A METHOD TO MONITOR VIRUS-SPECIFIC T CELLS IN BIOLOGICAL SAMPLES
20230393121 · 2023-12-07
Assignee
Inventors
Cpc classification
International classification
Abstract
The present invention relates to a method of diagnosing and/or monitoring of virus infection and/or response to vaccination by generating a profile of a virus-specific T cell response that can (i) discriminate between virus infected and uninfected individuals, (ii) determine the effect of vaccination on T cell response, and (iii) determine the effect of viral variants on T cell response. More particularly, the described virus-specific T cell profiling is based on the detection of activated antigen-specific T lymphocytes responding to pools of selected short peptides from virus proteins. These peptide sequences have been selected for their immunogenicity. The profiling is typically performed using ELISPOT, but may also be performed using other techniques such as qPCR, more particularly direct qPCR. The present invention also includes kits for use in the methods of the invention.
Claims
1. An in vitro method of discriminating past or currently virus-infected subjects from virus un-infected subjects, comprising: assaying a sample comprising whole blood, or comprising or derived from bronchoalveolar lavage (BAL) fluid, nasal swabs, or nasopharyngeal aspirate from a subject to determine whether it comprises T cells reactive to one or more virus peptide pools, wherein said peptide pools are separately derived from virus antigenic structural and non-structural proteins, wherein; (a) if the sample T cells are reactive to a majority of the peptide pools derived from the virus antigenic proteins, in comparison to unstimulated or DMSO treated cells, the subject is identified as past or currently infected by the virus, or (b) if the sample T cells are reactive to 0, or a minority of the peptide pools derived from the virus antigenic proteins, in comparison to unstimulated or DMSO treated cells, the subject is identified as having been uninfected by the virus.
2. The method of claim 1, wherein the virus is: a) a coronavirus, selected from the group comprising MERS-CoV, SARS-CoV, SARS-CoV-2, HKU1, OC43, NL63 and 229E or variant thereof; or b) hepatitis B virus (HBV) or variant thereof.
3. The method of claim 2, wherein: a) the virus antigenic structural and non-structural proteins are membrane (M), nucleoprotein (NP) and/or Spike (S) proteins; or b) the virus antigenic structural and non-structural proteins are Polymerase (Pol), Envelope (E), Core (C) and/or X proteins.
4. The method of claim 3, wherein the virus is a) SARS-CoV-2 or b) HBV; and ai) an M peptide pool comprises or consists of at least one peptide derived from an M protein comprising the amino acid sequence set forth in SEQ ID NO: 793; ii) an NP peptide pool comprises or consists of at least one peptide derived from an NP protein comprising the amino acid sequence set forth in SEQ ID NO: 794; and iii) an S peptide pool comprises or consists of at least one peptide derived from an S protein comprising the amino acid sequence set forth in SEQ ID NO: 795; or bi) a Pol peptide pool comprises or consists of at least one peptide derived from an Pol protein comprising the amino acid sequence set forth in SEQ ID NO: 796; ii) an E peptide pool comprises or consists of at least one peptide derived from an E protein comprising the amino acid sequence set forth in SEQ ID NO: 797; iii) a C peptide pool comprises or consists of at least one peptide derived from a C protein comprising the amino acid sequence set forth in SEQ ID NO: 798; and iv) an X peptide pool comprises or consists of at least one peptide derived from an X protein comprising the amino acid sequence set forth in SEQ ID NO: 799.
5. The method of claim 4, wherein; ai) an M peptide pool comprises or consists of at least one peptide selected from peptides having the amino acid sequences set forth in SEQ ID Nos: 1-43, ii) an NP peptide pool comprises or consists of at least one peptide selected from peptides having the amino acid sequences set forth in SEQ ID Nos: 44-125, and iii) an S peptide pool comprises or consists of at least one peptide selected from peptides having the amino acid sequences set forth in SEQ ID Nos: 126-180; or bi) a Pol peptide pool comprises or consists of at least one peptide selected from peptides having the amino acid sequences set forth in SEQ ID Nos: 626-792, ii) an E peptide pool comprises or consists of at least one peptide selected from peptides having the amino acid sequences set forth in SEQ ID Nos: 550-625; iii) a C peptide pool comprises or consists of at least one peptide selected from peptides having the amino acid sequences set forth in SEQ ID Nos: 480-520; and iv) an X peptide pool comprises or consists of at least one peptide selected from peptides having the amino acid sequences set forth in SEQ ID Nos: 521-549.
6. The method of claim 5, wherein the NP peptide pool is divided into 2 pools, NP1 and NP2; or wherein the Pol peptide pool and/or the E peptide pool is/are divided into a plurality of pools.
7. The method of claim 6, wherein; (a) if the sample T cells are reactive to 3 or 4 of the peptide pools derived from M, NP1, NP2 and S, in comparison to unstimulated or DMSO treated cells, the subject is identified as past or currently infected by SARS-CoV-2, (b) if the sample T cells are reactive to 0, 1 or 2 of the peptide pools derived from M, NP1, NP2 and S, in comparison to unstimulated or DMSO treated cells, the subject is identified as having been uninfected by SARS-CoV-2.
8. The method of claim 1, comprising the steps of: a) mixing the sample with each of said peptide pools to produce: i) assay samples corresponding to M, NP and S; or ii) E, Pol, C and X; b) incubating each mixture for a period to allow for T cell activation; c) measuring the level of at least one secreted cytokine in each said mixture and determining whether the level of at least one secreted cytokine is above a threshold control value to indicate a positive T-cell reaction; and d) counting the number of peptide pools that are positive.
9. The method of claim 6, comprising the steps of: a) mixing the sample with each of said peptide pools to produce: i) 4 assay samples corresponding to M, NP1, NP2 and S; or ii) 8 assay samples corresponding to C, Pol1, Pol2, Pol3, Pol4, E1, E2 and X; b) incubating each mixture for a period to allow for T cell activation; c) measuring the level of at least one secreted cytokine in each said mixture and determining whether the level of at least one secreted cytokine is above a threshold control value to indicate a positive T-cell reaction; and d) counting the number of peptide pools that are positive.
10. The method of claim 1, wherein if the sample T cells are reactive to 50% or more of the coronavirus peptide pools, in comparison to unstimulated or DMSO-treated cells, the subject is identified as past or currently infected by coronavirus.
11. An in vitro method of determining whether a vaccine or previously virus-infected subject has T cells whose activation may be reduced by a virus variant, such as a variant of concern (VOC), comprising: assaying a sample comprising whole blood, or comprising or derived from bronchoalveolar lavage (BAL fluid), nasal swabs, or nasopharyngeal aspirate from a subject to determine whether it comprises T cells reactive to one or more virus peptide pools, wherein said peptide pools are separately derived from (A) the whole virus antigenic protein present in the vaccine or corresponding to an antigenic protein from the virus that infected the subject, (B) non-conserved regions of said virus antigenic protein that are mutated in the virus variant, and (C) virus variant mutated non-conserved regions of the vaccine antigenic protein or corresponding to an antigenic protein from the virus that infected the subject, wherein; the number or proportion of reactive T cells present in each pool is analyzed and utilized to derive in each single individual, the frequency of T cells directed towards the whole virus antigenic protein (PBMC stimulated with peptide pool A), the frequency of T cells directed toward non-conserved regions of said virus antigenic protein that are mutated in the virus variant (PBMC stimulated with Pool B) and the frequency of T cells inhibited by amino acid mutations present in virus variant mutated non-conserved regions (PBMC stimulated with pool C), wherein; (a) if the sample T cells are reactive to peptide pool A, the subject has T cells responsive against the virus antigenic protein, and (b) if the sample T cells are similarly reactive to pool B and pool C, the impact of the amino acid mutations in the variant are negligible on the total T cell response against the said virus antigenic protein; (c) if the sample T cells reacts differently to pool B and pool C, the impact of the amino acid mutations in the variant on the total T cell response against the said virus antigenic protein can be estimated by the proportion of pool C against pool B response, wherein the method provides an estimation of the ability of T cells of the subject to recognize the conserved and non-conserved region of different vaccine antigenic proteins or virus that infected the subject, and of the ability of mutations to reduce the T cell response towards variants.
12. The method of claim 11, wherein: i) the virus is a coronavirus, selected from the group comprising MERS-CoV, SARS-CoV, SARS-CoV-2, KHU1, OC43, NL63 and 229E; or ii) the virus is HBV or variants thereof; and/or iii) the virus antigenic protein is an M, NP, or S protein; or an E, Pol, C or X protein; and/or iv) peptide pool A and pool B are derived from a wild-type virus.
13.-14. (canceled)
15. The method of claim 12 or, wherein iii) the virus antigenic protein is an M, NP, or S protein; or an E, Pol, C or X protein; and/or iv) peptide pool A and pool B are derived from a wild-type virus; and wherein: ai) the M protein comprises the amino acid sequence set forth in SEQ ID NO: 793; ii) the NP protein comprises the amino acid sequence set forth in SEQ ID NO: 794; and iii) the S protein comprises the amino acid sequence set forth in SEQ ID NO: 795; or bi) the Pol protein comprises the amino acid sequence set forth in SEQ ID NO: 796; ii) the E protein comprises the amino acid sequence set forth in SEQ ID NO: 797; iii) the C peptide protein comprises the amino acid sequence set forth in SEQ ID NO: 798; and iv) the X protein comprises the amino acid sequence set forth in SEQ ID NO: 799.
16. The method of claim 12, wherein iv) peptide pool A and pool B are derived from a wild-type virus; and wherein the wildtype virus is SARS-CoV-2 wildtype and the variant is selected from the group comprising B.1.617.2 (Delta), B.1.1.7 (Alpha V1), B.1.351 (Beta V2), P.1 (Gamma, V3), B.1.617.1 (Kappa), (P2), B.1.427/9 (Epsilon), B.1.525 (Eta), B.1.526 (Iota), C.37 (Lambda), B.1.621 and B.1.620; or the virus is HBV C.
17. The method of claim 11, comprising the steps of: a) mixing the sample with each of said peptide pools A, B, and C to produce assay samples; b) incubating each mixture formed for a period to allow T cell activation; c) measuring the level of at least one secreted cytokine in each said mixture and determining whether the level of at least one secreted cytokine is above a threshold control value to indicate a positive T-cell reaction; and d) determining the number or proportion of reactive T cells present in each pool.
18. The method of any one of claim 8, wherein the secreted cytokine is selected from the group comprising IFN-gamma, IL-2, CXCL9, CXCL10, TNF-alpha, IL-6, IL-10 and IL-1.
19.-20. (canceled)
21. The method of claim 1, wherein: a) whole blood is mixed with each of said peptide pools; b)i) each mixture is incubated for at least 6 h; b)ii) a plasma fraction of the mixture is isolated; c) the level of at least one secreted cytokine in each said plasma fraction is measured and compared to a threshold control value to indicate a positive or negative T cell reaction.
22. A method to quantify the presence of virus-specific T cells in a biological sample comprising or derived from blood, broncholavage (BAL fluid), nasal swabs, or nasopharyngeal aspirate from a subject, comprising; a) Mixing the biological sample with one or more virus peptide pools, wherein said peptide pools are separately derived from virus antigenic structural or non-structural proteins; b) incubating the mixture formed for a period to allow T cell activation; c) Rupture the cells from b); d) Aliquot a sample from c) into PCR reagents, ACTIN (or other internal control) forward and reverse primers, ACTIN (or other internal control) probe, CXCL10 forward and reverse primers and CXCL10 probe for dqPCR; and/or e) extract RNA from a sample from c) and add a portion into PCR reagents, ACTIN (or other internal control) forward and reverse primers, ACTIN (or other internal control) probe, CXCL10 forward and reverse primers and CXCL10 probe for qPCR; f) perform cycles of dqPCR and/or qPCR for d) and e), respectively; and g) quantitate the expression of CXCL10 in the sample and compare with a control, wherein an elevated CXCL10 level indicates the presence of virus-specific T cells in the subject sample.
23. The method of claim 22, wherein the virus is a coronavirus, selected from the group comprising MERS-CoV, SARS-CoV, SARS-CoV-2, KHU1, OC43, NL63 and 229E or variant mutants thereof; or HBV or variant mutant thereof: and/or wherein: ai) the M protein comprises the amino acid sequence set forth in SEQ ID NO: 793; ii) the NP protein comprises the amino acid sequence set forth in SEQ ID NO: 794; and iii) the S protein comprises the amino acid sequence set forth in SEQ ID NO: 795; or bi) the Pol protein comprises the amino acid sequence set forth in SEQ ID NO: 796; ii) the E protein comprises the amino acid sequence set forth in SEQ ID NO: 797; iii) the C protein comprises the amino acid sequence set forth in SEQ ID NO: 798; and iv) the X protein comprises the amino acid sequence set forth in SEQ ID NO: 799; and/or wherein the peptide pools comprise one or more M, NP and S peptides listed in Tables 1-4 and 7-19; or one or more Pol, E, C and X peptides listed in Tables 20-27.
24.-25. (canceled)
26. A method of treatment or prophylaxis, comprising administering, respectively, to a subject with T cells reactive to: i) a majority of peptide pools derived from virus antigenic proteins, an effective amount of a virus inhibitor; or ii) 0, or a minority of the peptide pools M, NP and S; or E, Pol, C and X, an effective amount of a coronavirus or non-enveloped virus vaccine, respectively.
27. The method of claim 26, wherein the virus is a coronavirus such as a coronavirus selected from the group comprising MERS-CoV, SARS-CoV, SARS-CoV-2, HKU1, OC43, NL63 and 229E or variants thereof; or wherein the virus is HBV or variant thereof.
28. The method of claim 27, wherein the virus is SARS-CoV-2, or HBV.
29. The method of claim 28, wherein the peptide pools comprise M, NP1, NP2 and S pools listed in Tables 1-4; or E1, E2, Pol1, Pol2, Pol3, Pol4, C and X pools listed in Tables 20-27.
30. A method of monitoring the efficacy of a virus vaccine, comprising testing whether the recipient of said vaccine has T cells reactive to 0, a minority, 50%, or a majority of peptide pools derived from the virus M, NP and S proteins; or virus E, Pol, C and X proteins.
31. The method of claim 30, wherein the virus is a coronavirus such as a coronavirus selected from the group comprising MERS-CoV, SARS-CoV, SARS-CoV-2, KHU1, OC43, NL63 and 229E or variants thereof; or HBV or a variant thereof.
32. The method of claim 31, wherein the virus is SARS-CoV-2 or HBV.
33. The method of claim 32, comprising testing whether the recipient of said vaccine has T cells reactive to 0, 1, 2, 3 or 4 of the peptide pools M, NP1, NP2 and S listed in Tables 1-4; or T cells reactive to 0, 1, 2, 3, 4, 5, 6 or 7 of the peptide pools E1, E2, Pol1, Pol2, Pol3, Pol4, C and X.
34. A kit to discriminate past or currently virus-infected subjects from virus un-infected subjects, the kit comprising a plurality of virus structural or non-structural peptides that stimulate virus-exposed T cells, wherein the virus peptides are in peptide pools derived from virus M, NP and S proteins; or from virus E, Pol, C and X proteins.
35. The kit of claim 34, wherein the virus is a coronavirus such as a coronavirus selected from the group comprising MERS-CoV, SARS-CoV, SARS-CoV-2, KHU1, OC43, NL63 and 229E or variants thereof; or HBV or variant thereof.
36. The kit of claim 35, wherein the virus is SARS-CoV-2 or HBV.
37. The kit of claim 36, wherein: ai) the M protein comprises the amino acid sequence set forth in SEQ ID NO: 793; ii) the NP protein comprises the amino acid sequence set forth in SEQ ID NO: 794; and iii) the S protein comprises the amino acid sequence set forth in SEQ ID NO: 795; or bi) the Pol protein comprises the amino acid sequence set forth in SEQ ID NO: 796; ii) the E protein comprises the amino acid sequence set forth in SEQ ID NO: 797; iii) the C protein comprises the amino acid sequence set forth in SEQ ID NO: 798; and iv) the X protein comprises the amino acid sequence set forth in SEQ ID NO: 799.
38. The kit of claim 37, wherein: the M peptide pool comprises peptides having amino acid sequences set forth in SEQ ID Nos: 1-43; the NP peptide pool comprises peptides having amino acid sequences set forth in SEQ ID Nos: 44-125; and the S peptide pool comprises peptides selected from peptides having amino acid sequences set forth in SEQ ID Nos: 126-454.
39. The kit of claim 34, further comprising one or more reagents to detect cytokines and/or chemokines secreted from activated T cells.
40. A kit to quantify SARS-CoV-2-specific T cell activation, or HBV-specific T cell activation, in an isolated patient sample, comprising: i) one or more peptide pools selected from the pools in Tables 1-4 and 7-19, or Tables 20-27, respectively; ii) PCR reagents and/or primers and probes to detect CXCL10 and/or IFN-gamma expression by stimulated T cells; and/or iii) ELISPOT reagents.
41. The kit of claim 40, wherein peptide pools from Tables 7-19 are used to analyse the effect of virus variants, including variants of concern (VOC), on T cell activation in vaccinated or previously virus-infected subjects.
42. A set of at least 2 separate pools of peptides suitable to discriminate past or currently SARS-CoV-2-infected subjects or vaccinated subjects from SARS-CoV-2 un-infected subjects, wherein the peptide pools are selected from those listed in Tables 1 to 4 and 7-19, or Tables 20-27.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
DEFINITIONS
[0077] Certain terms employed in the specification, examples and appended claims are collected here for convenience.
[0078] As used in the specification and the appended claims, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise.
[0079] The terms “amino acid” or “amino acid sequence,” as used herein, refer to an oligopeptide, peptide, polypeptide, or protein sequence, or a fragment of any of these, and to naturally occurring or synthetic molecules. Where “amino acid sequence” is recited herein to refer to an amino acid sequence of a naturally occurring protein molecule, “amino acid sequence” and like terms are not meant to limit the amino acid sequence to the complete native amino acid sequence associated with the recited protein molecule.
[0080] As used herein, the term “comprising” or “including” is to be interpreted as specifying the presence of the stated features, integers, steps or components as referred to, but does not preclude the presence or addition of one or more features, integers, steps or components, or groups thereof. However, in context with the present disclosure, the term “comprising” or “including” also includes “consisting of”. The variations of the word “comprising”, such as “comprise” and “comprises”, and “including”, such as “include” and “includes”, have correspondingly varied meanings.
[0081] As used herein, the term ‘majority’ refers to a value over 50%. Conversely, the term ‘minority’ refers to a value under 50%. For example, if 3 or 4 of a total of 4 peptide pools positively activate T cells in a sample, compared to a control, a majority of pools are positive and the sample is indicative of the subject having been exposed to SARS-CoV-2 infection. When 4 pools M, NP1, NP2 and S were used, 50% or more (2, 3, or 4 pools out of 4) positive pools was considered to indicate the subject had been infected by SARS-CoV-2.
[0082] As used herein, the term ‘a subject uninfected by SARS-CoV-2’ refers to a subject who is considered to not have been exposed to and infected by SARS-CoV-2, for the purpose of the invention.
[0083] Any discussion of documents, acts, materials, devices, articles or the like which has been included in the present specification is not to be taken as an admission that any or all of these matters form part of the prior art base, or were common general knowledge in the field relevant to the present disclosure as it existed before the priority date of each of the appended claims.
[0084] Bibliographic references mentioned in the present specification are for convenience listed at the end of the examples. The whole content of such bibliographic references are herein incorporated by reference.
DETAILED DESCRIPTION OF THE INVENTION
[0085] The present invention relates to a method of discriminating past or currently virus-infected subjects from virus un-infected subjects, based on the detection of activated antigen-specific T lymphocytes responding to selected peptide sequences from the virus in an isolated sample from said individual. These peptide sequences are selected for their immunogenicity and are represented in peptide pools separately derived from virus antigenic proteins, such as membrane (M), nucleoprotein (NP) and/or Spike (S) proteins; or Polymerase (Pol), Envelope (E), Core (C) and X proteins.
[0086] In addition, the present invention provides a method of testing T cell responses in vaccinated subjects. In this way, the efficacy of a vaccine to stimulate a T cell response can be determined.
[0087] Further, the invention provides a method of testing the impact of amino acid mutations in a virus strain on T cells that have previously been exposed to a parent or comparator strain. For example, different variants of concern (VOC) of SARS-CoV-2 have replaced world-wide the original SARS-CoV-2 Wuhan isolate. These VOCs are characterized by amino acid substitutions that provide biological advantages such as increased infectivity or escape humoral (Antibodies) but also cellular (T cells) immunity. We have designed a method based on specific combination of peptide pools covering both different SARS-CoV-2 proteins (i.e., Spike) and the corresponding regions affected by the amino acid mutations that are used to stimulate T cells, The results of this multiple stimulation strategy define with accuracy the impact of these amino acid mutations on the SARS-CoV-2-specific T cells induced by infection with Wuhan strain or by vaccination with the present vaccines based on the Wuhan strain. Presented herein as an example is a method to analyze the impact of amino acid mutations present in Spike in different VOCs (using Delta variant as an example) on the SPIKE specific T cells induced by vaccination or previous infection.
[0088] Discrimination can be achieved based on the number or proportion of peptide pools that stimulate the isolated T cells above a control value.
[0089] Each of the M, NP and S, or Pol, C, E and X, proteins may contribute at least one pool of immunogenic peptides. For example, the NP protein consists of 419 amino acids. It is possible that the NP protein could be divided into more than one pool comprising 15-mer peptides, such as 2 pools where 1 pool comprises 15-mer peptides which overlap adjacent peptides by 10 amino acids covering amino acids 1-215; and a second pool comprising 15-mers which overlap adjacent peptides by 10 amino acids covering amino acids 216-419. The peptide overlap can be seen, for example, in the NP peptides listed sequentially in Table 2. It would be understood that the degree of overlap between 15-mer peptides could be varied from 10 without substantially affecting the ability to activate T cells and obtain a valid result. Likewise, the S protein, which is 1273 amino acids in length, could be divided up into 1, 2, 3 or more pools of 15-mer peptides. The number and size of the pools needs to be balanced with practical considerations, such as the amount of blood sample available, the cost of generating peptide pools, and whether the number of pools improves discrimination.
[0090] In a first aspect the invention provides an in vitro method of discriminating past or currently virus-infected subjects from virus un-infected subjects, comprising: [0091] assaying a sample comprising or derived from blood, broncholavage (BAL fluid), nasal swabs, or nasopharyngeal aspirate from a subject to determine whether it comprises T cells reactive to one or more virus peptide pools, wherein said peptide pools are separately derived from virus antigenic structural and non-structural proteins, wherein; [0092] (a) if the sample T cells are reactive to a majority of the peptide pools derived from the virus antigenic proteins, in comparison to unstimulated or DMSO treated cells, the subject is identified as past or currently infected by the virus, or [0093] (b) if the sample T cells are reactive to 0, or a minority of the peptide pools derived from the virus antigenic proteins, in comparison to unstimulated or DMSO treated cells, the subject is identified as having been uninfected by the virus.
[0094] In some embodiments the virus is an enveloped virus or a non-enveloped virus. The antigenic structural and non-structural proteins of these viruses are well-known. An example is the membrane (M), nucleoprotein (NP) and/or Spike (S) proteins of an enveloped viruses such as coronaviruses, whereas and Hepatitis B viruses (HBV) comprise polymerase (Pol), envelope (E), core (C) and X antigenic structural and non-structural proteins.
[0095] In some embodiments of any aspect of the invention, the virus is a coronavirus.
[0096] In some embodiments, the virus is a coronavirus, selected from the group comprising MERS-CoV, SARS-CoV, SARS-CoV-2, HKU1, OC43, NL63 and 229E or variant thereof.
[0097] In some embodiments, the virus is SARS-CoV-2 or variant thereof.
[0098] In some embodiments, the virus is HBV or variant thereof.
[0099] In some embodiments, [0100] ai) an M peptide pool comprises or consists of at least one peptide derived from an M protein comprising the amino acid sequence set forth in SEQ ID NO: 793; [0101] ii) an NP peptide pool comprises or consists of at least one peptide derived from an NP protein comprising the amino acid sequence set forth in SEQ ID NO: 794; and [0102] iii) an S peptide pool comprises or consists of at least one peptide derived from an S protein comprising the amino acid sequence set forth in SEQ ID NO: 795; or [0103] bi) a Pol peptide pool comprises or consists of at least one peptide derived from a Pol protein comprising the amino acid sequence set forth in SEQ ID NO: 796; [0104] ii) an E peptide pool comprises or consists of at least one peptide derived from an E protein comprising the amino acid sequence set forth in SEQ ID NO: 797; [0105] iii) a C peptide pool comprises or consists of at least one peptide derived from a C protein comprising the amino acid sequence set forth in SEQ ID NO: 798; and [0106] iv) an X peptide pool comprises or consists of at least one peptide derived from an X protein comprising the amino acid sequence set forth in SEQ ID NO: 799.
[0107] In some embodiments; [0108] ai) an M peptide pool comprises or consists of at least one peptide selected from peptides having the amino acid sequences set forth in SEQ ID Nos: 1-43, [0109] ii) an NP peptide pool comprises or consists of at least one peptide selected from peptides having the amino acid sequences set forth in SEQ ID Nos: 44-125, and [0110] iii) an S peptide pool comprises or consists of at least one peptide selected from peptides having the amino acid sequences set forth in SEQ ID Nos: 126-454.
[0111] In some embodiments, the NP peptide pool is divided into 2 pools, NP1 and NP2.
[0112] In some embodiments, the S peptide pool comprises or consists of at least one peptide selected from peptides having the amino acid sequences set forth in SEQ ID Nos: 126-180 (Table 4).
[0113] In some embodiments NP1 comprises or consists of at least one peptide selected from peptides having the amino acid sequences set forth in SEQ ID Nos: 44-84, and the NP2 peptide pool comprises or consists of at least one peptide selected from peptides having the amino acid sequences set forth in SEQ ID Nos: 85-125.
[0114] In some embodiments; [0115] ai) the M peptide pool consists of peptides having the amino acid sequences set forth in SEQ ID Nos: 1-43, [0116] ii) the NP1 peptide pool consists of peptides having the amino acid sequences set forth in SEQ ID Nos: 44-84, [0117] iii) the NP2 peptide pool consists of peptides having the amino acid sequences set forth in SEQ ID Nos: 85-125, and [0118] iv) the S peptide pool consists of peptides having the amino acid sequences set forth in SEQ ID Nos: 126-180.
[0119] In some embodiments; [0120] bi) a Pol peptide pool comprises or consists of at least one peptide selected from peptides having the amino acid sequences set forth in SEQ ID Nos: 626-792 (Tables 24-27), [0121] ii) an E peptide pool comprises or consists of at least one peptide selected from peptides having the amino acid sequences set forth in SEQ ID Nos: 550-625 (Tables 22-23); [0122] iii) a C peptide pool comprises or consists of at least one peptide selected from peptides having the amino acid sequences set forth in SEQ ID Nos: 480-520 (Table 20); and [0123] iv) an X peptide pool comprises or consists of at least one peptide selected from peptides having the amino acid sequences set forth in SEQ ID Nos: 521-549 (Table 21).
[0124] In some embodiments, the Pol peptide pool is divided into a plurality of pools, such as 2, 3 or 4 pools of peptides. Preferably, each of the plurality of Pol pools has approximately equal numbers of peptides. In some embodiments, the Pol peptide pool is divided into 4 pools, Pol-1, Pol-2, Pol-3 and Pol-4. An example is shown in Tables 24-27.
[0125] In some embodiments, the E peptide pool is divided into 2 pools, E-1 and E-2. An example is shown in Tables 22-23.
[0126] In some embodiments, [0127] bi) the Pol peptide pool consists of peptides having the amino acid sequences set forth in SEQ ID Nos: 626-792; [0128] ii) the E peptide pool consists of peptides having the amino acid sequences set forth in SEQ ID Nos: 550-625; [0129] iii) the C peptide pool consists of peptides having the amino acid sequences set forth in SEQ ID Nos: 480-520; and [0130] iv) the X peptide pool consists of peptides having the amino acid sequences set forth in SEQ ID Nos: 521-549.
[0131] In some embodiments; [0132] (a) if the sample T cells are reactive to 3 or 4 of the peptide pools derived from M, NP1, NP2 and S, in comparison to unstimulated or DMSO treated cells, the subject is identified as past or currently infected by SARS-CoV-2, or [0133] (b) if the sample T cells are reactive to 0, 1 or 2 of the peptide pools derived from M, NP1, NP2 and S, in comparison to unstimulated or DMSO treated cells, the subject is identified as having been uninfected by SARS-CoV-2.
[0134] In some embodiments, the method comprises the steps of: [0135] a) mixing the sample with each of said peptide pools to produce: [0136] i) assay samples corresponding to M, NP and S; or [0137] ii) assay samples corresponding to E, Pol, C and X; [0138] b) incubating each mixture for a period to allow for T cell activation; [0139] c) measuring the level of at least one secreted cytokine in each said mixture and determining whether the level of at least one secreted cytokine is above a threshold control value to indicate a positive T-cell reaction; and [0140] d) counting the number of peptide pools that are positive.
[0141] In some embodiments, the method comprises the steps of: [0142] a) mixing the sample with each of said peptide pools to produce: [0143] i) 4 assay samples corresponding to M, NP1, NP2 and S; or [0144] ii) 8 assay samples corresponding to C, Pol1, Po12, Po13, Po14, E1, E2 and X; [0145] b) incubating each mixture for a period to allow for T cell activation; [0146] c) measuring the level of at least one secreted cytokine in each said mixture and determining whether the level of at least one secreted cytokine is above a threshold control value to indicate a positive T-cell reaction; and [0147] d) counting the number of peptide pools that are positive.
[0148] In some embodiments, if the sample T cells are reactive to 50% or more of the peptide pools derived from SARS-CoV-2 M, NP and S, in comparison to unstimulated or DMSO-treated cells, the subject is identified as past or currently infected by virus.
[0149] In a second aspect the invention provides an in vitro method of determining whether a vaccinee or previously virus-infected subject has T cells whose activation may be reduced by a virus variant, such as a variant of concern (VOC), comprising: [0150] assaying a sample comprising or derived from blood, bronchoalveolar lavage (BAL fluid), nasal swabs, or nasopharyngeal aspirate from a subject to determine whether it comprises T cells reactive to one or more virus peptide pools, wherein said peptide pools are separately derived from (A) the whole virus antigenic protein present in the vaccine or corresponding to an antigenic protein from the virus that infected the subject, (B) non-conserved regions of said virus antigenic protein that are mutated in the virus variant, and (C) virus variant mutated non-conserved regions of the vaccine antigenic protein or corresponding to an antigenic protein from the virus that infected the subject, wherein; [0151] the number or proportion of reactive T cells present in each pool is analyzed and utilized to derive in each single individual, the frequency of T cells directed towards the whole virus antigenic protein (PBMC stimulated with peptide pool A), the frequency of T cells directed toward non-conserved regions of said virus antigenic protein that are mutated in the virus variant (PBMC stimulated with Pool B) and the frequency of T cells inhibited by amino acid mutations present in virus variant mutated non-conserved regions (PBMC stimulated with pool C), wherein; [0152] (a) if the sample T cells are reactive to peptide pool A, the subject has T cells responsive against the virus antigenic protein, and [0153] (b) if the sample T cells are similarly reactive to pool B and pool C, the impact of the amino acid mutations in the variant are negligible on the total T cell response against the said virus antigenic protein; [0154] (c) if the sample T cells reacts differently to pool B and pool C, the impact of the amino acid mutations in the variant on the total T cell response against the said virus antigenic protein can be estimated by the proportion of pool C against pool B response, [0155] wherein the method provides an estimation of the ability of T cells of the subject to recognize the conserved and non-conserved region of different vaccine antigenic proteins or virus that infected the subject, and of the ability of mutations to reduce the T cell response towards variants.
[0156] In some embodiments, the virus is a coronavirus, selected from the group comprising MERS-CoV, SARS-CoV, SARS-CoV-2, KHU1, OC43, NL63 and 229E or variants thereof.
[0157] In some embodiments, the virus antigenic protein is an M, NP, or S protein.
[0158] In some embodiments, the virus is HBV and the virus antigenic protein is an E, Pol, C or X protein.
[0159] In some embodiments, peptide pool A and pool B are derived from a wild-type virus.
[0160] It would be understood that peptide pool A and pool B could be derived from a variant if it became a reference point due to becoming endemic or if future vaccines employ the variant sequence instead of the original wildtype virus.
[0161] In some embodiments of the method; [0162] ai) the M protein comprises the amino acid sequence set forth in SEQ ID NO: 793; [0163] ii) the NP protein comprises the amino acid sequence set forth in SEQ ID NO: 794; and [0164] iii) the S protein comprises the amino acid sequence set forth in SEQ ID NO: 795; or [0165] bi) the Pol protein comprises the amino acid sequence set forth in SEQ ID NO: 796; [0166] ii) the E protein comprises the amino acid sequence set forth in SEQ ID NO: 797; [0167] iii) the C protein comprises the amino acid sequence set forth in SEQ ID NO: 798; and [0168] iv) the X protein comprises the amino acid sequence set forth in SEQ ID NO: 799.
[0169] In some embodiments, the wildtype virus is SARS-CoV-2 wildtype and the variant is selected from the group comprising B.1.617.2 (Delta), B.1.1.7 (Alpha V1), B.1.351 (Beta V2), P.1 (Gamma, V3), B.1.617.1 (Kappa), P.2, B.1.427/9 (Epsilon), B.1.525 (Eta), B.1.526 (Iota), C.37 (Lambda), B.1.621 and B.1.620; or the virus is HBV C.
[0170] In some embodiments, the method comprises the steps of: [0171] a) mixing the sample with each of said peptide pools A, B, and C to produce assay samples; [0172] b) incubating each mixture formed for a period to allow T cell activation; [0173] c) measuring the level of at least one secreted cytokine in each said mixture and determining whether the level of at least one secreted cytokine is above a threshold control value to indicate a positive T-cell reaction; and [0174] d) determining the number or proportion of reactive T cells present in each pool.
[0175] In some embodiments, the secreted cytokine is selected from the group comprising IFN-gamma (IFN-γ), IL-2, CXCL9, CXCL10, TNF-alpha, IL-6, IL-10 and IL-1. Preferably IFN-gamma, IL-2, or CXCL10 levels are measured. Detection of the cytokine CXCL10 is preferred if qPCR is used to quantify T cell activation.
[0176] In some embodiments, the said cytokine level is determined by immunoassay, such as ELISA or ELISPOT, or by qPCR or direct qPCR.
[0177] According to the method, a sample is tested by separately mixing aliquots from the sample with a peptide pool representing at least a portion of M, NP or S protein, or with a peptide pool representing at least a portion of E, Pol, C or X protein to determine whether the sample comprises T cells reactive to M, NP and/or S peptides; or E, Pol, C and/or X peptides, respectively.
[0178] In some embodiments, the sample comprises whole blood, broncholavage (BAL fluid), nasal swabs, nasopharyngeal aspirate, or isolated peripheral blood mononuclear cells (PBMCs).
[0179] In some embodiments, when whole blood, broncholavage (BAL fluid), nasal swabs, or nasopharyngeal aspirate is used, the incubation period in step b) may be for between about 6 to 24 h.
[0180] In some embodiments of the method: [0181] a) whole blood is mixed with each of said peptide pools; [0182] b)i) each mixture is incubated for at least 6 h; [0183] b)ii) a plasma fraction of the mixture is isolated; [0184] c) the level of at least one secreted cytokine in each said plasma fraction is measured and compared to a threshold control value to indicate a positive or negative T cell reaction.
[0185] In some embodiments, the sample also comprises a concentration of DMSO and/or heparin. Heparin may be required particularly if whole blood is to be assayed, to inhibit coagulation.
[0186] In some embodiments, the control sample or threshold control value may be derived from an assay sample comprising a subject sample that is unstimulated or DMSO-treated.
[0187] In some embodiments of the method: [0188] a) whole blood is mixed with heparin, DMSO and each of said peptide pools to produce: [0189] i) 4 assay samples corresponding to M, NP1, NP2 and S; or [0190] ii) 8 assay samples corresponding to E1, E2, Pol1, Po12, Po13, Po14, C and X; [0191] b)i) each mixture is incubated overnight; [0192] b)ii) a plasma fraction of the mixture is isolated; [0193] c) the level of at least one secreted cytokine, selected from the group comprising IFN-gamma, IL-2, CXCL9, CXCL10, TNF-alpha, IL-6, IL-10 and IL-1, in each said plasma fraction is measured and compared to a threshold control value, derived from an assay sample comprising a subject sample that is unstimulated or DMSO-treated, to indicate a positive or negative T cell reaction.
[0194] In a third aspect the invention provides a method to quantify the presence of virus-specific T cells in a biological sample comprising or derived from blood, broncholavage (BAL fluid), nasal swabs, or nasopharyngeal aspirate from a subject, comprising; [0195] a) Mixing the biological sample with one or more virus peptide pools, wherein said peptide pools are separately derived from virus antigenic structural or non-structural proteins; [0196] b) incubating the mixture formed for a period to allow T cell activation; [0197] c) Rupture the cells from b); [0198] d) Aliquot a sample from c) into PCR reagents, ACTIN (or other internal control) forward and reverse primers, ACTIN (or other internal control) probe, CXCL10 forward and reverse primers and CXCL10 probe for dqPCR; and/or [0199] e) extract RNA from a sample from c) and add a portion into PCR reagents, ACTIN (or other internal control) forward and reverse primers, ACTIN (or other internal control) probe, CXCL10 forward and reverse primers and CXCL10 probe for qPCR; [0200] f) perform cycles of dqPCR and/or qPCR for d) and e), respectively; and [0201] g) quantitate the expression of CXCL10 in the stimulated T cells and compare with a control, [0202] wherein an elevated CXCL10 level indicates the presence of virus-specific T cells in the subject sample.
[0203] In some embodiments the virus is an enveloped virus. The antigenic structural and non-structural proteins of these viruses are well-known. An example is the membrane (M), nucleoprotein (NP) and/or Spike (S) proteins of a coronavirus. The antigenic proteins of Hepatitis B virus (HBV) are Pol, E, C and X proteins.
[0204] In some embodiments, the virus is a coronavirus, selected from the group comprising MERS-CoV, SARS-CoV, SARS-CoV-2, KHU1, OC43, NL63 and 229E or variant thereof; or a non-enveloped virus, such as HBV.
[0205] In some embodiments, the virus is SARS-CoV-2 or HBV.
[0206] In some embodiments: [0207] ai) the M protein comprises the amino acid sequence set forth in SEQ ID NO: 793; [0208] ii) the NP protein comprises the amino acid sequence set forth in SEQ ID NO: 794; and [0209] iii) the S protein comprises the amino acid sequence set forth in SEQ ID NO: 795; or [0210] bi) the Pol protein comprises the amino acid sequence set forth in SEQ ID NO: 796; [0211] ii) the E protein comprises the amino acid sequence set forth in SEQ ID NO: 797; [0212] iii) the C protein comprises the amino acid sequence set forth in SEQ ID NO: 798; and [0213] iv) the X protein comprises the amino acid sequence set forth in SEQ ID NO: 799.
[0214] In some embodiments, the peptide pools comprise one or more M, NP and S peptides listed in Tables 1-4 and 7-19; or one or more Pol, E, C and X peptides listed in Tables 20-27.
[0215] In a fourth aspect, the invention provides a method of treatment comprising administering, to a subject with T cells reactive to: [0216] i) a majority of peptide pools derived from virus antigenic structural or non-structural proteins, an effective amount of a virus inhibitor; or [0217] ii) 0, or a minority of the peptide pools M, NP and S; or E, Pol, C and X, an effective amount of a coronavirus or HBV vaccine, respectively.
[0218] In some embodiments, the virus is a coronavirus such as a coronavirus selected from the group comprising MERS-CoV, SARS-CoV, SARS-CoV-2, HKU1, OC43, NL63 and 229E or variants thereof.
[0219] In some embodiments, the virus is SARS-CoV-2.
[0220] In some embodiments the virus is HBV.
[0221] In some embodiments, the invention provides a method of treatment comprising administering, to a subject with T cells reactive to 3 or 4 of the peptide pools M, NP1, NP2 and S listed in Tables 1-4, an effective amount of a SARS-CoV-2 inhibitor.
[0222] In some embodiments, the invention provides a method of treatment comprising administering, to a subject with T cells reactive to 3 or 4 of the peptide pools M, NP1, NP2 and S listed in Tables 1-4, an effective amount of a SARS-CoV-2 inhibitor.
[0223] In some embodiments, the invention provides a method of treatment comprising administering, to a subject with T cells reactive to 5 to 8 of the pools E1, E2, Pol1, Pol2, Pol3, Pol4, C and X listed in Tables 20-27, an effective amount of a HBV inhibitor.
[0224] In a fifth aspect, the invention provides a method of prophylaxis comprising administering, to a subject with T cells reactive to 0, or a minority of peptide pools derived from virus antigenic structural and non-structural proteins, an effective amount of a virus vaccine.
[0225] In some embodiments the virus is an enveloped virus.
[0226] In some embodiments, the virus is a coronavirus such as a coronavirus selected from the group comprising MERS-CoV, SARS-CoV, SARS-CoV-2, HKU1, OC43, NL63 and 229E or variants thereof.
[0227] In some embodiments, the virus is SARS-CoV-2. In some embodiments the virus is HBV.
[0228] In some embodiments, the invention provides a method of prophylaxis comprising administering, to a subject with T cells reactive to 0, 1 or 2 of the peptide pools M, NP1, NP2 and S listed in Tables 1-4, an effective amount of a SARS-CoV-2 vaccine.
[0229] In some embodiments, the invention provides a method of prophylaxis comprising administering, to a subject with T cells reactive to 0, 1, 2, 3 or 4 of the peptide pools E1, E2, Pol1, Po12, Po13, Po14, C and X listed in Tables 20-27, an effective amount of a HBV vaccine.
[0230] In a sixth aspect the invention provides a method of monitoring the efficacy of a virus vaccine, comprising testing whether the recipient of said vaccine has T cells reactive to a minority, 50%, or majority of peptide pools derived from virus antigenic structural and non-structural proteins, such as virus M, NP and S proteins; or virus E, Pol, C and X proteins.
[0231] In some embodiments, the virus is a coronavirus such as a coronavirus selected from the group comprising MERS-CoV, SARS-CoV, SARS-CoV-2, HKU1, OC43, NL63 and 229E or variants thereof. In some embodiments, the virus is SARS-CoV-2.
[0232] In some embodiments the virus is HBV.
[0233] In some embodiments, the invention provides a method of monitoring the efficacy of a SARS-CoV-2 vaccine, comprising testing whether the recipient of said vaccine has T cells reactive to 0, 1, 2, 3 or 4 of the peptide pools M, NP1, NP2 and S listed in Tables 1-4 and 7-19.
[0234] In some embodiments, the invention provides a method of monitoring the efficacy of a HBV vaccine, comprising testing whether the recipient of said vaccine has T cells reactive to 0, 1, 2, 3, 4, 5, 6, 7 or 8 of the peptide pools E1, E2, Pol1, Pol2, Pol3, Pol4, C and X listed in Tables 20-27.
[0235] It would be understood that the pools used may depend on which of the virus antigenic proteins is/are used in the vaccine. The pool may be for a particular protein from a wildtype, or variant virus. Table 4 contains selected peptides of the spike protein that were tested and demonstrated to be good enough to estimate the total spike T cell response. This table of peptides do not cover the entire spike protein. This is used in conjunction with peptides from Tables 1-3 to detect if the subject is infected or not infected. Table 7 is the reference peptides that may be used to assess the T cell response against the delta VOC with the wildtype Wuhan as a reference. Tables 8-19 contain peptides derived from the VOC that are different from the Wuhan wildtype SARS-CoV-2 virus.
[0236] In a seventh aspect the invention provides a kit to discriminate past or currently virus-infected subjects from virus un-infected subjects, the kit comprising a plurality of virus structural or non-structural peptides that stimulate virus-exposed T cells, wherein the virus peptides are in peptide pools derived from virus antigenic structural or non-structural proteins.
[0237] In some embodiments the virus is an enveloped virus or a non-enveloped virus.
[0238] An example of the antigenic proteins is the membrane (M), nucleoprotein (NP) and/or Spike (S) proteins of an enveloped virus.
[0239] In some embodiments, the virus is a coronavirus such as a coronavirus selected from the group comprising MERS-CoV, SARS-CoV, SARS-CoV-2, HKU1, OC43, NL63 and 229E or variants thereof.
[0240] In some embodiments, the virus is SARS-CoV-2. In some embodiments the virus is HBV.
[0241] In some embodiments of the kit: [0242] ai) the M protein comprises the amino acid sequence set forth in SEQ ID NO: 793; [0243] ii) the NP protein comprises the amino acid sequence set forth in SEQ ID NO: 794; and [0244] iii) the S protein comprises the amino acid sequence set forth in SEQ ID NO: 795; or [0245] bi) the Pol protein comprises the amino acid sequence set forth in SEQ ID NO: 796; [0246] ii) the E protein comprises the amino acid sequence set forth in SEQ ID NO: 797; [0247] iii) the C protein comprises the amino acid sequence set forth in SEQ ID NO: 798; and [0248] iv) the X protein comprises the amino acid sequence set forth in SEQ ID NO: 799.
[0249] In some embodiments: [0250] the M peptide pool comprises peptides having amino acid sequences set forth in SEQ ID Nos: 1-43; [0251] the NP peptide pool comprises peptides having amino acid sequences set forth in SEQ ID Nos: 44-125; [0252] the S peptide pool comprising peptides selected from peptides having amino acid sequences set forth in SEQ ID Nos: 126-454.
[0253] In some embodiments the kit further comprises one or more reagents to detect cytokines and/or chemokines secreted from activated T cells.
[0254] In some embodiments the kit further comprises: [0255] i) PCR reagents and/or primers and probes to detect CXCL10 and/or IFN-gamma expression; and/or [0256] ii) ELISPOT reagents.
[0257] In some embodiments, suitable primers and probes are as shown in Table 5.
[0258] In some embodiments, the kit comprises one or more peptide pools selected from the pools in Tables 7-19 rather than the pools in Tables 1-4. Such pools could be used to analyse the effect of virus variants, including variants of concern (VOC), on T cell activation in vaccinated or previously infected subjects.
[0259] In some embodiments the VOC are selected from the group comprising B.1.617.2 (Delta), B.1.1.7 (Alpha V1), B.1.351 (Beta V2), P.1 (Gamma, V3), B.1.617.1 (Kappa), P.2, B.1.427/9 (Epsilon), B.1.525 (Eta), B.1.526 (Iota), C.37 (Lambda), B.1.621 and B.1.620.
[0260] Herein is presented a method based on specific combination of peptide pools covering both different SARS-CoV-2 proteins (i.e., Spike) and the corresponding regions affected by the amino acid mutations that are used to stimulate T cells, The results of this multiple stimulation strategy define with accuracy the impact of these amino acid mutations on the SARS-CoV-2-specific T cells induced by infection with Wuhan strain or by vaccination with the present vaccines based on the Wuhan strain. Peptide pools directed to non-conserved regions of the Wuhan strain variants are shown in Tables 8 to 19, while the sequences of the regions of the Wuhan strain that correspond to the regions of the Delta variant (B.1.617.2) are shown in Table 7.
[0261] Presented herein is an example of a method to analyze the impact of AA mutations present in the Spike protein in different VOCs (using Delta variant as an example) on the SPIKE specific T cells induced by vaccination. It would be understood that pools derived from non-conserved regions of M or NP may be used to analyse the effect of VOCs, depending on the antigens the subject's T cells have been exposed to.
[0262] In an eighth aspect the invention provides a set of at least 2, at least 3, or at least 4 separate pools of peptides suitable to discriminate: [0263] i) past or currently SARS-CoV-2-infected subjects from SARS-CoV-2 un-infected subjects, wherein the peptide pools are selected from those listed in Tables 1 to 4 and 7-19; or [0264] ii) past or currently HBV-infected subjects from HBV un-infected subjects, wherein the peptide pools are selected from those listed in Tables 20-27.
[0265] In a ninth aspect the invention provides a use of a kit of aspect 7 in a method according to any one of aspects 1 to 6.
[0266] Having now generally described the invention, the same will be more readily understood through reference to the following examples which are provided by way of illustration, and are not intended to be limiting of the present invention.
EXAMPLES
[0267] Standard molecular biology techniques known in the art and not specifically described were generally followed as described in Green and Sambrook, Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, New York (2012).
Example 1
SARS-CoV-2 Peptide Pools
[0268] An integral part of our invention is the selection of peptide pools necessary to define a profile of T cell responses that can differentiate individuals that have been primed by SARS-CoV-2 infection or individuals that were infected by other common cold coronaviruses. The SARS-CoV-2 specific T cell responses were profiled in individuals who were in contact with SARS-CoV-2 and tested antibody positive (Abbot test/anti-NP antibody) or were positive in a surrogate virus neutralization assay (sVNT) at the time of the T cell test (symptomatic n=35; asymptomatic n=73), and compared the profile to that obtained from healthy donors (n=51) without any history of SARS-CoV-2 contact and negative for anti-NP SARS-CoV-2 antibodies.
[0269] Four SARS-CoV-2 peptide pools of 15-mers (Tables 1-4) covering NP (NP-1, NP-2), membrane (M), and one pool of 55 peptides covering the most immunogenic regions of Spike (S)(
TABLE-US-00001 TABLE 1 Summary of Peptide Pool M. POOL M Peptide SEQ ID Number A.A Sequence A.A Position Number M_1 MADSNGTITVEELKK 1-15 1 M_2 GTITVEELKKLLEQW 6-20 2 M_3 EELKKLLEQWNLVIG 11-25 3 M_4 LLEQWNLVIGFLFLT 16-30 4 M_5 NLVIGFLFLTWICLL 21-35 5 M_6 FLFLTWICLLQFAYA 26-40 6 M_7 WICLLQFAYANRNRF 31-45 7 M_8 QFAYANRNRFLYIIK 36-50 8 M_9 NRNRFLYIIKLIFLW 41-55 9 M_10 LYIIKLIFLWLLWPV 46-60 10 M_11 LIFLWLLWPVTLACF 51-65 11 M_12 LLWPVTLACFVLAAV 56-70 12 M_13 TLACFVLAAVYRINW 61-75 13 M_14 VLAAVYRINWITGGI 66-80 14 M_15 YRINWITGGIAIAMA 71-85 15 M_16 ITGGIAIAMACLVGL 76-90 16 M_17 AIAMACLVGLMWLSY 81-95 17 M_18 CLVGLMWLSYFIASF 86-100 18 M_19 MWLSYFIASFRLFAR 91-105 19 M_20 FIASFRLFARTRSMW 96-110 20 M_21 RLFARTRSMWSFNPE 101-115 21 M_22 TRSMWSFNPETNILL 106-120 22 M_23 SFNPETNILLNVPLH 111-125 23 M_24 TNILLNVPLHGTILT 116-130 24 M_25 NVPLHGTILTRPLLE 121-135 25 M_26 GTILTRPLLESELVI 126-140 26 M_27 RPLLESELVIGAVIL 131-145 27 M_28 SELVIGAVILRGHLR 136-150 28 M_29 GAVILRGHLRIAGHH 141-155 29 M_30 RGHLRIAGHHLGRCD 146-160 30 M_31 IAGHHLGRCDIKDLP 151-165 31 M_32 LGRCDIKDLPKEITV 156-170 32 M_33 IKDLPKEITVATSRT 161-175 33 M_34 KEITVATSRTLSYYK 166-180 34 M_35 ATSRTLSYYKLGASQ 171-185 35 M_36 LSYYKLGASQRVAGD 176-190 36 M_37 LGASQRVAGDSGFAA 181-195 37 M_38 RVAGDSGFAAYSRYR 186-200 38 M_39 SGFAAYSRYRIGNYK 191-205 39 M_40 YSRYRIGNYKLNTDH 196-210 40 M_41 IGNYKLNTDHSSSSD 201-215 41 M_42 LNTDHSSSSDNIALL 206-220 42 M_43 SSSSDNIALLVQ 211-222 43
TABLE-US-00002 TABLE 2 Summary of Peptide Pool NP-1. POOL NP-1 Peptide A.A SEQ ID Number A.A Sequence Position Number NP_1 MSDNGPQNQRNAPRI 1-15 44 NP_2 PQNQRNAPRITFGGP 6-20 45 NP_3 NAPRITFGGPSDSTG 11-25 46 NP_4 TFGGPSDSTGSNQNG 16-30 47 NP_5 SDSTGSNQNGERSGA 21-35 48 NP_6 SNQNGERSGARSKQR 26-40 49 NP_7 ERSGARSKQRRPQGL 31-45 50 NP_8 RSKQRRPQGLPNNTA 36-50 51 NP_9 RPQGLPNNTASWFTA 41-55 52 NP_10 PNNTASWFTALTQHG 46-60 53 NP_11 SWFTALTQHGKEDLK 51-65 54 NP_12 LTQHGKEDLKFPRGQ 56-70 55 NP_13 KEDLKFPRGQGVPIN 61-75 56 NP_14 FPRGQGVPINTNSSP 66-80 57 NP_15 GVPINTNSSPDDQIG 71-85 58 NP_16 TNSSPDDQIGYYRRA 76-90 59 NP_17 DDQIGYYRRATRRIR 81-95 60 NP_18 YYRRATRRIRGGDGK 86-100 61 NP_19 TRRIRGGDGKMKDLS 91-105 62 NP_20 GGDGKMKDLSPRWYF 96-110 63 NP_21 MKDLSPRWYFYYLGT 101-115 64 NP_22 PRWYFYYLGTGPEAG 106-120 65 NP_23 YYLGTGPEAGLPYGA 111-125 66 NP_24 GPEAGLPYGANKDGI 116-130 67 NP_25 LPYGANKDGIIWVAT 121-135 68 NP_26 NKDGIIWVATEGALN 126-140 69 NP_27 IWVATEGALNTPKDH 131-145 70 NP_28 EGALNTPKDHIGTRN 136-150 71 NP_29 TPKDHIGTRNPANNA 141-155 72 NP_30 IGTRNPANNAAIVLQ 146-160 73 NP_31 PANNAAIVLQLPQGT 151-165 74 NP_32 AIVLQLPQGTTLPKG 156-170 75 NP_33 LPQGTTLPKGFYAEG 161-175 76 NP_34 TLPKGFYAEGSRGGS 166-180 77 NP_35 FYAEGSRGGSQASSR 171-185 78 NP_36 SRGGSQASSRSSSRS 176-190 79 NP_37 QASSRSSSRSRNSSR 181-195 80 NP_38 SSSRSRNSSRNSTPG 186-200 81 NP_39 RNSSRNSTPGSSRGT 191-205 82 NP_40 NSTPGSSRGTSPARM 196-210 83 NP_41 SSRGTSPARMAGNGG 201-215 84
TABLE-US-00003 TABLE 3 Summary of Peptide Pool NP-2. POOL NP-2 Peptide A.A SEQ ID Number A.A Sequence Position Number NP_42 SPARMAGNGGDAALA 206-220 85 NP_43 AGNGGDAALALLLLD 211-225 86 NP_44 DAALALLLLDRLNQL 216-230 87 NP_45 LLLLDRLNQLESKMS 221-235 88 NP_46 RLNQLESKMSGKGQQ 226-240 89 NP_47 ESKMSGKGQQQQGQT 231-245 90 NP_48 GKGQQQQGQTVTKKS 236-250 91 NP_49 QQGQTVTKKSAAEAS 241-255 92 NP_50 VTKKSAAEASKKPRQ 246-260 93 NP_51 AAEASKKPRQKRTAT 251-265 94 NP_52 KKPRQKRTATKAYNV 256-270 95 NP_53 KRTATKAYNVTQAFG 261-275 96 NP_54 KAYNVTQAFGRRGPE 266-280 97 NP_55 TQAFGRRGPEQTQGN 271-285 98 NP_56 RRGPEQTQGNFGDQE 276-290 99 NP_57 QTQGNFGDQELIRQG 281-295 100 NP_58 FGDQELIRQGTDYKH 286-300 101 NP_59 LIRQGTDYKHWPQIA 291-305 102 NP_60 TDYKHWPQIAQFAPS 296-310 103 NP_61 WPQIAQFAPSASAFF 301-315 104 NP_62 QFAPSASAFFGMSRI 306-320 105 NP_63 ASAFFGMSRIGMEVT 311-325 106 NP_64 GMSRIGMEVTPSGTW 316-330 107 NP_65 GMEVTPSGTWLTYTG 321-335 108 NP_66 PSGTWLTYTGAIKLD 326-340 109 NP_67 LTYTGAIKLDDKDPN 331-345 110 NP_68 AIKLDDKDPNFKDQV 336-350 111 NP_69 DKDPNFKDQVILLNK 341-355 112 NP_70 FKDQVILLNKHIDAY 346-360 113 NP_71 ILLNKHIDAYKTFPP 351-365 114 NP_72 HIDAYKTFPPTEPKK 356-370 115 NP_73 KTFPPTEPKKDKKKK 361-375 116 NP_74 TEPKKDKKKKADETQ 366-380 117 NP_75 DKKKKADETQALPQR 371-385 118 NP_76 ADETQALPQRQKKQQ 376-390 119 NP_77 ALPQRQKKQQTVTLL 381-395 120 NP_78 QKKQQTVTLLPAADL 386-400 121 NP_79 TVTLLPAADLDDFSK 391-405 122 NP_80 PAADLDDFSKQLQQS 396-410 123 NP_81 DDFSKQLQQSMSSAD 401-415 124 NP_82 QLQQSMSSADSTQA 406-419 125
TABLE-US-00004 TABLE 4 Summary of Peptide Pool SP. POOL SP Peptide A.A SEQ ID Number A.A Sequence Position Number SP_21 IRGWIFGTTLDSKTQ 101-115 126 SP_22 FGTTLDSKTQSLLIV 106-120 127 SP_34 CTFEYVSQPFLMDLE 166-180 128 SP_35 VSQPFLMDLEGKQGN 171-185 129 SP_48 TRFQTLLALHRSYLT 236-250 130 SP_49 LLALHRSYLTPGDSS 241-255 131 SP_50 RSYLTPGDSSSGWTA 246-260 132 SP_59 CALDPLSETKCTLKS 291-305 133 SP_60 LSETKCTLKSFTVEK 296-310 134 SP_61 CTLKSFTVEKGIYQT 301-315 135 SP_62 FTVEKGIYQTSNFRV 306-320 136 SP_63 GIYQTSNFRVQPTES 311-325 137 SP_70 RFASVYAWNRKRISN 346-360 181 SP_71 YAWNRKRISNCVADY 351-365 182 SP_75 SASFSTFKCYGVSPT 371-385 138 SP_76 TFKCYGVSPTKLNDL 376-390 139 SP_85 YNYKLPDDFTGCVIA 421-435 140 SP_88 WNSNNLDSKVGGNYN 436-450 141 SP_89 LDSKVGGNYNYLYRL 441-455 142 SP_90 GGNYNYLYRLFRKSN 446-460 143 SP_91 YLYRLFRKSNLKPFE 451-465 144 SP_92 FRKSNLKPFERDIST 456-470 145 SP_93 LKPFERDISTEIYQA 461-475 146 SP_106 GPKKSTNLVKNKCVN 526-540 147 SP_107 TNLVKNKCVNFNFNG 531-545 148 SP_109 FNFNGLTGTGVLTES 541-555 149 SP_110 LTGTGVLTESNKKFL 546-560 150 SP_130 RAGCLIGAEHVNNSY 646-660 151 SP_131 IGAEHVNNSYECDIP 651-665 152 SP_138 SVASQSIIAYTMSLG 686-700 153 SP_139 SIIAYTMSLGAENSV 691-705 154 SP_140 TMSLGAENSVAYSNN 696-710 155 SP_150 STECSNLLLQYGSFC 746-760 156 SP_151 NLLLQYGSFCTQLNR 751-765 157 SP_156 KNTQEVFAQVKQIYK 776-790 158 SP_157 VFAQVKQIYKTPPIK 781-795 159 SP_158 KQIYKTPPIKDFGGF 786-800 160 SP_159 TPPIKDFGGFNFSQI 791-805 161 SP_161 NFSQILPDPSKPSKR 801-815 162 SP_167 AGFIKQYGDCLGDIA 831-845 163 SP_168 QYGDCLGDIAARDLI 836-850 164 SP_179 GAALQIPFAMQMAYR 891-905 165 SP_181 QMAYRFNGIGVTQNV 901-915 166 SP_182 FNGIGVTQNVLYENQ 906-920 167 SP_188 DSLSSTASALGKLQD 936-950 168 SP_189 TASALGKLQDVVNQN 941-955 169 SP_192 AQALNTLVKQLSSNF 956-970 170 SP_196 VLNDILSRLDKVEAE 976-990 171 SP_200 LITGRLQSLQTYVTQ 996-1010 172 SP_203 QLIRAAEIRASANLA 1011-1025 173 SP_204 AEIRASANLAATKMS 1016-1030 174 SP_212 APHGVVFLHVTYVPA 1056-1070 175 SP_221 HWFVTQRNFYEPQII 1101-1115 176 SP_237 KEIDRLNEVAKNLNE 1181-1195 177 SP_238 LNEVAKNLNESLIDL 1186-1200 178 SP_239 KNLNESLIDLQELGK 1191-1205 179 SP_244 IWLGFIAGLIAIVMV 1216-1230 180
Example 2
Sample Processing and Testing
Human Samples
[0270] Whole blood samples (8 ml) were collected from individuals who were in contact with SARS-CoV-2 and tested antibody positive (Abbot test/anti-NP antibody), or were positive in a surrogate virus neutralization assay (sVNT) at the time of the T cell test (symptomatic n=35; asymptomatic n=73), or were healthy donors (n=51) without any history of SARS-CoV-2 contact and negative for anti-NP SARS-CoV-2 antibodies.
[0271] Schematic representations of suitable assays of the invention are presented in
ELISpot Testing of PBMCs
[0272] SARS-CoV-2-specific T cells were tested as described previously [Le Bert N, et al., Nature 584(7821): 457-62 (2020)]. Briefly, peripheral blood mononuclear cells (PBMCs) were isolated from 8 ml whole blood by density-gradient centrifugation using Ficoll-Paque™ (Sigma-Aldrich). Isolated PBMC were either studied directly or cryopreserved and stored in liquid nitrogen until used in the assays.
[0273] ELISpot plates (Millipore) were coated with human IFNγ antibody (1-D1K, Mabtech; 5 μg/ml) overnight at 4° C. Then, 4×10.sup.5 PBMCs were seeded per well and stimulated for 18 h with the different pools of SARS-CoV-2 peptides (2 μg/ml final concentration per peptide) described in Tables 1-4. For stimulation with peptide matrix pools or single peptides, a concentration of 5 μg/ml was used. Subsequently, the plates were developed with human biotinylated IFNγ detection antibody (7-B6-1, Mabtech; 1:2,000), followed by incubation with streptavidin-AP (Mabtech) and KPL BCIP/NBT Phosphatase Substrate (SeraCare). Spot forming units (SFU) were quantified with ImmunoSpot. To quantify positive peptide-specific responses, the highest number of spots of the unstimulated (or DMSO stimulated) wells was subtracted from the peptide-stimulated wells, and the results expressed as SFU/10.sup.6 PBMCs. We excluded the results if negative control wells had >30 SFU/10.sup.6 PBMCs or positive control wells (phorbol 12-myristate 13-acetate/ionomycin) were negative.
[0274] The ELISPOT assays showed that patients who have been infected by SARS-CoV-2 and cleared the virus up to 3 months ago have T cells that are reactive to peptide pools covering Membrane, Nucleoprotein and Spike (
Whole Blood Testing
[0275] Whole blood was isolated from each subject and tested within 24 hours after blood draw. 400 μl aliquots were separately mixed with 100 μl RPMI containing each of the SARS-CoV-2 peptide pools (2 μg/ml final concentration per peptide) or a DMSO control and incubated for a period extending overnight, to allow activation of responsive T cells. A plasma fraction was isolated from each of the incubated samples (about 30 minutes) and the level of cytokines in the sample measured using an EIIa™ multi-analyte ELISA machine (ProteinSimple, CA, USA).
[0276] It would be understood that the parameters described in the example may be changed and still achieve a valid assay. For example, the ratio of blood to RMPI media can range from 100% blood to 50% blood; 100 μl aliquots or more than 400 μl might be used, but a larger blood sample would be required to test multiple peptide pools. RPMI may be exchanged with other cell culture media. The final concentration of peptides in an assay mixture may be from 1 to 5 μg/ml. The control sample may contain DMSO or may be an unstimulated blood sample. The incubation period may range between about 6-24 h.
[0277] Having showed that the distinct peptide pools are able to define individuals that were recently in contact with SARS-CoV-2 (
[0278] SARS-CoV-2 reactive T cells in infected individuals can be detected by quantifying the amount of secreted IFN-γ after the direct addition of the peptide pools into whole blood (
qPCR and dqPCR Testing of PBMCs
[0279] The complexity of quantifying the presence of virus-specific T cell has so far prevented large scale studies of the cellular immune response to viral infection or, more recently, the vaccine. To address this problem, we have implemented a qPCR-based rapid T cell Activation (qTACT) assay, based on in vitro stimulation of whole blood samples with a pool of viral peptides covering the spike or other SARS-CoV-2 viral proteins (i.e., nucleoprotein [N]) [Le Bert, N., et al. Nature 584: 457-462 (2020); Kalimuddin S, et al., Med (N Y). 2021 Jun. 11; 2(6):682-688.e4. doi: 10.1016/j.medj.2021.04.003; Le Bert, N. et al., J Exp Med 218(5):e20202617 (2021)], followed by direct amplification of IFN-γ or IL-2 (directly produced by SARS-CoV-2 antigen-specific T cells) or CXCL10, a molecule expressed by monocytes in response to T cell activation. A further technical implementation of the assay allows quantification of T cell immunity directly from blood, bypassing the need for red blood cell (RBC) lysis or RNA purification. We call this latter assay direct qPCR-based rapid T cell Activation (dqTACT) assay
Summary of Methods
[0280] 1. Collect blood (sodium heparin collection tube) & stimulate (320 μl blood+80 μl RPMI/peptide) overnight. [0281] 2. The next morning, collect 25 μl of serum in Eppendorf tubes for ELLA/ELISA (freeze −80° C.). [0282] 3. Replace serum with 25 μl of RPMI. [0283] 4. Vortex or pipette up and down aggressively. [0284] 5. Split remaining sample into two more tubes: [0285] a. Tube A (whole blood—dqTACT): 180 μl blood+540 μl buffer A (process immediately or freeze −80° C.). [0286] b. Tube B (RNA—qTACT): 180 μl blood+180 μl RNA/DNA shield+3.6 μl blood proteinase K (incubate at room temperature for 30 minutes then process immediately or freeze −80° C.). [0287] i. To extract, add Trizol reagent (1:1) then proceed with Direct-zol 96 extraction kit (Zymo).
[0288] Primers and probes should be resuspended at 100 μM and stored at −20° C. Keep probes away from light when working with them.
TABLE-US-00005 TABLE 5 Primer & probe sequences (for qTACT or dqTACT) SEQ Primer/ ID probe Primer/probe sequence No ACTIN /5HEX/TCATCCATG/ZEN/ 455 probe GTGAGCTGGCGG/3IABkFQ/ HEX CXCL10 /56-FAM/AGTGGCATT/ZEN/ 456 probe CAAGGAGTACCTCTCTCT/ FAM 3IABkFQ/ ACTIN CCTTGCACATGCCGGAG 457 primer 1 ACTIN ACAGAGCCTCGCCTTTG 458 primer 2 CXCL10 CCATTCTGATTTGCTGCCTTATC 459 primer 1 CXCL10 TACTAATGCTGATGCAGGTACAG 460 primer 2
dqTACT PCR 1× Mix:
[0289] 10 μl SCRIPT Direct RT-qPCR ProbesMaster mix; 0.1 μl ACTIN primer 1; 0.1 μl ACTIN primer 2; 0.1 μl CXCL10 primer 1; 0.1 μl CXCL10 primer 2; 0.05 μl ACTIN probe (HEX); 0.05 μl CXCL10 probe (FAM); 2 μl blood/buffer A mixture; 7.5 μl PEC-1
qTACT PCR 1× Mix:
[0290] 5 μl TaqPath 1 Step Multiplex Master Mix (no ROX); 0.1 μl ACTIN primer 1; 0.1 μl ACTIN primer 2; 0.1 μl CXCL10 primer 1; 0.1 μl CXCL10 primer 2; 0.05 μl ACTIN probe (HEX); 0.05 μl CXCL10 probe (FAM); 5 μl RNA; 9.5 μl PEC-1
dqTACT Run Conditions (Hyris bCUBE ONLY): [0291] Reverse transcription: 53° C. for 15 minutes [0292] Initial denaturation: 95° C. for 5 minutes [0293] PCR (X45 cycles): [0294] 95° C. 15 seconds [0295] 60° C. 30 seconds
qTACT Run Conditions (Hyris bCUBE or CFX96/384) [0296] UNG incubation: 25° C. for 2 minutes [0297] Reverse transcription: 53° C. for 10 minutes [0298] Initial denaturation: 95° C. for 2 minutes [0299] PCR (X45 cycles): [0300] 95° C. for 15 seconds [0301] 60° C. for 30 seconds
Protocol Descriptions
[0302] Whole Blood Culture with SARS-CoV-2 Peptide Pools
[0303] 320 μl of whole blood drawn on the same day into sodium heparin tubes (BD) were mixed with 80 μl RPMI and stimulated with pools of SARS-CoV-2 peptides (S or NP; 2 μg/ml) or DMSO control at 37° C. After 15-17 hours of stimulation, the supernatant (plasma) was collected and stored at −80° C. until quantification of cytokines.
qTACT Assay
[0304] Samples used for RNA extraction were diluted 1:1 with RNA/DNA shield (Zymo) and incubated at room temperature with proteinase K at a 1:100 dilution (20 mg/ml stock). Samples were then frozen at −80° C. until RNA extraction could be performed. Samples stored in RNA/DNA shield were thawed at room temperature prior to RNA extraction. Samples were vortexed and mixed with Trizol reagent (Life Technologies) at a 1:1 dilution. After vortexing, samples were processed using the Direct-zol 96 well extraction kit (Zymo) as per the manufacturer's instructions. Eluted RNA was diluted in TE buffer, aliquoted, and stored at −80° C. or used immediately for qPCR analysis. Real-time quantification was performed on a BioRad CFX96/CFX384 or Hyris bCUBE 2.0. 5 μl of diluted RNA was used with the TaqPath 1-Step Multiplex MasterMix (Applied Biosystems) and primers/probes targeting ACTIN (internal control) and other target genes, as described.
dqTACT Assay
[0305] Samples used for direct amplification from whole blood were diluted 1:3 with Buffer A and stored at −80° C. or used immediately for qPCR analysis. 2 μl of diluted whole blood was mixed with SCRIPT Direct RT-qPCR ProbesMaster (Jena Bioscience) and primers/probes targeting ACTIN (internal control) and other target genes, as described. Quantification was performed using the Hyris bCUBE 2.0.
[0306] Reagents: [0307] Buffer A: 2% Tween-20 in RNAse free water [0308] SCRIPT Direct RT-qPCR ProbesMaster mix: worldwidewebdotjenabiosciencedotcom/molecular-biology/reversetranscription-rt-pcr/direct-rt-qpcr-robust-amplification/pcr-528-script-direct-rt-qpcr-probesmaster [0309] PEC-1: worldwidewebdotklentaqdotcom/products/pcr-enhancer-cocktail-1 [0310] TaqPath 1 Step Multiplex Master Mix: worldwidewebdotthermofisherdotcom/order/catalog/product/A28526#/A28526
Algorithm Representing T Cell Response Profile
[0311] The present study demonstrates that distinct SARS-CoV-2 peptide pools are able to define the individuals that were recently infected with SARS-CoV-2. This T cell response profile can be evaluated using other laboratory techniques capable of detecting T cell activation after peptide stimulation, including the direct activation of antigen-specific T cells in whole blood. A proposed algorithm to interpret the SARS-CoV-2 T cell response profile is summarized in Table 6.
[0312] Table 6 summarizes the interpretation of the SARS-CoV-2 T cell response profile in Example 1. When 50% or more of the pools (thus 2, 3 or 4 out of 4) are positive, the subject is categorized as having SARS-COV2 specific T cells induced by SARS-COV-2 infection (thus previously or currently SARS-COV-2 infected).
TABLE-US-00006 TABLE 6 Proposed algorithm to interpret SARS- CoV-2 T cell response profile No. of positive pools Spike M NP1 NP2 Interpretation 4 + + + + Infected 3 − + + + Infected + − + + + + − + + + + − 2 + + − − Infected + − + − + − − + − + + − − + − + − − + + 1 + − − − Uninfected − + − − − − + − − − − + 0 − − − − Uninfected
Example 3
Impact of Variants of Concern on T Cells Induced by SARS-CoV-2 Wuhan Infection or SARS-CoV-2 Vaccines
[0313] Different variants of concern (VOC) of SARS-CoV-2 have replaced world-wide the original SARS-CoV-2 Wuhan isolate. These VOCs are characterized by amino acid substitutions that provide biological advantages like increased infectivity or escape humoral (antibodies) but also cellular (T cells) immunity. We have designed a method based on specific combination of peptide pools covering both different SARS-CoV-2 proteins (i.e., Spike) and the corresponding regions affected by the amino acid mutations that are used to stimulate T cells, The results of this multiple stimulation strategy define with accuracy the impact of these amino acid mutations on the SARS-CoV-2-specific T cells induced by infection with Wuhan strain or by vaccination with the present vaccines based on the Wuhan strain. Peptide pools directed to non-conserved regions of the Wuhan strain variants are shown in Tables 8 to 19, while the sequences of the regions of the Wuhan strain that correspond to the regions of the Delta variant (B.1.617.2) are shown in Table 7.
[0314] The inventors present here as an example the method to analyze the impact of AA mutations present in Spike in different VOCs (using Delta variant as an example) on the SPIKE specific T cells induced by vaccination.
TABLE-US-00007 TABLE 7 Peptide sequences of non-conserved regions in Wuhan strain corresponding to Delta mutation peptides shown in Table 8. POOL SP Peptide A.A SEQ ID Number A.A Sequence Position Number SP_002 VLLPLVSSQCVNLTT 6-20 461 SP_003 VSSQCVNLTTRTQLP 11-25 462 SP_004 VNLTTRTQLPPAYTN 16-30 463 SP_027 CEFQFCNDPFLGVYY 131-145 464 SP_028 CNDPFLGVYYHKNNK 136-150 465 SP_029 LGVYYHKNNKSWMES 141-155 466 SP_030 HKNNKSWMESEFRVY 146-160 467 SP_031 SWMESEFRVYSSANN 151-165 468 SP_032 EFRVYSSANNCTFEY 156-170 469 SP_089 LDSKVGGNYNYLYRL 441-455 142 SP_090 GGNYNYLYRLFRKSN 446-460 143 SP_091 YLYRLFRKSNLKPFE 451-465 144 SP_094 RDISTEIYQAGSTPC 466-480 470 SP_095 EIYQAGSTPCNGVEG 471-485 471 SP_096 GSTPCNGVEGFNCYF 476-490 472 SP_121 GTNTSNQVAVLYQDV 601-615 473 SP_122 NQVAVLYQDVNCTEV 606-620 474 SP_123 LYQDVNCTEVPVAIH 611-625 475 SP_135 CASYQTQTNSPRRAR 671-685 476 SP_136 TQTNSPRRARSVASQ 676-690 477 SP_137 PRRARSVASQSIIAY 681-695 478 SP_188 DSLSSTASALGKLQD 936-950 168 SP_189 TASALGKLQDVVNQN 941-955 169 SP_190 GKLQDVVNQNAQALN 946-960 479
TABLE-US-00008 TABLE 8 Peptide sequences of non-conserved regions in SEQUENCE_21A (Delta) (B.1.617.2) POOL SP Peptide A.A SEQ ID Number A.A Sequence Position Number SP_002 VLLPLVSSQCVNLRT 6-20 183 SP_003 VSSQCVNLRTRTQLP 11-25 184 SP_004 VNLRTRTQLPPAYTN 16-30 185 SP_027 CEFQFCNDPFLDVYY 131-145 186 SP_028 CNDPFLDVYYHKNNK 136-150 187 SP_029 LDVYYHKNNKSWMES 141-155 188 SP_030 HKNNKSWMESGVYSS 146-160 189 SP_031 SWMESGVYSSANNCT 151-165 190 SP_032 GVYSSANNCTFEYVS 156-170 191 SP_089 LDSKVGGNYNYRYRL 441-455 192 SP_090 GGNYNYRYRLFRKSN 446-460 193 SP_091 YRYRLFRKSNLKPFE 451-465 194 SP_094 RDISTEIYQAGSKPC 466-480 195 SP_095 EIYQAGSKPCNGVEG 471-485 196 SP_096 GSKPCNGVEGFNCYF 476-490 197 SP_121 GTNTSNQVAVLYQGV 601-615 198 SP_122 NQVAVLYQGVNCTEV 606-620 199 SP_123 LYQGVNCTEVPVAIH 611-625 200 SP_135 CASYQTQTNSRRRAR 671-685 201 SP_136 TQTNSRRRARSVASQ 676-690 202 SP_137 RRRARSVASQSIIAY 681-695 203 SP_188 DSLSSTASALGKLQN 936-950 204 SP_189 TASALGKLQNVVNQN 941-955 205 SP_190 GKLQNVVNQNAQALN 946-960 206
TABLE-US-00009 TABLE 9 Peptide sequences of non-conserved regions in SEQUENCE_20I (Alpha, V1) (B.1.1.7) POOL SP Peptide A.A SEQ ID Number A.A Sequence Position Number SP_012 LPFFSNVTWFHAISG 56-70 207 SP_013 NVTWFHAISGTNGTK 61-75 208 SP_014 HAISGTNGTKRFDNP 66-80 209 SP_027 CEFQFCNDPFLGVYH 131-145 210 SP_028 CNDPFLGVYHKNNKS 136-150 211 SP_029 LGVYHKNNKSWMESE 141-155 212 SP_095 EIYQAGSTPCNGVKG 471-485 213 SP_096 GSTPCNGVKGFNCYF 476-490 214 SP_097 NGVKGFNCYFPLQPY 481-495 215 SP_098 FNCYFPLQPYGFQPT 486-500 216 SP_099 PLQPYGFQPTYGVGY 491-505 217 SP_100 GFQPTYGVGYQPYRV 496-510 218 SP_101 YGVGYQPYRVVVLSF 501-515 219 SP_112 NKKFLPFQQFGRDID 556-570 220 SP_113 PFQQFGRDIDDTTDA 561-575 221 SP_114 GRDIDDTTDAVRDPQ 566-580 222 SP_121 GTNTSNQVAVLYQGV 601-615 223 SP_122 NQVAVLYQGVNCTEV 606-620 224 SP_123 LYQGVNCTEVPVAIH 611-625 225 SP_135 CASYQTQTNSHRRAR 671-685 226 SP_136 TQTNSHRRARSVASQ 676-690 227 SP_137 HRRARSVASQSIIAY 681-695 228 SP_142 AYSNNSIAIPINFTI 706-720 229 SP_143 SIAIPINFTISVTTE 711-725 230 SP_144 INFTISVTTEILPVS 716-730 231 SP_195 GAISSVLNDILARLD 971-985 232 SP_196 VLNDILARLDKVEAE 976-990 233 SP_197 LARLDKVEAEVQIDR 981-995 234 SP_222 QRNFYEPQIITTHNT 1106-1120 235 SP_223 EPQIITTHNTFVSGN 1111-1125 236 SP_224 TTHNTFVSGNCDVVI 1116-1130 237 SP-237 KEIDRLNEVANNLNE 1181-1195 238 SP_238 LNEVANNLNESLIDL 1186-1200 239 SP_239 NNLNESLIDLQELGK 1191-1205 240
TABLE-US-00010 TABLE 10 Peptide sequences of non-conserved regions in SEQUENCE_20H (Beta, V2) (B.1.351) POOL SP Peptide A.A SEQ ID Number A.A Sequence Position Number SP_002 VLLPLVSSQCVNFTT 6-20 241 SP_003 VSSQCVNFTTRTQLP 11-25 242 SP_004 VNFTTRTQLPPAYTN 16-30 243 SP_014 HAIHVSGTNGTKRFA 66-80 244 SP_015 SGTNGTKRFANPVLP 71-85 245 SP_016 TKRFANPVLPFNDGV 76-90 246 SP_041 FKIYSKHTPINLVRG 201-215 247 SP_042 KHTPINLVRGLPQGF 206-220 248 SP_043 NLVRGLPQGFSALEP 211-225 249 SP_047 IGINITRFQTLHRSY 231-245 250 SP_048 TRFQTLHRSYLTPGD 236-250 251 SP_049 LHRSYLTPGDSSSGW 241-255 252 SP_082 EVRQIAPGQTGNIAD 406-420 253 SP_083 APGQTGNIADYNYKL 411-425 254 SP_084 GNIADYNYKLPDDFT 416-430 255 SP_095 EIYQAGSTPCNGVKG 471-485 256 SP_096 GSTPCNGVKGFNCYF 476-490 257 SP_097 NGVKGFNCYFPLQSY 481-495 258 SP_099 PLQSYGFQPTYGVGY 491-505 259 SP_100 GFQPTYGVGYQPYRV 496-510 260 SP_101 YGVGYQPYRVVVLSF 501-515 261 SP_121 GTNTSNQVAVLYQGV 601-615 262 SP_122 NQVAVLYQGVNCTEV 606-620 263 SP_123 LYQGVNCTEVPVAIH 611-625 264 SP_139 SIIAYTMSLGVENSV 691-705 265 SP_140 TMSLGVENSVAYSNN 696-710 266 SP_141 VENSVAYSNNSIAIP 701-715 267
TABLE-US-00011 TABLE 11 Peptide sequences of non-conserved regions in SEQUENCE_20J (Gamma, V3) (P.1) POOL SP Peptide A.A SEQ ID Number A.A Sequence Position Number SP_002 VLLPLVSSQCVNFTN 6-20 268 SP_003 VSSQCVNFTNRTQLP 11-25 269 SP_004 VNFTNRTQLPSAYTN 16-30 270 SP_005 RTQLPSAYTNSFTRG 21-35 271 SP_006 SAYTNSFTRGVYYPD 26-40 272 SP_026 VVIKVCEFQFCNYPF 126-140 273 SP_027 CEFQFCNYPFLGVYY 131-145 274 SP_028 CNYPFLGVYYHKNNK 136-150 275 SP_036 LMDLEGKQGNFKNLS 176-190 276 SP_037 GKQGNFKNLSEFVFK 181-195 277 SP_038 FKNLSEFVFKNIDGY 186-200 278 SP_082 EVRQIAPGQTGTIAD 406-420 279 SP_083 APGQTGTIADYNYKL 411-425 280 SP_084 GTIADYNYKLPDDFT 416-430 281 SP_095 EIYQAGSTPCNGVKG 471-485 282 SP_096 GSTPCNGVKGFNCYF 476-490 283 SP_097 NGVKGFNCYFPLQSY 481-495 284 SP_099 PLQSYGFQPTYGVGY 491-505 285 SP_100 GFQPTYGVGYQPYRV 496-510 286 SP_101 YGVGYQPYRVVVLSF 501-515 287 SP_121 GTNTSNQVAVLYQGV 601-615 288 SP_122 NQVAVLYQGVNCTEV 606-620 289 SP_123 LYQGVNCTEVPVAIH 611-625 290 SP_129 NVFQTRAGCLIGAEY 641-655 291 SP_130 RAGCLIGAEYVNNSY 646-660 292 SP_131 IGAEYVNNSYECDIP 651-665 293 SP_204 AEIRASANLAAIKMS 1016-1030 294 SP_205 SANLAAIKMSECVLG 1021-1035 295 SP_206 AIKMSECVLGQSKRV 1026-1040 296 SP_234 LGDISGINASFVNIQ 1166-1180 297 SP_235 GINASFVNIQKEIDR 1171-1185 298 SP_236 FVNIQKEIDRLNEVA 1176-1190 299
TABLE-US-00012 TABLE 12 Peptide sequences of non-conserved regions in SEQUENCE_21B (Kappa) (B.1.617.1) POOL SP Peptide A.A SEQ ID Number A.A Sequence Position Number SP_017 NPVLPFNDGVYFASI 81-95 300 SP_018 FNDGVYFASIEKSNI 86-100 301 SP_019 YFASIEKSNIIRGWI 91-105 302 SP_027 CEFQFCNDPFLDVYY 131-145 303 SP_028 CNDPFLDVYYHKNNK 136-150 304 SP_029 LDVYYHKNNKSWMKS 141-155 305 SP_030 HKNNKSWMKSEFRVY 146-160 306 SP_031 SWMKSEFRVYSSANN 151-165 307 SP_089 LDSKVGGNYNYRYRL 441-455 308 SP_090 GGNYNYRYRLFRKSN 446-460 309 SP_091 YRYRLFRKSNLKPFE 451-465 310 SP_095 EIYQAGSTPCNGVQG 471-485 311 SP_096 GSTPCNGVQGFNCYF 476-490 312 SP_097 NGVQGFNCYFPLQSY 481-495 313 SP_121 GTNTSNQVAVLYQGV 601-615 314 SP_122 NQVAVLYQGVNCTEV 606-620 315 SP_123 LYQGVNCTEVPVAIH 611-625 316 SP_135 CASYQTQTNSRRRAR 671-685 317 SP_136 TQTNSRRRARSVASQ 676-690 318 SP_137 RRRARSVASQSIIAY 681-695 319 SP_213 VFLHVTYVPAHEKNF 1061-1075 320 SP_214 TYVPAHEKNFTTAPA 1066-1080 321 SP_215 HEKNFTTAPAICHDG 1071-1085 322
TABLE-US-00013 TABLE 13 Peptide sequences of non-conserved regions in SEQUENCE_20B/S.484K (P.2) POOL SP Peptide A.A SEQ ID Number A.A Sequence Position Number SP_095 EIYQAGSTPCNGVKG 471-485 323 SP_096 GSTPCNGVKGFNCYF 476-490 324 SP_097 NGVKGFNCYFPLQSY 481-495 325 SP_121 GTNTSNQVAVLYQGV 601-615 326 SP_122 NQVAVLYQGVNCTEV 606-620 327 SP_123 LYQGVNCTEVPVAIH 611-625 328 SP_234 LGDISGINASFVNIQ 1166-1180 329 SP_235 GINASFVNIQKEIDR 1171-1185 330 SP_236 FVNIQKEIDRLNEVA 1176-1190 331
TABLE-US-00014 TABLE 14 Peptide sequences of non-conserved regions in SEQUENCE_21C (Epsilon) (B.1.427/9) POOL SP Peptide A.A SEQ ID Number A.A Sequence Position Number SP_001 MFVFLVLLPLVSIQC 1-15 332 SP_002 VLLPLVSIQCVNLTT 6-20 333 SP_003 VSIQCVNLTTRTQLP 11-25 334 SP_029 LGVYYHKNNKSCMES 141-155 335 SP_030 HKNNKSCMESEFRVY 146-160 336 SP_031 SCMESEFRVYSSANN 151-165 337 SP_089 LDSKVGGNYNYRYRL 441-455 338 SP_090 GGNYNYRYRLFRKSN 446-460 339 SP_091 YRYRLFRKSNLKPFE 451-465 340 SP_121 GTNTSNQVAVLYQGV 601-615 341 SP_122 NQVAVLYQGVNCTEV 606-620 342 SP_123 LYQGVNCTEVPVAIH 611-625 343
TABLE-US-00015 TABLE 15 Peptide sequences of non-conserved regions in SEQUENCE_21D (Eta) (B.1.525) POOL SP Peptide A.A SEQ ID Number A.A Sequence Position Number SP_009 KVFRSSVLHSTRDLF 41-55 344 SP_010 SVLHSTRDLFLPFFS 46-60 345 SP_011 TRDLFLPFFSNVTWF 51-65 346 SP_012 LPFFSNVTWFHVISG 56-70 347 SP 013 NVTWFHVISGTNGTK 61-75 348 SP_014 HVISGTNGTKRFDNP 66-80 349 SP_027 CEFQFCNDPFLGVYH 131-145 350 SP_028 CNDPFLGVYHKNNKS 136-150 351 SP-029 LGVYHKNNKSWMESE 141-155 352 SP_095 EIYQAGSTPCNGVKG 471-485 353 SP_096 GSTPCNGVKGFNCYF 476-490 354 SP_097 NGVKGFNCYFPLQSY 481-495 355 SP_121 GTNTSNQVAVLYQGV 601-615 356 SP_122 NQVAVLYQGVNCTEV 606-620 357 SP-123 LYQGVNCTEVPVAIH 611-625 358 SP_134 IGAGICASYQTHTNS 666-680 359 SP_135 CASYQTHTNSPRRAR 671-685 360 SP_136 THTNSPRRARSVASQ 676-690 361 SP_176 ALLAGTITSGWTLGA 876-890 362 SP_177 TITSGWTLGAGAALQ 881-895 363 SP_178 WTLGAGAALQIPFAM 886-900 364
TABLE-US-00016 TABLE 16 Peptide sequences of non-conserved regions in SEQUENCE_21F (Iota) (B.1.526) POOL SP Peptide A.A SEQ ID Number A.A Sequence Position Number SP_001 MFVFFVLLPLVSSQC 1-15 365 SP_017 NPVLPFNDGVYFASI 81-95 366 SP_018 FNDGVYFASIEKSNI 86-100 367 SP_019 YFASIEKSNIIRGWI 91-105 368 SP_049 LLALHRSYLTPGGSS 241-255 369 SP_050 RSYLTPGGSSSGWTA 246-260 370 SP_051 PGGSSSGWTAGAAAY 251-265 371 SP_095 EIYQAGSTPCNGVKG 471-485 372 SP_096 GSTPCNGVKGFNCYF 476-490 373 SP_097 NGVKGFNCYFPLQSY 481-495 374 SP_121 GTNTSNQVAVLYQGV 601-615 375 SP_122 NQVAVLYQGVNCTEV 606-620 376 SP_123 LYQGVNCTEVPVAIH 611-625 377 SP_139 SIIAYTMSLGVENSV 691-705 378 SP_140 TMSLGVENSVAYSNN 696-710 379 SP_141 VENSVAYSNNSIAIP 701-715 380
TABLE-US-00017 TABLE 17 Peptide sequences of non-conserved regions in SEQUENCE_21G (Lambda) (C.37) POOL SP Peptide A.A SEQ ID Number A.A Sequence Position Number SP_013 NVTWFHAIHVSGTNV 61-75 381 SP_014 HAIHVSGTNVIKRFD 66-80 382 SP_015 SGTNVIKRFDNPVLP 71-85 383 SP_016 IKRFDNPVLPFNDGV 76-90 384 SP_048 TRFQTLLALHNSSSG 236-250 385 SP_049 LLALHNSSSGWTAGA 241-255 386 SP_050 NSSSGWTAGAAAYYV 246-260 387 SP_089 LDSKVGGNYNYQYRL 441-455 388 SP_090 GGNYNYQYRLFRKSN 446-460 389 SP_091 YQYRLFRKSNLKPFE 451-465 390 SP_096 GSTPCNGVEGFNCYS 476-490 391 SP_097 NGVEGFNCYSPLQSY 481-495 392 SP_098 FNCYSPLQSYGFQPT 486-500 393 SP_121 GTNTSNQVAVLYQGV 601-615 394 SP_122 NQVAVLYQGVNCTEV 606-620 395 SP_123 LYQGVNCTEVPVAIH 611-625 396 SP_170 ARDLICAQKFNGLNV 846-860 397 SP_171 CAQKFNGLNVLPPLL 851-865 398 SP_172 NGLNVLPPLLTDEMI 856-870 399
TABLE-US-00018 TABLE 18 Peptide sequences of non-conserved regions in SEQUENCE_21H (B.1.621) POOL SP Peptide A.A SEQ ID Number A.A Sequence Position Number SP_017 NPVLPFNDGVYFASI 81-95 400 SP_018 FNDGVYFASIEKSNI 86-100 401 SP_019 YFASIEKSNIIRGWI 91-105 402 SP_027 CEFQFCNDPFLGVSN 131-145 403 SP_028 CNDPFLGVSNHKNNK 136-150 404 SP_029 LGVSNHKNNKSWMES 141-155 405 SP_068 CPFGEVFNATKFASV 336-350 406 SP_069 VFNATKFASVYAWNR 341-355 407 SP_070 KFASVYAWNRKRISN 346-360 408 SP_095 EIYQAGSTPCNGVKG 471-485 409 SP_096 GSTPCNGVKGFNCYF 476-490 410 SP_097 NGVKGFNCYFPLQSY 481-495 411 SP_099 PLQSYGFQPTYGVGY 491-505 412 SP_100 GFQPTYGVGYQPYRV 496-510 413 SP_101 YGVGYQPYRVVVLSF 501-515 414 SP_121 GTNTSNQVAVLYQGV 601-615 415 SP_122 NQVAVLYQGVNCTEV 606-620 416 SP_123 LYQGVNCTEVPVAIH 611-625 417 SP_135 CASYQTQTNSHRRAR 671-685 418 SP_136 TQTNSHRRARSVASQ 676-690 419 SP_137 HRRARSVASQSIIAY 681-695 420 SP_188 DSLSSTASALGKLQN 936-950 421 SP_189 TASALGKLQNVVNQN 941-955 422 SP_190 GKLQNVVNQNAQALN 946-960 423
TABLE-US-00019 TABLE 19 Peptide sequences of non-conserved regions in SEQUENCE_20A/S:126A (B.1.620) POOL SP Peptide A.A SEQ ID Number A.A Sequence Position Number SP_004 VNLTTRTQLPSAYTN 16-30 424 SP_005 RTQLPSAYTNSFTRG 21-35 425 SP_006 SAYTNSFTRGVYYPD 26-40 426 SP_012 LPFFSNVTWFHAISG 56-70 427 SP_013 NVTWFHAISGTNGTK 61-75 428 SP_014 HAISGTNGTKRFDNP 66-80 429 SP_024 SLLIVNNATNAVIKV 116-130 430 SP_025 NNATNAVIKVCEFQF 121-135 431 SP_026 AVIKVCEFQFCNDPF 126-140 432 SP_027 CEFQFCNDPFLGVYH 131-145 433 SP_028 CNDPFLGVYHKNNKS 136-150 434 SP_029 LGVYHKNNKSWMESE 141-155 435 SP_047 IGINITRFQTLYRSY 231-245 436 SP_048 TRFQTLYRSYLTPGD 236-250 437 SP_049 LYRSYLTPGDSSSGW 241-255 438 SP_094 RDISTEIYQAGNTPC 466-480 439 SP_095 EIYQAGNTPCNGVKG 471-485 440 SP_096 GNTPCNGVKGFNCYF 476-490 441 SP_097 NGVKGFNCYFPLQSY 481-495 442 SP_121 GTNTSNQVAVLYQGV 601-615 443 SP_122 NQVAVLYQGVNCTEV 606-620 444 SP_123 LYQGVNCTEVPVAIH 611-625 445 SP_135 CASYQTQTNSHRRAR 671-685 446 SP_136 TQTNSHRRARSVASQ 676-690 447 SP_137 HRRARSVASQSIIAY 681-695 448 SP_204 AEIRASANLAAIKMS 1016-1030 449 SP_205 SANLAAIKMSECVLG 1021-1035 450 SP_206 AIKMSECVLGQSKRV 1026-1040 451 SP_222 QRNFYEPQIITTHNT 1106-1120 452 SP_223 EPQIITTHNTFVSGN 1111-1125 453 SP_224 TTHNTFVSGNCDVVI 1116-1130 454
[0315] An embodiment is shown in schematic diagram
[0316] These peptide pools can be, for example, used in a classical ELISPOT assay and thus used to stimulate PBMC of different vaccinated individuals (
[0317] Thus, the inventors can obtain a measurement of the alteration that the mutations present in VOCs can exert on total SARS-CoV-2 T cell response.
Example 4
PCR-Based Test to Detect Virus Cellular Immunity
[0318] The inventors show in this Example that qPCR can be used to quantify the presence of virus-specific T cells, based on ex vivo stimulation of whole blood samples with a pool of viral peptides covering the spike or other SARS-CoV-2 viral proteins (i.e. nucleoprotein [NP]), followed by direct amplification of IFN-γ or IL-2 (directly produced by SARS-CoV-2 antigen-specific T cells) or CXCL10, a molecule expressed by monocytes in response to T cell activation.
[0319] In order to select genes whose induction would correlate with the presence and activation of antigen specific T cells; we first evaluated the transcriptional profile of whole blood after overnight stimulation with SARS-CoV-2 peptide pools by RNA sequencing (
qPCR
[0320] Next, we validated transcriptional induction of shortlisted genes by qPCR (as described in Example 2) in 11 naïve and 8 COVID-19 convalescent subjects. Out of all genes tested (
[0321] To assess the reliability of the qTACT test, we compared CXCL10 and IFN-γ expression levels to IFN-γ cytokine secretion as quantified by ELLA in a larger cohort comprised of 89 subjects (43 naïve and 46 COVID-19 convalescent. For this cohort, only samples stimulated with DMSO (control) and the spike peptide pool (Table 4) were considered for downstream analysis. CXCL10 was selected as preferred because our previous data had confirmed its reliability and reproducibility when distinguishing between naïve and COVID-19 convalescent subjects. For this larger cohort, we chose to keep IFN-γ, despite its inferiority relative to CXCL10, to include a gene that is expressed by antigen-specific T cells and to directly correlate mRNA expression (qTACT) with IFN-γ protein secretion (ELLA). The cohort was recruited prior to vaccination and followed at day 10 and 20 after the first and second dose of the BNT162b2 vaccine and the data on IFN-γ an IL-2 cytokine secretion have been described elsewhere (Camara C., et al., bioRxiv 2021.03.22.436441; doi:/10.1101/2021.03.22.436441).
[0322] Compared to naïve subjects, COVID-19 recovered individuals had a higher median expression of CXCL10 prior to vaccination (2.53 [N=21] vs 0.0087 [N=19] in naïve subjects) (
A Second Vaccine Dose Increases CXCL10 and IFN-v Expression Levels in Naiive Subjects but not in COVID-19 Recovered Individuals
[0323] The effect of a second dose of the vaccine was next studied. Sampling on day 10 and 20 after a second dose confirmed the beneficial effects of the recall vaccine in naïve individuals who increase their CXCL10 and IFN-γ expression to significant levels. On the contrary, the second dose in COVID-19 recovered individuals did not have a boost effect (no significant increase in CXCL10 and IFN-γ levels) (
qPCR Quantification of CXCL10 as a Proxy for Cellular Immunity
[0324] We used the qPCR assay to quantify the levels of CXCL10, as a proxy for cellular immunity, over time. We assessed the level of T cell activation in a small cohort of COVID-19 convalescent subjects at different time points post infection. We observed that, while for some patients CXCL10 levels decreased to background levels after 9 months from SARS-CoV-2 infection, we were able to detect the activation of antigen specific T cells in the majority of subjects even 9-12 months post infection (
dqPCR
[0325] Blood samples were prepared as described in Example 2. To this end, following overnight incubation with DMSO control, or SARS-CoV-2 nucleoprotein or spike peptide pools (Table 4), we took 50 μl of blood, diluted it (1:3) to avoid PCR inhibition by anticoagulants (i.e., heparin), and loaded 2 μl directly onto a qPCR instrument (dqTACT)(
[0326] IFN-γ and CXCL10 were tested as potential readouts for the dqTACT assay (described in Example 2), being optimized for use on the Hyris bCUBE given its high range of detection compared to other tested instruments, the reduced cost, and the ease of assay set up (
[0327] A lack of rapid, accessible, and accurate diagnostic methods to quantify cellular immunity hinders long-term vaccination strategies and public health responses to global pandemics, such as the one being caused by SARS-CoV-2. Considering that diagnostic centers around the world have ramped up the setup of RT-qPCR based facilities, we developed a qPCR-based dqTACT assay, which is amenable to periodic and repeated testing of patient samples, as it requires only 1 ml of blood and a 24-hour turnaround time. Clinical validation of this assay in response to recent draft guidance from the United States Food and Drug Administration (FDA) and European Medicines Agency (EMA) is ongoing in a Clinical Laboratory Improvement Amendments (CLIA)-certified microbiology laboratory. First, we implemented a Next Generation Sequencing (NGS) approach. The pros of this approach, which could be further implemented by a targeted amplification panel of 15-20 genes, is the possibility of capturing the variability of the response and measure cytokines produced by both T cells and other myeloid cells in the blood. The cons are a longer turnaround time, a higher cost, and the need for skilled technical personnel.
[0328] Second, we developed a qPCR-based method (qTACT assay) on a 96 or 384 well platform (BioRad CFX). The advantages of this approach are the accuracy and sensitivity of qPCR probes, the opportunity to combine more than 2 fluorophores to measure the expression of 2-4 genes, and the scalability and potential automation of the process. The cons include a relatively longer processing time (48 hours per 200 samples), the need to purify RNA (by standard RNA-purification kits/columns), higher associated costs, and a certain level of technical skill (although less than that required for NGS).
[0329] Third, we optimized a direct qPCR-based method (dqTACT assay) on the HYRIS bCUBE platform. The advantages of this approach are the accuracy of qPCR probes, the increased accuracy of the bCUBE platform over other tested qPCR machines, and the reduced processing time/cost/skill required. Overall, this is an easy to implement protocol that requires minimal training of the operator, thus reducing technical errors. The cons include a relatively lower scalability (18 samples on the bCUBE as opposed to 48/192 samples on the CFX 96/384) and the limitation to a 2 fluorophore/2 genes detection system.
[0330] The derived profile of SARS-CoV-2-specific T cell activation by qTACT/dqTACT assays in different cohorts of naïve, infected or vaccinated individuals, will provide information about their level of SARS-CoV-2-specific cellular immunity.
Example 5
HBV Peptide Pools
[0331] Eight HBV peptide pools of 15-mers (Tables 20-27) covering the proteome (Core, X, Envelope and Polymerase) of HBV (AB112063 (HBV Gen C)) were generated (
TABLE-US-00020 TABLE 20 Summary of Peptide Pool C (core). POOL C Peptide A.A SEQ ID Number A.A Sequence Position Number C_1 MQLFHLCLIISCLRP 1-15 480 C_2 LCLIISCLRPTVQAS 6-20 481 C_3 SCLRPTVQASKLCLG 11-25 482 C_4 TVQASKLCLGWLWGM 16-30 483 C_5 KLCLGWLWGMDIDPY 21-35 484 C 6 WLWGMDIDPYKEFGA 26-40 485 C_7 DIDPYKEFGASVELL 31-45 486 C_8 KEFGASVELLSFLPS 36-50 487 C_9 SVELLSFLPSDFFPN 41-55 488 C_10 SFLPSDFFPNIRDLL 46-60 489 C_11 DFFPNIRDLLDTASA 51-65 490 C_12 IRDLLDTASALFREA 56-70 491 C_13 DTASALFREALESPE 61-75 492 C_14 LFREALESPEHCTPH 66-80 493 C_15 LESPEHCTPHHTAIR 71-85 494 C_16 HCTPHHTAIRQAILC 76-90 495 C_17 HTAIRQAILCWGELM 81-95 496 C_18 QAILCWGELMNLATW 86-100 497 C_19 WGELMNLATWVGSNL 91-105 498 C_20 NLATWVGSNLEDPAS 96-110 499 C_21 VGSNLEDPASRELVV 101-115 500 C_22 EDPASRELVVGYVNV 106-120 501 C_23 RELVVGYVNVNMGLK 111-125 502 C_24 GYVNVNMGLKIRQLL 116-130 503 C_25 NMGLKIRQLLWFHIS 121-135 504 C_26 IRQLLWFHISCLTFG 126-140 505 C_27 WFHISCLTFGRETVL 131-145 506 C_28 CLTFGRETVLEYLVS 136-150 507 C_29 RETVLEYLVSFGVWI 141-155 508 C_30 EYLVSFGVWIRTPPA 146-160 509 C_31 FGVWIRTPPAYRPPN 151-165 510 C_32 RTPPAYRPPNAPILS 156-170 511 C_33 YRPPNAPILSTLPET 161-175 512 C_34 APILSTLPETTVVRR 166-180 523 C_35 TLPETTVVRRRGRSP 171-185 514 C_36 TVVRRRGRSPRRRTP 176-190 515 C_37 RGRSPRRRTPSPRRR 181-195 516 C_38 RRRTPSPRRRRSQSP 186-200 517 C_39 SPRRRRSQSPRRRRS 191-205 518 C_40 RSQSPRRRRSQSRGS 196-210 519 C_41 RRRRSQSRGSQC 201-215 520
TABLE-US-00021 TABLE 21 Summary of Peptide Pool X. POOL X Peptide A.A SEQ ID Number A.A Sequence Position Number X_1 MAARLCCQLDPARDV 1-15 521 X_2 CCQLDPARDVLCLRP 6-20 522 X_3 PARDVLCLRPVGAES 11-25 523 X_4 LCLRPVGAESRGRPV 16-30 524 X_5 VGAESRGRPVSGAFG 21-35 525 X_6 RGRPVSGAFGTLPSP 26-40 526 X_7 SGAFGTLPSPSSSAV 31-45 527 X_8 TLPSPSSSAVPTDHG 36-50 528 X_9 SSSAVPTDHGAHLSL 41-55 529 X_10 PTDHGAHLSLRGLPV 46-60 530 X_11 AHLSLRGLPVCAFSS 51-65 531 X_12 RGLPVCAFSSAGPCA 56-70 532 X_13 CAFSSAGPCALRFTS 61-75 533 X_14 AGPCALRFTSARRME 66-80 534 X_15 LRFTSARRMETTVNA 71-85 535 X_16 ARRMETTVNARQVLP 76-90 536 X_17 TTVNARQVLPKVLHK 81-95 537 X_18 RQVLPKVLHKRTLGL 86-100 538 X_19 KVLHKRTLGLSAMST 91-105 539 X_20 RTLGLSAMSTTDLEA 96-110 540 X_21 SAMSTTDLEAYFKDR 101-115 541 X_22 TDLEAYFKDRVFKDW 106-120 542 X_23 YFKDRVFKDWEELGE 111-125 543 X_24 VFKDWEELGEETRLM 116-130 544 X_25 EELGEETRLMIFVLG 121-135 545 X_26 ETRLMIFVLGGCRHK 126-140 546 X_27 IFVLGGCRHKLVCSP 131-145 547 X_28 GCRHKLVCSPAPCNF 136-150 548 X_29 LVCSPAPCNFFTSA 141-155 549
TABLE-US-00022 TABLE 22 Summary of Peptide Pool E1 (envelope). POOL E-1 Peptide A.A SEQ ID Number A.A Sequence Position Number E_1 MGTNLSVPNPLGFFP 1-15 550 E_2 SVPNPLGFFPDHQLD 6-20 551 E_3 LGFFPDHQLDPAFGA 11-25 552 E_4 DHQLDPAFGANSNNP 16-30 553 E_5 PAFGANSNNPDWDFN 21-35 554 E_6 NSNNPDWDFNPNKDQ 26-40 555 E_7 DWDFNPNKDQWPAAN 31-45 556 E_8 PNKDQWPAANQVGVG 36-50 557 E_9 WPAANQVGVGSFGPG 41-55 558 E_10 QVGVGSFGPGFTPPH 46-60 559 E_11 SFGPGFTPPHGNLLG 51-65 560 E_12 FTPPHGNLLGWSPQA 56-70 561 E_13 GNLLGWSPQAQGILT 61-75 562 E_14 WSPQAQGILTTVPAA 66-80 563 E_15 QGILTTVPAAPPPAS 71-85 564 E_16 TVPAAPPPASTNRQS 76-90 565 E_17 PPPASTNRQSGRQPT 81-95 566 E_18 TNRQSGRQPTPISLP 86-100 567 E_19 GRQPTPISLPLRDSH 91-105 568 E_20 PISLPLRDSHPQAMQ 96-110 569 E_21 LRDSHPQAMQWNSST 101-115 570 E_22 PQAMQWNSSTFHQAL 106-120 571 E_23 WNSSTFHQALLDPKV 111-125 572 E_24 FHQALLDPKVRGLYL 116-130 573 E_25 LDPKVRGLYLPAGGS 121-135 574 E_26 RGLYLPAGGSSSGTV 126-140 575 E_27 PAGGSSSGTVNPVQT 131-145 576 E_28 SSGTVNPVQTTASPI 136-150 577 E_29 NPVQTTASPISSIFS 141-155 578 E_30 TASPISSIFSRTGDP 146-160 579 E_31 SSIFSRTGDPAPNME 151-165 580 E_32 RTGDPAPNMESTTSG 156-170 581 E_33 APNMESTTSGFLGPL 161-175 582 E_34 STTSGFLGPLLVLQA 166-180 583 E_35 FLGPLLVLQAGFFLL 171-185 584 E_36 LVLQAGFFLLTRILT 176-190 585 E_37 GFFLLTRILTIPQSL 181-195 586 E_38 TRILTIPQSLDSWWT 186-200 587
TABLE-US-00023 TABLE 23 Summary of Peptide Pool E2 (envelope). POOL E-2 Peptide A.A SEQ ID Number A.A Sequence Position Number E_39 IPQSLDSWWTSLNFL 191-205 588 E_40 DSWWTSLNFLGGAPT 196-210 589 E_41 SLNFLGGAPTCSGQN 201-215 590 E_42 GGAPTCSGQNLQSPT 206-220 591 E_43 CSGQNLQSPTSNHSP 211-225 592 E_44 LQSPTSNHSPTSCPP 216-230 593 E_45 SNHSPTSCPPICPGY 221-235 594 E_46 TSCPPICPGYRWMCL 226-240 595 E_47 ICPGYRWMCLRRFII 231-245 596 E_48 RWMCLRRFIIFLFIL 236-250 597 E_49 RRFIIFLFILLLCLI 241-255 598 E_50 FLFILLLCLIFLLVL 246-260 599 E_51 LLCLIFLLVLLDYQG 251-265 600 E_52 FLLVLLDYQGMLPVC 256-270 601 E_53 LDYQGMLPVCPLLPG 261-275 602 E_54 MLPVCPLLPGTSTTS 266-280 603 E_55 PLLPGTSTTSMGPCK 271-285 604 E_56 TSTTSMGPCKTCTTP 276-290 605 E_57 MGPCKTCTTPAQGTS 281-295 606 E_58 TCTTPAQGTSMFPSC 286-300 607 E_59 AQGTSMFPSCCCTQP 291-305 608 E_60 MFPSCCCTQPSDGNC 296-310 609 E_61 CCTQPSDGNCTCIPI 301-315 610 E_62 SDGNCTCIPIPSSWA 306-320 611 E_63 TCIPIPSSWAFARFL 311-325 612 E_64 PSSWAFARFLWEWAS 316-330 613 E_65 FARFLWEWASVRFSW 321-335 614 E_66 WEWASVRFSWLSLLV 326-340 615 E_67 VRFSWLSLLVPFVQW 331-345 616 E_68 LSLLVPFVQWFVGLS 336-350 617 E_69 PFVQWFVGLSPTVWL 341-355 618 E_70 FVGLSPTVWLSVIWM 346-360 619 E_71 PTVWLSVIWMMWYWG 351-365 620 E_72 SVIWMMWYWGRSLYN 356-370 621 E_73 MWYWGRSLYNILNPF 361-375 622 E_74 RSLYNILNPFLPLLP 366-380 623 E_75 ILNPFLPLLPIFFCL 371-385 624 E_76 LPLLPIFFCLWVYI 386-390 625
TABLE-US-00024 TABLE 24 Summary of Peptide Pool Pol-1 (Polymerase). POOL Pol-1 Peptide A.A SEQ ID Number A.A Sequence Position Number Pol_1 MPLSYQHFRKLLLLD 1-15 626 Pol_2 QHFRKLLLLDDEAGP 6-20 627 Pol_3 LLLLDDEAGPLEEEL 11-25 628 Pol_4 DEAGPLEEELPRLAD 16-30 629 Pol_5 LEEELPRLADEGLNH 21-35 630 Pol_6 PRLADEGLNHRVAED 26-40 631 Pol_7 EGLNHRVAEDLNLGD 31-45 632 Pol_8 RVAEDLNLGDLNVSI 36-50 633 Pol_9 LNLGDLNVSIPWTHK 41-55 634 Pol_10 LNVSIPWTHKVGNFT 46-60 635 Pol_11 PWTHKVGNFTGLYSS 51-65 636 Pol_12 VGNFTGLYSSTVPVF 56-70 637 Pol_13 GLYSSTVPVFNPEWK 61-75 638 Pol_14 TVPVFNPEWKTPSFP 66-80 639 Pol_15 NPEWKTPSFPNIHLK 71-85 640 Pol_16 TPSFPNIHLKEDIIN 76-90 641 Pol_17 NIHLKEDIINRCQQY 81-95 642 Pol_18 EDIINRCQQYVGPLT 86-100 643 Pol_19 RCQQYVGPLTVNEKR 91-105 644 Pol_20 VGPLTVNEKRRLKVT 96-110 645 Pol_21 VNEKRRLKVTMPARF 101-115 646 Pol_22 RLKVTMPARFYPNLT 106-120 647 Pol_23 MPARFYPNLTKYLPL 111-125 648 Pol_24 YPNLTKYLPLDKGIK 116-130 649 Pol_25 KYLPLDKGIKPYYPE 121-135 650 Pol_26 DKGIKPYYPEHIVNH 126-140 651 Pol_27 PYYPEHIVNHYFQTR 131-145 652 Pol_28 HIVNHYFQTRHYLHT 136-150 653 Pol_29 YFQTRHYLHTLWKAG 141-155 654 Pol_30 HYLHTLWKAGILYKR 146-160 655 Pol_31 LWKAGILYKRETTRS 151-165 656 Pol_32 ILYKRETTRSASFCG 156-170 657 Pol_33 ETTRSASFCGSPYSW 161-175 658 Pol_34 ASFCGSPYSWEQELQ 166-180 659 Pol_35 SPYSWEQELQHGTLV 171-185 660 Pol_36 EQELQHGTLVFQTST 176-190 661 Pol_37 HGTLVFQTSTRHGDE 181-195 662 Pol_38 FQTSTRHGDESFGSQ 186-200 663 Pol_39 RHGDESFGSQSSGIL 191-205 664 Pol_40 SFGSQSSGILSRSPV 196-210 665 Pol_41 SSGILSRSPVGPGIR 201-215 666 Pol_42 SRSPVGPGIRSQFKQ 206-220 667
TABLE-US-00025 TABLE 25 Summary of Peptide Pool Pol-2 (Polymerase). POOL Pol-2 Peptide A.A SEQ ID Number A.A Sequence Position Number Pol_43 GPGIRSQFKQSRLGL 211-225 668 Pol_44 SQFKQSRLGLQPQQG 216-230 669 Pol_45 SRLGLQPQQGSMASG 221-235 670 Pol_46 QPQQGSMASGKPGRS 226-240 671 Pol_47 SMASGKPGRSGIIRA 231-245 672 Pol_48 KPGRSGIIRARVHPT 236-250 673 Pol_49 GIIRARVHPTTRQSF 241-255 674 Pol_50 RVHPTTRQSFGVEPA 246-260 675 Pol_51 TRQSFGVEPAGSGHI 251-265 676 Pol_52 GVEPAGSGHIDNSTS 256-270 677 Pol_53 GSGHIDNSTSSASSC 261-275 678 Pol_54 DNSTSSASSCLHQSA 266-280 679 Pol_55 SASSCLHQSAVRKTA 271-285 680 Pol_56 LHQSAVRKTAYSHLS 276-290 681 Pol_57 VRKTAYSHLSTSKRQ 281-295 682 Pol_58 YSHLSTSKRQSSSGH 286-300 683 Pol_59 TSKRQSSSGHAVELQ 291-305 684 Pol_60 SSSGHAVELQHIPPS 296-310 685 Pol_61 AVELQHIPPSSARSQ 301-315 686 Pol_62 HIPPSSARSQSEGPI 306-320 687 Pol_63 SARSQSEGPIPSCWW 311-325 688 Pol_64 SEGPIPSCWWLQFRN 316-330 689 Pol_65 PSCWWLQFRNSKPCS 321-335 690 Pol_66 LQFRNSKPCSDYCLS 326-340 691 Pol_67 SKPCSDYCLSHIVNL 331-345 692 Pol_68 DYCLSHIVNLLEDWG 336-350 693 Pol_69 HIVNLLEDWGPCTEY 341-355 694 Pol_70 LEDWGPCTEYGEHHI 346-360 695 Pol_71 PCTEYGEHHIRIPRT 351-365 696 Pol_72 GEHHIRIPRTPARVT 356-370 697 Pol_73 RIPRTPARVTGGVFL 361-375 698 Pol_74 PARVTGGVFLVDKNP 366-380 799 Pol_75 GGVFLVDKNPHNTTE 371-385 700 Pol_76 VDKNPHNTTESRLVV 386-390 701 Pol_77 HNTTESRLVVDFSQF 381-395 702 Pol_78 SRLVVDFSQFSRGST 386-400 703 Pol_79 DFSQFSRGSTHVFWP 391-405 704 Pol_80 SRGSTHVFWPKFAVP 396-410 705 Pol_81 HVFWPKFAVPNLQSL 401-415 706 Pol_82 KFAVPNLQSLTNLLS 406-419 707 Pol_83 NLQSLTNLLSSNLSW 411-425 708 Pol_84 TNLLSSNLSWLSLDV 416-430 709
TABLE-US-00026 TABLE 26 Summary of Peptide Pool Pol-3 (Polymerase). POOL Pol-3 Peptide A.A SEQ ID Number A.A Sequence Position Number Pol_85 SNLSWLSLDVSAAFY 421-435 710 Pol_86 LSLDVSAAFYHIPLH 426-440 711 Pol_87 SAAFYHIPLHPAAMP 431-445 712 Pol_88 HIPLHPAAMPHLLVG 436-450 713 Pol_89 PAAMPHLLVGSSGLP 441-455 714 Pol_90 HLLVGSSGLPRYVAR 446-460 715 Pol_91 SSGLPRYVARLSSTS 451-465 716 Pol_92 RYVARLSSTSRNINY 456-470 717 Pol_93 LSSTSRNINYQHGTM 461-475 718 Pol_94 RNINYQHGTMQDLHD 466-480 719 Pol_95 QHGTMQDLHDTCSRN 471-485 720 Pol_96 QDLHDTCSRNLYVSL 476-490 721 Pol_97 TCSRNLYVSLLLLYT 481-495 722 Pol_98 LYVSLLLLYTTFGRK 486-500 723 Pol_99 LLLYTTFGRKLHLYS 491-505 724 Pol_100 TFGRKLHLYSHPIIL 496-510 725 Pol_101 LHLYSHPIILGFRKI 501-515 726 Pol_102 HPIILGFRKIPMGVG 506-520 727 Pol_103 GFRKIPMGVGLSPFL 511-525 728 Pol_104 PMGVGLSPFLLAQFT 516-530 729 Pol_105 LSPFLLAQFTSAICS 521-535 730 Pol_106 LAQFTSAICSVVRRA 526-540 731 Pol_107 SAICSVVRRAFPHCL 531-545 732 Pol_108 VVRRAFPHCLAFSYM 536-550 733 Pol_109 FPHCLAFSYMDDVVL 541-555 734 Pol_110 AFSYMDDVVLGAKSV 546-560 735 Pol_111 DDVVLGAKSVQHLES 551-565 736 Pol_112 GAKSVQHLESLFTAV 556-570 737 Pol_113 QHLESLFTAVTNFLL 561-575 738 Pol_114 LFTAVTNFLLSLGVH 566-580 739 Pol_115 TNFLLSLGVHLNPTK 571-585 740 Pol_116 SLGVHLNPTKTKRWG 576-590 741 Pol_117 LNPTKTKRWGYSLNF 581-595 742 Pol_118 TKRWGYSLNFMGYVI 586-600 743 Pol_119 YSLNFMGYVIGSWGT 591-605 744 Pol_120 MGYVIGSWGTLPQEH 596-610 745 Pol_121 GSWGTLPQEHIVHKI 601-615 746 Pol_122 LPQEHIVHKIKQCFR 606-620 747 Pol_123 IVHKIKQCFRKLPLN 611-625 748 Pol_124 KQCFRKLPLNRPIDW 616-630 749 Pol_125 KLPLNRPIDWKVCQR 621-635 750 Pol_126 RPIDWKVCQRIVGLL 626-640 751
TABLE-US-00027 TABLE 27 Summary of Peptide Pool Pol-4 (Polymerase). POOL Pol-4 Peptide A.A SEQ ID Number A.A Sequence Position Number Pol_127 KVCQRIVGLLGFAAP 631-645 752 Pol_128 IVGLLGFAAPFTQCG 636-650 753 Pol_129 GFAAPFTQCGYPALM 641-655 754 Pol_130 FTQCGYPALMPLSAC 646-660 755 Pol_131 YPALMPLSACIQAKR 651-665 756 Pol_132 PLSACIQAKRAFTFS 656-670 757 Pol_133 IQAKRAFTFSPTYRA 661-675 758 Pol_134 AFTFSPTYRAFLCKQ 666-680 759 Pol_135 PTYRAFLCKQYMNLY 671-685 760 Pol_136 FLCKQYMNLYPVARQ 676-690 761 Pol_137 YMNLYPVARQRPGLC 681-695 762 Pol_138 PVARQRPGLCQVFAD 686-700 763 Pol_139 RPGLCQVFADATPTG 691-705 764 Pol_140 QVFADATPTGWGLAI 696-710 765 Pol_141 ATPTGWGLAIGHQRM 701-715 766 Pol_142 WGLAIGHQRMRGTFV 706-720 767 Pol_143 GHQRMRGTFVAPLPI 711-725 768 Pol_144 RGTFVAPLPIHTAEL 716-730 769 Pol_145 APLPIHTAELLAACF 721-735 770 Pol_146 HTAELLAACFARSRS 726-740 771 Pol_147 LAACFARSRSGAKLI 731-745 772 Pol_148 ARSRSGAKLIGTDNS 736-750 773 Pol_149 GAKLIGTDNSVVLSR 741-755 774 Pol_150 GTDNSVVLSRKYTSF 746-760 775 Pol_151 VVLSRKYTSFPWLLG 751-765 776 Pol_152 KYTSFPWLLGCAANW 756-770 777 Pol_153 PWLLGCAANWILRGT 761-775 778 Pol_154 CAANWILRGTSFVYV 766-780 779 Pol_155 ILRGTSFVYVPSALN 771-785 780 Pol_156 SFVYVPSALNPADDP 776-790 781 Pol_157 PSALNPADDPSRGRL 781-795 782 Pol_158 PADDPSRGRLGLYRP 786-800 783 Pol_159 SRGRLGLYRPLLRLP 791-805 784 Pol_160 GLYRPLLRLPFRPTT 796-810 785 Pol_161 LLRLPFRPTTGRTSL 801-815 786 Pol_162 FRPTTGRTSLYAVSP 806-820 787 Pol_163 GRTSLYAVSPSVPSH 811-825 788 Pol_164 YAVSPSVPSHLPDRV 816-830 789 Pol_165 SVPSHLPDRVHFASP 821-835 790 Pol_166 LPDRVHFASPLHVAW 826-840 791 Pol_167 HFASPLHVAWRPP 831-843 792
Human Samples
[0332] Whole blood was isolated from either a patient with chronic HBV infection or a healthy individual who was vaccinated for HBV (with recombinant HBV envelope vaccine) and tested within 24 hours after blood draw (
[0333] It would be understood that the parameters described in the example may be changed and still achieve a valid assay. For example, the ratio of blood to RMPI media can range from 100% blood to 50% blood; 100 μl aliquots or more than 400 μl might be used, but a larger blood sample would be required to test multiple peptide pools. RPMI may be exchanged with other cell culture media. The final concentration of peptides in an assay mixture may be from 1 to 5 μg/ml. The control sample may contain DMSO or may be an unstimulated blood sample. The incubation period may range between about 6-24 h.
[0334] HBV reactive T cells in infected individuals can be detected by quantifying the amount of secreted cytokines after the direct addition of the peptide pools into whole blood. At the moment, we have selected the detection of both IFN-γ and IL-2, two cytokines commonly secreted by T cells, as a means of detection.
[0335] From the data (
SUMMARY
[0336] The assays presented here are based on the ability of SARS-CoV-2 T cells to respond to different peptides covering different proteins of the virus. With the possibility to use different peptides pools, our approach represents a flexible strategy that can be easily utilized to detect the presence of T cells responding to emerging mutant strains and, thus, immediately gauge the impact that viral mutation might have on cellular immunity. Moreover, the methods exemplified herein are applicable to viruses other than SARS-CoV-2 and its variants.
[0337] Hence, a diagnostic method that can be easily adapted to detect the degree of cellular immunity is an urgently needed complement to the currently available tests measuring viral presence or antibody titers.
REFERENCES
[0338] 1. Braun, J., Loyal, L., Frentsch, M., Wendisch, D., Georg, P., Kurth, F., Hippenstiel, S., Dingeldey, M., Kruse, B., Fauchere, F., Baysal, E., Mangold, M., Henze, L., Lauster, R., Mall, M., Beyer, K., Roehmel, J., Schmitz, J., Miltenyi, S., Mueller, M. A., Witzenrath, M., Suttorp, N., Kern, F., Reimer, U., Wenschuh, H., Drosten, C., Corman, V. M., Giesecke-Thiel, C., Sander, L.-E., Thiel, A., 2020. Presence of SARS-CoV-2 reactive T cells in COVID-19 patients and healthy donors. medRxiv 1-12. doi:10.1101/2020.04.17.20061440. [0339] 2. Camara C., et al., Differential effects of the second SARS-CoV-2 mRNA vaccine dose on T cell immunity in naïve and COVID-19 recovered individuals. bioRxiv 2021.03.22.436441; doi: https://doi.org/10.1101/2021.03.22.436441. [0340] 3. Dong, T., Peng, Y., Mentzer, A. J., Liu, G., Yao, X., Yin, Z., Dong, D., Dejnirattisai, W., Turtle, L., Rostron, T., Subramaniam, K., Thomson, P., Zhang, P., Dold, C., Ratcliff, J., de Silva, T., Sopp, P., Wellington, D., Rajapaksa, U., Paes, W., Borrow, P., Kessler, B. M., Fry, J. W., Schwabe, N. F., Semple, M. G., Baillie, J. K., Openshaw, P. J., Cornall, R. J., Conlon, C., Screaton, G., Klenerman, P., Mongkolsapaya, J., McMichael, A., Knight, J. C., Ogg, G., Simmonds, P., Lockett, T., Levin, R., Moore, S. C., Salio, M., Napolitani, G., Chen, Y.-L., Dunachie, S., Supasa, P., Liu, C., Lopez-Camacho, C., Slon-Campos, J., Zhao, Y., Stuart, D. I., Paeson, G., Grimes, J., Antson, F., Bayfield, O. W., Hawkins, D. E., Ker, D.-S., Ansari, A., Barnes, E., Frater, J., Kerr, G., Goulder, P., 2020. Broad and strong memory CD4+ and CD8+ T cells induced by SARS-CoV-2 in UK convalescent COVID-19 patients. bioRxiv 1-36. doi:10.1101/2020.06.05.134551. [0341] 4. Grifoni A, Sidney J, Zhang Y, Scheuermann R H, Peters B, Sette A. A Sequence Homology and Bioinformatic Approach Can Predict Candidate Targets for Immune Responses to SARS-CoV-2. Cell Host Microbe 2020; 27(4): 671-680.e2. doi:10.1016/j.chom.2020.03.002. [0342] 5. Grifoni, A., n.d. Targets of T cell responses to SARS-CoV-2 coronavirus in humans with COVID-19 disease and unexposed individuals. Cell. doi:10.1016/j.cell.2020.05.015. [0343] 6. Ichikawa, A. et al. CXCL10-CXCR3 enhances the development of neutrophil-mediated fulminant lung injury of viral and nonviral origin. Am J Respir Crit Care Med 187, 65-77 (2013). [0344] 7. Kalimuddin S, Tham C Y L, Qui M, de Alwis R, Sim J X Y, Lim J M E, Tan H C, Syenina A, Zhang S L, Le Bert N, Tan A T, Leong Y S, Yee J X, Ong E Z, Ooi E E, Bertoletti A, Low J G. Early T cell and binding antibody responses are associated with COVID-19 RNA vaccine efficacy onset. Med (N Y). 2021 Jun. 11; 2(6):682-688.e4. doi: 10.1016/j.medj.2021.04.003. [0345] 8. Le Bert N, Tan A T, Kunasegaran K, et al. SARS-CoV-2-specific T cell immunity in cases of COVID-19 and SARS, and uninfected controls. Nature 2020; 584(7821): 457-62. [0346] 9. Le Bert, N. et al. Highly functional virus-specific cellular immune response in asymptomatic SARS-CoV-2 infection. J Exp Med 218(5):e20202617 (2021). [0347] 10. Long, Q.-X., Liu, B.-Z., Deng, H.-J., Wu, G.-C., Deng, K., Chen, Y.-K., Liao, P., Qiu, J.-F., Lin, Y., Cai, X.-F., Wang, D.-Q., Hu, Y., Ren, J.-H., Tang, N., Xu, Y.-Y., Yu, L.-H., Mo, Z., Gong, F., Zhang, X.-L., Tian, W.-G., Hu, L., Zhang, X.-X., Xiang, J.-L., Du, H.-X., Liu, H.-W., Lang, C.-H., Luo, X.-H., Wu, S.-B., Cui, X.-P., Zhou, Z., Zhu, M.-M., Wang, J., Xue, C.-J., Li, X.-F., Wang, L., Li, Z.-J., Wang, K., Niu, C.-C., Yang, Q.-J., Tang, X.-J., Zhang, Y., Liu, X.-M., Li, J.-J., Zhang, D.-C., Zhang, F., Liu, P., Yuan, J., Li, Q., Hu, J.-L., Chen, J., Huang, A.-L., 2020. Antibody responses to SARS-CoV-2 in patients with COVID-19. Nat Med 1-15. doi:10.1038/s41591-020-0897-1. [0348] 11. Luster, A. D., Unkeless, J. C. & Ravetch, J. V. Gamma-interferon transcriptionally regulates an early-response gene containing homology to platelet proteins. Nature 315, 672-676 (1985). [0349] 12. Tauzin, A. et al., A single BNT162b2 mRNA dose elicits antibodies with Fc-mediated effector functions and boost pre-existing humoral and T cell responses. bioRxiv. 2021 Mar. 18; 2021.03.18.435972. doi: 10.1101/2021.03.18.435972. [0350] 13. Zhao, J., Alshukairi, A. N., Baharoon, S. A., Ahmed, W. A., Bokhari, A. A., Nehdi, A. M., Layqah, L. A., Alghamdi, M. G., Gethamy, Al, M. M., Dada, A. M., Khalid, I., Boujelal, M., Johani, Al, S. M., Vogel, L., Subbarao, K., Mangalam, A., Wu, C., Eyck, Ten, P., Perlman, S., Zhao, J., 2017. Recovery from the Middle East respiratory syndrome is associated with antibody and T-cell responses. Science Immunology 2, eaan5393. doi:10.1126/sciimmunol.aan5393.