ANTIBODY-LIKE PROTEIN AND USE THEREOF
20230391893 · 2023-12-07
Inventors
Cpc classification
C07K2318/20
CHEMISTRY; METALLURGY
C07K2317/92
CHEMISTRY; METALLURGY
C07K2319/735
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
International classification
C07K16/28
CHEMISTRY; METALLURGY
Abstract
An antibody-like protein is formed by self-assembly of a plurality of ferritin monomers including at least CDR-ferritin monomers having a complementarity-determining region of an antibody fused thereto whereby the antibody-like protein has the complementarity-determining regions present at a high density on the surface or outside thereof so that even some of the complementarity-determining regions, such as HCDR3, etc., can bind to an antigen at an affinity level similar to that of the antibody, and the antibody-like protein possesses a structural feature advantageous for binding simultaneously to a plurality of antigens, and as such, has remarkably improved binding avidity, compared to the antibody. The antibody-like protein of the present invention is an antibody substitute that can be utilized in antibody-based uses and fields.
Claims
1. An antibody-like protein comprising self-assembly of a plurality of ferritin monomers, in which at least a CDR-ferritin monomer fused with a complementarity determining region is included.
2. The antibody-like protein according to claim 1, wherein the complementarity determining region is any one selected from the group consisting of HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, LCDR3, and conservative sequence variants thereof.
3. The antibody-like protein according to claim 1, wherein the complementarity determining region is exposed to a surface or outside of the protein for binding to an antigen.
4. The antibody-like protein according to claim 1, wherein the complementarity determining region has a length of 25aa or less.
5. The antibody-like protein according to claim 1, wherein the CDR-ferritin monomer is characterized in that the complementarity determining region is fused to a human ferritin heavy chain monomer.
6. The antibody-like protein according to claim 1, wherein the complementarity determining region is fused to any one selected from the group consisting of the inside of α-helix, between adjacent α-helices, N-terminus, C-terminus, A-B loop, B-C loop, C-D loop, D-E loop, between N-terminus and A helix, and between E helix and C-terminus of the ferritin monomer.
7. The antibody-like protein according to claim 1, wherein the CDR-ferritin monomer is characterized in that a plurality of complementarity determining regions of the antibody are fused to a single ferritin monomer.
8. The antibody-like protein according to claim 1, wherein the CDR-ferritin monomer is characterized in that at least one heavy chain complementarity determining region selected from the group consisting of HCDR1, HCDR2, HCDR3 and conservative sequence variants thereof of the antibody is fused to a single ferritin monomer.
9. The antibody-like protein according to claim 1, wherein the CDR-ferritin monomer is characterized in that at least one light chain complementarity determining region selected from the group consisting of LCDR1, LCDR2, LCDR3 and conservative sequence variants thereof of the antibody is fused to a single ferritin monomer.
10. The antibody-like protein according to claim 1, wherein the CDR-ferritin monomer comprises a heavy chain CDR-ferritin monomer to which at least one heavy chain complementarity determining region selected from the group consisting of HCDR1, HCDR2, HCDR3 and conservative sequence variants thereof of the antibody is fused, and a light chain CDR-ferritin monomer to which at least one light chain complementarity determining region selected from the group consisting of LCDR1, LCDR2, LCDR3 and conservative sequence variants thereof of the antibody is fused.
11. The antibody-like protein according to claim 1, wherein the complementarity determining region is fused to the DE loop or C-terminus of the CDR-ferritin monomer to form a four-fold symmetric structure.
12. The antibody-like protein according to claim 1, wherein the complementarity determining region is fused to the N-terminus, AB loop or BC loop of the CDR-ferritin monomer to form a two-fold symmetric structure.
13. The antibody-like protein according to claim 1, wherein the complementarity determining region is fused to the CD loop of the CDR-ferritin monomer to form a three-fold symmetric structure.
14. The antibody-like protein according to claim 1, wherein the complementarity determining regions are disposed to be spaced apart from each other by a distance of 0.7 to 7 nm.
15. The antibody-like protein according to claim 1, wherein the CDR-ferritin monomer is characterized in that each complementarity determining region of two or more antibodies is fused to a single ferritin monomer.
16. The antibody-like protein according to claim 1, wherein the CDR-ferritin monomer comprises a first CDR-ferritin monomer to which at least one complementarity determining region of a first antibody is fused, and a second CDR-ferritin monomer to which at least one complementarity determining region of a second antibody is fused.
17. The antibody-like protein according to claim 16, wherein the first CDR-ferritin monomer comprises a first heavy chain CDR-ferritin monomer to which at least one heavy chain complementarity determining region selected from the group consisting of HCDR1, HCDR2, HCDR3 and conservative sequence variants thereof of the first antibody is fused, and a first light chain CDR-ferritin monomer to which at least one light chain complementarity determining region selected from the group consisting of LCDR1, LCDR2, LCDR3 and conservative sequence variants thereof of the first antibody is fused.
18. The antibody-like protein according to claim 16, wherein the second CDR-ferritin monomer comprises a second heavy chain CDR-ferritin monomer to which at least one heavy chain complementarity determining region selected from the group consisting of HCDR1, HCDR2, HCDR3 and conservative sequence variants thereof of the second antibody is fused, and a second light chain CDR-ferritin monomer to which at least one light chain complementarity determining region selected from the group consisting of LCDR1, LCDR2, LCDR3 and conservative sequence variants thereof of the second antibody is fused.
19. The antibody-like protein according to claim 16, wherein the first CDR-ferritin monomer and the second CDR-ferritin monomer are included in a ratio of 1:1 to 1:5.
20. The antibody-like protein according to claim 1, wherein the CDR-ferritin monomer comprises at least a first CDR-ferritin monomer fused with a plurality of complementarity determining regions of a first antibody group including a plurality of different antibodies, and a second CDR-ferritin monomer fused with a plurality of complementarity determining regions of a second antibody group including a plurality of different antibodies.
21. The antibody-like protein according to claim 1, wherein the plurality of ferritin monomers include at least a ferritin monomer to which the complementarity determining region is not fused.
22. The antibody-like protein according to claim 1, wherein the protein is formed by self-assembly of 24 CDR-ferritin monomers.
23. The antibody-like protein according to claim 1, wherein the protein has a spherical shape with a particle diameter of 8 to 50 nm.
24. The antibody-like protein according to claim 1, wherein the affinity (Kd) to the antigen bound to the complementarity determining region is 1000 nM or less.
25. The antibody-like protein according to claim 1, wherein the antibody is an antibody against any one selected from the group consisting of PD-1, Her-2/neu, VISTA, 4-1BBL, CD48, Galectin-9, Adenosine A2a receptor, CD80, CD86, ICOS, ICOSL, BTLA, OX-40L, CD155, BCL2, MYC, PP2A, BRD1, BRD2, BRD3, BRD4, BRDT, CBP, E2F1, MDM2, MDMX, PPP2CA, PPM1D, STAT3, IDH1, PD-L1, PD-L2, CD40L, LAG3, TIM3, TIGIT, BTLA, CD52, SLAMF7, 4-1BB, OX-40, ICOS, GITR, CD27, CD28, CD16, CD3, CD20, EGFR family, AXL, CSF1R, DDR1, DDR2, EPH receptor family, FGFR family, VEGFR family, IGF1R, LTK, PDGFR family, RET, KIT, KRAS, NTRK1, NTRK2 and SARS-Cov.
26. The antibody-like protein according to claim 1, wherein the antibody is an antibody against any one selected from the group consisting of gp100, MART-1, Melna-A, MAGE-A3, MAGE-C2, Mammaglobin-A, proteinsase-3, mucin-1, HPV E6, LMP2, PSMA, GD2, hTERT, PAP, ERG, NA17, ALK, GM3, EPhA2, NA17-A, TRP-1, TRP-2, NY-ESO-1, CEA, CA 125, AFP, Survivin, AH1, ras, G17DT, MUC1, Her-2/neu, E75, p53, PSA, HCG, PRAME, WT1, URLC10, VEGFR1, VEGFR2, E7, Tyrosinase peptide, B16F10, EL4 and neoantigen.
27. The antibody-like protein according to claim 1, wherein the antibody is an antibody against an antigen of a cancer selected from the group consisting of brain cancer, head and neck cancer, bladder cancer, breast cancer, cervical cancer, colon cancer, colorectal cancer, endometrial cancer, esophageal cancer, leukemia, lung cancer, liver cancer, ovarian cancer, pancreatic cancer, prostate cancer, rectal cancer, kidney cancer, gastric cancer, testicular cancer, uterine cancer, vascular tumor, squamous cell carcinoma, adenocarcinoma, small cell carcinoma, melanoma, glioma, neuroblastoma, sarcoma, laryngeal cancer, parotid cancer, biliary tract cancer, thyroid cancer, actinic keratosis, acute lymphocytic leukemia, acute myeloid leukemia, adenoid cystic carcinoma, adenoma, adenoid squamous cell carcinoma, anal canal cancer, anal cancer, anorectal cancer, astrocytoma, ganglion adenocarcinoma, basal cell carcinoma, bile cancer, bone cancer, bone marrow cancer, bronchial cancer, bronchial carcinoma, carcinoid, cholangiocarcinoma, chronic lymphocytic leukemia, chronic myelogenous leukemia, clear cell carcinoma, connective tissue cancer, cystic adenoma, digestive system cancer, duodenal cancer, endocrine system cancer, endoderm sinus tumor, endometrial hyperplasia, endometrial adenocarcinoma, endothelial cell carcinoma, ependymal cell, epithelial cell carcinoma, orbital cancer, focal nodular hyperplasia, gallbladder cancer, palpebral cancer, gastrobasal cancer, gastrinoma, glioblastoma, glucagonoma, heart cancer, hemangioblastoma, hemangioendothelioma, hemangioma, hepatodenoma, liver adenoma, hepatobiliary cancer, hepatocellular carcinoma, Hodgkin's disease, ileal cancer, insulinoma, intraepithelial neoplasia, intraepithelial squamous cell neoplasia, intrahepatic biliary tract cancer, invasive squamous cell carcinoma, jejunum cancer, joint cancer, pelvic cancer, giant cell carcinoma, colon cancer, lymphoma, malignant mesothelial cell tumor, medulloblastoma, medullary epithelioma, meningeal cancer, mesothelial cancer, metastatic carcinoma, oral cancer, mucoepithelial carcinoma, multiple myeloma, muscle cancer, nasal duct cancer, nervous system cancer, non-epithelial skin cancer, non-Hodgkin's lymphoma, soft cell carcinoma, oligodendroglioma, oral cancer, osteosarcoma, papillary serous adenocarcinoma, penile cancer, pharyngeal cancer, pituitary tumor, plasmacytoma, pseudosarcoma, pulmonary blastoma, rectal cancer, renal cell carcinoma, respiratory system cancer, retina blastoma, serous carcinoma, sinus cancer, skin cancer, small cell carcinoma, small intestine cancer, smooth muscle cancer, soft tissue cancer, somatostatin-secreting tumor, spine cancer, squamous cell carcinoma, striatal muscle cancer, submesothelial carcinoma, T cell leukemia, tongue cancer, ureter cancer, urethral cancer, cervical cancer, uterine trunk cancer, vaginal cancer, VIPoma, vulvar cancer, highly differentiated carcinoma, and Wilm's tumor.
28. The antibody-like protein according to claim 1, wherein the antibody is an antibody against an infectious disease antigen.
29. The antibody-like protein according to claim 28, wherein the infectious disease is a bacterial, fungal, viral, parasitic or prion-induced disease.
30. A pharmaceutical composition for treatment or prevention of a disease, comprising the antibody-like protein according to claim 1.
31. A composition for diagnosis of a disease, comprising the antibody-like protein according to claim 1.
32. A method for detecting an antigen, comprising treating an antigen with the antibody-like protein according to claim 1.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
DETAILED DESCRIPTION
[0070] In one embodiment of the present invention, there is provided an antibody-like protein, in which a complementarity determining region of an antibody is formed by self-assembly of a plurality of ferritin monomers including at least a fused CDR-ferritin monomer, such that the complementarity determining region is present at a high density on the surface or outside of HCDR3, etc., wherein the antibody-like protein has significantly improved avidity compared to antibodies since it can bind to an antigen with a similar level of affinity to an antibody with only the complementarity determining region of the antibody and has advantageous structural properties for simultaneous binding with a plurality of antigens.
[0071] The antibody-like protein of the present invention is formed by self-assembly of ferritin monomers. In eukaryotic ferritin, 24 monomers come together to form a spherical three-dimensional structure.
[0072] The ferritin monomer useable in the present invention is not limited in origin and sequence. The ferritin monomer of the present invention includes human ferritin monomers. Human heavy chain ferritin monomer or human light chain ferritin monomer may be used as the human ferritin monomer. The human heavy chain ferritin monomer and human light chain ferritin monomer may also be used together.
[0073] Human ferritin consists of a heavy chain (21 kDa) and a light chain (19 kDa), and 24 monomers form a self-assembly.
[0074] The human ferritin has an outer diameter of about 12 nm and an inner diameter of about 8 nm. A structure of the ferritin monomer may include a form in which five α-helix structures, that is, A helix, B helix, C helix, D helix and E helix, are sequentially connected, and a non-canonical polypeptide moiety to link polypeptides each having α-helix structure called a loop is included.
[0075] The loop refers to a region that is not structurally broken even when the complementarity determining region is inserted into the ferritin monomer. In the present invention, a loop for linking A helix and B helix is called A-B loop, a loop for linking B helix and C helix is called B-C loop, a loop for linking C helix and D helix is called C-D loop, and a loop for linking D helix and E helix is called D-E loop.
[0076] Information on ferritin monomers is known from the NCBI (GenBank Accession No. NM_000146, NM_002032, etc.).
[0077] The ferritin monomer may be a ferritin heavy chain monomer, and specifically, a human ferritin heavy chain monomer. The human ferritin heavy chain monomer (huHF) may be a protein represented by the amino acid sequence of SEQ ID NO: 1 derived from human.
[0078] The ferritin heavy chain monomer may have some sequences mutated so that the affinity to the transferrin receptor is reduced. For example, in the case of a human ferritin heavy chain monomer, amino acids 15, 16, 23, 82 or 84 in the sequence of SEQ ID NO: 1 may be substituted with alanine, glycine, valine or leucine.
[0079] CDR-ferritin monomer is a ferritin monomer to which a complementarity determining region is fused. The antibody-like protein of the present invention may be formed by self-assembly of a plurality of ferritin monomers, wherein at least one CDR-ferritin monomer is included in the plurality of ferritin monomers. In this case, 24 or less of CDR-ferritin monomers may be included.
[0080] The complementarity determining region refers to any one selected from the group consisting of HCDR1, HCDR2, HCDR3, LCDR1, LCDR2 and LCDR3 of an antibody. The complementarity determining region may also include conservative sequence variants thereof.
[0081] The conservative sequence variant refers to variants of the amino acid sequence that do not significantly affect or change the binding properties of the complementarity determining region having a specific amino acid sequence, or have improved binding properties. Such conservative sequence variants may include substitutions, additions, and deletions of amino acids. Conservative amino acid substitutions may include substituting an amino acid residue with another amino acid residue having a similar side chain. A group of amino acid residues having similar side chains has been defined in the art. These groups may include amino acids having basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), non-polar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).
[0082] The complementarity determining region is exposed to the surface on or outside of the antibody-like protein for binding with the antigen.
[0083] The complementarity determining region has a length capable of being fused to the ferritin monomer. For example, the length may be 25aa or less. If the length is 25aa or less, it is suitable for the complementarity determining region to be exposed to the surface or the outside after an antibody-like protein is formed by self-assembly without interfering with self-assembly by the ferritin monomer.
[0084] The length of the complementarity determining region may be, for example, 25aa or less, 20aa or less, 19aa or less, 18aa or less, 17aa or less, 16aa or less, 15aa or less, 14aa or less, 13aa or less, 12aa or less, 11aa or less, 10aa or less, 9aa or less, etc. Further, for example, it may be 3aa or more, 4aa or more, 5aa or more, 6aa or more.
[0085] The complementarity determining region is fused to any one selected from the group consisting of the inside of α-helix, between adjacent α-helices, N-terminus, C-terminus, A-B loop, B-C loop, C-D loop, D-E loop, between N-terminus and A helix, and between E helix and C-terminus. The position at which the complementarity determining region is to be fused may be determined among the above-listed sites of the ferritin monomer, in consideration of the three-dimensional arrangement of the complementarity determining region in the antibody, the distance therebetween, the degree of influence on the specific binding with the antigen and the like.
[0086] A CDR-ferritin monomer is a fusion of one or more complementarity determining regions. The CDR-ferritin monomer may be a fusion of at least one heavy chain complementarity determining region selected from the group consisting of HCDR1, HCDR2, HCDR3 and conservative sequence variants thereof of an antibody. Alternatively, the CDR-ferritin monomer may be a fusion of at least one light chain complementarity determining region selected from the group consisting of LCDR1, LCDR2, LCDR3, and conservative sequence variants thereof of an antibody.
[0087] The complementarity determining region for one antibody may be fused to one CDR-ferritin monomer or to a plurality of CDR-ferritin monomers.
[0088] One CDR-ferritin monomer may be fused with a complementarity determining region for one antibody, or complementarity determining regions for a plurality of antibodies.
[0089] From 1 to 24 CDR-ferritin monomers may participate in self-assembly. Alternatively, from 0 to 23 ferritin monomers to which the complementarity determining region is not fused may participate in self-assembly.
[0090] For example, 24 CDR-ferritin monomers may be self-assembled to form an antibody-like protein. For example, 12 CDR-ferritin monomers and 12 ferritin monomers to which complementarity determining regions are not fused may be self-assembled to form an antibody-like protein. For example, 12 first CDR-ferritin monomers for a first antibody and 12 second CDR-ferritin monomers for a second antibody may be self-assembled to form an antibody-like protein. For example, 12 heavy chain CDR-ferritin monomers to which heavy chain complementarity determining regions (HCDR1, HCDR2, HCDR3 or a conservative sequence variant thereof) for any antibody are fused, and 12 light chain CDR-ferritin monomers to which light chain complementarity determining regions (LCDR1, LCDR2, LCDR3 or a conservative sequence variant thereof) for the same antibody are fused, respectively, may be self-assembled to form an antibody-like protein. In addition, for example, 12 first CDR-ferritin monomers to which a plurality of complementarity determining regions of a first antibody group including a plurality of different antibodies are fused, and 12 second CDR-ferritin monomers to which a plurality of complementarity determining regions of a second antibody group including a plurality of different antibodies are fused, respectively, may be self-assembled to form an antibody-like protein.
[0091] Which position of the ferritin monomer the entire portion or a portion of the complementarity determining region is fused may be determined in consideration of the distance between the complementarity determining regions of the antibody, affinity and avidity to be required, and the contribution of each complementarity determining region to binding.
[0092] Depending on the number of self-assembled CDR-ferritin monomers, the number of complementarity determining regions included in the monomer, the fusion position of the complementarity determining regions, and the density of the complementarity determining regions after self-assembly, and the like, the affinity and avidity of an antibody-like protein may be adjusted.
[0093] Among the complementarity determining regions of the antibody, only a portion having major effects on the binding with an antigen may be selected and fused to a ferritin monomer. Depending on the type of antibody, if 1, 2, 3, 4 or 5 of total 6 complementarity determining regions have major effects on the binding with the antigen, only some of the complementarity determining regions having major effects may be fused to the ferritin monomer thus to prepare a CDR-ferritin monomer. For example, a CDR-ferritin monomer may be prepared by fusing only HCDR3 of an antibody to a ferritin monomer. For example, only HCDR3 and LCDR3 of an antibody may be selected and fused to a ferritin monomer thus to prepare a CDR-ferritin monomer.
[0094] When the complementarity determining region is fused to the DE loop or C-terminus of the CDR-ferritin monomer, it may form a four-fold symmetric structure. By utilizing such a four-fold symmetric structure, the arrangement and distance between the complementarity determining regions on the surface of an antibody-like protein may be made similar to the arrangement and distance between the complementarity determining regions of an antibody. For example, when 12 heavy chain CDR-ferritin monomers in which a heavy chain complementarity determining region (at least one of HCDR1, HCDR2, HCDR3 and conservative sequence variants thereof) is fused at the C-terminus of each ferritin monomer, and 12 light chain CDR-ferritin monomers in which a light chain complementarity determining region (at least one of LCDR1, LCDR2, LCDR3 and conservative sequence variants thereof) is fused at the C-terminus of each ferritin monomer, respectively, are self-assembled in the same ratio, the heavy chain complementarity determining region and the light chain complementarity determining region may be displayed on the surface of the antibody-like protein with being spaced apart from the antibody by a similar distance.
[0095] When the complementarity determining region is fused to the N-terminus, AB loop or BC loop of the CDR-ferritin monomer, a two-fold symmetric structure may be formed. By utilizing such a two-fold symmetric structure, the arrangement and distance between the complementarity determining regions on the surface of the antibody-like protein can be made similar to the arrangement and distance between the complementarity determining regions of an antibody. In particular, the BC loop is relatively long, such that it is suitable for fusing the complementarity determining regions at an appropriate position in consideration of the arrangement and distance between the complementarity determining regions. For example, when 12 heavy chain CDR-ferritin monomers in which HCDR1, HCDR2 and HCDR3 (or conservative sequence variants thereof) corresponding to the heavy chain complementarity determining regions are fused to the BC loop of each ferritin monomer while being spaced apart by a distance similar to that in an antibody, and light chain CDR-ferritin monomers in which LCDR1, LCDR2 and LCDR3 (or conservative sequence variants thereof) corresponding to the light chain complementarity determining regions are fused to the BC loop of another ferritin monomer with being spaced apart by a distance similar to that in the antibody, respectively, are self-assembled at the same ratio, the heavy chain complementarity determining region and the light chain complementarity determining region may be displayed on the surface of the antibody-like protein with being spaced apart therefrom by a distance similar to that of the antibody.
[0096] When the complementarity determining region is fused to the CD loop of the CDR-ferritin monomer, a three-fold symmetric structure may be formed. For example, when some complementarity determining regions (e.g., HCDR3) known to serve an important role in antigen binding are fused to the CD loop of a CDR-ferritin monomer, an antibody-like protein having a density of HCDR3 three (3) times higher than that of the antibody may be prepared.
[0097] Depending on which loop, terminus or helix of the ferritin monomer the complementarity determining region is fused to, and which position the loop, terminus or helix is fused to, a distance to the adjacent complementarity determining region may vary when the CDR-ferritin monomer is fused to form an antibody-like protein.
[0098] For example, the distance between the complementarity determining regions may be 0.7 nm, 0.75 nm, 0.8 nm, 0.85 nm, 0.9 nm, 0.95 nm, 1.0 nm, 1.05 nm. 1.1 nm, 1.15 nm, 1.2 nm, 1.25 nm, 1.3 nm, 1.35 nm, 1.4 nm, 1.45 nm, 1.5 nm, 1.55 nm, 1.6 nm, 1.65 nm, 1.7 nm, 1.75 nm, 1.8 nm, 1.85 nm, 1.9 nm, 1.95 nm, 2.0 nm, 2.05 nm, 2.1 nm, 2.15 nm, 2.2 nm, 2.25 nm, 2.3 nm, 2.35 nm, 2.4 nm, 2.45 nm, 2.5 nm, 2.55 nm, 2.6 nm, 2.65 nm, 2.7 nm, 2.75 nm, 2.8 nm, 2.85 nm, 2.9 nm, 2.95 nm, 3.0 nm, 3.05 nm, 3.1 nm, 3.15 nm, 3.2 nm, 3.25 nm, 3.3 nm, 3.35 nm, 3.4 nm, 3.45 nm, 3.5 nm, 3.55 nm, 3.6 nm, 3.65 nm, 3.7 nm, 3.75 nm, 3.8 nm, 3.85 nm, 3.9 nm, 3.95 nm, 4.0 nm, 4.05 nm, 4.1 nm, 4.15 nm, 4.2 nm, 4.25 nm, 4.3 nm, 4.35 nm, 4.4 nm, 4.45 nm, 4.5 nm, 4.55 nm, 4.6 nm, 4.65 nm, 4.7 nm, 4.75 nm, 4.8 nm, 4.85 nm, 4.9 nm, 4.95 nm, 5.0 nm, 5.05 nm, 5.1 nm, 5.15 nm, 5.2 nm, 5.25 nm, 5.3 nm, 5.35 nm, 5.4 nm, 5.45 nm, 5.5 nm, 5.55 nm, 5.6 nm, 5.65 nm, 5.7 nm, 5.75 nm, 5.8 nm, 5.85 nm, 5.9 nm, 5.95 nm, 6.0 nm, 6.05 nm, 6.1 nm, 6.15 nm, 6.2 nm, 6.25 nm, 6.3 nm, 6.35 nm, 6.4 nm, 6.45 nm, 6.5 nm, 6.55 nm, 6.6 nm, 6.65 nm, 6.7 nm, 6.75 nm, 6.8 nm, 6.85 nm, 6.9 nm, 6.95 nm or 7.0 nm
[0099] The antibody is a protein having a complementarity determining region. For example, antibodies, antigen-binding their fragments, and the like belonging to classes IgA, IGD, IgE, IgG, IgM, IgY, IgW, etc. may be included.
[0100] Further, the antibody may include an antibody to a disease antigen, an antibody to an immune checkpoint molecule, an antibody to an antigen to be detected for the purpose of diagnosis, prediction, evaluation, etc., or an antibody to an antigen that is a treatment target for a disease and the like.
[0101] The disease antigen may be an antigen causing a disease, a surface or internal antigen of a disease cell and the like. The diseased cells may be pathogen cells, pathogen-infected cells and the like.
[0102] The disease refers to any disease that can be treated by an antibody. For example, infectious diseases, cancer, inflammatory diseases, and the like may be included.
[0103] The infectious disease may be, for example, any disease caused by viruses, bacteria, fungi, parasites or prions.
[0104] Inflammatory diseases may include, for example, atherosclerosis, arteriosclerosis, autoimmune disease, multiple sclerosis, systemic lupus erythematosus, polymyalgia rheumatica, gouty arthritis, degenerative arthritis, tendinitis, bursitis, psoriasis, cystic fibrosis, osteoarthritis, rheumatoid arthritis, inflammatory arthritis, Sjogren's syndrome, giant cell arteritis, progressive systemic sclerosis (scleroderma), ankylosing spondylitis, polymyositis, dermatomyositis, pemphigus psoriasis, diabetes (e.g., type I), myasthenia gravis, Hashimoto's thyroiditis, Graves' disease, Goodpasture's disease, mixed connective tissue disease, sclerosing cholangitis, inflammatory bowel disease, Crohn's disease, ulcerative colitis, pernicious anemia, inflammatory dermatosis, common interstitial pneumonia, asbestosis, silicosis, bronchiectasis, beryllosis, talcosis, pneumoconiosis, sarcoidosis, dissecting interstitial pneumonia, lymphocytic interstitial pneumonia, giant cell interstitial pneumonia, cellular interstitial pneumonia, exogenous allergic alveolitis, Wegener's granulomatosis and related forms of vasculitis (temporal arteritis and polyarteritis nodosa), inflammatory dermatitis, hepatitis, delayed-type hypersensitivity reactions (e.g. poison ivy), pneumonia, respiratory tract infections, adult respiratory distress syndrome, encephalitis, immediate hypersensitivity reactions, asthma, hay fever, allergies, acute anaphylaxis, rheumatic fever, glomerulonephritis, pyelonephritis, cellulitis, cystitis, chronic cholecystitis, ischemia (ischemic injury), reperfusion injury, allograft rejection, host versus graft rejection, appendicitis, arteritis, blepharitis, bronchiolitis, bronchitis, cervicitis, cholangitis, chorioamnionitis, conjunctivitis, laryngitis, dermatomyositis, endocarditis, endometritis, enteritis, enterocolitis, epicondylitis, epididymitis, fasciitis, fibrosis, gastritis, gastroenteritis, gingivitis, ileitis, iritis, laryngitis, myelitis, myocarditis, nephritis, umbilical corditis, oophoritis, orchitis, osteitis, otitis, pancreatitis, parotitis, pericarditis, pharyngitis, pleurisy, phlebitis, pneumonia, proctitis, prostatitis, rhinitis, salpingitis, sinusitis, stomatitis, synovitis, orchitis, tonsillitis, urethritis, cystitis, uveitis, vaginitis, vasculitis, vulvitis, vulvovaginitis, vasculitis, chronic bronchitis, osteomyelitis, optic neuritis, temporal arteritis, transverse myelitis, necrotizing fasciitis and necrotizing enterocolitis.
[0105] For example, the cancer may be a cancer selected from the group consisting of brain cancer, head and neck cancer, bladder cancer, breast cancer, cervical cancer, colon cancer, colorectal cancer, endometrial cancer, esophageal cancer, leukemia, lung cancer, liver cancer, ovarian cancer, pancreatic cancer, prostate cancer, rectal cancer, kidney cancer, gastric cancer, testicular cancer, uterine cancer, vascular tumor, squamous cell carcinoma, adenocarcinoma, small cell carcinoma, melanoma, glioma, neuroblastoma, sarcoma, laryngeal cancer, parotid cancer, biliary tract cancer, thyroid cancer, actinic keratosis, acute lymphocytic leukemia, acute myeloid leukemia, adenoid cystic carcinoma, adenoma, adenoid squamous cell carcinoma, anal canal cancer, anal cancer, anorectal cancer, astrocytoma, ganglion adenocarcinoma, basal cell carcinoma, bile cancer, bone cancer, bone marrow cancer, bronchial cancer, bronchial carcinoma, carcinoid, cholangiocarcinoma, chronic lymphocytic leukemia, chronic myelogenous leukemia, clear cell carcinoma, connective tissue cancer, cystic adenoma, digestive system cancer, duodenal cancer, endocrine system cancer, endoderm sinus tumor, endometrial hyperplasia, endometrial adenocarcinoma, endothelial cell carcinoma, ependymal cell, epithelial cell carcinoma, orbital cancer, focal nodular hyperplasia, gallbladder cancer, palpebral cancer, gastrobasal cancer, gastrinoma, glioblastoma, glucagonoma, heart cancer, hemangioblastoma, hemangioendothelioma, hemangioma, hepatodenoma, liver adenoma, hepatobiliary cancer, hepatocellular carcinoma, Hodgkin's disease, ileal cancer, insulinoma, intraepithelial neoplasia, intraepithelial squamous cell neoplasia, intrahepatic biliary tract cancer, invasive squamous cell carcinoma, jejunum cancer, joint cancer, pelvic cancer, giant cell carcinoma, colon cancer, lymphoma, malignant mesothelial cell tumor, medulloblastoma, medullary epithelioma, meningeal cancer, mesothelial cancer, metastatic carcinoma, oral cancer, mucoepithelial carcinoma, multiple myeloma, muscle cancer, nasal duct cancer, nervous system cancer, non-epithelial skin cancer, non-Hodgkin's lymphoma, soft cell carcinoma, oligodendroglioma, oral cancer, osteosarcoma, papillary serous adenocarcinoma, penile cancer, pharyngeal cancer, pituitary tumor, plasmacytoma, pseudosarcoma, pulmonary blastoma, rectal cancer, renal cell carcinoma, respiratory system cancer, retina blastoma, serous carcinoma, sinus cancer, skin cancer, small cell carcinoma, small intestine cancer, smooth muscle cancer, soft tissue cancer, somatostatin-secreting tumor, spine cancer, squamous cell carcinoma, striatal muscle cancer, submesothelial carcinoma, T cell leukemia, tongue cancer, ureter cancer, urethral cancer, cervical cancer, uterine trunk cancer, vaginal cancer, VIPoma, vulvar cancer, highly differentiated carcinoma, and Wilm's tumor
[0106] The inflammatory disease antigen may be, for example, an inflammatory cytokine. For example, growth hormone such as human growth hormone, N-methionyl human growth hormone and bovine growth hormone; parathyroid hormone; thyroxine; insulin; proinsulin; relaxin; prorelaxin; glycoprotein hormones such as follicle stimulating hormone (FSH), thyroid stimulating hormone (TSH) and luteinizing hormone (LH); hepatic growth factor; fibroblast growth factor; prolactin; placental lactogen; tumor necrosis factor such as tumor necrosis factor-alpha (TNF-α) and tumor necrosis factor-beta (TNF-β); mullerian-inhibitory substances; mouse gonadotropin-associated peptide; inhibin; activin; vascular endothelial growth factor; integrin; human platelet production promoter (thrombopoietin, TPO); nerve growth factors such as NGF-alpha (NGF-α); platelet-growth factor; placental growth factor; transforming growth factors (TGF) such as TGF-α and TGF-β; insulin-like growth factor-1 and -11; erythropoietin (EPO); osteoinductive factors; interferons such as interferon-alpha (IFN-α), interferon-beta (IFN-β) and interferon-gamma (IFN-γ); colony stimulating factors (CSF) such as macrophage-CSF (M-CSF); granulocyte macrophage-CSF (GM-CSF); granulocyte-CSF (G-CSF); interleukins such as IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-15, IL-17, IL-18, IL-21, IL-22, IL-23, IL-33, etc.; and other polypeptide factors including LIF and kit ligand (KL).
[0107] Cancer antigens may include, for example, gp100, MART-1, Melna-A, MAGE-A3, MAGE-C2, Mammaglobin-A, proteinsase-3, mucin-1, HPV E6, LMP2, PSMA, GD2, hTERT, PAP, ERG, NA17, ALK, GM3, EPhA2, NA17-A, TRP-1, TRP-2, NY-ESO-1, CEA, CA 125, AFP, Survivin, AH1, ras, G17DT, MUC1, Her-2/neu, E75, p53, PSA, HCG, PRAME, WT1, URLC10, VEGFR1, VEGFR2, E7, tyrosinase peptide, B16F10, EL4 neoantigen, etc. The neoantigen refers to an immunogenic peptide induced and formed by somatic mutation in tumor cells. The neoantigen forms a complex with MHC I, then moves to the surface of tumor cells, and may be displayed as an antigenic epitope. T-cell receptor (TCR) recognizes this neoantigen-MHC I complex and thus may induce an immune response.
[0108] The immune checkpoint molecule may be, for example, PD-L1, PD1, CTLA4, LAG3, TIM3 or TIGIT.
[0109] The antibody may be, for example, an antibody against an immune checkpoint molecule on the surface of a cancer cell or T cell. For example, the antibody may be PD-1, Her-2/neu, VISTA, 4-1BBL, CD48, Galectin-9, Adenosine A2a receptor, CD80, CD86, ICOS, ICOSL, BTLA, OX-40L, CD155, BCL2, MYC, PP2A, BRD1, BRD2, BRD3, BRD4, BRDT, CBP, E2F1, MDM2, MDMX, PPP2CA, PPM1D, STAT3, IDH1, PD-L1, PD-L2, CD40L, LAG3, TIM3, TIGIT, BTLA, CD52, SLAMF7, 4-1BB, OX-40, ICOS, GITR, CD27, CD28, CD16, CD3, CD20, EGFR family, AXL, CSF1R, DDR1, DDR2, EPH receptor family, FGFR family, VEGFR family, IGF1R, LTK, PDGFR family, RET, KIT, KRAS, NTRK1 or NTRK2
[0110] The antigen to be detected may be, for example, a biomarker, and may include, for example, a biomarker for disease diagnosis, a biomarker for predicting disease occurrence, a biomarker for prognostic diagnosis of a specific drug, etc., but it is not limited thereto.
[0111] Hereinafter, the antibody-like protein of the present invention will be described with reference to
[0112]
[0113] For example, according to self-assembly of 24 CDR-ferritin monomers fused with a complementarity determining region at the sites shown in
[0114] The above regulation can be applied similarly even when a plurality of complementarity determining regions for a plurality of antibodies are fused. For example, when the complementarity determining regions of different antibodies are dense, antigen binding may be hindered by steric hindrance, and thus the complementarity determining regions of the different antibodies may be controlled not to be dense. This may be controlled, for example, by fusing the complementarity determining regions to different regions of each CDR-ferritin monomer in the first CDR-ferritin monomer and the second CDR-ferritin monomer to which the complementarity determining regions of different antibodies are fused respectively.
[0115] Further, for example, it is possible to regulate LCDR1, LCDR2 and LCDR3 to be dense, HCDR1, HCDR2 and HCDR3 to be gathered, or all of them to be gathered, such that the complementarity determining region of the same antibody mimics the structure of an antibody in the first CDR-ferritin monomer and the second CDR-ferritin monomer to which the complementarity determining regions are fused at the same site. The above process may be controlled by, for example, fusing the complementarity determining regions at the same site in the first and second CDR-ferritin monomers. For example, the above process may be controlled by fusing the CDRs at a site where a 3-fold symmetric structure is formed. This may be, for example, a C-D loop. For example, when HCDR1 of a specific antibody is fused to the C-D loop of the first CDR-ferritin monomer while HCDR2 and HCDR3 of the same antibody are fused to the C-D loop of the second CDR-ferritin monomer, and thus these are self-assembled, an antibody-like protein in which HCDR1, HCDR2 and HCDR3 are densed in the 3-fold symmetric structure, may be obtained.
[0116]
[0117] The antibody-like protein of the present invention may exhibit excellent affinity to an antigen. The affinity can be variously adjusted depending on the fusion position of the complementarity determining regions, a degree of application of a plurality of complementarity determining regions, etc. For example, the affinity (Kd) to an antigen corresponding to the complementarity determining region of CDR-ferritin monomer may be 1000 nM or less. Within the above range, it may be 1000 nM or less, 900 nM or less, 800 nM or less, 700 nM or less, 600 nM or less, 500 nM or less, 400 nM or less, 300 nM or less, 200 nM or less, 150 nM or less, 100 nM or less, etc. The lower limit is not limited and may be, for example, 1 nM, 5 nM, 10 nM, 20 nM, 30 nM, 40 nM, 50 nM or the like. The affinity may be measured, for example, by an ELISA method.
[0118] When the antibody-like protein of the present invention forms particles, a particle diameter may be, for example, 8 to 50 nm. Specifically, it may be 8 to 50 nm, 8 to 45 nm, 8 to 40 nm, 8 to 35 nm, 8 to 30 nm, 8 to 25 nm, 8 to 20 nm, 8 to 15 nm, etc., but it is not limited thereto.
[0119] Since the antibody-like protein of the present invention uses only CDRs in the composition of an antibody as described above, it may not induce an unnecessary immune response due to use of the entire antibody sequence.
[0120] Further, since the ferritin protein can be stored at room temperature, the antibody-like protein of the present invention does not need to be refrigerated.
[0121] In addition, the present invention relates to a pharmaceutical composition for treating or preventing a disease, including the antibody-like protein.
[0122] It is natural to use the CDR of the antibody suitable for the target disease, the pharmaceutical composition for treatment of a disease according to the present invention is not only usable for the treatment of a specific disease, but also applicable to all diseases that can be alleviated, treated, or improved by the use of the antibody. As the disease to be treated herein, any disease known to be treatable by application of an antibody may be applied without limitation thereof, and may include, for example, an infectious disease, an inflammatory disease, cancer or the like. Specific examples thereof are the same as described above.
[0123] The CDR fused to the antibody-like protein of the present invention may be CDRs of an antibody to a disease antigen or an antibody to a therapeutic target substance in a disease.
[0124] The pharmaceutical composition of the present invention may further include an active substance known in the art for a target disease, a therapeutic agent and the like.
[0125] The active substances, therapeutic agents, etc., which can be additionally included, may be contained in the self-assembled structure, but they are not limited thereto.
[0126] The pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier. As used herein, the term “pharmaceutically acceptable carrier” refers to a carrier or diluent that does not significantly stimulate the organism and does not inhibit the biological activity and properties of the administered component. The pharmaceutically acceptable carrier in the present invention may include one component of saline, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, and a mixture of one or more of these components. Other commonly used additives such as antioxidants, buffers and bacteriostatic agents may be added if necessary, thereby producing an injection formulation suitable for injection into tissues or organs. Further, it may be formulated as an isotonic sterile solution or, in some cases, a dry preparation (especially a freeze-dried preparation) that can become an injectable solution by adding sterile water or physiological saline to the administered component. In addition, a target organ-specific antibody or other ligands may be used in combination with the carrier so as to act specifically on the target organ.
[0127] Further, the composition of the present invention may further include a filler, excipient, disintegrant, binder or lubricant. Furthermore, the compositions of the present invention may be formulated using methods known in the art to provide rapid, sustained or delayed release of the active ingredient after administration to a mammal.
[0128] In one embodiment, the pharmaceutical composition may be an injection formulation and may be administered intravenously, but it is not limited thereto.
[0129] As used herein, the term “effective amount” refers to an amount necessary to delay the onset or progression of a specific disease to be treated or to completely improve the same.
[0130] In the present invention, the composition may be administered in a pharmaceutically effective amount. It is apparent to those skilled in the art that a proper total daily amount of the pharmaceutical composition can be determined by a physician for treatment within the scope of reasonable medical judgment.
[0131] For the purposes of the present invention, it is preferable that a specific pharmaceutically effective amount for a specific patient is differently applied depending on a specific composition, including the type and extent of the response to be achieved, in some cases, various factors including whether other agents are used, the specific composition, the patient's age, weight, general health status, gender and diet, administration time, administration route and secretion rate of the composition, treatment period, and drugs used or concurrently with the specific composition, as well as similar factors well known in the pharmaceutical field.
[0132] In the present invention, the pharmaceutical composition may be accompanied by instructions associated with packaging in a form instructed by a government agency in charge of the manufacture, use and sale of drugs if necessary, and the instructions indicate the approval of any private interest organization in relation of the form of a composition or administration to human or animals and may be, for example, a label approved by the US Food and Drug Administration for the prescription of a drug.
[0133] Further, the present invention relates to a composition for detecting a target substance, which includes the antibody-like protein.
[0134] The composition of the present invention includes the protein described above, and can confirm/detect the presence or absence of a target material based on whether to bind to the target material.
[0135] The target material may be, for example, a biomarker. For example, the target material may include a biomarker for diagnosing a disease, a biomarker for predicting the possibility of a disease, a biomarker for predicting the sensitivity of a specific drug, etc., but it is not limited thereto.
[0136] When the target substance is a biomarker for diagnosing a disease, the composition of the present invention may be used as a composition for diagnosing a disease.
[0137] The antibody CDR may be a CDR of an antibody to a target substance.
[0138] For easy detection/identification of the target substance, the antibody CDR, ferritin monomer or protein may be labeled with a fluorescent dye, a radioactive isotope, or the like, but it is not limited thereto.
[0139] The composition of the present invention may be treated with a sample to be checked for the presence or absence of a target substance, or treated with an animal.
[0140] The animal may be, for example, a mammal including a human, and specifically may be a human.
[0141] The composition of the present invention may be formulated in a variety of known methods, for example, may be formulated in the formulation exemplified above for the pharmaceutical composition, but it is not limited thereto.
[0142] The present invention also relates to a method for treating a disease, which includes administering an antibody-like protein to a subject.
[0143] The subject is a diseased individual, and may be a mammal including a human, and specifically may be a human.
[0144] The disease is a disease that can be treated by the use of an antibody, and may be the diseases exemplified above, but it is not limited thereto.
[0145] The antibody CDRs fused to the protein of the present invention may be CDRs of an antibody to a disease antigen or an antibody to a therapeutic target substance in a disease.
[0146] The protein may be administered in a therapeutically effective amount.
[0147] As used herein, the term “administration” means introducing the composition of the present invention to a patient by any suitable method, and the administration route of the composition of the present invention may include administration through various oral or parenteral routes as long as it can reach the target tissue. Specifically, it may include intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, oral administration, topical administration, intranasal administration, intrapulmonary administration or rectal administration, and the like, but it is not limited thereto.
[0148] Further, the present invention relates to a method for detecting an antigen, which includes treating the antibody-like protein.
[0149] The antibody CDRs may be CDR of an antibody to a target antigen.
[0150] For easy detection/identification of the target antigen, the antibody CDR, ferritin monomer, or protein may be labeled with a fluorescent dye, a radioisotope, or the like, but it is not limited thereto.
[0151] Hereinafter, the present invention will be described in more detail by way of the following examples in order to concretely describe the present invention.
EXAMPLE
[0152] 1. Construction of Expression Vector for Protein Production
[0153] (1) huHF is a spherical protein nanoparticle (12 nm) consisting of 24 monomers, wherein each monomer is composed of total 5 α-helixes. The present inventors ensured a delivery system, in which antibody CDR3 peptides were inserted at different positions in huHF, by inserting the antibody CDR3 peptide into a position selected among the loop between each α-helix of the huHF monomer (AB loop in huHF 5T to 176G based on the PDB 3AJO sequence; between 46D/47V, BC loop; 93D/94W, CD loop; between 127D/128P, DE loop; 163E/1645), N-terminus and C-terminus through gene cloning.
[0154] The sequences in Table 1 below were used, and PCR was executed according to a schematic diagram for vector preparation of
[0155] Specifically, an expression vector capable of expressing each protein nanoparticle was constructed by sequentially inserting the PCR products required for the preparation of each expression vector into the plasmid pT7-7 vector using the primer set of Table 3 below. In this case, the linker peptide of Table 3 below may be additionally included.
TABLE-US-00001 TABLE 1 Sequence No. Name Sequence 2 αPD-L1 GGSYGSLYAFDI 3 αPD1 DLGAGPYYYGKDV 4 αCTLA4 TAQFAY 5 αLAG3 GYSDYEYNWFDP 6 αTIM3 VGGAFPMDY 7 αTIGIT MPSFITLASLSTWEGYFDF
TABLE-US-00002 TABLE 2 CDR-ferritin monomer Expression vector huHF-αPD-L1 NH2-NdeI-huHF-αPD-L1 HCDR3-HindIII-COOH huHF-αPD1 NH2-NdeI-huHF-αPD1 HCDR3-HindIII-COOH huHF-αCTLA4 NH2-Ndel-huHF-αCTLA4 HCDR3-HindIII-COOH huHF-αLAG3 NH2-NdeI-huHF-αLAG3 HCDR3-HindIII-COOH huHF-αTIM3 NH2-NdeI-huHF-αTIM3 HCDR3-HindIII-COOH huHF-αTIGIT NH2-NdeI-huHF-αTIGIT HCDR3-HindIII-COOH huHF-PD-L1-TIGIT BC(92D/93W): NH2-NdeI-(His)6-huHF-[αTIGIT dual blocker HCDR3]- huHF- αPD-L1 HCDR3-HindIII-COOH
TABLE-US-00003 TABLE 3 Sequence Insertion No. Name site Primer 8 α_PD-L1_F C- CATATGCACCATCACCATCACCATACGACCGCGTCC 9 α_PD-L1_R terminus AAGCTTCTAAATATCAAACGCATACAGAGAACCAT AAGAACCACCGCTTTCATTATC 10 α_PD1_F C- CATATGCACCATCACCATCACCATACGACCGCGTCC 11 α_PD1_R terminus AAGCTTCTACACATCTTTGCCATAGTAATACGGGCC CGCGCCCAGATCGCTTTCATTATC 12 α_CTLA4_F C- CATATGCACCATCACCATCACCATACGACCGCGTCC 13 α_CTLA4_R terminus AAGCTTCTAATACGCAAACTGCGCGGTCTCGAGGC TTTCATTATC 14 α_LAG3_F C- CATATGCACCATCACCATCACCATACGACCGCGTCC 15 α_LAG3-R terminus AAGCTTCTACGGATCAAACCAGTTATATTCATAATC GCTATAGCCGCTTTCATTATC 16 α_TIM3_F C- CATATGCACCATCACCATCACCATACGACCGCGTCC 17 α_TIM3_R terminus AAGCTTCTAATAATCCATCGGAAATGCACCGCCAA CGCTTTCATTATC 18 α_TIGIT_F C- CATATGCACCATCACCATCACCATACGACCGCGTCC 19 α_TIGIT_R terminus AAGCTTCTAAAAATCAAAATAGCCTTCCCAGGTGC TCAGGCTCGCCAGGGTAATAAAGCTCGGCATGCTT TCATTATC 20 BC_α_PD- BC CTGTATGCGTTTGATATTGAATTCTGGGAGAGCGGG L1_F loop CTGAAT 21 BC_α_PD- AGAACCATAAGAACCACCGGATCCGTCATCACAGT L1_R CTGGTTTCTTGATATC
TABLE-US-00004 TABLE 4 Sequence No. Name Sequence 22 Linker1 GGGSGGGT 23 Linker2 GGGGSGGGGT 24 Linker3 GGGSGGGTGGGS
[0156] (2) An antibody CDR3 peptide was inserted into a position selected among the loop between each α-helix of huHF monomer (AB loop in huHF 5T to 176G based on PDB 3AJO sequence; 46D/47V, BC loop; 81F/82L, 87K/88K, 93D/94W, CD loop; Between 127D/128P, DE loop; between 162E/163S), N-terminus and C-terminus through gene cloning, thereby ensuring a delivery system in which the antibody CDR3 peptides were inserted at different positions in huHF.
[0157] As huHF, mutant huHF of SEQ ID NO: 25 was used.
[0158] The sequences in Table 5 below were used as CDRs and, according to the schematic view for vector preparation shown in
[0159] All of the constructed plasmid expression vectors were purified on an agarose gel, and then, the sequence was confirmed through complete DNA sequencing. As a plasmid vector, pT7-7 vector was used.
TABLE-US-00005 TABLE 5 Sequence No. Name Sequence 26 Her2/neu (herceptin) WGGDGFYAMDY 27 PD1 (keytruda) RDYRFDMGFDY 28 PD-L1 (tecentriq) RHWPGGF 2 PD-L1 GGSYGSLYAFDI 5 LAG3 GYSDYEYNWFDP 6 TIM3 VGGAFPMDY 7 TIGIT MPSFITLASLSTWEGYFDF 29 SARS-Cov ARGDSSGYYYYFDY 30 CTLA4(yervoy) ARTGWLGPFDY
[0160] (3) According to the schematic view for vector preparation shown in
[0161] All of the constructed plasmid expression vectors were purified on an agarose gel, and then the sequence was confirmed through complete DNA sequencing. As a plasmid vector, pT7-7 vector was used.
[0162] 2. Protein Biosynthesis
[0163] E. coli strain BL21(DE3)[F-ompThsdSB(rB-mB-)] was transformed with the expression vector prepared above, respectively, and ampicillin-resistant transformants were selected. The transformed E. coli was cultured in a flask (250 mL Erlenmeyer flasks, 37° C., 150 rpm) containing 50 mL of Luria-Bertani (LB) medium (containing 100 mg L-1 ampicillin). When the medium turbidity (O.D 600) reached about 0.5-0.7, Isopropyl-β-Dthiogalactopyanosid (IPTG) (1.0 mM) was injected to induce expression of the recombinant gene.
[0164] Except for huHF-(93-AbPD-L1+C-AbTIGIT), individual expression vectors were used and transformed into one vector. In the case of huHF-(93-AbPD-L1+C-AbTIGIT), it was transformed into two vectors for the preparation of huHF-PD-L1 HCDR3 (BC loop (92/93)) and huHF-TIGIT HCDR3.
[0165] After incubation at 20° C. for 16 to 18 hours, the cultured E. coli was centrifuged at 4,500 rpm for 10 minutes to recover the cell precipitate, followed by suspending the product in 5 ml of a disruption solution (10 mM Tris-HCl buffer, pH 7.5, 10 mM EDTA) and crushing the same using an ultrasonic crusher (Branson Ultrasonics Corp., Danbury, CT, USA). After crushing, centrifugation was performed at 13,000 rpm for 10 minutes to separate the supernatant and insoluble aggregates. The separated supernatant was used for subsequent experiments.
[0166] 3. Protein Purification and Fluorescent Material Attachment
[0167] The supernatant obtained in Example 2 above was purified through a three-step process. First, 1) Ni.sup.2+-NTA affinity chromatography using the binding of histidine and nickel fused to the recombinant protein was performed, then 2) the recombinant protein was concentrated and the fluorescent material was attached through buffer exchange, and finally, 3) sucrose gradient ultracentrifugation was performed to separate only the fluorescent material-attached and self-assembled protein nanoparticles. The detailed description of each step is as follows.
[0168] 1) Ni.sup.2+-NTA Affinity Chromatography
[0169] In order to purify the recombinant protein, E. coli cultured in the same manner as specified above was recovered, the recovered cell pellets were resuspended in 5 mL lysis buffer (pH 8.0, 50 mM sodium phosphate, 300 mM NaCl, 20 mM imidazole), and the cells were crushed using a sonicator. The crushed and lysed cell solution was centrifuged at 13,000 rpm for 10 minutes to separate only the supernatant, and then each recombinant protein was separated using a .sup.Ni2+-NTA column (Qiagen, Hilden, Germany) (washing buffer: pH 8.0, 50 mM sodium phosphate, 300 mM NaCl, 80 mM imidazole/elution buffer: pH 8.0, 50 mM sodium phosphate, 300 mM NaCl, 200 mM imidazole).
[0170] 2) Concentration, Buffer Exchange, and Fluorescent Material Attachment Process
[0171] For imaging, huHF-gp100 particles and huHF-PD1 particles were subjected to Ni.sup.2+-NTA affinity chromatography, and 3 ml of the eluted recombinant protein was placed in an ultracentrifugal filter (Amicon Ultra 100K, Millipore, Billerica, MA) at 5,000 g on the column. Centrifugation was performed at 5,000 g until 1 ml of the solution remained. Thereafter, the protein particles were buffer exchanged with sodium bicarbonate (0.1 M, pH 8.5) buffer in order to attach NIR fluorescent substances such as cy5.5 and fluorescein isothiocyanate (FITC), followed by attaching the fluorescent substance at room temperature for 12 hours.
[0172] 3) Sucrose Gradient Ultracentrifugation
[0173] To PBS (2.7 mM KCl, 137 mM NaCl, 2 mM KH2PO4, 10 mM Na2HPO4, pH7.4) buffer, each concentration of sucrose was added to prepare solutions each containing 40%, 35%, 30%, 25%, and 20% sucrose, respectively. After preparing each solution, 2 ml of the solution at a concentration (45-20%), starting from the solution with the highest concentration, was put in a high-speed centrifugation tube (ultraclear 13.2 ml tube, Beckman), and then 1 ml of the recombinant protein solution existing in the prepared self-assembled buffer was added thereto, followed by ultra-high speed centrifugation at 35,000 rpm and 4° C. for 16 hours (Ultracentrifuge L-90k, Beckman). After centrifugation, the upper layer (20-25% sucrose solution part) was subjected to replacement of the buffer in the recombinant protein by a pipette using an ultracentrifugal filter and PBS buffer as described in step 2).
[0174] 4. Identification of Water-Soluble Fractions of Proteins
[0175] BL21 (DE3) competent cells were transformed with various pT7-7-based expression vectors. A single colony was inoculated in LB liquid medium (50 mL) supplemented with 100 mg/L of ampicillin and cultured under conditions of 37° C. and 130 rpm in a shaking incubator. When the turbidity/optical density at 600 nm reached 0.5, the expression of the target protein was induced through administration of 1 mM IPTG. After 12 to 16 hours of incubation at 20° C., the cells in the culture medium were spun-down through centrifugation (13,000 rpm, 10 minutes), and the cell pellet was collected and resuspended in 10 mM Tris-Hcl (pH 7.4) buffer. The resuspended cells were ruptured using a Branson Sonifier (Branson Ultrasonics Corp., Danbury, CT). After sonication, the supernatant containing soluble protein and aggregates containing insoluble protein were separated by centrifugation (13,000 rpm, 10 min). Through SDS-PAGE analysis, the separated soluble and insoluble protein fractions were confirmed.
[0176]
[0177] 5. Verification of Protein Assembly
[0178] In order to analyze the structure of the purified recombinant protein nanoparticles of each protein prepared in Example 3, the recombinant protein was photographed with a transmission electron microscope (TEM). First, unstained and purified protein samples were placed on carbon-coated copper electron microscope grids and then air-dried. To obtain stained images of proteins, electron microscope grids including the air-dried samples were incubated with 2% (w/v) aqueous uranyl acetate solution for 10 minutes at room temperature and washed 3-4 times with distilled water. As a result of observing the protein image using a Philips Technai 120 kV electron microscope, it was confirmed that each particle forms a spherical nanoparticle (
[0179] 6. Measurement of Protein Affinity to Antigen
[0180] The antigen-affinity of the proteins prepared in the above examples was compared with the antigen-affinity of the antibody. The affinity A of the prepared protein to the antigen was measured according to the following method.
[0181] Nunc MaxiSorp™ flat-bottom (cat. 44-2404-21) 96 well-plates were used.
[0182] 100 μl of protein at a concentration of 2 μg/ml was dispensed into each well-plate, and the protein was attached by shaking the plate at 4° C. over-night.
[0183] After removing the solution from the well-plate, 200 μl of PBST (Tween20, 0.05%) was dispensed and removed (washing).
[0184] 200 μl of SuperBlock™ (PBS) Blocking Buffer (cat. 37515) was dispensed at a time for masking, and the solution was removed from the well-plate, followed by dispensing 200 μl of PBST (Tween20, 0.05%) and then removing the same (washing).
[0185] Thereafter, 100 μl of the sample to be checked for Kd was dispensed into each well-plate by the concentration and, after removing the solution from the well-plate, 200 μl of PBST (Tween20, 0.05%) was dispensed and removed (washing).
[0186] After the 2nd antibody-HRP was diluted 1/100 in PBS, 100 μl of this solution was dispensed into each well-plate. After removing the solution from the well-plate, 200 μl of PBST (Tween20, 0.05%) was dispensed and removed (washing).
[0187] Thereafter, 100 μl of TMB solution was dispensed into each well-plate, and 100 μl of Stop solution (1M H.sub.2SO.sub.4) was dispensed into each well-plate, followed by measuring absorbance at 450 nm wavelength.
[0188] A graph of absorbance (abs) at each concentration was drawn to determine a fluorescence value (abs(sat)) at the saturation point, and further, a graph having concentration/abs on x-axis and concentration/abs(sat) on y-axis was drawn to prepare an equation through linearly fitting.
[0189] Multiplying y-intercept in the equation by abs(sat) may obtain Kd.
[0190] Each affinity indicates the affinity of the target antibody to the target antigen. In the figure, “m” in, for example, mPD-L1 indicates the affinity to mouse antigen, while “h” in, for example, hPD-L1 indicates the affinity to human antigen.
[0191] All of the antibody-like proteins in the examples were formed by self-assembly of 24 CDR-ferritin monomers. huHF-dual is a self-assembly of 24 heavy chain CDR-ferritin monomers fused with PD-L1 HCDR3 and TIGIT HCDR3, and huHF-(93-AbPD-LT+C-AbTIGIT) is a self-assembly including first heavy chain CDR-ferritin monomer fused with PD-L1 HCDR3 at position 93 (BC loop) and second heavy chain CDR-ferritin monomer fused with TIGIT HCDR3 at C-terminus, wherein a sum of the number of first and second heavy chain CDR-ferritin monomers is 24.
[0192] Measurement results are shown in Tables 6 to 9 below and
[0193] Table 6 shows the results of measuring the affinity of the self-assembly of 24 heavy chain CDR-ferritin monomers in which each antibody HCDR3 is fused at C-terminus, and Table 7 shows the results of measuring the affinity of the self-assembly of 24 heavy chain CDR-ferritin monomers in which each PD-L1 HCDR3 is fused at various positions, respectively.
[0194] Table 8 shows the results of measuring the affinity of each of: huHF-dual; a self-assembly of heavy chain CDR-ferritin monomer in which PD-L1 HCDR3 is fused to BC loop; a self-assembly of heavy chain CDR-ferritin monomer in which TIGIT HCDR3 is fused at C-terminus; and huHF-(93-AbPD)-L1+C-AbTIGIT), to each antigen.
[0195] Table 9 shows the results of measuring the affinity of huHF-dual to mouse antigen.
TABLE-US-00006 TABLE 6 Her2/neu PD1 PD-L1 Section (herceptin) (keytruda) (tecentriq) PD-L1 TIM3 LAG3 TIGIT SARS-Cov C-term 93.81 115.99 29.78(mouse)/ 77.45 127.92 76.23 20.85 14.16 47.92(human)
TABLE-US-00007 TABLE 7 Section PD-L1 N-term 87.16 AB-loop 49.28 BC-loop(80) 37.65 BC-loop(86) 85.43 BC-loop(92) 28.56 DE-loop 184.31 C-term 77.45
TABLE-US-00008 TABLE 8 Section hPD-L1 hTIGIT huHF-dual 40.14 21.17 huHF-93-AbPD-L1 28.56 Not measured huHF-C-AbTIGIT Not measured 20.85 huHF-(93-AbPD-L1 + C-AbTIGIT) 58.29 101.44
TABLE-US-00009 TABLE 9 Section mPD-L1 mTIGIT huHF-dual 27.17 42.37
[0196] 7. Use of a Protein Fused to a Molecule that Binds to an Immune Checkpoint Molecule
[0197] (1) Assessment of Tumor Inhibitory Ability
[0198] The tumor inhibitory ability of the protein was evaluated by subcutaneously inoculating a colorectal cancer cell line (CT26) into BALB/c mice and injecting the protein according to the schedule of
[0199] Specifically, PBS, PD-L1 antibody, TIGIT antibody and huHF-PD-L1-TIGIT dual blocker protein, respectively, were intravenously injected into mice Balb/c having a certain size of colorectal cancer tumor (CT26) every 3 days. As a result of the observation, it could be seen that the huHF-PD-L1-TIGIT dual blocker protein showed similar tumor treatment efficacy to the antibody treatment. For the experiment, 4 mice per experimental group were used, and the size of cancer cells was calculated by Equation 1 below:
(Tumor volume)=(Major axis)×(Minor axis).sup.2×0.52 [Equation 1]
[0200] In this regard, the experimental groups used herein were 1) PBS group, 2) antibody treatment group (α-PD-L1, α-TIGIT), and 3) protein treatment group (huHF-PD-L1-TIGIT dual blocker).
[0201] Further, the tumor tissue was extracted to measure the weight for each treatment group, and results thereof are shown in
[0202] (2) Efficiency Analysis According to the Site of Fusion to Ferritin Monomer
[0203] A protein in which α-PD-L1 HCDR3 is fused to different positions of the ferritin monomer was prepared in order to determine the tumor inhibitory ability.
[0204] Specifically, in order to compare the targeting efficiency of the FITC fluorescent substance-attached huHF-αPD-L1 HCDR3 (AB, BC, CD, DE loops, C-terminus) protein against CT26 colorectal cancer, CT26 colorectal cancer cells were reacted with the protein nanoparticles at a concentration of 300 nM, followed by comparing the fluorescence signal in order to determine the cell uptake efficiency. As a result, it was confirmed that the huHF-αPD-L1 HCDR3 (AB, BC, CD, DE loops, C-terminus) protein was bound to cancer cells and exhibited a fluorescence signal rather than the control huHF protein.
[0205] Results thereof are shown in
[0206] As a result of the investigation, it was confirmed that, regardless of the fusion site, it exhibited a stronger targeting ability compared to the antibody-like protein.
[0207] 8. Confirmation of Affinity in Cells of Antibody-Like Proteins
[0208] Target cells (immune cells, cancer cells) were cultured and aliquoted (1*10.sup.5 pieces/10 ul, 1 FACS column (5 ml polystyrene round-bottom tube, Falcon (352052))).
[0209] Then, the cells were treated with the samples (drug, antibody (anti-mouse PD-L1 antibody (BE0101), anti-mouse TIGIT antibody (BE0274), anti-human PD-L1 (BE0285))) at 100 μ/FACS column, respectively, while the control group was treated with 100 μl of FACS buffer (0.1% BSA+0.01% sodium azide in PBS) (3 hr, room temperature).
[0210] After putting 1 ml of each FACS buffer into the FACS column, centrifugation was performed at 1700 rpm for 5 minutes followed by removing the supernatant, and this process was repeated 3 times.
[0211] Thereafter, the above cells were treated with fluorescence antibodies (anti his tag antibody-PE(SC-8036 PE), anti-IgG antibody-PE (PE goat F(ab′)2 anti-rat (IgG) secondary antibody (ab7010), PE F(ab′)) 2-goat anti-mouse IgG (H+L) secondary antibody (12-4010-82))), respectively (2 hr, room temperature).
[0212] After putting 1 ml of each FACS buffer into the FACS column, centrifugation was performed at 1700 rpm for 5 minutes followed by removing the supernatant, and this process was repeated 3 times.
[0213] After putting 100 ul of FACS buffer in each sample FACS column, the sample was treated with 2 ul of 7-AAD (BD Pharmigen (559925)) for 5 minutes.
[0214] Analysis was performed using the ratio of target cells showing PE fluorescence among live cells in each FAC column by BD Biosciences and FACS equipment.
[0215] Measurement results are shown in
[0216] Referring to these figures, it could be confirmed that the antibody-like protein of the present invention exhibits very high avidity due to a significantly lower Kd value compared to the monoclonal antibody. This is because the antibody-like protein of the present invention has a plurality of CDRs, and thus can bind to a plurality of antigens.
REFERENCE TO AN ELECTRONIC SEQUENCE LISTING
[0217] A sequence listing electronically submitted with the present application on Apr. 27, 2023 as an ASCII text file named 20230427_S12323LC27_TU_SEQ.TXT, created on Apr. 21, 2023 and having a size of 8,776 bytes, is incorporated herein by reference in its entirety.