.021763 0.980735991 6 S2 NA 0.980735991 0.958972991 NA nsp4-P62699 0 30 0 0 0.991805 0 3 S1 0.991805 NA −0.991805 NA nsp4-Q13586 26.67 0 0 0.969345 0 0 5 M −0.969345 −0.969345 NA −0.969345 nsp4-Q2TAA5 0 40 70 0 0.800615 0.863728025 4 S2_S1 0.800615 0.863728025 0.063113025 0.832171513 nsp4-Q6VN20 0 36.67 0 0 0.996385 0 3 S1 0.996385 NA −0.996385 NA nsp4-Q7L5Y9 0 26.67 0 0 0.984585 0 3 S1 0.984585 NA −0.984585 NA nsp4-Q8NBJ7 33.33 0 0 0.990575 0 0 5 M −0.990575 −0.990575 NA −0.990575 nsp4-Q8NFQ8 46.67 0 0 0.89845 0 0 5 M −0.89845 −0.89845 NA −0.89845 nsp4-Q8TEM1 86.67 3.33 63.33 0.69621 0.00199495 0.855087349 7 S2_M −0.69421505 0.158877349 0.853092399 NA nsp4-Q92643 50 6.67 30 0.914435 0.11348 0.540710722 7 S2_M −0.800955 −0.373724278 0.427230722 NA nsp4-Q969N2 40 0 16.67 0.85454 0 0.341991813 5 M −0.85454 −0.512548188 NA −0.683544094 nsp4-Q96S59 0 70 0 0 0.99675 0 3 S1 0.99675 NA −0.99675 NA nsp4-Q9BSF4 0 0 76.67 0 0 0.993490156 6 S2 NA 0.993490156 0.993490156 NA nsp4-Q9H7D7 0 93.33 0 0 0.964705 0 3 S1 0.964705 NA −0.964705 NA nsp4-Q9H871 0 40 0 0 0.9787 0 3 S1 0.9787 NA −0.9787 NA nsp4-Q9NVH1 0 0 113.33 0 0 0.863433437 6 S2 NA 0.863433437 0.863433437 NA nsp4-Q9NWU2 0 46.67 0 0 0.990345 0 3 S1 0.990345 NA −0.990345 NA nsp4-Q9Y5J6 0 0 30 0 0 0.982552028 6 S2 NA 0.982552028 0.982552028 NA nsp4-Q9Y5J7 0 0 40 0 0 0.956903142 6 S2 NA 0.956903142 0.956903142 NA nsp6-O75964 3.33 40 66.67 0.010592 0.711715 0.858632779 4 S2_S1 0.701123 0.848040779 0.146917779 0.77458189 nsp6-P25685 43.33 0 0 0.911885 0 0 5 M −0.911885 −0.911885 NA −0.911885 nsp6-Q15904 13.33 0 50 0.51662 0 0.994553461 7 S2_M −0.51662 0.477933461 0.994553461 NA nsp6-Q99720 0 63.33 50 0 0.870475 0.921106627 4 S2_S1 0.870475 0.921106627 0.050631627 0.895790813 nsp6-Q9H7F0 0 6.67 56.67 0 0.13509 0.902762927 6 S2 NA 0.902762927 0.767672927 NA nsp6-Q9UDY4 23.33 0 0 0.769675 0 0 5 M −0.769675 −0.769675 NA −0.769675 nsp7-A8MTT3 46.67 30 16.67 0.996545 0.983035 0.814439289 2 S2_S1_M −0.01351 −0.182105712 −0.168595712 −0.097807856 nsp7-O00116 8 90 76.67 0.58034 0.81255 0.913245163 2 S2_S1_M 0.23221 0.332905163 0.100695163 0.282557581 nsp7-O14975 36.67 10 3.33 0.89937 0.301675 0.024969109 5 M −0.597695 −0.874400892 NA −0.736047946 nsp7-O43169 13.33 33.33 33.33 0.46285 0.698355 0.896755095 2 S2_S1_M 0.235505 0.433905095 0.198400095 0.334705048 nsp7-O94766 40 26.67 26.67 0.77505 0.703715 0.777879459 2 S2_S1_M −0.071335 0.002829459 0.074164459 −0.034252771 nsp7-O95159 23.33 10 0 0.83907 0.2099495 0 5 M −0.6291205 −0.83907 NA −0.73409525 nsp7-O95573 173.33 100 43.33 0.956415 0.80568 0.948534466 2 S2_S1_M −0.150735 −0.007880534 0.142854466 −0.079307767 nsp7-P00387 3.33 60 73.33 0.0394585 0.87562 0.978174676 4 S2_S1 0.8361615 0.938716176 0.102554676 0.887438838 nsp7-P11233 23.33 33.33 23.33 0.619915 0.67243 0.860183243 2 S2_S1_M 0.052515 0.240268243 0.187753243 0.146391621 nsp7-P21964 20 73.33 20 0.759765 0.69864 0.702615883 2 S2_S1_M −0.061125 −0.057149118 0.003975882 −0.059137059 nsp7-P51148 0 56.67 80 0 0.77073 0.939542965 4 S2_S1 0.77073 0.939542965 0.168812965 0.855136483 nsp7-P51149 0 56.67 106.67 0 0.740855 0.986362115 4 S2_S1 0.740855 0.986362115 0.245507115 0.863608557 nsp7-P61006 3.33 46.67 23.33 0.047039 0.877235 0.772872298 4 S2_S1 0.830196 0.725833298 −0.104362702 0.778014649 nsp7-P61019 0 33.33 20 0 0.770655 0.81459786 4 S2_S1 0.770655 0.81459786 0.04394286 0.79262643 nsp7-P61026 3.33 23.33 30 0.056935 0.68887 0.980721536 4 S2_S1 0.631935 0.923786536 0.291851536 0.777860768 nsp7-P61106 13.33 76.67 66.67 0.348925 0.684125 0.875356413 4 S2_S1 0.3352 0.526431413 0.191231413 0.430815707 nsp7-P61586 0 26.67 20 0 0.67556 0.7395147 4 S2_S1 0.67556 0.7395147 0.0639547 0.70753735 nsp7-P62820 0 36.67 40 0 0.71914 0.962644797 4 S2_S1 0.71914 0.962644797 0.243504797 0.840892398 nsp7-P62873 3.33 16.67 26.67 0.0137575 0.30248 0.909766068 6 S2 NA 0.896008568 0.607286068 NA nsp7-P63218 6.67 16.67 20 0.162845 0.47149 0.733815783 4 S2_S1 0.308645 0.570970783 0.262325783 0.439807892 nsp7-Q12907 0 60 70 0 0.871285 0.862886992 4 S2_S1 0.871285 0.862886992 −0.008398008 0.867085996 nsp7-Q13724 246.67 406.67 276.67 0.90434 0.834215 0.891165494 2 S2_S1_M −0.070125 −0.013174507 0.056950493 −0.041649753 nsp7-Q2TAA5 0 63.33 30 0 0.9501 0.557525176 4 S2_S1 0.9501 0.557525176 −0.392574824 0.753812588 nsp7-Q53H12 253.33 273.33 210 0.852945 0.702285 0.790614972 2 S2_S1_M −0.15066 −0.062330028 0.088329972 −0.106495014 nsp7-Q5JTV8 3.33 20 20 0.018931 0.743185 0.697584025 4 S2_S1 0.724254 0.678653025 −0.045600975 0.701453513 nsp7-Q5VT66 10 73.33 63.33 0.262925 0.914985 0.969860512 4 S2_S1 0.65206 0.706935512 0.054875512 0.679497756 nsp7-Q6P1M0 106.67 0 0 0.955085 0 0 5 M −0.955085 −0.955085 NA −0.955085 nsp7-Q6P1Q0 146.67 83.33 40 0.98912 0.895605 0.843229772 2 S2_S1_M −0.093515 −0.145890229 −0.052375229 −0.119702614 nsp7-Q6ZRP7 36.67 63.33 43.33 0.968085 0.994445 0.732162573 2 S2_S1_M 0.02636 −0.235922427 −0.262282427 −0.104781214 nsp7-Q7LGA3 10 43.33 50 0.28665 0.904245 0.853233417 4 S2_S1 0.617595 0.566583417 −0.051011583 0.592089209 nsp7-Q8IUR0 0 20 6.67 0 0.929345 0.438749271 3 S1 0.929345 NA −0.49059573 NA nsp7-Q8N183 0 13.33 30 0 0.69781 0.980722429 4 S2_S1 0.69781 0.980722429 0.282912429 0.839266215 nsp7-Q8N2K0 50 6.67 13.33 0.889245 0.1209 0.356790399 5 M −0.768345 −0.532454601 NA −0.650399801 nsp7-Q8N9F7 40 6.67 0 0.993505 0.43991 0 5 M −0.553595 −0.993505 NA −0.77355 nsp7-Q8NBU5 86.67 70 36.67 0.86913 0.79998 0.81621023 2 S2_S1_M −0.06915 −0.05291977 0.01623023 −0.061034885 nsp7-Q8NBX0 23.33 56.67 23.33 0.813255 0.996085 0.97433756 2 S2_S1_M 0.18283 0.16108256 −0.021747441 0.17195628 nsp7-Q8WTV0 0 30 26.67 0 0.98008 0.757203124 4 S2_S1 0.98008 0.757203124 −0.222876877 0.868641562 nsp7-Q8WUY8 70 40 43.33 0.970235 0.889705 0.860142873 2 S2_S1_M −0.08053 −0.110092127 −0.029562127 −0.095311064 nsp7-Q8WVC6 290 83.33 90 0.958145 0.8368 0.931226168 2 S2_S1_M −0.121345 −0.026918833 0.094426168 −0.074131916 nsp7-Q96A26 136.67 166.67 110 0.92584 0.93852 0.874386791 2 S2_S1_M 0.01268 −0.051453209 −0.064133209 −0.019386605 nsp7-Q96DA6 20 26.67 30 0.713645 0.7685 0.980725063 2 S2_S1_M 0.054855 0.267080063 0.212225063 0.160967532 nsp7-Q96ER9 0 26.67 3.33 0 0.9181 0.342755242 3 S1 0.9181 NA −0.575344758 NA nsp7-Q96KC8 0 33.33 0 0 0.979895 0 3 S1 0.979895 NA −0.979895 NA nsp7-Q9BQE4 23.33 50 33.33 0.82553 0.86263 0.850882202 2 S2_S1_M 0.0371 0.025352202 −0.011747798 0.031226101 nsp7-Q9H7Z7 196.67 60 60 0.988265 0.93241 0.877269166 2 S2_S1_M −0.055855 −0.110995835 −0.055140835 −0.083425417 nsp7-Q9NP72 0 26.67 20 0 0.54086 0.703302544 4 S2_S1 0.54086 0.703302544 0.162442544 0.622081272 nsp7-Q9NX40 70 80 76.67 0.954545 0.79609 0.845374481 2 S2_S1_M −0.158455 −0.109170519 0.049284481 −0.13381276 nsp7-Q9NYP7 0 23.33 3.33 0 0.90949 0.342755427 3 S1 0.90949 NA −0.566734573 NA nsp7-Q9Y3D7 6.67 33.33 13.33 0.296865 0.8098 0.5483636 4 S2_S1 0.512935 0.2514986 −0.261436401 0.3822168 nsp7-Q9Y5J7 26.67 10 3.33 0.716075 0.16155 0.037183933 5 M −0.554525 −0.678891068 NA −0.6167080 nsp8-O00566 30 30 26.67 0.80071 0.886905 0.694279586 2 S2_S1_M 0.086195 −0.106430414 −0.192625414 −0.010117707 nsp8-O15381 30 30 0 0.94873 0.51182 0 1 S1_M −0.43691 −0.94873 −0.51182 NA nsp8-O60287 60 133.33 90 0.875535 0.81079 0.79329767 2 S2_S1_M −0.064745 −0.08223733 −0.017492331 −0.073491165 nsp8-O76094 253.33 336.67 336.67 0.751585 0.860345 0.869770328 2 S2_S1_M 0.10876 0.118185328 0.009425328 0.113472664 nsp8-O95260 0 140 83.33 0 0.91861 0.902146319 4 S2_S1 0.91861 0.902146319 −0.016463682 0.910378159 nsp8-O95373 46.67 0 0 0.86596 0 0 5 M −0.86596 −0.86596 NA −0.86596 nsp8-O95707 26.67 10 10 0.85579 0.590045 0.5935402 2 S2_S1_M −0.265745 −0.2622498 0.0034952 −0.2639974 nsp8-O96028 6.67 20 20 0.24973 0.812515 0.75732598 4 S2_S1 0.562785 0.50759598 −0.055189021 0.53519049 nsp8-P09132 140 150 120 0.78396 0.928905 0.916251186 2 S2_S1_M 0.144945 0.132291186 −0.012653814 0.138618093 nsp8-P10644 36.67 0 0 0.986265 0 0 5 M −0.986265 −0.986265 NA −0.986265 nsp8-P42285 60 30 23.33 0.87745 0.583995 0.607652812 2 S2_S1_M −0.293455 −0.269797189 0.023657811 −0.281626094 nsp8-P51114 93.33 76.67 63.33 0.9278 0.6668 0.668238829 2 S2_S1_M −0.261 −0.259561171 0.001438829 −0.260280586 nsp8-P51116 90 96.67 93.33 0.87708 0.67988 0.686838818 2 S2_S1_M −0.1972 −0.190241183 0.006958817 −0.193720591 nsp8-P61011 6.18 30 40 0.577605 0.6537 0.872792074 2 S2_S1_M 0.076095 0.295187074 0.219092074 0.185641037 nsp8-P82663 23.33 13.33 46.67 0.775315 0.439465 0.91321856 7 S2_M −0.33585 0.13790356 0.47375356 NA nsp8-Q03701 196.67 166.67 266.67 0.85365 0.72293 0.760986525 2 S2_S1_M −0.13072 −0.092663475 0.038056525 −0.111691738 nsp8-Q12788 93.33 82 53.33 0.87482 0.73317 0.690414065 2 S2_S1_M −0.14165 −0.184405936 −0.042755936 −0.163027968 nsp8-Q13206 66.67 73.33 56.67 0.878515 0.89008 0.877876797 2 S2_S1_M 0.011565 −0.000638203 −0.012203203 0.005463398 nsp8-Q14146 40 33.33 20 0.941165 0.777745 0.333093372 1 S1_M −0.16342 −0.608071628 −0.444651628 NA nsp8-Q14692 56.67 60 46.67 0.84302 0.8672 0.80826186 2 S2_S1_M 0.02418 −0.034758141 −0.058938141 −0.00528907 nsp8-Q15269 36.67 46.67 30 0.87901 0.688805 0.479327319 1 S1_M −0.190205 −0.399682682 −0.209477682 NA nsp8-Q15397 183.33 226.67 163.33 0.8118 0.86082 0.813323307 2 S2_S1_M 0.04902 0.001523307 −0.047496693 0.025271654 nsp8-Q16531 36.67 40 63.33 0.95416 0.64357 0.664919889 2 S2_S1_M −0.31059 −0.289240112 0.021349889 −0.299915056 nsp8-Q4G0J3 96.67 150 126.67 0.719595 0.89692 0.906239841 2 S2_S1_M 0.177325 0.186644841 0.00931984 0.181984921 nsp8-Q76FK4 83.33 43.33 20 0.902575 0.816175 0.760221042 2 S2_S1_M −0.0864 −0.142353959 −0.055953959 −0.114376979 nsp8-Q7L2J0 76.67 130 103.33 0.718475 0.89101 0.895489059 2 S2_S1_M 0.172535 0.177014059 0.004479059 0.174774529 nsp8-Q7Z4Q2 23.33 0 0 0.96868 0 0 5 M −0.96868 −0.96868 NA −0.96868 nsp8-Q8IX01 23.33 0 0 0.83277 0 0 5 M −0.83277 −0.83277 NA −0.83277 nsp8-Q8IY37 23.33 43.33 0 0.580735 0.99481 0 1 S1_M 0.414075 −0.580735 −0.99481 NA nsp8-Q8N5D0 126.67 3.33 20 0.99578 0.0077805 0.683891711 7 S2_M −0.9879995 −0.31188829 0.676111211 NA nsp8-Q8N983 0 23.33 0 0 0.98039 0 3 S1 0.98039 NA −0.98039 NA nsp8-Q8NEJ9 16.67 33.33 36.67 0.603725 0.810405 0.85703947 2 S2_S1_M 0.20668 0.25331447 0.04663447 0.229997235 nsp8-Q8NI36 50 63.33 83.33 0.879955 0.712755 0.73693436 2 S2_S1_M −0.1672 −0.14302064 0.02417936 −0.15511032 nsp8-Q8TC07 43.33 0 0 0.99287 0 0 5 M −0.99287 −0.99287 NA −0.99287 nsp8-Q96B26 20 30 36.67 0.5721 0.97933 0.995449113 2 S2_S1_M 0.40723 0.423349113 0.016119113 0.415289556 nsp8-Q96FK6 30 30 0 0.841435 0.991765 0 1 S1_M 0.15033 −0.841435 −0.991765 NA nsp8-Q96I59 13.33 3.33 53.33 0.750075 0.033522 0.890925175 7 S2_M −0.716553 0.140850175 0.857403175 NA nsp8-Q99547 20 23.33 13.33 0.84781 0.62049 0.647145842 2 S2_S1_M −0.22732 −0.200664159 0.026655842 −0.213992079 nsp8-Q9BSC4 70 103.33 83.33 0.95159 0.900105 0.903909756 2 S2_S1_M −0.051485 −0.047680245 0.003804755 −0.049582622 nsp8-Q9GZL7 36.67 26.67 20 0.918495 0.793965 0.606449939 2 S2_S1_M −0.12453 −0.312045062 −0.187515062 −0.218287531 nsp8-Q9H6F5 23.33 24 43.33 0.60171 0.970285 0.868401831 2 S2_S1_M 0.368575 0.266691831 −0.10188317 0.317633415 nsp8-Q9H6R4 123.33 90 56.67 0.866245 0.6852 0.677648918 2 S2_S1_M −0.181045 −0.188596083 −0.007551083 −0.184820541 nsp8-Q9HD40 13.33 10 43.33 0.642 0.36176 0.904779624 7 S2_M −0.28024 0.262779624 0.543019624 NA nsp8-Q9NQT4 23.33 30 36.67 0.77041 0.815345 0.847145951 2 S2_S1_M 0.044935 0.07673595 0.031800951 0.060835475 nsp8-Q9NQT5 23.33 30 63.33 0.76155 0.791265 0.88739866 2 S2_S1_M 0.029715 0.12584866 0.09613366 0.07778183 nsp8-Q9NTK5 46.67 3.33 46.67 0.78034 0.0067235 0.720728425 7 S2_M −0.7736165 −0.059611576 0.714004925 NA nsp8-Q9NY61 23.33 70 116.67 0.803015 0.92578 0.891851841 2 S2_S1_M 0.122765 0.088836841 −0.03392816 0.10580092 nsp8-Q9UGI8 0 96.67 10 0 0.99523 0.507755438 4 S2_S1 0.99523 0.507755438 −0.487474562 0.751492719 nsp8-Q9UHG3 86.67 0 0 0.995825 0 0 5 M −0.995825 −0.995825 NA −0.995825 nsp8-Q9UL40 2 33.33 0 0.20369 0.84735 0 3 S1 0.64366 NA −0.84735 NA nsp8-Q9ULT8 0 53.33 53.33 0 0.913545 0.942752393 4 S2_S1 0.913545 0.942752393 0.029207392 0.928148696 nsp8-Q9ULX6 23.33 0 13.33 0.88436 0 0.42682183 5 M −0.88436 −0.457538171 NA −0.670949085 nsp8-Q9Y399 0 0 20 0 0 0.811028785 6 S2 NA 0.811028785 0.811028785 NA nsp8-Q9Y3A4 30 10 13.33 0.881945 0.16819 0.330559314 5 M −0.713755 −0.551385687 NA −0.632570343 nsp9-O00142 0 96.67 73.33 0 0.992005 0.842759395 4 S2_S1 0.992005 0.842759395 −0.149245605 0.917382198 nsp9-O00233 26.67 0 0 0.98034 0 0 5 M −0.98034 −0.98034 NA −0.98034 nsp9-P13984 0 23.2 140 0 0.777645 0.938713469 4 S2_S1 0.777645 0.938713469 0.161068469 0.858179235 nsp9-P21281 26.67 0 0 0.81161 0 0 5 M −0.81161 −0.81161 NA −0.81161 nsp9-P35555 0 6.67 153.33 0 0.502755 0.996186198 4 S2_S1 0.502755 0.996186198 0.493431198 0.749470599 nsp9-P35556 0 473.33 830 0 0.995555 0.995506165 4 S2_S1 0.995555 0.995506165 −4.88E−05 0.995530582 nsp9-P35658 2 0 83.33 0.015781 0 0.981116632 6 S2 NA 0.965335632 0.981116632 NA nsp9-P37198 0 3.33 180 0 0.082145 0.996505226 6 S2 NA 0.996505226 0.914360226 NA nsp9-P38606 106.67 0 0 0.989065 0 0 5 M −0.989065 −0.989065 NA −0.989065 nsp9-P41250 20 0 0 0.927295 0 0 5 M −0.927295 −0.927295 NA −0.927295 nsp9-P49419 50 0 0 0.945525 0 0 5 M −0.945525 −0.945525 NA −0.945525 nsp9-P61962 0 50 160 0 0.880205 0.984617012 4 S2_S1 0.880205 0.984617012 0.104412012 0.932411006 nsp9-P62310 26.67 0 0 0.918185 0 0 5 M −0.918185 −0.918185 NA −0.918185 nsp9-Q14232 0 26.67 10 0 0.87989 0.496000682 4 S2_S1 0.87989 0.496000682 −0.383889318 0.687945341 nsp9-Q15056 0 6.67 60 0 0.16176 0.934509695 6 S2 NA 0.934509695 0.772749695 NA nsp9-Q5SW79 240 0 0 0.94098 0 0 5 M −0.94098 −0.94098 NA −0.94098 nsp9-Q6SZW1 26.67 0 0 0.74016 0 0 5 M −0.74016 −0.74016 NA −0.74016 nsp9-Q7Z3B4 0 0 213.33 0 0 0.995812411 6 S2 NA 0.995812411 0.995812411 NA nsp9-Q86YT6 563.33 193.33 150 0.98055 0.857085 0.948911165 2 S2_S1_M −0.123465 −0.031638835 0.091826165 −0.077551918 nsp9-Q8IWP9 50 6.67 0 0.96061 0.2048965 0 5 M −0.7557135 −0.96061 NA −0.85816175 nsp9-Q8N0X7 0 110 136.67 0 0.919655 0.981482065 4 S2_S1 0.919655 0.981482065 0.061827065 0.950568532 nsp9-Q8N1G2 10 30 0 0 0.689855 0 3 S1 0.689855 NA −0.689855 NA nsp9-Q8TD19 10 56.67 390 0.697675 0.88751 0.995986433 2 S2_S1_M 0.189835 0.298311433 0.108476433 0.244073216 nsp9-Q96F45 0.5 14.67 93.5 0.039492 0.7588 0.888790724 4 S2_S1 0.719308 0.849298724 0.129990724 0.784303362 nsp9-Q96PM5 63.33 0 0 0.90321 0 0 5 M −0.90321 −0.90321 NA −0.90321 nsp9-Q99567 0 0 36.67 0 0 0.95862156 6 S2 NA 0.95862156 0.95862156 NA nsp9-Q9BU61 23.33 0 0 0.923145 0 0 5 M −0.923145 −0.923145 NA −0.923145 nsp9-Q9BVL2 0 0 120 0 0 0.989793112 6 S2 NA 0.989793112 0.989793112 NA nsp9-Q9NZL9 0 0 43.33 0 0 0.989141328 6 S2 NA 0.989141328 0.989141328 NA nsp9-Q9UBX5 10 0 20 0.496875 0 0.976001097 7 S2_M −0.496875 0.479126097 0.976001097 NA

    TABLE-US-00028 TABLE 10B Column Headers from 8A Description Bait_Prey Viral bait protein followed by uniprot identifier of human prey protein. Bait Viral bait protein. Prey Human prey protein as HGNC gene symbols. MIST_MERS MiST score for interaction in MERS-COV. MIST_SARS1 MiST score for interaction in SARS-COV-1. MIST_SARS2 MiST score for interaction in SARS-COV-2. Saint_MERS Saint score for interaction in MERS-COV. Saint_SARS1 Saint score for interaction in SARS-COV-1. Saint_SARS2 Saint score for interaction in SARS-COV-2. BFDR_MERS False discovery rate of Saint score for interaction in MERS-COV. BFDR_SARS1 False discovery rate of Saint score for interaction in SARS-COV-1. BFDR_SARS2 False discovery rate of Saint score for interaction in SARS-COV-2. AvgSpec_MERS Average spectral counts across three biological replicates for interaction in MERS-COV. AvgSpec_SARS1 Average spectral counts across three biological replicates for interaction in SARS-COV-1. AvgSpec_SARS2 Average spectral counts across three biological replicates for interaction in SARS-COV-2. FoldChange_MERS Fold change between spectral counts detected in experimental versus control samples for interaction in MERS-COV; derived from Saint scoring algorithm. FoldChange_SARS1 Fold change between spectral counts detected in experimental versus control samples for interaction in SARS-COV-1; derived from Saint scoring algorithm. FoldChange_SARS2 Fold change between spectral counts detected in experimental versus control samples for interaction in SARS-COV-2; derived from Saint scoring algorithm. K_InteractionScore_ Interaction score (K) for interaction from MERS- MERS COV, defined as the average between the MiST and Saint score. K_InteractionScore_ Interaction score (K) for interaction from SARS- SARS1 COV-1, defined as the average between the MiST and Saint score. K_InteractionScore_ Interaction score (K) for interaction from SARS- SARS2 COV-2, defined as the average between the MiST and Saint score. Cluster Cluster number assigned from hierarchical clustering. Cluster_Assignments Cluster category from hierarchical clusters. Annotations denote where interactions exist. M = MERS-COV only. S1 = SARS-COV-1 only. S2 = SARS-COV-2 only. S2_S1 = SARS-COV-2 and SARS-COV-1 only. S1_M = SARS-COV-1 and MERS-COV only. S2_M = SARS-COV-2 and MERS-COV only. S2_S1_M = SARS-COV-2, SARS-COV-1, and MERS-CoV. DIS_SARS1_MERS Differential interaction score comparing SARSI- MERS. Ranges from −1 to 1. DIS of 1 indicates SARS-COV-1 specificity, −1 indicates MERS- COV specificity, and 0 indicates shared between both. DIS_SARS2_MERS DIfferential interaction score comparing SARS2- MERS. Ranges from −1 to 1. DIS of 1 indicates SARS-COV-2 specificity, −1 indicates MERS-COV specificity, and 0 indicates shared between both. DIS_SARS2_SARS1 Differential interaction score comparing SARS2- SARS1. Ranges from −1 to 1. DIS of 1 indicates SARS-COV-2 specificity, −1 indicates SARS- COV-1 specificity, and 0 indicates shared between both. DIS_SARS_MERS Differential interaction score comparing SARS- MERS. Ranges from −1 to 1. DIS of 1 indicates SARS-COV-1 and SARS-COV-2 specificity, −1 indicates MERS-COV specificity, and 0 indicates shared between all three viruses.

    [0478] In agreement with previous results (FIG. 2A), DIS scores for the comparison between SARS-CoV-2 and SARS-CoV-1 are enriched near zero, indicating a high number of shared interactions (FIG. 15B, star). On the other hand, comparing interactions from either SARS-CoV-1 or SARS-CoV-2 with MERS-CoV resulted in DIS values closer to ±1, indicating a higher divergence (FIG. 15B, line and circle). The breakdown of DIS by homologous viral proteins reveals high similarity of interactions for proteins N, Nsp8, Nsp7, and Nsp13 (FIG. reinforcing the observations made by overlapping thresholded interactions (FIG. 15C and FIG. 15D). As the greatest dissimilarity was observed between the SARS-CoVs and MERS-CoV, a fourth DIS (SARS-MERS) was computed by averaging K from SARS-CoV-1 and SARS-CoV-2 prior to calculating the difference with MERS-CoV (FIG. 15B and FIG. triangle). Next, a network visualization of the SARS-MERS comparison was created (FIG. 15D), permitting an appreciation of SARS-specific (red; DIS near ±1) versus MERS-specific (blue; DIS near −1) interactions, as well as those conserved between all three coronavirus species (black; DIS near zero). SARS-specific interactions include: DNA polymerase a interacting with Nsp 1; stress granule regulators interacting with N protein; TLE transcription factors interacting with Nsp13; and AP2 clathrin interacting with Nsp10. Notable MERS-CoV-specific interactions include: mTOR and Stat3 interacting with Nsp1; DNA damage response components p53 (TP53), MRE11, RAD50, and UBR5 interacting with Nsp14; and the activating signal cointegrator 1 (ASC-1) complex interacting with Nsp2. Interactions shared between all three coronaviruses include: casein kinase II and RNA processing regulators interacting with N protein; IMP dehydrogenase 2 (IMPDH2) interacting with Nsp14; centrosome, protein kinase A, and TBK1 interacting with Nsp13; and the signal recognition particle, 7SK snRNP, exosome, and ribosome biogenesis components interacting with Nsp8 (FIG. 15D).

    [0479] Referring to FIG. 15B, a density histogram of the DIS for all comparisons is shown.

    [0480] Referring to FIG. 15C, a dot plot depicting the DIS of interactions from viral bait proteins shared between all three viruses, ordered left-to-right by the mean DIS per viral bait, is shown.

    [0481] Referring to FIG. 15D, a virus-human protein-protein interaction map depicting the SARS-MERS comparison (triangle/purple in FIG. 15B-C) is shown. The network depicts interactions derived from cluster 2 (all 3 viruses), cluster 4 (SARS-CoV-1 and SARS-CoV-2), and cluster 5 (MERS-CoV only). Edge color denotes DIS: red, interactions specific to SARS-CoV-1 and SARS-CoV-2 but absent in MERS-CoV; blue, interactions specific to MERS-CoV but absent from both SARS-CoV-1 and SARS-CoV-2; black, interactions shared between all three viruses. Human-human interactions (thin dark grey line), proteins sharing the same protein complexes or biological processes (light yellow or light blue highlighting, respectively) are shown. Host-host physical interactions, protein complex definitions, and biological process groupings are derived from CORUM (M. Giurgiu, et al., CORUM: the comprehensive resource of mammalian protein complexes-2019. Nucleic Acids Res. 47, D559-D563 (2019)), Gene Ontology (biological process), and manually curated from literature sources. DIS=differential interactions score; SARS2=SARS-CoV-2; SARS1=SARS-CoV-1; MERS=MERS-CoV; SARS=both SARS-CoV-1 and SARS-CoV-2.

    [0482] Cell-Based Genetic Screens Identify SARS-CoV-2 Host Dependency Factors

    [0483] To identify host factors that are critical for infection and therefore potential targets for host-directed therapies, genetic perturbations of 332 human proteins were performed, 331 previously identified to interact with SARS-CoV-2 proteins (Gordon, et al. A SARS-CoV-2 protein interaction map reveals targets for drug repurposing. Nature (2020) plus ACE2, and their effect on infectivity observed. To ensure a broad coverage of potential hits, two screens in different cell lines were carried out to investigate the effects on infection: siRNA knockdowns in A549 cells stably expressing ACE2 (A549-ACE2) (FIG. 4A) and CRISPR-based knockouts in Caco-2 cells (FIG. 4B). ACE2 was included as positive control in both screens as were non-targeting siRNAs or non-targeted Caco-2 cells as negative controls. After SARS-CoV-2 infection, effects on virus infectivity were quantified by RT-qPCR on cell supernatants (siRNA) or by titrating virus-containing supernatants on Vero E6 cells (CRISPR). Cells were monitored for viability, and knockdown or editing efficiency was determined as described (FIG. 3A-F). This revealed that 93% of the genes were knocked down at least 50% in the A549-ACE2 screen, and 95% of the knockdowns exhibited less than a 20% decrease in viability. In the Caco-2 assay, an editing efficiency of at least 80% for 89% of the genes tested was observed (FIG. 3A-F). Of the 332 human SARS-CoV-2 interactors, the final A549-ACE2 dataset includes 331 gene knockdowns and the Caco-2 dataset includes 286 gene knockouts, with the difference mainly due to removal of essential genes. The readouts from both assays were then separately normalized using robust Z-scores, with negative and positive Z-scores indicating proviral dependency factors (perturbation=decreased infectivity) and antiviral host factors with restrictive activity (perturbation=increased infectivity), respectively. As expected, negative controls resulted in neutral Z-scores (FIG. 4C-D and Tables S6-7 provide in U.S. Provisional Application No. 63/091,929 filed on Oct. 15, 2020, expressly incorporated by reference herein). Similarly, perturbations of the positive control ACE2 resulted in strongly negative Z-scores in both assays (FIG. 4C-D). Overall, the Z-scores did not exhibit any trends related to viability, knockdown efficiency, or editing efficiency (FIG. 3A-F). With a cutoff of |Z|>2 to highlight genes that notably affect SARS-CoV-2 infectivity when perturbed, 31 and 40 dependency factors (Z<−2) and 3 and 4 factors with restrictive activity (Z>2) were identified in A549-ACE2 and Caco-2 cells, respectively (FIG. 4E). Of particular interest are the host dependency factors for SARS-CoV-2 infection, which represent potential targets for drug development and repurposing. For example, non-opioid receptor sigma 1 (sigma-1, encoded by SIGMAR1) was identified as a functional host-dependency factor in both cell systems in agreement with a previous report of antiviral activity for sigma receptor ligands (Gordon, et al. A SARS-CoV-2 protein interaction map reveals targets for drug repurposing. Nature (2020). To provide a contextual view of the genetics results, a network that integrates the hits from both cell lines and the PPIs of their encoded proteins with SARS-CoV-2, SARS-CoV-1, and MERS-CoV proteins was geneterated (FIG. 4F). Interestingly, an enrichment of genetic hits that encode proteins interacting with viral Nsp7, which has a high degree of interactions shared across all the three viruses, was observed (FIG. 2C). Prostaglandin E synthase 2 (encoded by PTGES2), for example, is a functional interactor of Nsp7 from SARS-CoV-1, SARS-CoV-2 and MERS-CoV. Other dependency factors were specific to SARS-CoV-2, including interleukin-17 receptor A (IL17RA), which interacts with SARS-CoV-2 Orf8. Dependency factors that are shared interactors between SARS-CoV-1 and SARS-CoV-2, such as the aforementioned sigma-1 (SIGMAR1) which interacts with Nsp6, and the mitochondrial import receptor subunit Tom70 (TOMM70) which interacts with Orf9b, were also identified.

    [0484] SARS Orf9b Interacts with Tom70

    [0485] The mitochondrial outer membrane protein Tom70 (encoded by TOMM70) is a high-confidence interactor of Orf9b in both SARS-CoV-1 and SARS-CoV-2 interactomes (FIG. 16A) and a putative interactor of MERS-CoV Nsp2 with an observed interaction that falls below the scoring threshold. TOMM70 knockout in Caco-2 cells led to a significant decrease in viral titers upon SARS-CoV-2 infection, suggesting that Tom70 acts as a host dependency factor (FIG. 16B). Tom70 is one of the major import receptors in the TOM complex that recognizes and mediates the translocation of mitochondrial preproteins from the cytosol into the mitochondria in a chaperone dependent manner (J. C. Young, et al., Molecular chaperones Hsp90 and Hsp70 deliver preproteins to the mitochondrial import receptor Tom70. Cell. 112, 41-50 (2003)). Additionally, Tom70 is involved in the activation of MAVS-dependent antiviral signaling and apoptosis upon virus infection (R. Lin, et al., Tom70 imports antiviral immunity to the mitochondria. Cell Res. 20, 971-973 (2010); B. Wei, Tom70 mediates Sendai virus-induced apoptosis on mitochondria. J. Virol. 89, 3804-3818 (2015)).

    [0486] Referring to FIG. 16A, Orf9b-Tom70 interaction is conserved between SARS-CoV-1 and SARS-CoV-2.

    [0487] Referring to FIG. 16B, viral titers in Caco-2 cells after CRISPR knockout of TOMM70 or controls is shown.

    [0488] Referring to FIG. 16C, co-immunoprecipitation of endogenous Tom70 with Strep-tagged Orf9b from SARS-CoV-1 and SARS-CoV-2, Nsp2 from SARS-CoV-1, SARS-CoV-2, and MERS-CoV, or vector control in HEK293T cells is shown. Representative blots of whole cell lysates and eluates after IP are shown.

    [0489] Referring to FIG. 16D, size exclusion chromatography traces (10/300 S200 Increase) of Orf9b alone, Tom70 alone, and co-expressed Orf9b-Tom70 complex purified from recombinant expression in E. coli are shown. Insert shows SDS-PAGE of the complex peak indicating presence of both proteins.

    [0490] Referring to FIG. 16E, immunostainings for Tom70 in HeLaM cells transfected with GFP-Strep and Orf9b from SARS-CoV-1 and SARS-CoV-2 (left) and mean fluorescence intensity±SD values of Tom70 in GFP-Strep and Orf9b expressing cells (normalized to nontransfected cells; right) are shown.

    [0491] Referring to FIG. 16F, flag-Tom70 expression levels in total cell lysates of HEK293T cells upon titration of co-transfected Strep-Orf9b from SARS-CoV-1 and SARS-CoV-2 are shown.

    [0492] Referring to FIG. 16G, immunostaining for Orf9b and Tom70 in Caco-2 cells infected with SARS-CoV-2 (left) and mean fluorescence intensity±SD values of Tom70 in uninfected and SARS-CoV-2 infected cells (right) is shown. SARS2=SARS-CoV-2; SARS1=SARS-CoV-1; MERS=MERS-CoV; IP=immunoprecipitation. **p<0.05. B, E, G, Student's t-test. E, scale bar=10 μm.

    [0493] To validate the interaction between viral proteins and Tom70, a co-immunoprecipitation experiment was performed in the presence or absence of Strep-tagged Orf9b from SARS-CoV-1 and SARS-CoV-2 as well as Strep-tagged Nsp2 from all three CoVs. Endogenous Tom70, but not other translocase proteins of the outer membrane including Tom20, Tom22, and Tom40, co-precipitated only in the presence of Orf9b in both HEK293T and A549 cells, confirming the AP-MS data and suggesting that Orf9b specifically interacts with Tom70 (FIG. 16C and FIG. 17A). Further, upon co-expression in bacterial cells, it was possible to co-purify the Orf9b-Tom70 protein complex, indicating a high degree of stability (FIG. 16D). It was found that SARS-CoV-1 and SARS-CoV-2 Orf9b expressed in HeLaM cells co-localized with Tom70 (FIG. 16E), and it was observed that SARS-CoV-1 or SARS-CoV-2 Orf9b overexpression led to decreases in Tom70 expression (FIG. 16F). Similarly, Orf9b was found to co-localize with Tom70 upon SARS-CoV-2 infection (FIG. 16G). This is in agreement with the known outer mitochondrial membrane localization of Tom70 (A. M. Edmonson, et al., Characterization of a human import component of the mitochondrial outer membrane, TOMM70A. Cell Commun. Adhes. 9, 15-27 (2002)), and Orf9b localization to mitochondria upon over-expression and during SARS-CoV-2 infection (FIG. 6B). A decreases in Tom70 expression was also seen during SARS-CoV-2 infection (FIG. 16G) but did not see dramatic changes in expression levels of the mitochondrial protein Tom20 after individual Strep-Orf9b expression or upon SARS-CoV-2 infection (FIG. 17B-C).

    [0494] Referring to FIG. 17A, co-immunoprecipitation between Strep-Orf9b and endogenous Tom70 is shown. A549 cells were transfected with Strep-tagged Orf9b from SARS-CoV-1 and SARS-CoV-2 along with Nsp2 from MERS-CoV. IP was performed using anti-Strep beads and representative immunoblots of whole cell lysates and eluates are shown.

    [0495] Referring to FIG. 17B, immunostained images of SARS-CoV-2 Orf9b-expressing HeLaM cells stained for Tom20 and Strep-Orf9b (left) are shown. Mean fluorescence intensity±SD values of Tom20 in GFP-Strep and Orf9b expressing cells (normalized to non-transfected cells; right).

    [0496] Referring to FIG. 17C, representative immunostained images of Orf9b and Tom20 upon SARS-CoV-2 infection are shown. IP=immunoprecipitation; SD=standard deviation.

    [0497] CryoEM Structure of Orf9b-Tom70 Complex Reveals Orf9b Interacting at the Substrate Binding Site of Tom70

    [0498] Tom70 preferentially binds preproteins with internal hydrophobic targeting sequences (J. Brix, et al., Differential recognition of preproteins by the purified cytosolic domains of the mitochondrial import receptors Tom20, Tom22, and Tom70. J Biol. Chem. 272, 20730-20735 (1997)). It contains an N-terminal transmembrane domain and tetratricopeptide repeat (TPR) motifs in its cytosolic segment. The C-terminal TPR motifs recognize the internal mitochondrial targeting signals (MTS) of preproteins, and the N-terminal TPR clamp domain serves as a docking site for multi-chaperone complexes that contain preprotein (J. Brix, et al., The mitochondrial import receptor Tom70: identification of a 25 kDa core domain with a specific binding site for preproteins. J. Mol. Biol. 303, 479-488 (2000); R. D. Mills, et al., Domain organization of the monomeric form of the Tom70 mitochondrial import receptor. J. Mol. Biol. 388, 1043-1058 (2009)). To further understand the molecular details of Orf9b-Tom70 interactions, a 3 Å cryoEM structure of the Orf9b-Tom70 complex was obtained (FIG. 18A and FIG. 19A-C). Interestingly, although purified proteins failed to interact upon attempted in vitro complex reconstitution, they yielded a stable and pure complex when co-expressed in E. coli (FIG. 16D). This may be due to the fact that Orf9b alone purifies as a dimer (as inferred by the apparent molecular weight on size exclusion chromatography) and would need to dissociate to interact with Tom70 based on the structure. Obtained cryoEM density allowed for atomic models to be built for residues 109-600 of human Tom70 and residues 39-76 of SARS-CoV-2 Orf9b (FIG. 18A and Table 11). Orf9b makes extensive hydrophobic interactions at the pocket on Tom70 that has been implicated in its binding to MTS, with the total buried surface area at the interface being quite extensive, approximately 2000 A.sup.2 (FIG. 18B). In addition to the mostly hydrophobic interface, four salt bridges further stabilize the interaction (FIG. 18C). Upon interaction with Orf9b, the interacting helices on Tom70 move inward to tightly wrap around Orf9b as compared to previously crystallized yeast Tom70 homologs. No structure for human Tom70 without a substrate has been reported to date and therefore it cannot be ruled out that the conformational differences are due to differences between homologs. However, it is possible that this conformational change upon substrate binding is conserved across homologs as many of the Tom70 residues interacting with Orf9b are highly conserved, likely indicating residues essential for endogenous MTS substrate recognition.

    [0499] Referring to FIG. 18A, a surface representation of the Orf9b-Tom70 structure. Tom70 is depicted as molecular surface in green, Orf9b is depicted as ribbon in orange. Region in charcoal indicates Hsp70/Hsp90 binding site on Tom70, is shown.

    [0500] Referring to FIG. 18B, a magnified view of Orf9b-Tom70 interactions with interacting hydrophobic residues on Tom70 is indicated and shown in spheres. The two phosphorylation sites on Orf9b, S50 and S53, are shown in yellow.

    [0501] Referring to FIG. 18C, ionic interactions between Tom70 and Orf9b are depicted as sticks. Highly conserved residues on Tom70 making hydrophobic interactions with Orf9b are depicted as spheres.

    [0502] Referring to FIG. 19A, a cryoEM density (weighted by FSC and sharpened with a B-factor of −145) of Orf9b-Tom70 complex with the built atomic models depicted as ribbon is shown. Tom70 is in green, Orf9b is in orange.

    [0503] Referring to FIG. 19B, a magnified view of the cryoEM density just around Orf9b indicated in sticks showing a good agreement between the density and the model is shown.

    [0504] Referring to FIG. 19C, a gold standard Fourier shell correlation of the resulting reconstruction as output by cryosparc software package is shown.

    TABLE-US-00029 TABLE 11 Orf9b-TOM70 (EMDB-XXXX) (PDB XXXX) Data collection and processing Magnification 105,000× Voltage (kV) 300 Electron exposure (e−/Å.sup.2) 66 Dose rate (e−/pix/sec) 8 Defocus range (μm) −0.7 to −2.4 Pixel size (Å) 0.834 (physical) Symmetry imposed C1 Initial particle images (no.) 2,805,121 Final particle images (no.) 178,373 Map resolution (Å) 3.05 FSC threshold 0.143 Map resolution range (Å) 3-4 Refinement Initial model used (PDB code) 3FP3 Model resolution (Å) 3.4 FSC threshold 0.5 Model resolution range (Å) 3-4 Map sharpening B factor (Å2) −145 Model composition Non-hydrogen atoms 4022 Protein residues 505 Ligands N/A B factors (Å2) Protein 60 Ligand N/A R.m.s. deviations Bond lengths (Å) 0.012 (1) Bond angles (°) 1.882 (3) Validation MolProbity score 0.55 Clashscore 0.12 Poor rotamers (%) 0.47 Ramachandran plot Favored (%) 0 Allowed (%) 1.4 Disallowed (%) 98.6

    [0505] Surprisingly, although a previously published crystal structure of SARS-CoV-2 Orf9b revealed that it entirely consists of beta sheets (PDB:6Z4U) (S. D. Weeks, et al., X-ray Crystallographic Structure of Orf9b from SARS-CoV-2 (2020), doi:10.2210/pdb6z4u/pdb), upon binding Tom70 residues 52-68, Orf9b forms a helix (FIG. 18D). This is consistent with the fact that MTS sequences recognized by Tom70 are usually helical, and analysis with the TargetP MTS prediction server revealed a high probability for this region of Orf9b to possess an MTS (FIG. 18E). This shows an incredible structural plasticity in this viral protein where, depending on the binding partner, Orf9b changes between helical and beta strand folds. Furthermore, two infection-driven phosphorylation sites on Orf9b had been identified, S50 and S53 (M. Bouhaddou, et al., The Global Phosphorylation Landscape of SARS-CoV-2 Infection. Cell (2020)), which map to the region on Orf9b buried deep in the Tom70 binding pocket (FIG. 18B, within circle region). S53 contributes two hydrogen bonds to the interaction with Tom70 in this overall hydrophobic region. Therefore, once phosphorylated, it is likely that the Orf9b-Tom70 interaction is weakened. These residues are surface exposed in the dimeric structure of the Orf9b, which could potentially allow phosphorylation to partition Orf9b between Tom70-bound and dimeric populations.

    [0506] Referring to FIG. 18D, a diagram depicting secondary structure comparison of Orf9b as predicted by Jpred server, as visualized in the structure herein, or as visualized in the previously-crystallized dimer structure (PDB:6Z4U) (S. D. Weeks, S. De Graef, A. Munawar, X-ray Crystallographic Structure of Orf9b from SARS-CoV-2 (2020), doi:10.2210/pdb6z4u/pdb) is shown. Pink tubes indicate helices, charcoal arrows indicate beta strands, amino acid sequence for the region visualized in the cryoEM structure is shown on top.

    [0507] Referring to FIG. 18E, predicted probability of possessing an internal MTS as output by TargetP server by serially running N-terminally truncated regions of SARS-CoV-2 Orf9b. Region visualized in the cryoEM structure (amino acids 39-76) overlaps with the highest internal MTS probability region (amino acids 40-50) is shown. MTS=mitochondrial targeting signal.

    [0508] The two binding sites on Tom70—the substrate binding site and the TPR domain that recognizes Hsp70/Hsp90—are known to be conformationally coupled (M. Bouhaddou, et al., The Global Phosphorylation Landscape of SARS-CoV-2 Infection. Cell (2020)); J. Li, et al., Molecular chaperone Hsp70/Hsp90 prepares the mitochondrial outer membrane translocon receptor Tom71 for preprotein loading. J. Biol. Chem. 284, 23852-23859 (2009)). Tom70's interaction with a C-terminal EEVD motif of Hsp90 via the TPR domain is key for its function in the interferon pathway, and induction of apoptosis upon virus infection (B. Wei, et al., Tom70 mediates Sendai virus-induced apoptosis on mitochondria. J Virol. 89, 3804-3818 (2015); X.-Y. Liu, et al., Tom70 mediates activation of interferon regulatory factor 3 on mitochondria. Cell Res. 20, 994-1011 (2010)). It is hypothesized that Orf9b, by binding to the substrate recognition site of Tom70, allosterically inhibits Tom70's interaction with Hsp90 at the TPR domain. Indeed, it can be seen in the structure that R192, a key residue in the interaction with Hsp70/Hsp90, is moved out of position to interact with the EEVD sequence, suggesting that Orf9b may modulate interferon and apoptosis signaling via Tom70 (FIG. 20).

    [0509] Referring to FIG. 20, a magnified view of R192/R200 (human Tom70/yeast Tom71), which is a key interacting residue with the EEVD motif from Hsp70/Hsp90, is shown. The conformation in yeast Tom71 (competent to bind EEVD, PDB:3FP2 (J. Li, X. Qian, J. Hu, B. Sha, Crystal structure of Tom71 complexed with Hsp82 C-terminal fragment (2009)) is shown in lavender. Conformation in our human Tom70 structure is shown in green, indicating that the arginine (R) is moved out of position to hydrogen bond with the glutamate. The EEVD peptide is shown as sticks in blue with the E at the −2 position (where terminal D is position 0) indicated. The cryoEM density is also shown depicting good agreement between the model and the density for R192.

    [0510] Overall, the structure of Orf9b bound to Tom70 visualizes Orf9b in a completely different conformation than previously observed, potentially explaining the pleiotropic functions of this viral protein. In addition to being one of the smallest asymmetric protein complexes resolved at near-atomic resolution by cryoEM, it also clearly places Orf9b at a substrate binding site of Tom70, facilitating informed hypotheses on how Orf9b binding may regulate Tom70.

    [0511] Implications of the Orf8-IL17RA Interaction for COVID-19

    [0512] Infectious and transmissible SARS-CoV-2 viruses with large deletions of Orf8 have arisen during the pandemic and have been associated with milder disease and lower concentrations of pro-inflammatory cytokines (B. E. Young, et al., Effects of a major deletion in the SARS-CoV-2 genome on the severity of infection and the inflammatory response: an observational cohort study. Lancet. 396, 603-611 (2020)). Notably, compared to healthy controls, patients infected with wildtype but not Orf8-deleted virus had three-fold elevated plasma levels of IL-17A (B. E. Young, et al., Effects of a major deletion in the SARS-CoV-2 genome on the severity of infection and the inflammatory response: an observational cohort study. Lancet. 396, 603-611 (2020)). It was found that IL-17 receptor A (IL17RA) physically interacts with Orf8 from SARS-CoV-2, but not SARS-CoV-1 or MERS-CoV (FIG. 21A). Furthermore, knockdown of IL17RA or IL-17A treatment led to significant decreases in SARS-CoV-2 viral replication in A549-ACE2 cells (FIG. 21B-D). Regardless of whether IL-17A treatment occurred on cells before or after Orf8 plasmid transfection, or on bulk cell protein lysate, IL17RA was consistently and robustly found to immunoprecipitate with Orf8 in overexpression experiments, suggesting that IL-17A signaling or ligation to IL17RA does not disrupt the interaction with Orf8 (FIG. 21E).

    [0513] Referring to FIG. 21A, IL17RA is a functional interactor of SARS-CoV-2 Orf8. Only interactors identified in the genetic screening are shown.

    [0514] Referring to FIG. 21B, viral titers of after IL17RA or control knockdown in A549-ACE2 cells are shown.

    [0515] Referring to FIG. 21C, viral gene E RNA expression after infection with indicated agents in A549-ACE2 cells is shown.

    [0516] Referring to FIG. 21D, CXCL8 mRNA expression after infection with indicated agents in A549-ACE2 cells. Plots represent 2 biological replicates with 3 technical replicates each.

    [0517] Referring to FIG. 21E, co-immunoprecipitation of endogenous IL17RA with Strep-tagged Orf8 or EGFP with or without IL-17A treatment at different times is shown. Overexpression was done in HEK293T cells.

    [0518] Referring to FIG. 21F, odds ratio of membership in indicated cohorts by genetically-predicted sIL17RA levels. SARS2=SARS-CoV-2; IP=immunoprecipitation; SD=standard deviation; OR=odds ratio; CI=confidence interval; sIL17RA=soluble IL17RA. *=p<0.05, **=p<0.005, ****=p<0.00005. B, unpaired t-test; C-D, one-way ANOVA relative to untreated control condition with Dunnet multiple comparison correction. Error bars in B-D indicate SD; in F they indicate 95% CI.

    [0519] Orf8 may use its physical interaction with IL17RA to modulate IL-17 signaling systemically, which may not be readily detectable in in vitro epithelial cell monoculture experiments. One manner in which IL-17 signaling is regulated is through the release of the extracellular domain as soluble IL17RA (sIL17RA), which acts as a decoy receptor in circulation and inhibits IL-17 signalling (M. Zaretsky, et al., Directed evolution of a soluble human IL-17A receptor for the inhibition of psoriasis plaque formation in a mouse model. Chem. Biol. 20, 202-211 (2013)). Production of sIL17RA has been demonstrated by alternative splicing in cultured cells (Identification of a soluble isoform of human IL-17RA generated by alternative splicing. Cytokine. 64, 642-645 (2013)), but the mechanism by which IL17RA is shed in vivo remains unclear (Biological functions and therapeutic opportunities of soluble cytokine receptors. Cytokine Growth Factor Rev. (2020)). ADAM family proteases—including dependency factor ADAM9—are known to mediate the release of other interleukin receptors into their soluble form (M. Sammel, et al., Differences in Shedding of the Interleukin-11 Receptor by the Proteases ADAM9, ADAM10, ADAM17, Meprin α, Meprin β and MT1-MMP. Int. J. Mol. Sci. 20, 3677 (2019)). Interestingly, it was found that SARS-CoV-2 Orf8 interacted with both ADAM9 and ADAMTS1 in a previous study (D. E. Gordon, et al. Nature (2020)). In order to test the in vivo relevance of sIL17RA in modulating SARS-CoV-2 infection, the largest proteomic genome-wide association study (GWAS) to date was used, which identified 14 single nucleotide polymorphisms (SNPs) near the IL17RA gene that causally regulate sIL17RA plasma levels (B. B. Sun, Jet al., Genomic atlas of the human plasma proteome. Nature. 558, 73-79 (2018)). Then, generalized summary-based Mendelian randomization (GSMR) was used (B. B. Sun, Jet al., Genomic atlas of the human plasma proteome. Nature. 558; Z. Zhu, et al., Causal associations between risk factors and common diseases inferred from GWAS summary data. Nat. Commun. 9, 224 (2018)) on the curated GWAS datasets of the COVID-19 Host Genetics Initiative (COVID-HGI) (C. Huang, et al., The COVID-19 Host Genetics Initiative, a global initiative to elucidate the role of host genetic factors in susceptibility and severity of the SARS-CoV-2 virus pandemic. Eur. J Hum. Genet. 28, 715-718 (2020)) and it was observed that increased predicted sIL17RA plasma levels were associated with lower risk of COVID-19 when compared to the population (FIG. 21F and Table 12A-B). Similar results were obtained when comparing only hospitalized COVID-19 patients to the population. However, there was no evidence of association in hospitalized versus non-hospitalized COVID-19 patients. Though the COVID-HGI dataset is underpowered and this observation needs to be replicated in other cohorts, the evidence suggests that genetically-predicted higher sIL17RA levels may be associated with disease susceptibility, but not necessarily disease severity amongst symptomatic individuals. Overall, this is consistent with the improved clinical outlook for infections with Orf8-deleted virus.

    TABLE-US-00030 TABLE 12A Column Definition Comparison Indication of which comparison in FIG. 8F is being described Case Phenotype definition of case as established in COVID-HGI definition “Phenotype defnitions for analyses v 2.0” found here: https://docs.google.com/document/d/ 1okamrqYmJfa35ClLvCt_vEe4PkvrTwggHq7T3jbeyCI/edit Case n Number of individuals in the case cohort Control Phenotype definition of case as established in COVID-HGI definition “Phenotype defnitions for analyses v 2.0” found here: https://docs.google.com/document/d/ 1okamrqYmJfa35ClLvCt_vEe4PkvrTwggHq7T3jbeyCI/edit Control n Number of individuals in the control cohort n SNPs number of cis-acting IL17RA pQTL SNPs analyzed p p value of comparison OR Odds ratio of comparison LCI Lower bound of the 95% confidence interval UCI Upper bound of the 95% confidence interval

    TABLE-US-00031 TABLE 12B Case Case Control Control Comparison definition n definition n nSNPs p OR LCI UCI hospitalized_covid_vs_pop- Hospitalized 3199 Everybody 897488 12 0.0371043 0.92008134 0.85077536 0.99503313 ulation laboratory that is confirmed not a case, SARS-CoV- e.g. 2 infection population (RNA and/or serology based) OR hospitalization due to corona- related symptoms. covid_vs_population Individuals 6696 Everybody 1073072 14 0.00586206 0.93156836 0.88576034 0.97974539 with laboratory that is confirmation not a case, of SARS-CoV- e.g. 2 infection population (RNA and/or serology based) OR EHR/ICD coding/ Physician Confirmed COVID-19 OR self-reported COVID-19 positive (e.g. by questionnaire) hospital- Hospitalized 928 Laboratory 2028 13 0.965391 1.003398 0.86084471 1.16955768 ized_covid_vs_not_hos- laboratory confirmed pitalized_covid confirmed SARS-CoV- SARS-CoV- 2 infection 2 infection (RNA and/or (RNA and/or serology serology based) based) OR AND not hospitalization hospitalised due to corona- 21 days after related the test. symptoms.

    [0520] Investigation of Druggable Targets Identified as Interactors of Multiple Coronaviruses

    [0521] The identification of druggable host factors provides a rationale for drug repurposing efforts. Given the extent of the current pandemic, real-world data can now be used to study the outcome of COVID-19 patients coincidentally treated with host factor-directed, FDA-approved therapeutics. Using medical billing data, 738,933 patients in the United States with documented SARS-CoV-2 infection were identified. In this cohort, the use of drugs against targets identified here that were shared across coronavirus strains was probed, and found to be functionally relevant in the genetic perturbation screens. In particular, outcomes for an inhibitor of prostaglandin E synthase type 2 (PGES-2, encoded by PTGES2) and for ligands of sigma non-opioid receptor 1 (sigma-1, encoded by SIGMAR1) were analyzed, and whether these patients fared better than carefully-matched patients treated with clinically-similar drugs that do not act on coronavirus host factors was investigated.

    [0522] PGES-2, an interactor of Nsp7 from all three viruses (FIG. 15D), is a dependency factor for SARS-CoV-2 (FIG. 4F). It is inhibited by the FDA-approved prescription nonsteroidal anti-inflammatory drug (NSAID) indomethacin. Computational docking of Nsp7 and PGES-2 to predict binding configuration showed that the dominant cluster of models localizes Nsp7 adjacent to the PGES-2-indomethacin binding site (FIG. 20A-C). However, indomethacin did not inhibit SARS-CoV-2 in vitro at reasonable antiviral concentrations (FIG. 22A-E). A previous study also found that similarly high levels of the drug were needed for inhibition of SARS-CoV-1 in vitro, but still showed efficacy for indomethacin against canine coronavirus in vivo (C. Amici, et al., Indomethacin has a potent antiviral activity against SARS coronavirus. Antivir. Ther. 11, 1021-1030 (2006)). This provided motivation to observe outcomes in a cohort of outpatients with confirmed SARS-CoV-2 infection who by happenstance initiated a course of indomethacin, as compared to those who initiated the prescription NSAID celecoxib, which lacks anti-PGES-2 activity. The odds of hospitalization were compared by risk-set sampling (RSS) patients treated at the same time and at similar levels of disease severity and then further matching on propensity score (PS) (P. R. Rosenbaum, D. B. Rubin, The central role of the propensity score in observational studies for causal effects. Biometrika. 70, 41-55 (1983)) (FIG. 23A and Table 7A-I). This new user, active comparator design mimics the interventional component of prospective clinical studies. Relative to celecoxib, indomethacin treatment showed a strong trend towards improved outcomes (FIG. 23B). In sensitivity analysis, neither using the larger, risk-set-sampled cohort nor relaxing the outcome definition to include any hospital visit appreciably changed the trend that was initially observed, but it did increase the significance of the observation: SARS-CoV-2-positive, new users of indomethacin in the outpatient setting were less likely than matched new users of celecoxib to require hospitalization or inpatient services. While it is important to acknowledge that this is a small, non-interventional study, it is nonetheless a powerful example of how molecular insight can rapidly generate testable clinical hypotheses and help prioritize candidates for prospective clinical trials or future drug development.

    [0523] Referring to FIG. 22A, SARS-CoV-2 replication in Caco-2 cells after knockout of PTGES2 or controls is shown.

    [0524] Referring to FIG. 22B, SARS-CoV-2 replication in A549-ACE2 cells or Caco-2 cells after knockdown and knockout, respectively, of SIGMAR1, SIGMAR2 (TMEM97) or controls is shown.

    [0525] Referring to FIG. 22C, antiviral activity of amiodarone against SARS-CoV-2 (left) and SARS-CoV-1 (right) in Vero E6 cells is shown.

    [0526] Referring to FIG. 22D, clinically-approved sigma receptor-targeting drugs with verified anti-SARS-CoV-2 activity by clinical drug class are shown. Heatmap indicates, from top to bottom: pIC50 (−log 10[IC50]) of the drug against SARS-CoV-2; reported pKi (−log 10[Ki]) of the drug against sigma-1 receptor; reported pKi of the drug against sigma-2 receptor. SARS-CoV-2 IC50 was determined in A549-ACE2 cells or in Vero E6 cells where indicated by a black border. Grey boxes indicate no value was reported in the literature.

    [0527] Referring to FIG. 22E, performance of representative clinical drugs against SARS-CoV-2 in vitro in A549-ACE2 cells is shown. Error bars indicate standard deviation.

    [0528] Referring to FIG. 23A, a schematic of retrospective real-world clinical data analysis of indomethacin use for outpatients with SARS-CoV-2 is shown. Plots show distribution of propensity scores for all included patients (red, indomethacin users; blue, celecoxib users). For a full list of inclusion, exclusion, and matching criteria see Table 7A-I.

    [0529] Referring to FIG. 23B, the effectiveness of indomethacin vs. celecoxib in patients with confirmed SARS-CoV-2 infection treated in an outpatient setting is shown. Average standardized absolute mean difference (ASAMD) is a measure of balance between indomethacin and celecoxib groups calculated as the mean of the absolute standardized difference for each propensity score factor (Table 7A-I); p-value and odds ratios with 95% CI are estimated using the Aetion Evidence Platform r4.6. No ASAMD was greater than 0.1.

    [0530] To create larger patient cohorts, drugs that shared activity against the same target, sigma receptors, were grouped. Sigma-1 and sigma-2 were previously identified as drug targets in the SARS-CoV-2-human protein-protein interaction map and multiple potent, non-selective sigma ligands were among the most promising inhibitors of SARS-CoV-2 replication in Vero E6 cells (D. E. Gordon, et al. Nature (2020)). As shown above, knockout and knockdown of SIGMAR1, but not SIGMAR2 (also known as TMEM97), led to robust decreases in SARS-CoV-2 replication (FIG. 4F and FIG. 22A-E), suggesting that sigma-1 may be a key therapeutic target. SIGMARJ sequences were analyzed across 359 mammals, and positive selection of several residues was observed within beaked whale, mouse, and ruminant lineages, which may indicate a role in host-pathogen competition (FIG. 24). Additionally, the sigma ligand drug amiodarone inhibited SARS-CoV-1 as well as SARS-CoV-2, consistent with the conservation of the Nsp6-sigma-1 interaction across the SARS viruses (FIG. 15D and FIG. 22A-E). Then, a search for other FDA-approved drugs with reported nanomolar affinity for sigma receptors or that fit the sigma ligand chemotype was conducted (D. E. Gordon, et al. Nature (2020); C. Abate, et al., A structure-affinity and comparative molecular field analysis of sigma-2 (sigma2) receptor ligands. Cent. Nerv. Syst. Agents Med. Chem. 9, 246-257 (2009); R. A. Glennon, Sigma receptor ligands and the use thereof. US Patent (2000), (available at https://patentimages.storage.googleapis.com/dc/36/68/73f4ccdac4c973/U.S. Pat. No. 6,057,371.pdf); R. R. Matsumoto, B. Pouw, Correlation between neuroleptic binding to sigma(1) and sigma(2) receptors and acute dystonic reactions. Eur. J. Pharmacol. 401, 155-160 (2000); M. Dold, et al., Haloperidol versus first-generation antipsychotics for the treatment of schizophrenia and other psychotic disorders. Cochrane Database Syst. Rev. 1, CD009831 (2015); F. F. Moebius, et al., Pharmacological analysis of sterol delta8-delta7 isomerase proteins with [3H]ifenprodil. Mol. Pharmacol. 54, 591-598 (1998); E. Gregori-Puigjané, et al.t, Identifying mechanism-of-action targets for drugs and probes. Proc. Natl. Acad. Sci. U S. A. 109, 11178-11183 (2012); Z. Hubler, et al., Accumulation of 8,9-unsaturated sterols drives oligodendrocyte formation and remyelination. Nature. 560, 372-376 (2018); F. F. Moebius, et al., High affinity of sigma 1-binding sites for sterol isomerization inhibitors: evidence for a pharmacological relationship with the yeast sterol C8-C7 isomerase. Br. J. Pharmacol. 121, 1-6 (1997)), and 12 such therapeutics were selected. It was found that all are potent inhibitors of SARS-CoV-2 with IC.sub.50 values under 10 μM, though it is important to note that a wide range in sigma receptor affinity is seen, with no clear correlation between sigma receptor binding affinity and antiviral activity (FIG. 22D). Several clinical drug classes were represented by more than one candidate, including typical antipsychotics and antihistamines. Over-the-counter antihistamines are not well represented in medical billing data and are therefore poor candidates for real-world analysis, but users of typical antipsychotics can be easily identified in the patient cohort. By grouping these individual drug candidates by clinical indication, a better-powered comparison was built.

    [0531] Referring to FIG. 24, Benjamini-Hochberg-corrected p-values (y-axis) for accelerated (blue circles) or conserved (green Xs) evolution at codons in SIGMAR1 in the denoted lineages relative to the neutral rate in mammals are shown.

    [0532] A cohort for retrospective analysis on new, inpatient users of antipsychotics was constructed. In inpatient settings, typical and atypical antipsychotics are used similarly, most commonly for delirium. The effectiveness of typical antipsychotics, which have sigma activity and antiviral effects, versus atypical antipsychotics, which are not predicted to, was compared for treatment of COVID-19 (FIG. 23C). Observing mechanical ventilation outcomes in inpatient cohorts is a proxy for worsening of severe illness, rather than the progression from mild disease signified by the hospitalization of indomethacin-exposed outpatients above. RSS plus PS was again employed to build a robust, directly comparable cohort of inpatients (Table 7A-I). In the primary analysis, half as many new users of the sigma-ligand typical antipsychotics compared to new users of atypical antipsychotics progressed to the point of requiring mechanical ventilation, demonstrating significantly lower propensity with an odds ratio (OR) of 0.46 (95% CI=0.23-0.93, p=0.03, FIG. 23D). As above, a sensitivity analysis was conducted in the RSS-only cohort, and the same trend observed (OR=0.56, 95% CI=0.31-1.02, p=0.06), emphasizing the primary result of a beneficial effect for typical versus atypical antipsychotics observed in the RSS-plus-PS-matched cohort. Although a careful analysis of the relative benefits and risks of typical antipsychotics should be undertaken before considering prospective studies or interventions, these data and analysis demonstrate how molecular information can be translated into real-world implications for the treatment of COVID-19, an approach that can ultimately be applied to other diseases in the future.

    [0533] Referring to FIG. 23C, a schematic of retrospective real-world clinical data analysis of typical antipsychotic use for inpatients with SARS-CoV-2 is shown. Plots show distribution of propensity scores for all included patients (red, typical users; blue, atypical users). For a full list of inclusion, exclusion, and matching criteria see Table 7A-I.

    [0534] Referring to FIG. 23D, the effectiveness of typical vs. atypical antipsychotics among hospitalized patients with confirmed SARS-CoV-2 infection treated inhospital is shown. Average standardized absolute mean difference (ASAMD) is a measure of balance between typical and atypical groups calculated as the mean of the absolute standardized difference for each propensity score factor (Table 7A-I); p-value and odds ratios with 95% CI are estimated using the Aetion Evidence Platform r4.6. No ASAMD was greater than 0.1.

    Discussion

    [0535] In this study, three different coronavirus-human protein-protein interaction maps were generated and compared in an attempt to identify and understand pan-coronavirus molecular mechanisms. The use of a quantitative differential interaction scoring (DIS) approach permitted the identification of virus-specific as well as shared interactions among distinct coronaviruses. Subcellular localization analysis was also systemically carried out using tagged viral proteins as well as antibodies targeting specific SARS-CoV-2 proteins.

    [0536] These data were integrated with genetic data where the interactions uncovered with SARS-CoV-2 were perturbed using RNAi and CRISPR in different cellular systems and viral assays, an effort that functionally connected many host factors to infection. One of these, Tom70, which has been shown to bind to Orf9b from both SARS-CoV-1 and SARS-CoV-2, is a mitochondrial outer membrane translocase that has been previously shown to be important for mounting an interferon response (H.-W. Jiang, et al., SARS-CoV-2 Orf9b suppresses type I interferon responses by targeting TOM70. Cell. Mol. Immunol. 17, 998-1000 (2020)). These functional data, however, show that Tom70 has at least some role in promoting infection rather than inhibiting it. Using cryoEM, a 3 Å structure of a region of Orf9b binding to the active site of Tom70 was obtained. Remarkably, it was found that Orf9b is in a drastically different conformation than previously visualized. This offers the possibility that Orf9b may partition between two distinct structural states in the cells, with each possessing a different function and possibly explaining its potential functional pleiotropy. The exact details of functional significance and regulation of the Orf9b-Tom70 interaction await further experimental elucidation. This interaction, however, which is conserved between SARS-CoV-1 and SARS-CoV-2, could have value as a pan-coronavirus therapeutic target.

    [0537] Finally, an attempt to connect the in vitro molecular data to clinical information available for COVID-19 patients was made to understand the pathophysiology of COVID-19 and explore new therapeutic avenues. To this end, using GWAS datasets of the COVID-19 Host Genetics Initiative (C. Huang, et al., The COVID-19 Host Genetics Initiative, a global initiative to elucidate the role of host genetic factors in susceptibility and severity of the SARS-CoV-2 virus pandemic. Eur. J. Hum. Genet. 28, 715-718 (2020)), it was observed that increased predicted sIL17RA plasma levels were associated with lower risk of COVID-19. Interestingly, it was found that IL17RA physically binds to SARS-CoV-2 Orf8 and genetic disruption results in decreased infection. Without wishing to be bound by theory, these collective data suggest that future studies should be focused on this pathway as both an indicator and therapeutic target for COVID-19. Furthermore, using medical billing data, trends in COVID-19 patients on specific drugs indicated by the molecular studies were also observed. For example, inpatients prescribed sigma-ligand typical antipsychotics seemingly have better COVID-19 outcomes when compared to users of atypical antipsychotics, which do not bind to sigma-1. It is uncertain whether sigma receptor interaction is the mechanism underpinning this effect, as typical antipsychotics are known to bind to a multitude of cellular targets. Replication in other patient cohorts and further work will be needed to see if there is therapeutic value in these connections, but at the very least a strategy has been demonstrated wherein protein network analyses can be used to make testable predictions from real-world, clinical information.

    [0538] Overall, an integrative and collaborative approach to study and understand pathogenic coronavirus infection is described, identifying conserved targeted mechanisms that are likely to be of high relevance for other viruses of this family. Proteomics, cell biology, virology, genetics, structural biology, biochemistry, and clinical and genomic information was used in an attempt to provide a holistic view of SARS-CoV-2 and other coronaviruses' interactions with infected host cells. Without wishing to be bound by theory, it is proposed that such an integrative and collaborative approach could and should be used to study other infectious agents as well as other disease areas.

    Additional Exemplifications

    [0539] In some embodiments, it is envisioned that the methods and systems disclosed herein can be used on a variety of different diseases, uncovering new biology and ultimately novel targets as well as new drugs. For example, the integrated suite of technologies disclosed herein will be focused on neurodegenerative diseases (e.g., Parkinsons disease, Amyotrophic Lateral Sclerosis, Alzheimer's disease) and neuropsychiatric disorders (e.g., autism, schizophrenia, obsessive compulsive disorder, depression). A number of cancers will also be studied, including lung, brain, and pancreatic cancers. Finally, additional efforts will be placed on pathogens, both bacterial and viral, with a focus on coronaviruses and other viruses that could result in future pandemics.

    [0540] Exemplary genes and cell lines that can be utilized in focusing on neurodegenerative diseases are listed in Table 13A and Table 13B, respectively.

    TABLE-US-00032 TABLE 13A GenBank ID or Indication Gene Ensembl ID Amyotrophic Lateral Sclerosis SOD1 6647 (ALS) Amyotrophic Lateral Sclerosis ALS2 57679 (ALS) Amyotrophic Lateral Sclerosis SETX 23064 (ALS) Amyotrophic Lateral Sclerosis SPG11 80208 (ALS) Amyotrophic Lateral Sclerosis FUS 2521 (ALS) Amyotrophic Lateral Sclerosis VAPB 9217 (ALS) Amyotrophic Lateral Sclerosis ANG 283 (ALS) Amyotrophic Lateral Sclerosis TARDBP 23435 (ALS) Amyotrophic Lateral Sclerosis FIG4 9896 (ALS) Amyotrophic Lateral Sclerosis OPTN 10133 (ALS) Amyotrophic Lateral Sclerosis ATXN2 6311 (ALS) Amyotrophic Lateral Sclerosis VCP 7415 (ALS) Amyotrophic Lateral Sclerosis UBQLN2 29978 (ALS) Amyotrophic Lateral Sclerosis SIGMAR1 10280 (ALS) Amyotrophic Lateral Sclerosis CHMP2B 25978 (ALS) Amyotrophic Lateral Sclerosis PFN1 5216 (ALS) Amyotrophic Lateral Sclerosis ERBB4 2066 (ALS) Amyotrophic Lateral Sclerosis HNRNPA1 3178 (ALS) Amyotrophic Lateral Sclerosis MATR3 9782 (ALS) Amyotrophic Lateral Sclerosis TUBA4A 7277 (ALS) Amyotrophic Lateral Sclerosis ANXA11 311 (ALS) Amyotrophic Lateral Sclerosis NEK1 4750 (ALS) Amyotrophic Lateral Sclerosis C9orf72 203228 (ALS) Amyotrophic Lateral Sclerosis CHCHD10 400916 (ALS) Amyotrophic Lateral Sclerosis SQSTM1 8878 (ALS) Alzheimer's disease (AD) APOE 348 Alzheimer's disease (AD) CD2AP 23607 Alzheimer's disease (AD) ABCA7 10347 Alzheimer's disease (AD) CLU 1191 Alzheimer's disease (AD) CR1 1378 Alzheimer's disease (AD) PICALM 8301 Alzheimer's disease (AD) PLD3 23646 Alzheimer's disease (AD) TREM2 54209 Alzheimer's disease (AD) SORL1 6653 Alzheimer's disease (AD) APP 351 Alzheimer's disease (AD) PSEN1 5663 Alzheimer's disease (AD) PSEN2 5664 Alzheimer's disease (AD) RUFY1 80230 Alzheimer's disease (AD) PSD2 84249 Alzheimer's disease (AD) TCIRG1 10312 Alzheimer's disease (AD) RIN3 79890 Alzheimer's disease (AD) STH 246744 Alzheimer's disease (AD) CLU 1191 Alzheimer's disease (AD) PICALM 8301 Alzheimer's disease (AD) BIN1 274 Alzheimer's disease (AD) EPHA1 2041 Alzheimer's disease (AD) SORL1 6653 Alzheimer's disease (AD) ABI3 51225 Parkinson's Disease (PD) LRRK2 120892 Parkinson's Disease (PD) PINK1 65018 Parkinson's Disease (PD) PRKN 5071 Parkinson's Disease (PD) SNCA 6622 Parkinson's Disease (PD) GBA 2629 Parkinson's Disease (PD) UCHL1 7345 Parkinson's Disease (PD) ATP13A2 23400 Parkinson's Disease (PD) VPS35 55737 Parkinson's Disease (PD) PARK3 5072 Parkinson's Disease (PD) DJ-1 11315 Parkinson's Disease (PD) PARK10 170534 Parkinson's Disease (PD) PARK11 26058 Parkinson's Disease (PD) PARK12 677662 Parkinson's Disease (PD) HTRA2 27429 Parkinson's Disease (PD) PLA2G6 8398 Parkinson's Disease (PD) FBX07 25793 Parkinson's Disease (PD) PARK16 100359403 Parkinson's Disease (PD) EIF4G1 1981

    TABLE-US-00033 TABLE 13B Indication Cell Lines Amyotrophic Lateral WC034i-SOD1-D90A Sclerosis (ALS) Amyotrophic Lateral WC035i-SOD1-D90D Sclerosis (ALS) Amyotrophic Lateral Human iPSC-derived neural Sclerosis (ALS) stem cells Amyotrophic Lateral HEK293T Sclerosis (ALS) Alzheimer's disease Human iPSC-derived neural (AD) stem cells Alzheimer's disease HEK293T (AD) Parkinson's Disease Human iPSC-derived neural (PD) stem cells Parkinson's Disease HEK293T (PD)

    [0541] Exemplary genes and cell lines that can be utiliz5d in focusing on neuropsychiatric disorders are listed in Table 14A and Table 14B, respectively.

    TABLE-US-00034 TABLE 14A GenBank ID or Indication Gene Ensembl ID Autism CHD8 57680 Autism SCN2A 6326 Autism SYNGAP1 8831 Autism ADNP 23394 Autism FOXP1 27086 Autism POGZ 23126 Autism ARID1B 57492 Autism SUV420H1 51111 Autism DYRK1A 1859 Autism SLC6A1 6529 Autism GRIN2B 2904 Autism PTEN 5728 Autism SHANK3 85358 Autism MED13L 23389 Autism GIGYF1 64599 Autism CHD2 1106 Autism ANKRD11 29123 Autism ANK2 287 Autism ASH1L 55870 Autism TLK2 11011 Autism DNMT3A 1788 Autism DEAF1 10522 Autism CTNNB1 1499 Autism KDM6B 23135 Autism DSCAM 1826 Autism SETD5 55209 Autism KCNQ3 3786 Autism SRPR 6734 Autism KDM5B 10765 Autism WAC 51322 Autism SHANK2 22941 Autism NRXN1 9378 Autism TBL1XR1 79718 Autism MYTIL 23040 Autism BCL11A 53335 Autism RORB 6096 Autism RAI1 10743 Autism DYNC1H1 1778 Autism DPYSL2 1808 Autism AP2S1 1175 Autism KMT2C 58508 Autism PAX5 5079 Autism MKX 283078 Autism GABRB3 2562 Autism SIN3A 25942 Autism MBD5 55777 Autism MAP1A 4130 Autism STXBP1 6812 Autism CELF4 56853 Autism PHF12 57649 Autism TBR1 10716 Autism PPP2R5D 5528 Autism TM9SF4 9777 Autism PHF21A 51317 Autism PRR12 57479 Autism SKI 6497 Autism ASXL3 80816 Autism SPAST 6683 Autism SMARCC2 6601 Autism TRIP12 9320 Autism CREBBP 1387 Autism TCF4 6925 Autism CACNA1E 777 Autism GNAI1 2770 Autism TCF20 6942 Autism FOXP2 93986 Autism NSD1 64324 Autism TCF7L2 6934 Autism LDB1 8861 Autism EIF3G 8666 Autism PHF2 5253 Autism KIAA0232 9778 Autism VEZF1 7716 Autism GFAP 2670 Autism IRF2BPL 64207 Autism ZMYND8 23613 Autism SATB1 6304 Autism RFX3 5991 Autism SCN1A 6323 Autism PPP5C 5536 Autism TRIM23 373 Autism TRAF7 84231 Autism ELAVL3 1995 Autism GRIA2 2891 Autism LRRC4C 57689 Autism CACNA2D3 55799 Autism NUP155 9631 Autism KMT2E 55904 Autism NR3C2 4306 Autism NACC1 112939 Autism PTK7 5754 Autism PPP1R9B 84687 Autism GABRB2 2561 Autism HDLBP 3069 Autism TAOK1 57551 Autism UBR1 197131 Autism TEK 7010 Autism KCNMA1 3778 Autism CORO1A 11151 Autism HECTD4 283450 Autism NCOA1 8648 Autism DIP2A 23181

    TABLE-US-00035 TABLE 14B Indication Cell Lines Autism HEK293T Autism NPCs

    [0542] Exemplary genes and cell lines that can be utilized in focusing on cancer are listed in Table 15A and Table 15B, respectively.

    TABLE-US-00036 TABLE 15A GenBank ID or Indication Gene Ensembl ID Glioblastoma PTEN ENSG00000171862 Glioblastoma TTN ENSG00000155657 Glioblastoma TP53 ENSG00000141510 Glioblastoma EGFR ENSG00000146648 Glioblastoma FLG ENSG00000143631 Glioblastoma MUC16 ENSG00000181143 Glioblastoma NF1 ENSG00000196712 Glioblastoma RYR2 ENSG00000198626 Glioblastoma PKHD1 ENSG00000170927 Glioblastoma HMCN1 ENSG00000143341 Glioblastoma SYNE1 ENSG00000131018 Glioblastoma SPTA1 ENSG00000163554 Glioblastoma PIK3R1 ENSG00000145675 Glioblastoma RB1 ENSG00000139687 Glioblastoma ATRX ENSG00000085224 Glioblastoma PIK3CA ENSG00000121879 Glioblastoma OBSCN ENSG00000154358 Glioblastoma APOB ENSG00000084674 Glioblastoma FLG2 ENSG00000143520 Glioblastoma LRP2 ENSG00000081479 Glioblastoma USH2A ENSG00000042781 Glioblastoma LAMA1 ENSG00000101680 Glioblastoma PCLO ENSG00000186472 Glioblastoma DNAHS ENSG00000039139 Glioblastoma MUC17 ENSG00000169876 Glioblastoma DNAH3 ENSG00000158486 Glioblastoma COL6A3 ENSG00000163359 Glioblastoma DNAH2 ENSG00000183914 Glioblastoma TRRAP ENSG00000196367 Glioblastoma DST ENSG00000151914 Glioblastoma HRNR ENSG00000197915 Glioblastoma KMT2C ENSG00000055609 Glioblastoma FCGBP ENSG00000275395 Glioblastoma SDK1 ENSG00000146555 Glioblastoma GRIN2A ENSG00000183454 Glioblastoma SYNE2 ENSG00000054654 Glioblastoma AHNAK ENSG00000124942 Glioblastoma RELN ENSG00000189056 Glioblastoma MXRA5 ENSG00000101825 Glioblastoma DNAH8 ENSG00000124721 Glioblastoma DNAH9 ENSG00000007174 Glioblastoma RYR3 ENSG00000198838 Glioblastoma TAF1L ENSG00000122728 Glioblastoma FAT2 ENSG00000086570 Glioblastoma HYDIN ENSG00000157423 Glioblastoma AHNAK2 ENSG00000185567 Glioblastoma EP400 ENSG00000183495 Glioblastoma TMEM132D ENSG00000151952 Glioblastoma IDH1 ENSG00000138413 Glioblastoma DNAH11 ENSG00000105877 Glioblastoma PDZD2 ENSG00000133401 Glioblastoma PDGFRA ENSG00000134853 Glioblastoma DOCK5 ENSG00000147459 Glioblastoma PIK3CG ENSG00000105851 Glioblastoma ADAM29 ENSG00000168594 Glioblastoma FRAS1 ENSG00000138759 Glioblastoma ESPL1 ENSG00000135476 Glioblastoma SACS ENSG00000151835 Glioblastoma FAT4 ENSG00000196159 Glioblastoma CFAP4Z ENSG00000165164 Glioblastoma ANK2 ENSG00000145362 Glioblastoma CSMD2 ENSG00000121904 Glioblastoma RIMS2 ENSG00000176406 Glioblastoma ZNF318 ENSG00000171467 Glioblastoma NOS1 ENSG00000089250 Glioblastoma LRP1 ENSG00000123384 Glioblastoma HCN1 ENSG00000164588 Glioblastoma PKDREJ ENSG00000130943 Glioblastoma VWF ENSG00000110799 Glioblastoma DSP ENSG00000096696 Glioblastoma CNTNAP2 ENSG00000174469 Glioblastoma HSPG2 ENSG00000142798 Glioblastoma TSHZ2 ENSG00000182463 Glioblastoma ZFHX3 ENSG00000140836 Glioblastoma LCT ENSG00000115850 Glioblastoma SPHKAP ENSG00000153820 Glioblastoma ADAMTS12 ENSG00000151388 Glioblastoma UBR4 ENSG00000127481 Glioblastoma KIF2B ENSG00000141200 Glioblastoma RYR1 ENSG00000196218 Glioblastoma GRM3 ENSG00000198822 Glioblastoma LRRK1 ENSG00000154237 Glioblastoma ADGRV1 ENSG00000164199 Glioblastoma SLIT3 ENSG00000184347 Glioblastoma KMT2A ENSG00000118058 Glioblastoma PLCG2 ENSG00000197943 Glioblastoma ANK3 ENSG00000151150 Glioblastoma WBSCR17 ENSG00000185274 Glioblastoma TCHH ENSG00000159450 Glioblastoma MYH2 ENSG00000125414 Glioblastoma MYH11 ENSG00000133392 Glioblastoma NLRP7 ENSG00000167634 Glioblastoma TSHZ3 ENSG00000121297 Glioblastoma PRDM9 ENSG00000164256 Glioblastoma UNC79 ENSG00000133958 Glioblastoma COL1A2 ENSG00000164692 Glioblastoma HERC2P3 ENSG00000180229 Glioblastoma KANK1 ENSG00000107104 Glioblastoma RNF213 ENSG00000173821 Glioblastoma ATP10B ENSG00000118322 Pancreatic KRAS ENSG00000133703 Pancreatic TP53 ENSG00000141510 Pancreatic SMAD4 ENSG00000141646 Pancreatic CDKN2A ENSG00000147889 Pancreatic TTN ENSG00000155657 Pancreatic DNM1P47 ENSG00000259660 Pancreatic MUC16 ENSG00000181143 Pancreatic RNF43 ENSG00000108375 Pancreatic CSMD2 ENSG00000121904 Pancreatic RNF213 ENSG00000173821 Pancreatic RYR1 ENSG00000196218 Pancreatic GLI3 ENSG00000106571 Pancreatic DNAH11 ENSG00000105877 Pancreatic SCNSA ENSG00000183873 Pancreatic OBSCN ENSG00000154358 Pancreatic GNAS ENSG00000087460 Pancreatic ARID1A ENSG00000117713 Pancreatic RREB1 ENSG00000124782 Pancreatic FLG ENSG00000143631 Pancreatic CACNA1B ENSG00000148408 Pancreatic USH2A ENSG00000042781 Pancreatic CSMD3 ENSG00000164796 Pancreatic PCDH15 ENSG00000150275 Pancreatic LRP1B ENSG00000168702 Pancreatic COL6A2 ENSG00000142173 Pancreatic APOB ENSG00000084674 Pancreatic FBN3 ENSG00000142449 Pancreatic SYNE1 ENSG00000131018 Pancreatic MACE1 ENSG00000127603 Pancreatic COL5A1 ENSG00000130635 Pancreatic SDK1 ENSG00000146555 Pancreatic ADAMTS16 ENSG00000145536 Pancreatic ATP10A ENSG00000206190 Pancreatic ZFHX4 ENSG00000091656 Pancreatic TGFBR2 ENSG00000163513 Pancreatic ADAMTS12 ENSG00000151388 Pancreatic KCNA6 ENSG00000151079 Pancreatic KMT2D ENSG00000167548 Pancreatic FAT2 ENSG00000086570 Pancreatic MYO18B ENSG00000133454 Pancreatic HMCN1 ENSG00000143341 Pancreatic HECW2 ENSG00000138411 Pancreatic FAT3 ENSG00000165323 Pancreatic ATM ENSG00000149311 Pancreatic PCDHB7 ENSG00000113212 Pancreatic KIF1A ENSG00000130294 Pancreatic PEG3 ENSG00000198300 Pancreatic PLEC ENSG00000178209 Pancreatic DCHS1 ENSG00000166341 Pancreatic TPO ENSG00000115705 Pancreatic ADGRD1 ENSG00000111452 Pancreatic DSI ENSG00000151914 Pancreatic FLNC ENSG00000128591 Pancreatic PCDHA9 ENSG00000204961 Pancreatic RIMS2 ENSG00000176406 Pancreatic NOS1 ENSG00000089250 Pancreatic KCNB2 ENSG00000182674 Pancreatic LRP1 ENSG00000123384 Pancreatic SSPO ENSG00000197558 Pancreatic RP1 ENSG00000104237 Pancreatic DSCAM ENSG00000171587 Pancreatic MTUS2 ENSG00000132938 Pancreatic RYR3 ENSG00000198838 Pancreatic CSMD1 ENSG00000183117 Pancreatic FN1 ENSG00000115414 Pancreatic NYNG1 ENSG00000162631 Pancreatic RELN ENSG00000189056 Pancreatic MYLK ENSG00000065534 Pancreatic MYO16 ENSG00000041515 Pancreatic KDM6A ENSG00000147050 Pancreatic FLT4 ENSG00000037280 Pancreatic ATR ENSG00000175054 Pancreatic CMYA5 ENSG00000164309 Pancreatic TMEM132D ENSG00000151952 Pancreatic APBA2 ENSG00000034053 Pancreatic ABCA4 ENSG00000198691 Pancreatic MUC17 ENSG00000169876 Pancreatic PCDH9 ENSG00000184226 Pancreatic WDR17 ENSG00000150627 Pancreatic PKD1 ENSG00000008710 Pancreatic COL22A1 ENSG00000169436 Pancreatic PBRM1 ENSG00000163939 Pancreatic SCN9A ENSG00000169432 Pancreatic SORCS2 ENSG00000184985 Pancreatic PTCHD2 ENSG00000204624 Pancreatic MEFV ENSG00000103313 Pancreatic KCNT1 ENSG00000107147 Pancreatic PSG7 ENSG00000221878 Pancreatic NLRP2 ENSG00000022556 Pancreatic POM121L12 ENSG00000221900 Pancreatic CUBN ENSG00000107611 Pancreatic ANK3 ENSG00000151150 Pancreatic NRXN3 ENSG00000021645 Pancreatic ADGRL2 ENSG00000117114 Pancreatic TENM3 ENSG00000218336 Pancreatic ADAMTSL4 ENSG00000143382 Pancreatic AKAP6 ENSG00000151320 Pancreatic DPP6 ENSG00000130226 Pancreatic TRPS1 ENSG00000104447 Pancreatic SACS ENSG00000151835 Lung TP53 ENSG00000141510 Lung TTN ENSG00000155657 Lung MUC16 ENSG00000181143 Lung CSMD3 ENSG00000164796 Lung RYR2 ENSG00000198626 Lung SYNE1 ENSG00000131018 Lung LRP1B ENSG00000168702 Lung USH24 ENSG00000042781 Lung FLG ENSG00000143631 Lung PCLO ENSG00000186472 Lung PIK3CA ENSG00000121879 Lung OBSCN ENSG00000154358 Lung ZFHX4 ENSG00000091656 Lung MUC4 ENSG00000145113 Lung DNAH5 ENSG00000039139 Lung CSMD1 ENSG00000183117 Lung FAT4 ENSG00000196159 Lung FAT3 ENSG00000165323 Lung DST ENSG00000151914 Lung XIRP2 ENSG00000163092 Lung HMCN1 ENSG00000143341 Lung KMT2D ENSG00000167548 Lung RYR1 ENSG00000196218 Lung SPTA1 ENSG00000163554 Lung MUC17 ENSG00000169876 Lung APOB ENSG00000084674 Lung RYR3 ENSG00000198838 Lung MACF1 ENSG00000127603 Lung KRAS ENSG00000133703 Lung PCDH15 ENSG00000150275 Lung NEB ENSG00000183091 Lung ADGRY1 ENSG00000164199 Lung AHNAK2 ENSG00000185567 Lung LRP2 ENSG00000081479 Lung KMT2C ENSG00000055609 Lung DNAH9 ENSG00000007174 Lung PTEN ENSG00000171862 Lung MUC5B ENSG00000117983 Lung DNAH8 ENSG00000124721 Lung ABCA13 ENSG00000179869 Lung CSMD2 ENSG00000121904 Lung DMD ENSG00000198947 Lung DNAH11 ENSG00000105877 Lung PKHD1L1 ENSG00000205038 Lung ARID1A ENSG00000117713 Lung SYNE2 ENSG00000054654 Lung FAT1 ENSG00000083857 Lung DNAH7 ENSG00000118997 Lung ANK2 ENSG00000145362 Lung DNAH3 ENSG00000158486 Lung APC ENSG00000134982 Lung PKHD1 ENSG00000170927 Lung CACNA1E ENSG00000198216 Lung COL6A3 ENSG00000163359 Lung RELN ENSG00000189056 Lung HYDIN ENSG00000157423 Lung AHNAK ENSG00000124942 Lung BRAF ENSG00000157764 Lung CUBN ENSG00000107611 Lung IGHG1 ENSG00000211896 Lung FAM135B ENSG00000147724 Lung NPAP1 ENSG00000185823 Lung NAV3 ENSG00000067798 Lung ZNFS36 ENSG00000198597 Lung COL11A1 ENSG00000060718 Lung ANK3 ENSG00000151150 Lung FCGBP ENSG00000275395 Lung DNAH17 ENSG00000187775 Lung PAPPA2 ENSG00000116183 Lung TENM1 ENSG00000009694 Lung NRXN1 ENSG00000179915 Lung ATRX ENSG00000085224 Lung SSPO ENSG00000197558 Lung DNAH10 ENSG00000197653 Lung HERC2 ENSG00000128731 Lung NF1 ENSG00000196712 Lung MXRA5 ENSG00000101825 Lung DSCAM ENSG00000171587 Lung LAMA1 ENSG00000101680 Lung SI ENSG00000090402 Lung SACS ENSG00000151835 Lung FAT2 ENSG00000086570 Lung RNF213 ENSG00000173821 Lung DCHS2 ENSG00000197410 Lung RP1 ENSG00000104237 Lung LRP1 ENSG00000123384 Lung RIMS2 ENSG00000176406 Lung PLEC ENSG00000178209 Lung HUWE1 ENSG00000086758 Lung FMN2 ENSG00000155816 Lung PLXNA4 ENSG00000221866 Lung PCDH11X ENSG00000102290 Lung DNAH2 ENSG00000183914 Lung FBN2 ENSG00000138829 Lung ZFHX3 ENSG00000140836 Lung PTPRT ENSG00000196090 Lung HRNR ENSG00000197915 Lung KIAA1109 ENSG00000138688 Lung COL22A1 ENSG00000169436 Lung PTPRD ENSG00000153707

    TABLE-US-00037 TABLE 15B Indication Cell Lines Glioblastoma U-138 MG Glioblastoma LN-229 Glioblastoma U-87 MG Glioblastoma T98G Glioblastoma M059K Glioblastoma U-118 MG Glioblastoma LN-18 Glioblastoma DBTRG-05MG Glioblastoma A-172 Glioblastoma M059J Glioblastoma B104-1-1 Glioblastoma 9L/lacZ Pancreatic SW1990 Pancreatic SU.86.86 Pancreatic MIA-PaCa-2 Pancreatic CFPAC-1 Pancreatic HPAF-II Pancreatic SW 1990 Pancreatic Capan-1 Pancreatic MIA PaCa-2 Pancreatic BxPC-3 Pancreatic PANC-1 Ecadherin EmGFP Pancreatic LTPA Pancreatic HPAC Pancreatic AsPC-1 Pancreatic 1116-NS-19-9 Pancreatic Panc 10.05 Pancreatic Capan-2 Lung 201T Lung A549 Lung ABC-1 Lung Calu-3 Lung Calu-6 Lung COR-L105 Lung EKVX Lung EMC-BAC-1 Lung EMC-BAC-2 Lung H3255 Lung HCC-44 Lung HCC-78 Lung HCC-827 Lung LC-2-ad Lung LXF-289 Lung NCI-H1355 Lung NCI-H1395 Lung NCI-H1435 Lung NCI-H1563 Lung NCI-H1568 Lung NCI-H1573 Lung NCI-H1623 Lung NCI-H1648 Lung NCI-H1650 Lung NCI-H1651 Lung NCI-H1666 Lung NCI-H1693 Lung NCI-H1703 Lung NCI-H1734 Lung NCI-H1755 Lung NCI-H1781 Lung NCI-H1792 Lung NCI-H1793 Lung NCI-H1838 Lung NCI-H1944 Lung NCI-H1975 Lung NCI-H1993 Lung NCI-H2009 Lung NCI-H2023 Lung NCI-H2030 Lung NCI-H2085 Lung NCI-H2087 Lung NCI-H2122 Lung NCI-H2228 Lung NCI-H2291 Lung NCI-H23 Lung NCI-H2342 Lung NCI-H2347 Lung NCI-H2405 Lung NCI-H292 Lung NCI-H3122 Lung NCI-H322M Lung NCI-H358 Lung NCI-H441 Lung NCI-H522 Lung NCI-H596 Lung NCI-H650 Lung NCI-H838 Lung PC-14 Lung RERF-LC-KJ Lung RERF-LC-MS Lung SK-LU-1 Lung SW1573 Lung NCI-H720 Lung NCI-H727 Lung NCI-H835 Lung UMC-11 Lung COR-L23 Lung HOP-92 Lung IA-LM Lung LCLC-103H Lung LCLC-97TM1 Lung LU-65 Lung LU-99A Lung NCI-H1155 Lung NCI-H1299 Lung NCI-H1581 Lung NCI-H1915 Lung NCI-H661 Lung NCI-H810 Lung A427 Lung BEN Lung CAL-12T Lung ChaGo-K-1 Lung HCC-366 Lung NCI-H1770 Lung NCI-H2110 Lung NCI-H2135 Lung NCI-H2172 Lung NCI-H2444 Lung NCI-H647 Lung EBC-1 Lung EPLC-272H Lung HARA Lung HCC-15 Lung KNS-62 Lung LC-1-sq Lung LK-2 Lung LOU-NH91 Lung NCI-H1869 Lung NCI-H2170 Lung NCI-H226 Lung NCI-H520 Lung RERF-LC-Sq1 Lung SK-MES-1 Lung SW900 Lung COR-L321 Lung COLO-668 Lung COR-L279 Lung COR-L303 Lung COR-L311 Lung COR-L32 Lung COR-L88 Lung CPC-N Lung DMS-114 Lung DMS-273 Lung DMS-53 Lung IST-SL1 Lung IST-SL2 Lung LB647-SCLC Lung LU-134-A Lung LU-135 Lung LU-139 Lung LU-165 Lung MS-1 Lung NCI-H1048 Lung NCI-H1092 Lung NCI-H1105 Lung NCI-H1341 Lung NCI-H1417 Lung NCI-H1436 Lung NCI-H146 Lung NCI-H1688 Lung NCI-H1694 Lung NCI-H1836 Lung NCI-H187 Lung NCI-H1876 Lung NCI-H196 Lung NCI-H1963 Lung NCI-H2029 Lung NCI-H2066 Lung NCI-H209 Lung NCI-H211 Lung NCI-H2141 Lung NCI-H2196 Lung NCI-H2227 Lung NCI-H250 Lung NCI-H345 Lung NCI-H378 Lung NCI-H446 Lung NCI-H510A Lung NCI-H524 Lung NCI-H526 Lung NCI-H64 Lung NCI-H69 Lung NCI-H748 Lung NCI-H82 Lung NCI-H841 Lung NCI-H847 Lung SBC-1 Lung SBC-3 Lung SBC-5 Lung H2369 Lung H2373 Lung H2461 Lung H2591 Lung H2595 Lung H2722 Lung H2731 Lung H2795 Lung H2803 Lung H2804 Lung H2810 Lung H2818 Lung H2869 Lung H290 Lung H513 Lung IST-MES1 Lung MPP-89 Lung MSTO-211H Lung NCI-H2052 Lung NCI-H2452 Lung NCI-H28 Lung DMS-79 Lung HOP-62 Lung NCI-H1437 Lung PC-3 [JPC-3] Lung NCI-H740 Lung COR-L95 Lung HCC-33 Lung NCI-H128 Lung NCI-H1304 Lung NCI-H2081 Lung NCI-H2171 Lung SHP-77 Lung SW1271 Lung VMRC-LCD Lung NCI-H460 Lung RERF-LC-FM

    [0543] Without wishing to be bound by theory, it is believed that the following protocols, as well as those detailed elsewhere herein, could be used on a variety of diseases including, but not limited to, viral and bacterial diseases, cancers, neurodegenerative diseases, and neuropsychiatric disorders.

    Affinity Purification Mass Spectrometry (AP-MS)

    [0544] Plasmid Cloning

    [0545] Sequences of interest are downloaded from Genbank and utilized to design 2×-Strep tagged expression constructs. Protein termini are analyzed for predicted acylation motifs, signal peptides, and transmembrane regions, and either the N- or C-terminus is chosen for tagging as appropriate. Finally, reading frames are codon optimized and cloned into pLVX-EF1alpha-IRES-Puro (Takara/Clontech) including a 5′ Kozak motif.

    [0546] Transfection and Cell Harvest for Immunoprecipitation Experiments

    [0547] For each affinity purification, ten million cells are transfected with up to 15 μg of individual expression constructs using PolyJet transfection reagent (SignaGen Laboratories) at a 1:3 μg:μl ratio of plasmid to transfection reagent based on manufacturer's protocol. After more than 38 hours, cells are dissociated at room temperature using 10 ml PBS without calcium and magnesium (D-PBS) with 10 mM EDTA for at least 5 minutes, pelleted by centrifugation at 200×g, at 4° C. for 5 minutes, washed with 10 ml D-PBS, pelleted once more and frozen on dry ice before storage at −80° C. for later immunoprecipitation analysis. For each protein, three independent biological replicates are prepared. Whole cell lysates are resolved on 4%-20% Criterion SDS-PAGE gels (Bio-Rad Laboratories) to assess Strep-tagged protein expression by immunoblotting using mouse anti-Strep tag antibody 34850 (QIAGEN) and anti-mouse HRP secondary antibody (BioRad).

    [0548] Anti-Strep-Tag Affinity Purification

    [0549] Frozen cell pellets are thawed on ice for 15-20 minutes and suspended in 1 ml Lysis Buffer, composed of 50 mM Tris-HCl, pH 7.4 at 4° C., 150 mM NaCl, 1 mM EDTA supplemented with 0.5% Nonidet P 40 Substitute (NP-40; Fluka Analytical) and cOmplete mini EDTA-free protease and PhosSTOP phosphatase inhibitor cocktails (Roche). Samples are then freeze-fractured by refreezing on dry ice for 10-20 minutes, then rethawed and incubated on a tube rotator for 30 minutes at 4° C. Debris is pelleted by centrifugation at 13,000×g, at 4° C. for 15 minutes. Up to 56 samples are arrayed into a 96-well Deepwell plate for affinity purification on the KingFisher Flex Purification System (Thermo Scientific) as follows: MagStrep “type3” beads (30 μl; IBA Lifesciences) are equilibrated twice with 1 ml Wash Buffer (IP Buffer supplemented with 0.05% NP-40) and incubated with 0.95 ml lysate for 2 hours. Beads are washed three times with 1 ml Wash Buffer and then once with 1 ml IP Buffer. Beads are released into 75 μl Denaturation-Reduction Buffer (2 M urea, 50 mM Tris-HCl pH 8.0, 1 mM DTT) in advance of on-bead digestion. All automated protocol steps are performed at 4° C. using the slow mix speed and the following mix times: 30 seconds for equilibration/wash steps, 2 hours for binding, and 1 minute for final bead release. Three 10 second bead collection times are used between all steps.

    [0550] On-Bead Digestion for Affinity Purification

    [0551] Bead-bound proteins are denatured and reduced at 37° C. for 30 minutes, alkylated in the dark with 3 mM iodoacetamide for 45 minutes at room temperature, and quenched with 3 mM DTT for 10 minutes. To offset evaporation, 22.5 μl 50 mM Tris-HCl, pH 8.0 is added prior to trypsin digestion. Proteins are then incubated at 37° C., initially for 4 hours with 1.5 μl trypsin (0.5 μg/μl; Promega) and then another 1-2 hours with 0.5 μl additional trypsin. All steps are performed with constant shaking at 1,100 rpm on a ThermoMixer C incubator. Resulting peptides are combined with 50 μl 50 mM Tris-HCl, pH 8.0 used to rinse beads and acidified with trifluoroacetic acid (0.5% final, pH<2.0). Acidified peptides are desalted for MS analysis using a BioPureSPE Mini 96-Well Plate (20 mg PROTO 300 C18; The Nest Group, Inc.) according to standard protocols.

    [0552] Mass Spectrometry Operation and Peptide Search

    [0553] Samples are re-suspended in 4% formic acid, 2% acetonitrile solution, and separated by a reversed-phase gradient over a nanoflow C18 column (Dr. Maisch). HPLC buffer A is composed of 0.1% formic acid, and HPLC buffer B was composed of 80% acetonitrile in formic acid. Peptides are eluted by a linear gradient from 7 to 36% B over the course of 52 min, after which the column is washed with 95% B, and re-equilibrated at 2% B. Each sample is directly injected via a Easy-nLC 1200 (Thermo Fisher Scientific) into a Q-Exactive Plus mass spectrometer (Thermo Fisher Scientific) and analyzed with a 75 minute acquisition, with all MS1 and MS2 spectra collected in the orbitrap; data is acquired using the Thermo software Xcalibur (4.2.47) and Tune (2.11 QF1 Build 3006). For all acquisitions, QCloud is used to control instrument longitudinal performance during the project (C. Chiva, R. Olivella, E. Bonis, G. Espadas, O. Pastor, A. Solé, E. Sabidó, QCloud: A cloud-based quality control system for mass spectrometry-based proteomics laboratories. PLoS One. 13, e0189209 (2018)). All proteomic data is searched against the human proteome, EGFP sequence, and the sequences of bait proteins using the default settings for MaxQuant (version 1.6.12.0) (J. Cox, M. Mann, MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification. Nat. Biotechnol. 26, 1367-1372 (2008)). Detected peptides and proteins are filtered to 1% false discovery rate in MaxQuant.

    Scoring and Comparing Protein-Protein Interactions

    [0554] High-Confidence Protein Interaction Scoring

    [0555] Identified proteins are then subjected to protein-protein interaction scoring with SAINTexpress (version 3.6.3), MiST (https://github.com/kroganlab/mist), and compPASS (G. Teo, et al., SAINTexpress: improvements and additional features in Significance Analysis of INTeractome software. J. Proteomics. 100, 37-43 (2014); S. Jager, et al., Global landscape of HIV-human protein complexes. Nature. 481, 365-370 (2011); P. K. Jackson, Navigating the deubiquitinating proteome with a CompPASS. Cell. 138 (2009), pp. 222-224). A two-step filtering strategy is applied to determine the final list of reported interactors, which relies on two different scoring stringency cut-offs. In the first step, all protein interactions that fall above specific thresholds defined for MiST, compPASS, and/or SAINTexpress are chosen. For all proteins that fulfilled these criteria, information about the stable protein complexes that they participated in is extracted from the CORUM (M. Giurgiu, et al., CORUM: the comprehensive resource of mammalian protein complexes-2019. Nucleic Acids Res. 47, D559-D563 (2019)) database of known protein complexes. In the second step, the stringency is relaxed, and additional interactors that formed complexes with interactors determined in filtering step 1 are recovered. Proteins that fulfilled filtering criteria in either step 1 or step 2 are considered to be high-confidence protein-protein interactions (HC-PPIs).

    [0556] Protein Protein Interaction Scoring: MiST

    [0557] The MiST score is a weighted sum of three features: (1) normalized protein abundance measured by peak intensities, spectral counts, or unique number of peptide per protein (abundance); (2) invariability of abundance over replicated experiments (reproducibility); and (3) a measure of how unique a bait-prey pair is compared to all other baits (specificity). The weights of the three features are configurable in three different ways: first, pre-configured fixed weights can be used; second, they can be trained de novo on a custom list of trusted bait-prey pairs identified in the data set; lastly, a principal component analysis (PCA) can be run to assign the feature weights according their contribution to the variance in the data set.

    [0558] Specifically, the amount of prey i interacting with bait b is quantified using modified SI.sub.N score that is computed from a protein intensity I.sub.b,i (not spectral counts as in the original design), total protein intensities of N number of preys observed from a single pull-down experiment is:

    [00013] .Math. i = 1 N I b , i .

    [0559] The length (number of residues) of the identified prey, L.sub.i, is as follows:

    [00014] ? ? indicates text missing or illegible when filed

    [0560] The quantity Q.sub.b,i,r of bait-prey pair b, i in a replica r is defined as SI.sub.N score of b, i pair normalized by a sum of SI.sub.N scores of all preys from a given pull-down experiment r as:

    [00015] Q b , i , r = SI N ; b , i , r .Math. i = 1 N SI N ; b , i , r .

    [0561] Next, the three features used to define the biological relevance score are calculated as follows. The first feature, the abundance, A.sub.b,i, of a given bait-prey pair i,b, is defined as the mean of the bait-prey quantities Q.sub.b,i,r over all NR number of replicas:

    [00016] A b , i = .Math. r = 1 N ? Q b , i , r N R . ? indicates text missing or illegible when filed

    [0562] The second feature, the reproducibility, R.sub.b,i, of a given bait-prey pair b,i, is defined as the normalized entropy of the vector Q.sub.b,i:

    [00017] R b , i + .Math. r = 1 N ? Q b , i , r .Math. log ( Q b , i , r ) log 2 ( N R ) - 1 . ? indicates text missing or illegible when filed

    [0563] The third feature, the specificity, S.sub.b,i, of a given bait-prey pair b, i, is defined as the proportion of the abundance of prey i compared to the abundances of prey i for the other N.sub.B number of baits:

    [00018] S b , i = A b , i .Math. b = 1 N ? A b , i . ? indicates text missing or illegible when filed

    [0564] Optionally, MiST can exclude consideration of specificity for baits that are expected to bind similar preys (based on either manual annotation or clustering of pull-downs). The three features are combined into a single composite score (the MiST score) by maximizing the variance in the three features space using the standard principal component analysis (PCA), as implemented in the MDP toolkit.

    [0565] Protein Protein Interaction Scoring: CompPASS

    [0566] CompPASS is an acronym for Comparative Proteomic Analysis Software Suite. It relies on an unbiased comparative approach for identifying high-confidence candidate interacting proteins (HCIPs for short) from the hundreds of proteins typically identified in IP-MS/MS experiments. There are several scoring metrics calculated as part of comPASS: The Z-score, the S-score, the D-score, and the WD-score. The S-score, D-score, and WD-score were all developed empirically based on their ability to effectively discriminate known interactors from known background proteins. Each score has advantages and disadvantages, and each are used to assess distinct aspects of the dataset. However, the primary score use to determine the high-confidence protein-protein interaction dataset is the WD-score. Typically, the top 5% of the WD-score scores are taken (more information under “Determining Thresholds”).

    [0567] The Z-Score. The first score is the conventional Z-score, which determines the number of standard deviations away from the mean (Eq. 1) at which a measurement lies (Eq. 2). In Eq. 1 & 2 X is the TSC, i is the bait number, j is the interactor, n denotes which interactor is being considered, k is the total number of baits, and s is the standard deviation of the TSC mean.

    [00019] x _ j = .Math. ? ? x i , j k ? n = 1 , 2 , .Math. m ( Eq . 1 ) z i , j = x i , j - x _ j σ j ( Eq . 2 ) ? indicates text missing or illegible when filed

    [0568] Each interactor for each bait has a Z-score calculated and therefore, the same interactor will have a different Z-score depending on the bait (assuming the TSC is different when identified for that bait). Although the Z-score can effectively identify interactors who's TSC is significantly different from the mean, if an interactor is unique (found in association with only 1 bait), then it fails to discriminate between interactors with a single TSC (“one hit wonders”) and another that may have 20 TSC or 50 TSC, etc. In this way, the Z-score will tend to upweight unique proteins, no matter their abundance. This can be dangerous since the stochastic nature of data-dependent acquisition mass spectrometry leads to spurious identification of proteins. These would be assigned the maximal Z-score as they would be unique, however they likely do not represent bona fide interactors.

    [0569] The S-Score. The next score is the S-score which incorporates the frequency of the observed interactor and its' abundance (TSC). Both the D- and WD-scores are based on the S-score, sharing the same fundamental formulation, but have additional terms that add increasing resolving power. The S-score (Eq. 3) is essentially a uniqueness and abundance measurement.

    [00020] S i , j = ( k .Math. ? ? ? ) x i , j ; f i , j = { 1 ? x i , j > 0 x i , j ( Eq . 3 ) ? indicates text missing or illegible when filed

    [0570] In Eq. 3, the variables are the same as for Eq. 1 & 2. f is a term which is 0 or 1 depending on whether or not the interacting protein is found in a given bait. Placed in the summation across all baits, it is a counting term and therefore, k/Sf is the inverse ratio (or frequency) of this interactor across all baits. The smaller f the larger this value becomes and thus upweights interactors that are rare. The term X.sub.i,j is the TSC for interactor j from bait i and therefore multiplying by this value scales the S-score with increasing interactor TSC—this provides a higher score to interactors having high TSC and are therefore more abundant and less likely to be stochastically sampled. Although increasing the resolution above using the Z-score alone (the S-score can discriminate between unique one hit wonders and unique interactors with high TSC), the S-score will give its highest values to interactors that very rare and can lead to one hit wonders being scored among the top proteins. However, with a stringent cut-off value, the S-score reliably identifies HCIPs and bona fide interacting proteins but at this level, is prone to miss lower abundant likely interacting proteins. In order to address this limitation, the S-score is modified to take into account the reproducibility of the interactor for a given bait—a quantity that can be determined as a result of performing duplicate mass spectrometry runs. After adding this modification, the S-score becomes the D-score (Eq. 4).

    [0571] The D-Score. The D-score is fundamentally the same as the S-score except with an added power term to take into account the reproducibility of the interaction. The term p can either be 1 (if the interactor was found in 1 of 2 duplicate runs) or 2 (if the interactor was found in both duplicate runs).

    [00021] D ? = ( k .Math. ? ? ? ) P x i , j ; f i , j = { 1 ? x i , j > 0 x i , j p = ? ? ( Eq . 4 ) ? indicates text missing or illegible when filed

    [0572] If p is 1 (the interactor was found in 1 of 2 duplicates) then the D-score is the same as the S-score. Adding the reproducibility term now allows for better discrimination between a true one hit wonder (a protein found with 1 peptide in a single run, not in the duplicate) which is likely a false positive versus a true interactor with low (even 1) TSC that is found in both duplicate runs. Although powerful in its ability to delineate HCIPs from background proteins, the D-score still relies heavily on the frequency term, k/Sf and will thus assign lower scores to more frequently observed proteins. In the vast majority of the cases, this is of course a good thing since these proteins are more than likely background. However, in the event that a canonical background protein is a bona fide interactor for a specific bait, its D-score would likely be too low for passing the D-score threshold (discussed below) and would not be considered a HCIP. Another example pertains to CompPASS analysis of baits from within the same biological network or pathway. In the case of the Dub Project, most of these proteins do not share interactors as this analysis is performed across a protein family—in which case the D-score works very well. However, sometimes baits do share interactors as these proteins are part of the same biological pathway and determining these share interactors (and hence the connections among these proteins) is critical for a reliable assessment of the pathway. In these cases, the D-score works fairly well for most interactors, however it can downweigh very commonly found bona fide interactors (especially when these interactors have low TSC). To address this limitation, a weighting factor was designed to be added into the D-score and thus created the WD-score (or Weighted D-score; Eq. 5).

    [0573] The WD-Score. Upon examination of frequently observed proteins (considered background) that are either known not to be a bona fide interactor for any bait and those that are known to be true interactors for a subset of baits, it is found that the distributions of the TSC for these groups vary in a correlated manner. In the first case, where these “background” proteins are never true interactors, the standard deviation of the TSC (s.sub.TSC) is smaller than that of the latter case (“background” proteins that are known to be true interactors for specific baits). This occurs since real background protein abundance is mainly determined by the amount of resin used in the IP whereas in the case of a background protein becoming a true interactor, its TSC then rises far above this consistent level (and thus cause s.sub.TSC to increase. In fact, when s.sub.TSC is systematically examined across all proteins found in >50% of the IP-MS/MS datasets, the proteins that are known to be real interactors for specific baits are found to have a s.sub.TSC that is >100% of the TSC mean for that protein across all IPs. Therefore, a weight factor term is introduced as w.sub.j and is essentially the s.sub.TSC/TSC mean for interactor j (shown below).

    [00022] WD i , j = ( k .Math. ? ? ? ω j ) P x i , j ( Eq . 5 ) ω j = ( σ j x _ j ) , x _ j = .Math. ? ? x i , j k ? n = 1 , 2 , .Math. m , if ω j ? 1 ? ω j = 1 if ω j ? 1 ? ω j = ω j f i , j = { 1 ; x i , j > 0 x i , j p = number of ? in which the ? is present ? indicates text missing or illegible when filed

    [0574] The weight factor, w.sub.j, is added as a multiplicative factor to the frequency term in order to offset this low value for interactors that are found frequently across baits but will only be >1 if the conditions in Eq. 5 are met. If these conditions are not met, then o.sub.j is set to 1 and the WD-score is the same as the D-score. In this way, only if a frequent interactor displays the observed characteristics of a true interactor will its score increase due to the weight factor.

    [0575] To determine score thresholds for determining high-confidence protein-protein interactions, randomly generated simulated run data are compared against. In order to create simulated random runs, the data from actual experiments is first used to create the proteome observed from the experiments. To do this, each protein is represented by its TSC from each run—in other words, if a protein is found with a total of 450 TSC summed across all real runs, then it is represented 450 times. Simulated runs are then created by randomly drawing from this “experimental proteome” until 300 proteins are selected and the total TSC for the simulated run is 1500 (these are the average values found across the actual experiments). Next, scores are calculated for the random runs to determine the distributions of the scores for random data. Finally, for each score, the corresponding value above which 5% of the random data lies is found, and that value taken to be that score's threshold. Although 5% of the random data is above this threshold value, an examination of the TSC distribution for these random data is expected to show that >99% have TSC<4. Therefore, although there are false positive HCIPs in real datasets, this distribution can now be used to assign a p-value for proteins passing the score thresholds. In this way, an argument can be made that a protein passing a score threshold and found to have high enough TSC (reflected in the p-value) is very likely to be a real interactor. A suitable approximation for this above described method is to simply take the minimal value of the top 5% of the scores for each metric and set that value to be the threshold for that score.

    [0576] Protein-Protein Interaction Scoring: SAINT

    [0577] The aim of SAINT is to convert the label free quantification (spectral count X.sub.ij) for a prey protein i identified in a purification of bait j into the probability of true interaction between the two proteins, P(True|X.sub.ij). The spectral counts for each prey-bait pair are modeled with a mixture distribution of two components representing true and false interactions. Note that these distributions are specific to each bait-prey pair. The parameters for true and false distributions, P(X.sub.ij|True) and P(X.sub.ij|False), and the prior probability π.sub.T of true interactions in the dataset, are inferred from the spectral counts for all interactions involving prey i and bait j. SAINT normalizes spectral counts to the length of the proteins and to the total number of spectra in the purification.

    [0578] The spectral counts for prey i in purification with bait j are considered to be either from a Poisson distribution representing true interaction (with mean count λ.sub.ij) or from a Poisson distribution representing false interaction (with mean count κ.sub.ij. In the form of probability distribution, the following formula is written:


    P(X.sub.ij|*)=π.sub.TP(X.sub.ij|λ.sub.ij)+(I−π.sub.T)P(X.sub.ij|κ.sub.ij)  (1)

    [0579] where π.sub.T is the proportion of true interactions in the data, and dot notation represents all relevant model parameters estimated from the data (here, specifically for the pair of prey i and bait j). The individual bait-prey interaction parameters λ.sub.ij and κ.sub.ij are estimated from joint modeling of the entire bait-prey association matrix, with the probability distribution (likelihood) of the form P(X|)=Π.sub.i,jP(X.sub.ij|). The proportion π.sub.T is also estimated from the model, which relies on latent variables in the sampling algorithm (see below).

    [0580] When at least three control purifications are available, and assuming that the control purifications provide a robust representation of nonspecific interactors, the parameter κ.sub.ij can be estimated from spectral counts for prey i observed in the negative controls. This is equivalent to assuming


    P(X.sub.ij|*)=π.sub.i,j;j∈E(π.sub.TP(X.sub.ij|λ.sub.ij)+(1−π.sub.T)P(X.sub.ij|κ.sub.ij))×π.sub.i,j,j∈C(P(X.sub.ij|κ.sub.ij))  (2)

    [0581] where E and C denote the group of experimental purifications and the group of negative controls, respectively. This leads to a semi-supervised mixture model in the sense that there is a fixed assignment to false interaction distribution for negative controls. As negative controls guarantee sufficient information for inferring model parameters for false interaction distributions, Bayesian nonparametric inference using Dirichlet process mixture priors can be used to derive the posterior distribution of protein-specific abundance parameters in the model. As a result, the mean parameters in the Poisson likelihood functions follow a nonparametric posterior distribution, allowing more flexible modeling at the proteome level. Under this setting, all model parameters are estimated from an efficient Markov chain Monte Carlo algorithm.

    [0582] To elaborate on the two distributions, the mean parameter for each distribution is assumed to have the following form. For false interactions, it is assumed that spectral counts follow a Poisson distribution with mean count:


    log(κ.sub.ij)=log(l.sub.i)+log(c.sub.j)+γ.sub.0+μ.sub.i  (3)

    where l.sub.i is the sequence length of prey i, and c.sub.j is the bait coverage, the spectral count of the bait in its own purification experiment, γ.sub.0 is the average abundance of all contaminants and μ.sub.i is prey i specific mean difference from γ.sub.0. For true interactions, it is assumed that spectral counts follow a Poisson distribution with mean count:


    log(λ.sub.ij)=log(l.sub.i)+log(c.sub.j)+β.sub.0+α.sub.bj+α.sub.pi  (4)

    where β.sub.0 is the average abundance of prey proteins in those cases where they are true interactors of the bait, α.sub.bj is bait j specific abundance factor and α.sub.pi is prey i specific abundance factor. In other words, the mean spectral count for a prey protein in a true interaction is calculated using a multiplicative model combining bait- and prey-specific abundance parameters. This formulation substantially reduces the number of parameters in the model, avoiding the need to estimate every λ.sub.ij separately.

    [0583] For datasets without negative control purifications, the mixture component distributions for true and false interactions have to be identified solely from experimental (non-control) purifications. In this case, a user-specified threshold is applied to divide preys into high-frequency and low-frequency groups, denoted as Y.sub.i=1 or 0 if prey i belongs to the high- or low-frequency group, respectively. An arbitrary 20% threshold is applied in the case of the DUB dataset; however, the results are not expected to be very sensitive to the choice of the threshold. For preys in the high frequency group, the model considers spectral counts for the observed prey proteins (ignoring zero count data, which represent the absence of protein identification), as there are sufficient data to estimate distribution parameters. In the low-frequency group, non-detection of a prey is included to help the separation of high-count from low-count hits. The entire mixture model can then be expressed as


    P(X.sub.ij|*)=π.sub.i,j(π.sub.TP(X.sub.ij|λ.sub.ij)+(1−π.sub.T)P(X.sub.ij|κ.sub.ij)).sup.Z.sup.ij  (5)

    where Z.sub.ij=1(Y.sub.i=0)+1(Y.sub.i=1,X.sub.ij>0) and the false and true interaction distributions are modeled by equations (3) and (4), respectively.

    [0584] The posterior probability of a true interaction given the data is computed using Bayes rule


    P(true|X.sub.ij)=T.sub.ijI(T.sub.ij+F.sub.ij)  (6)

    where T.sub.ij=π.sub.TP(X.sub.ij|λ.sub.ij) and F.sub.ij=(1−π.sub.T) P(X.sub.ij|κ.sub.ij). If there are replicate purifications for bait j, the final probability is computed as an average of individual probabilities over replicates. Note that one alternative approach is to compute the probability assuming conditional independence over replicates, that is, Π.sub.k∈jP(X.sub.ijk|λ.sub.ijk) and Π.sub.k∈jP(X.sub.ijk|κ.sub.ijk) for true and false interactions, with additional index k denoting replicates for bait j. Unlike average probability, this probability puts less emphasis on the degree of reproducibility, and thus may be more appropriate in datasets where replicate analysis of the same bait is performed using different experimental conditions (for example, purifications using different affinity tags) to increase the coverage of the interactome.

    [0585] When probabilities have been calculated for all interaction partners, the Bayesian false discovery rate (FDR) can be estimated from the posterior probabilities as follows. For each probability threshold p*, the Bayesian FDR is approximated by


    FDR(p*)=(Σ.sub.k1(p.sub.k≥p*)(1−p.sub.k))/(Σ.sub.k1(p.sub.k≥p*))  (7)

    where p.sub.k is the posterior probability of true interaction of protein pair k. The output from SAINT allows the user to select a probability threshold to filter the data to achieve the desired FDR.

    [0586] Comparing Protein Interactions Using Hierarchical Clustering

    [0587] Hierarchical clustering is performed on interactions for distinct but related proteins, including viral proteins, cancer proteins, or proteins from other diseases, which are hereout simply referred to as “conditions.” First, protein interactions that pass the master threshold (defined in “High-confidence protein interaction scoring” section above) in at least one condition are assembled. New interaction scores (K) are created by taking the average of several interaction scores. This is done to provide a single score that captures the benefits from each scoring method. Clustering is then done using this new Interaction Score (K). Clustering is performed using the ComplexHeatmap package in R, using the “average” clustering method and “euclidean” distance metric. K-means clustering is applied to capture all possible combinations of interaction patterns between conditions.

    [0588] Differential Interaction Score (DIS) Analysis

    [0589] To compare PPIs across conditions (i.e., cell lines, viruses, diseases), a method for calculating a differential interaction score (DIS) was developed, and a corresponding false discovery rate (FDR) can be calculated using AP-MS data across multiple conditions. This approach uses the SAINTexpress score (G. Teo, et al., SAINTexpress: improvements and additional features in Significance Analysis of INTeractome software. J. Proteomics. 100, 37-43 (2014)), which is the probability of a PPI being bonafide in a single condition. Here, S.sub.c(b, p) is the SAINTexpress score of a specific PPI denoted as (b, p) in a condition c. Here, an example is provided using three distinct conditions, C1, C2, and C3. Given that PPIs are independent events across different conditions, the differential interaction score is calculated for each PPI (b, p) as the product of the probability of a PPI being present in two of the conditions but absent in the third for each PPI:


    DIS.sub.A(b,p)=S.sub.C1(b,pS.sub.C2(b,p)×[1−S.sub.C3(b,p)]

    [0590] This differential interaction score highlights PPIs that are strongly conserved across two of the conditions, but not shared by the third. Additionally, PPIs that are present in the one conditions, but depleted in the other two, can be highlighted as follows:


    DIS.sub.B(b,p)=[1−S.sub.C1(b,p)]×[1−S.sub.C2(b,p)]×S.sub.C3(b,p)

    [0591] These two DIS scores can be further merged to define a single score for each PPI, where if DIS.sub.A>DIS.sub.B, the DIS is assigned a positive (+) sign, while if DIS.sub.A<DIS.sub.B, the unified DIS is assigned a negative (−) sign. In this way, the DIS for each PPI is represented by a continuum, in which negative DIS scores represent PPIs depleted in two of the three conditions, while positive DIS scores represent PPIs enriched in two of the three conditions. Additionally, for all differential interaction scores calculated, the Bayesian false discovery rate (BFDR) (G. Teo, G. Liu, J. Zhang, A. I. Nesvizhskii, A.-C. Gingras, H. Choi, SAINTexpress: improvements and additional features in Significance Analysis of INTeractome software. J. Proteomics. 100, 37-43 (2014)) estimates are also computed at all possible thresholds (p*) as follows:

    [00023] F D R ( p * ) = .Math. i , i ( 1 - D I S ( p i , p j ) ) × I { D I S ( p i , p j ) > p * } .Math. i , j I { DIS ( p i , p j ) > p * } , where I { A } is 1 when A is True and 0 otherwise .

    [0592] Note, while these scores are used here for comparison across 3 conditions, it can also be used more simply to compare between any two conditions. Such a comparison is calculated as follows where DIS.sub.1/2 results in PPIs specific to condition 1 have a positive DIS value, while PPIs specific to condition 2 results in a negative DIS value:


    DIS.sub.C1/C2(p.sub.1,p.sub.2)=S.sub.C1(p.sub.1,p.sub.2)×(1−S.sub.C2(p.sub.1,p.sub.2)) or


    DIS.sub.C3/C2(p.sub.1,p.sub.2)=S.sub.C3(p.sub.1,p.sub.2)×(1−S.sub.C2(p.sub.1,p.sub.2)) or


    DIS.sub.C3/C1(p.sub.1,p.sub.2)=S.sub.C3(p.sub.1,p.sub.2)×(1−S.sub.C1(p.sub.1,p.sub.2)).

    Genetic Perturbation Analysis

    [0593] Network Generation and Visualization

    [0594] Protein-protein interaction networks are generated in Cytoscape (P. Shannon, et al., Cytoscape: a software environment for integrated models of biomolecular interaction networks. Genome Res. 13, 2498-2504 (2003)) and subsequently annotated using Adobe Illustrator. Host-host physical interactions, protein complex definitions, and biological process groupings are derived from CORUM (M. Giurgiu, et al., CORUM: the comprehensive resource of mammalian protein complexes-2019. Nucleic Acids Res. 47, D559-D563 (2019)), Gene Ontology (biological process), and manually curated from literature sources. All networks are deposited in NDEx (R. T. Pillich, J. Chen, V. Rynkov, D. Welker, D. Pratt, NDEx: A Community Resource for Sharing and Publishing of Biological Networks. Methods Mol. Biol. 1558, 271-301 (2017)).

    [0595] siRNA Library and Transfection into Human Cells

    [0596] An OnTargetPlus siRNA SMARTpool library (Horizon Discovery) is purchased targeting proteins of interest. This library is arrayed in 96-well format, with each plate also including two non-targeting siRNAs as well as positive and negative controls. The siRNA library is transfected into cells using Lipofectamine RNAiMAX reagent (Thermo Fisher). Briefly, 6 pmoles of each siRNA pool are mixed with 0.25 μl RNAiMAX transfection reagent and OptiMEM (Thermo Fisher) in a total volume of 20 μl. After a 5 minute incubation period, the transfection mix is added to cells seeded in a 96-well format. 24 hours post-transfection, the cells are subjected to viral infection or drug treatment as warranted by the current investigation. Next, the cells are incubated for 72 hours to assess cell viability using the CellTiter-Glo luminescent viability assay according to the manufacturer's protocol (Promega). Luminescence is measured in a Tecan Infinity 2000 plate reader, and percentage viability calculated relative to untreated cells (100% viability) and cells lysed with 20% ethanol or 4% formalin (0% viability), included in each experiment.

    [0597] Knockdown Validation with qRT-PCR in Human Cells

    [0598] Gene-specific quantitative PCR primers targeting all genes represented in the OnTargetPlus library are purchased and arrayed in a 96-well format identical to that of the siRNA library (IDT). Cells treated with siRNA are lysed using the Luna® Cell Ready Lysis Module (New England Biolabs) following the manufacturer's protocol. The lysate is used directly for gene quantification by RT-qPCR with the Luna® Universal One-Step RT-qPCR Kit (New England Biolabs), using the gene-specific PCR primers and GAPDH as a housekeeping gene. The following cycling conditions are used in an Applied Biosystems QuantStudio 6 thermocycler: 55° C. for 10 minutes, 95° C. for 1 minute, and 40 cycles of 95° C. for 10 seconds, followed by 60° C. for 1 minute. The fold change in gene expression for each gene is derived using the 2.sup.−ΔΔCT, 2 (Delta Delta CT) method (K. J. Livak, T. D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25, 402-408 (2001)), normalized to the constitutively expressed housekeeping gene GAPDH. Relative changes are generated comparing the control siRNA knockdown transfected cells to the cells transfected with each siRNA.

    [0599] sgRNA Selection and Synthesis for Cas9 Knockout Screen

    [0600] sgRNAs are designed according to Synthego's multi-guide gene knockout (R. Stoner, T. Maures, D. Conant, Methods and systems for guide ma design and use. US Patent (2019), (available at https://patentimages. storage.googleapis. com/95/c7/43/3d48387ce0f116/US20190382797A1.p df)). Briefly, two or three sgRNAs are bioinformatically designed to work in a cooperative manner to generate small, knockout-causing, fragment deletions in early exons. These fragment deletions are larger than standard indels generated from single guides. The genomic repair patterns from a multi-guide approach are highly predictable based on the guide-spacing and design constraints to limit off-targets, resulting in a higher probability protein knockout phenotype. RNA oligonucleotides are chemically synthesized on Synthego solid-phase synthesis platform, using CPG solid support containing a universal linker. 5-Benzylthio-1H-tetrazole (BTT, 0.25 M solution in acetonitrile) is used for coupling, (3-((Dimethylamino-methylidene)amino)-3H-1,2,4-dithiazole-3-thione (DDTT, 0.1 M solution in pyridine)) is used for thiolation, dichloroacetic acid (DCA, 3% solution in toluene) is used for detritylation. Modified sgRNA are chemically synthesized to contain 2′-O-methyl analogs and 3′ phosphorothioate nucleotide interlinkages in the terminal three nucleotides at both 5′ and 3′ ends of the RNA molecule. After synthesis, oligonucleotides are subject to a series of deprotection steps, followed by purification by solid phase extraction (SPE). Purified oligonucleotides are analyzed by ESI-MS.

    [0601] Arrayed Knockout Generation with Cas9-RNPs

    [0602] For transfection into human cells, 10 pmol Streptococcus Pyogenes NLS-Sp.Cas9-NLS (SpCas9) nuclease (Aldevron; 9212) is combined with 30 pmol total synthetic sgRNA (10 pmol each sgRNA, Synthego) to form ribonucleoproteins (RNPs) in 20 μl total volume with SF Buffer (Lonza VSSC-2002) and allowed to complex at room temperature for 10 minutes. All cells are dissociated into single cells using TrypLE Express (Gibco), resuspended in culture media and counted. 100,000 cells per nucleofection reaction are pelleted by centrifugation at 200×g for 5 minutes. Following centrifugation, cells are resuspended in transfection buffer according to cell type and diluted to 2×10.sup.4 cells/μl. 5 μl of cell solution was added to preformed RNP solution and gently mixed. Nucleofections were performed on a Lonza HT 384-well nucleofector system (Lonza, #AAU-1001) using program CM-150 Immediately following nucleofection, each reaction is transferred to a tissue-culture treated 96-well plate containing 100 μl normal culture media and seeded at a density of 50,000 cells/well. Transfected cells are incubated following standard protocols.

    [0603] Quantification of Arrayed Knockout Efficiency

    [0604] Two days post-nucleofection, genomic DNA is extracted from cells using DNA QuickExtract (Lucigen, #QE09050). Briefly, cells are lysed by removal of the spent media followed by addition of 40 μl of QuickExtract solution to each well. Once the QuickExtract DNA Extraction Solution is added, the cells are scraped off the plate into the buffer. Following transfer to compatible plates, DNA extract is then incubated at 68° C. for 15 minutes followed by 95° C. for 10 minutes in a thermocycler before being stored for downstream analysis Amplicons for indel analysis are generated by PCR amplification with NEBNext polymerase (NEB, #M0541) or AmpliTaq Gold 360 polymerase (Thermo Fisher Scientific, #4398881) according to the manufacturer's protocol. The primers are designed to create amplicons between 400-800 bp, with both primers at least 100 bp distance from any of the sgRNA target sites. PCR products are cleaned-up and analyzed by Sanger sequencing (Genewiz). Sanger data files and sgRNA target sequences are input into Inference of CRISPR Edits (ICE) analysis (ice.synthego.com) to determine editing efficiency and to quantify generated indels (T. Hsiau, T. Maures, K. Waite, J. Yang, R. Kelso, K. Holden, R. Stoner, Inference of CRISPR Edits from Sanger Trace Data (2018), p. 251082). Percentage of alleles edited is expressed as an ice-d score. This score is a measure of how discordant the sanger trace is before vs. after the edit. It is a simple and robust estimate of editing efficiency in a pool, especially suited to highly disruptive editing techniques like multi-guide.

    [0605] Identification of Essential Genes for siRNA and Cas9 Knockout Screen

    [0606] Here, longitudinal imaging in human cells is used to assess cell viability. For benchmarking, relative cell viability is measured by CellTiter-Glo Luminescent Cell Viability Assay (Promega; G7571) as per manufacturer's instructions. Briefly, two passages post-nucleofection siRNA pools cultured in 96-well tissue-culture treated plates (Corning, #3595) are lysed in the CellTIter-Glo reagent, by removing spent media and adding 100 μl of the CellTiter-Glo reagent containing the CellTiter-Glo buffer and CellTiter-Glo Substrate. Cells are placed on an orbital shaker for 2 minutes on a SpectraMax iD5 (Molecular Devices) and then incubated in the dark at room temperature for 10 minutes. Completely lysed cells are pipette mixed and 25 μl are transferred to a 384-well assay plate (Corning, #3542). The luminescence is recorded on a SpectraMax iD5 (Molecular Devices) with an integration time of 0.25 seconds per well. Luminescence readings are all normalized to the without-sgRNA control condition.

    [0607] To determine cell viability in Caco-2 knockouts, longitudinal imaging is used. All gene knockout pools are maintained for a minimum of six passages to determine the effect of loss of protein function on cell fitness prior to viral infection. Viability is determined through longitudinal imaging and automated image analysis using a Celigo Imaging Cytometer (Celigo). Each gene knockout pool is split in triplicate wells on separate plates. Every day, except the day of seeding, each well is scanned and analyzed using built in “Confluence” imaging parameters using auto-exposure and autofocus with an offset of −45 μm. Analysis is performed with standard settings except for an intensity threshold setting of 8. Confluency is averaged across 3 wells and plotted over time. Viability genes are determined as pools that are less than 20% confluent 5 days post seeding following 6 passages. Genes deemed essential are excluded from the knockout screen.

    [0608] Quantitative Analysis and Scoring of Knockdown and Knockout Library Screens

    [0609] Assay readouts from genetic perturbation screens are processed using the RNAither package (https://www.bioconductor.org/packages/release/bioc/html/RNAither.html) in the statistical computing environment R. The two datasets are normalized separately, using the following method. The readouts are first log transformed (natural logarithm), and robust Z-scores (using median and MAD “median absolute deviation” instead of mean and standard deviation) are then calculated for each 96-well plate separately. Z-scores of multiple replicates of the same perturbation are averaged into a final Z-score for presentation.

    Cryogenic Electron Microscopy (Cryo-EM)

    [0610] Co-Expression and Purification of Protein Complexes

    [0611] Protein components are coexpressed using a pET29-b(+) vector backbone where one protein is tag-less and one has an N-terminal 10×His-tag and SUMO-tag. LOBSTR E. coli cells are transformed and grown at 37° C. till O.D. (600 nm)=0.8 and the expression is induced at 37° C. with 1 mM IPTG for 4 hours. Frozen cell pellets are resuspended in 25 ml lysis buffer (200 mM NaCl, 50 mM Tris-HCl pH 8.0, 10% v/v glycerol, 2 mM MgCl.sub.2) per liter cell culture, supplemented with cOmplete protease inhibitor tablets (Roche), 1 mM PMSF (Sigma), 100 μg/ml lysozyme (Sigma), 5 μg/ml DNaseI (Sigma), and then homogenized with an immersion blender (Cuisinart). Cells are lysed by 3× passage through an Emulsiflex C3 cell disruptor (Avestin) at −15,000 psi, and the lysate clarified by ultracentrifugation at 100,000×g for 30 minutes at 4° C. The supernatant is collected, supplemented with 20 mM imidazole, loaded into a gravity flow column containing Ni-NTA superflow resin (Qiagen), and rocked with the resin at 4° C. for 1 hour. After allowing the column to drain, resin is rinsed twice with 5 column volumes (cv) of wash buffer (150 mM KCl, 30 mM Tris-HCl pH 8.0, 10% v/v glycerol, 20 mM imidazole, 0.5 mM tris(hydroxypropyl)phosphine (THP, VWR)) supplemented with 2 mM ATP (Sigma) and 4 mM MgCl.sub.2, then washed with 5 cv wash buffer with 40 mM imidazole. Resin is then rinsed with 5 cv Buffer A (50 mM KCl, 30 mM Tris-HCl pH 8.0, 5% glycerol, 0.5 mM THP) and protein is eluted with 2×2.5 cv Buffer A+300 mM imidazole. Elution fractions are combined, supplemented with Ulp1 protease, and rocked at 4° C. for 2 hours. Ulp1-digested Ni-NTA eluate is diluted 1:1 with additional Buffer A, loaded into a 50 ml Superloop, and applied to a MonoQ 10/100 column on an Äkta pure system (GE Healthcare) using 100% Buffer A, 0% Buffer B (1000 mM KCl, 30 mM Tris-HCl pH 8.0, 5% glycerol, 0.5 mM THP). The MonoQ column is washed with 0%-40% Buffer B gradient over 15 cv, peak fractions are analyzed by SDS-PAGE and the identity of the tagless protein and the other protein confirmed by intact protein mass spectrometry (Xevo G2-XS Mass Spectrometer, Waters). Peak fractions are concentrated using 10 kDa Amicon centrifugal filter (Millipore) and further purified by size exclusion chromatography using a Superdex 200 increase 10/300 GL column (GE healthcare) in buffer containing 150 mM KCl, mM HEPES-NaOH pH 7.5, 0.5 mM THP. Peak fractions are used directly for cryo-EM grid preparation.

    [0612] CryoEM Sample Preparation and Data Collection

    [0613] Three μL of purified protein complex (12.5 μM) is added to a 400 mesh 1.2/1.3R Au Quantifoil grid previously glow discharged at 15 mA for 30 seconds. Blotting is performed with a blot force of 0 for 5 seconds at 4° C. and 100% humidity in a FEI Vitrobot Mark IV (ThermoFisher) prior to plunge freezing into liquid ethane. 1534 118-frame super-resolution movies are collected with a 3×3 image shift collection strategy at a nominal magnification of 105,000× (physical pixel size: 0.834 Å/pix) on a Titan Krios (ThermoFisher) equipped with a K3 camera and a Bioquantum energy filter (Gatan) set to a slit width of 20 eV. Collection dose rate is 8 e-/pixel/second for a total dose of 66 e-/Å2. Defocus range was −0.7 um to −2.4 um. Each collection is performed with semi-automated scripts in SerialEM (D. N. Mastronarde, Automated electron microscope tomography using robust prediction of specimen movements. J Struct. Biol. 152, 36-51 (2005)).

    [0614] CryoEM Image Processing and Model Building

    [0615] 1534 movies are motion corrected using Motioncor2 (S. Q. Zheng, E. Palovcak, J.-P. Armache, K. A. Verba, Y. Cheng, D. A. Agard, MotionCor2: anisotropic correction of beam-induced motion for improved cryo-electron microscopy. Nat. Methods. 14, 331-332 (2017)) and dose-weighted summed micrographs are imported in cryosparc (v2.15.0). 1427 micrographs were curated based on CTF fit (better than 5 Å) from a patch CTF job. Template-based particle picking results in 2,805,121 particles and 1,616,691 particles are selected after 2D-classification. Five rounds of 3D-classification using multi-class ab-initio reconstruction and heterogenous refinement yields 178,373 particles. Homogenous refinement of these final particles leads to a 3.1 Å electron density map that is used for model building. The reconstruction is filtered by the masked FSC and sharpened with a b-factor of −145.

    [0616] To build the model of the protein complex, crystal structures of orthologous proteins are used as a scaffold, and are fit into the cryoEM density as a rigid body in UCSF ChimeraX and then relaxed into the final density using Rosetta FastRelax mover in torsion space. This model, along with a BLAST alignment of the two sequences (S. F. Altschul, et al., Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25, 3389-3402 (1997)), is used as a starting point for manual building using COOT (P. Emsley, K. Cowtan, Coot: model-building tools for molecular graphics. Acta Crystallogr. D Biol. Crystallogr. 60, 2126-2132 (2004)). After initial building by hand the regions with poor density fit/geometry are iteratively rebuilt using Rosetta (R. Y.-R. Wang, et al., Automated structure refinement of macromolecular assemblies from cryo-EM maps using Rosetta. Elife. 5 (2016), doi:10.7554/eLife.17219). Final densities can be built using COOT, informed and facilitated by the predictions of the TargetP-2.0, MitoFates, and JPRED servers. The model of the protein complex is submitted to the Namdinator web server (R. T. Kidmose, et al., Namdinator—automatic molecular dynamics flexible fitting of structural models into cryo-EM and crystallography experimental maps. IUCrJ. 6, 526-531 (2019)) and further refined in ISOLDE 1.0 (T. I. Croll, ISOLDE: a physically realistic environment for model building into low-resolution electron-density maps. Acta Crystallogr D Struct Biol. 74, 519-530 (2018)) using the plugin for UCSF ChimeraX (T. D. Goddard, et al., UCSF ChimeraX: Meeting modern challenges in visualization and analysis. Protein Sci. 27, 14-25 (2018)). Final model B-factors are estimated using Rosetta. The model is validated using phenix.validation_cryoem (P. V. Afonine, B. P. Klaholz, N. W. Moriarty, B. K. Poon, O. V. Sobolev, T. C. Terwilliger, P. D. Adams, A. Urzhumtsev, New tools for the analysis and validation of cryo-EM maps and atomic models. Acta Crystallogr D Struct Biol. 74, 814-840 (2018)). Molecular interface residues between the proteins in the complex are analyzed using the PISA web server (E. Krissinel, K. Henrick, Inference of macromolecular assemblies from crystalline state. J. Mol. Biol. 372, 774-797 (2007)). Figures are prepared using UCSF ChimeraX.

    Determination of 3-Dimensional Structure of a Protein of Interest

    [0617] It will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the scope or spirit of the invention. Other embodiments of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein. It is intended that the specification and examples be considered as exemplary only, with a true scope and spirit of the invention being indicated by the following claims.

    REFERENCES

    [0618] A comparative overview of COVID-19, MERS and SARS: Review article. Int. J Surg. 81, 1-8 (2020). [0619] J. H. Beigel, et al., Remdesivir for the treatment of Covid-19—preliminary report. N. Engl. J Med. [0620] T. R. C. Group, The RECOVERY Collaborative Group, Dexamethasone in Hospitalized Patients with Covid-19—Preliminary Report. New England Journal of Medicine (2020), doi:10.1056/nejmoa2021436. [0621] M. Becerra-Flores, T. Cardozo, SARS-CoV-2 viral spike G614 mutation exhibits higher case fatality rate. Int. J Clin. Pract. (2020), doi:10.1111/ijcp.13525. [0622] D. E. Gordon, et al., SARS-CoV-2 protein interaction map reveals targets for drug repurposing. Nature (2020), doi:10.1038/s41586-020-2286-9. [0623] G. Teo, et al., SAINTexpress: improvements and additional features in Significance Analysis of INTeractome software. J. Proteomics. 100, 37-43 (2014). [0624] S. Jäger, et al., Global landscape of HIV-human protein complexes. Nature. 481, 365-370 (2011). [0625] M. Giurgiu, et al., CORUM: the comprehensive resource of mammalian protein complexes-2019. Nucleic Acids Res. 47, D559-D563 (2019). [0626] J. C. Young, et al., Molecular chaperones Hsp90 and Hsp70 deliver preproteins to the mitochondrial import receptor Tom70. Cell. 112, 41-50 (2003). [0627] R. Lin, et al., Tom70 imports antiviral immunity to the mitochondria. Cell Res. 20, 971-973 (2010). [0628] B. Wei, et al., Tom70 mediates Sendai virus-induced apoptosis on mitochondria. J. Virol. 89, 3804-3818 (2015). [0629] A. M. Edmonson, et al., Characterization of a human import component of the mitochondrial outer membrane, TOMM70A. Cell Commun. Adhes. 9, 15-27 (2002). [0630] J. Brix, et al., Differential recognition of preproteins by the purified cytosolic domains of the mitochondrial import receptors Tom20, Tom22, and Tom70. J. Biol. Chem. 272, 20730-20735 (1997). [0631] J. Brix, et al., The mitochondrial import receptor Tom70: identification of a 25 kDa core domain with a specific binding site for preproteins. J. Mol. Biol. 303, 479-488 (2000). [0632] R. D. Mills, et al., Domain organization of the monomeric form of the Tom70 mitochondrial import receptor. J. Mol. Biol. 388, 1043-1058 (2009). [0633] S. D. Weeks, et al., X-ray Crystallographic Structure of Orf9b from SARS-CoV-2 (2020), doi:10.2210/pdb6z4u/pdb. [0634] M. Bouhaddou, et al., The Global Phosphorylation Landscape of SARS-CoV-2 Infection. Cell (2020), doi:10.1016/j.cell.2020.06.034. [0635] J. Li, et al., Molecular chaperone Hsp70/Hsp90 prepares the mitochondrial outer membrane translocon receptor Tom71 for preprotein loading. J Biol. Chem. 284, 23852-23859 (2009). [0636] X.-Y. Liu, et al., Tom70 mediates activation of interferon regulatory factor 3 on mitochondria. Cell Res. 20, 994-1011 (2010). [0637] B. E. Young, et al., Effects of a major deletion in the SARS-CoV-2 genome on the severity of infection and the inflammatory response: an observational cohort study. Lancet. 396, 603-611 (2020). [0638] M. Zaretsky, et al., Directed evolution of a soluble human IL-17A receptor for the inhibition of psoriasis plaque formation in a mouse model. Chem. Biol. 20, 202-211 (2013). [0639] Identification of a soluble isoform of human IL-17RA generated by alternative splicing. Cytokine. 64, 642-645 (2013). [0640] Biological functions and therapeutic opportunities of soluble cytokine receptors. Cytokine Growth Factor Rev. (2020), doi:10.1016/j.cytogfr.2020.04.003. [0641] M. Sammel, et al., Differences in Shedding of the Interleukin-11 Receptor by the Proteases ADAM9, ADAM10, ADAM17, Meprin α, Meprin β and MT1-MMP. Int. J. Mol. Sci. 20, 3677 (2019). [0642] B. B. Sun, et al., Genomic atlas of the human plasma proteome. Nature. 558, 73-79 (2018). [0643] Z. Zhu, et al., Causal associations between risk factors and common diseases inferred from GWAS summary data. Nat. Commun. 9, 224 (2018). [0644] C. Huang, Y et al., The COVID-19 Host Genetics Initiative, a global initiative to elucidate the role of host genetic factors in susceptibility and severity of the SARS-CoV-2 virus pandemic. Eur. J Hum. Genet. 28, 715-718 (2020). [0645] C. Amici, et al., Indomethacin has a potent antiviral activity against SARS coronavirus. Antivir. Ther. 11, 1021-1030 (2006). [0646] P. R. Rosenbaum, D. B. Rubin, The central role of the propensity score in observational studies for causal effects. Biometrika. 70, 41-55 (1983). [0647] C. Abate, et al., A structure-affinity and comparative molecular field analysis of sigma-2 (sigma2) receptor ligands. Cent. Nerv. Syst. Agents Med. Chem. 9, 246-257 (2009). [0648] R. A. Glennon, Sigma receptor ligands and the use thereof. US Patent (2000), (available at https://patentimages.storage.googleapis.com/dc/36/68/73f4ccdac4c973/U.S. Pat. No. 6,057,371.pdf).

    [0649] R. R. Matsumoto, B. Pouw, Correlation between neuroleptic binding to sigma(1) and sigma(2) receptors and acute dystonic reactions. Eur. J. Pharmacol. 401, 155-160 (2000). [0650] M. Dold, et al., Haloperidol versus first-generation antipsychotics for the treatment of schizophrenia and other psychotic disorders. Cochrane Database Syst. Rev. 1, CD009831 (2015). [0651] F. F. Moebius, et al., Pharmacological analysis of sterol delta8-delta7 isomerase proteins with [3H]ifenprodil. Mol. Pharmacol. 54, 591-598 (1998). [0652] E. Gregori-Puigjané, et al., Identifying mechanism-of-action targets for drugs and probes. Proc. Natl. Acad. Sci. U.S.A 109, 11178-11183 (2012). [0653] Z. Hubler, et al., Accumulation of 8,9-unsaturated sterols drives oligodendrocyte formation and remyelination. Nature. 560, 372-376 (2018). [0654] F. F. Moebius, et al., High affinity of sigma 1-binding sites for sterol isomerization inhibitors: evidence for a pharmacological relationship with the yeast sterol C8-C7 isomerase. Br. J Pharmacol. 121, 1-6 (1997). [0655] H.-W. Jiang, et al., SARS-CoV-2 Orf9b suppresses type I interferon responses by targeting TOM70. Cell. Mol. Immunol. 17, 998-1000 (2020). [0656] Y. Perez-Riverol, et al., The PRIDE database and related tools and resources in 2019: improving support for quantification data. Nucleic Acids Res. 47, D442-D450 (2019). [0657] J. J. Almagro Armenteros, et al., DeepLoc: prediction of protein subcellular localization using deep learning. Bioinformatics. 33, 3387-3395 (2017). [0658] C. Chiva, et al., QCloud: A cloud-based quality control system for mass spectrometry-based proteomics laboratories. PLoS One. 13, e0189209 (2018). [0659] J. Cox, M. Mann, MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification. Nat. Biotechnol. 26, 1367-1372 (2008). [0660] E. L. Huttlin, et al., The BioPlex Network: A Systematic Exploration of the Human Interactome. Cell. 162, 425-440 (2015). [0661] G. Yu, et al., clusterProfiler: an R package for comparing biological themes among gene clusters. OMICS. 16, 284-287 (2012). [0662] M. Remmert, et al., HHblits: lightning-fast iterative protein sequence searching by HMM-HMM alignment. Nat. Methods. 9, 173-175 (2011). [0663] J. Yang, et al., Improved protein structure prediction using predicted interresidue orientations. Proc. Natl. Acad. Sci. U.S.A 117, 1496-1503 (2020). [0664] Y. Zhai, et al., Insights into SARS-CoV transcription and replication from the structure of the nsp7-nsp8 hexadecamer. Nat. Struct. Mol. Biol. 12, 980-986 (2005). [0665] A. Waterhouse, et al., SWISS-MODEL: homology modelling of protein structures and complexes. Nucleic Acids Res. 46, W296—W303 (2018). [0666] J. Durairaj, et al., Geometricus Represents Protein Structures as Shape-mers Derived from Moment Invariants (2020), p. 2020.09.07.285569. [0667] M. Akdel, et al., Caretta—A multiple protein structure alignment and feature extraction suite. Comput. Struct. Biotechnol. J. 18, 981-992 (2020). [0668] P. Shannon, et al., Cytoscape: a software environment for integrated models of biomolecular interaction networks. Genome Res. 13, 2498-2504 (2003). [0669] R. T. Pillich, et al., NDEx: A Community Resource for Sharing and Publishing of Biological Networks. Methods Mol. Biol. 1558, 271-301 (2017). [0670] D. K. W. Chu, et al., Molecular Diagnosis of a Novel Coronavirus (2019-nCoV) Causing an Outbreak of Pneumonia. Clin. Chem. 66, 549-555 (2020). [0671] K. J. Livak, T. D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25, 402-408 (2001). [0672] R. Stoner, T. Maures, D. Conant, Methods and systems for guide ma design and use. US Patent (2019). [0673] T. Hsiau, et al., Inference of CRISPR Edits from Sanger Trace Data (2018), p. 251082. [0674] A. S. Jureka, et al., Propagation, Inactivation, and Safety Testing of SARS-CoV-2. Viruses. 12 (2020), doi:10.3390/v12060622. [0675] A. C. Y. Fan, et al., Hsp90 functions in the targeting and outer membrane translocation steps of Tom70-mediated mitochondrial import. J. Biol. Chem. 281, 33313-33324 (2006). [0676] S. Backes, et al., Tom70 enhances mitochondrial preprotein import efficiency by binding to internal targeting sequences. J Cell Biol. 217, 1369-1382 (2018). [0677] J. J. Almagro Armenteros, et al., Detecting sequence signals in targeting peptides using deep learning. Life Sci Alliance. 2 (2019), doi:10.26508/1sa.201900429. [0678] Y. Fukasawa, et al., MitoFates: improved prediction of mitochondrial targeting sequences and their cleavage sites. Mol. Cell. Proteomics. 14, 1113-1126 (2015). [0679] A. Drozdetskiy, et al., JPred4: a protein secondary structure prediction server. Nucleic Acids Res. 43, W389-94 (2015). [0680] D. N. Mastronarde, Automated electron microscope tomography using robust prediction of specimen movements. J Struct. Biol. 152, 36-51 (2005). [0681] S. Q. Zheng, et al., MotionCor2: anisotropic correction of beam-induced motion for improved cryo-electron microscopy. Nat. Methods. 14, 331-332 (2017). [0682] S. F. Altschul, et al., Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25, 3389-3402 (1997). [0683] P. Emsley, K. Cowtan, Coot: model-building tools for molecular graphics. Acta Crystallogr. D Biol. Crystallogr. 60, 2126-2132 (2004). [0684] R. Y.-R. Wang, et al., Automated structure refinement of macromolecular assemblies from cryo-EM maps using Rosetta. Elife. 5 (2016), doi:10.7554/eLife.17219. [0685] R. T. Kidmose, et al., Namdinator—automatic molecular dynamics flexible fitting of structural models into cryo-EM and crystallography experimental maps. IUCrJ. 6, 526-531 (2019). [0686] T. I. Croll, ISOLDE: a physically realistic environment for model building into low-resolution electron-density maps. Acta Crystallogr D Struct Biol. 74, 519-530 (2018). [0687] T. D. Goddard, et al., UCSF ChimeraX: Meeting modern challenges in visualization and analysis. Protein Sci. 27, 14-25 (2018). [0688] P. V. Afonine, et al., A. Urzhumtsev, New tools for the analysis and validation of cryo-EM maps and atomic models. Acta Crystallogr D Struct Biol. 74, 814-840 (2018). [0689] E. Krissinel, K. Henrick, Inference of macromolecular assemblies from crystalline state. J. Mol. Biol. 372, 774-797 (2007). [0690] A. N. Honko, et al., Rapid Quantification and Neutralization Assays for Novel Coronavirus SARS-CoV-2 Using Avicel RC-591 Semi-Solid Overlay. [0691] A. Sali, T. L. Blundell, Comparative protein modelling by satisfaction of spatial restraints. J. Mol. Biol. 234, 779-815 (1993). [0692] T. Yamada, et al., Crystal structure and possible catalytic mechanism of microsomal prostaglandin E synthase type 2 (mPGES-2). J. Mol. Biol. 348, 1163-1176 (2005). [0693] W. Yin, et al., Structural basis for inhibition of the RNA-dependent RNA polymerase from SARS-CoV-2 by remdesivir. Science. 368, 1499-1504 (2020). [0694] D. Kozakov, et al., The ClusPro web server for protein-protein docking. Nat. Protoc. 12, 255-278 (2017). [0695] B. G. Pierce, et al., ZDOCK server: interactive docking prediction of protein-protein complexes and symmetric multimers. Bioinformatics. 30, 1771-1773 (2014). [0696] Y. Yan, et al., The HDOCK server for integrated protein-protein docking. Nat. Protoc. 15, 1829-1852 (2020). [0697] A. Tovchigrechko, I. A. Vakser, GRAMM-X public web server for protein-protein docking. Nucleic Acids Res. 34, W310-4 (2006). [0698] M. Torchala, et al., SwarmDock: a server for flexible protein-protein docking. Bioinformatics. 29, 807-809 (2013). [0699] D. Schneidman-Duhovny, et al., PatchDock and SymmDock: servers for rigid and symmetric docking. Nucleic Acids Res. 33, W363-7 (2005). [0700] G. Q. Dong, H. Fan, D. Schneidman-Duhovny, B. Webb, A. Sali, Optimized atomic statistical potentials: assessment of protein interfaces and loops. Bioinformatics. 29, 3158-3166 (2013). [0701] J. Armstrong, et al., Progressive alignment with Cactus: a multiple-genome aligner for the thousand-genome era (2019), p. 730531. [0702] B. Paten, et al., Cactus: Algorithms for genome multiple sequence alignment. Genome Res. 21, 1512-1528 (2011). [0703] M. D. Smith, et al., Less Is More: An Adaptive Branch-Site Random Effects Model for Efficient Detection of Episodic Diversifying Selection. Mol. Biol. Evol. 32, 1342-1353 (2015). [0704] S. L. K. Pond, et al., HyPhy: hypothesis testing using phylogenies. Bioinformatics. 21, 676-679 (2004). [0705] K. S. Pollard, et al., Detection of nonneutral substitution rates on mammalian phylogenies. Genome Res. 20, 110-121 (2010). [0706] M. J. Hubisz, K. S. Pollard, A. Siepel, PHAST and RPHAST: phylogenetic analysis with space/time models. Brief Bioinform. 12, 41-51 (2011). [0707] R. Ramani, et al., PhastWeb: a web interface for evolutionary conservation scoring of multiple sequence alignments using phastCons and phyloP. Bioinformatics. 35, 2320-2322 (2019). [0708] W. A. Ray, Evaluating medication effects outside of clinical trials: new-user designs. Am. J. Epidemiol. 158, 915-920 (2003). [0709] S. Schneeweiss, A basic study design for expedited safety signal evaluation based on electronic healthcare data. Pharmacoepidemiol. Drug Saf 19, 858-868 (2010). [0710] H. Quan, et al., Coding algorithms for defining comorbidities in ICD-9-CM and ICD-10 administrative data. Med. Care. 43, 1130-1139 (2005). [0711] P. C. Austin, Balance diagnostics for comparing the distribution of baseline covariates between treatment groups in propensity-score matched samples. Stat. Med. 28, 3083-3107 (2009). [0712] WHO R&D Blueprint novel Coronavirus: COVID-19 Therapeutic Trial Synopsis. [0713] World Health Organization, 2020. [0714] J. Li, X. Qian, J. Hu, B. Sha, Crystal structure of Tom71 complexed with Hsp82 C-terminal fragment (2009), doi: 10.2210/pdb3fp2/pdb.