USE OF REELIN FOR TREATING CARDIAC DISEASES
20230390359 · 2023-12-07
Inventors
Cpc classification
International classification
A61L15/32
HUMAN NECESSITIES
Abstract
Disclosed herein are compositions and methods useful for treating diseases, conditions and injuries of the heart, and/or improving cardiac function in a subject in need thereof. In some embodiments, the methods comprise administering a therapeutically effective amount of a reelin polypeptide, a functional fragment or variant thereof, or a nucleic acid that expresses a reelin polypeptide or a functional fragment or variant thereof, to the subject.
Claims
1. A method for treating a disease or condition of the heart in a subject in need thereof, the method comprising: administering to the subject a composition comprising a reelin polypeptide or a variant thereof.
2. The method of claim 1 wherein the disease or conditions of the heart comprises one or more of: (1) coronary artery disease; (2) arrhythmia; (3) bradycardia; (4) tachycardia; (5) congenital heart disease or defect; (6) myocardial infarction (heart attack); (7) cardiomyopathy; (8) heart valve disease; (9) pericardial disease; (10) rheumatic heart disease; (11) stroke; (12) heart failure; (13) ischemia/reperfusion injury; (14) trauma; (15) cardiac inflammation; (16) cardiac edema; (17) and endocarditis (bacterial, viral, or fungal).
3. The method of claim 2, wherein the disease or condition comprise myocardial infarction.
4. The method of claim 1, wherein treatment provides an alleviation of at least one symptom of the cardiac disease or condition sooner than an untreated subject with the same or similar disease or condition.
5. The method of claim 4, wherein the at least one symptom comprises one or more of: (1) arrhythmia; (2) tachycardia; (3) bradycardia; (4) chest pain (angina); (5) fainting; (6) swollen feet or ankles; (7) cyanosis; (8) dizziness; (9) decreased cardiac lymphatics; (10) cardiac fluid accumulation and/or cardiac inflammation; (11) decreased systolic function; (12) atherosclerotic plaque formation; (13) delayed cardiac healing process and cardiac repair; (14) adverse cardiac remodeling; (15) shortness of breath; (16) weakness or fatigue.
6. A method for improving cardiac function in a subject in need thereof, the method comprising: administering an effective amount of reelin polypeptide, or a variant thereof.
7. The method of claim 6, wherein the subject has been diagnosed with a cardiac disease or condition or has suffered a cardiac injury.
8. The method of claim 7, wherein the cardiac disease or cardiac injury comprises a myocardial infarction.
9. The method of claim 8, wherein improved cardiac function includes a measurable improvement in on or more of: (1) arrhythmia; (2) tachycardia; (3) bradycardia; (4) chest pain (angina); (5) fainting; (6) swollen feet or ankles; (7) cyanosis; (8) dizziness; (9) decreased cardiac lymphatics; (10) cardiac fluid accumulation and/or cardiac inflammation; (11) systolic function; (12) atherosclerotic plaque formation; (13) cardiac healing process and cardiac repair; (14) cardiac remodeling; (15) shortness of breath; (16) weakness or fatigue.
10. A method to stimulate the formation of new lymphatics in cardiac tissue in a subject in need thereof, the method comprising administering an effective amount of reelin polypeptide, or a variant thereof.
11. The method of claim 10, wherein the subject in need thereof has suffered or is at risk of a cardiac disease or conditions selected from the group consisting of: (1) coronary artery disease; (2) arrhythmia; (3) bradycardia; (4) tachycardia; (5) congenital heart disease or defect; (6) myocardial infarction (heart attack); (7) cardiomyopathy; (8) heart valve disease; (9) pericardial disease; (10) rheumatic heart disease; (11) stroke; (12) heart failure; (13) ischemia/reperfusion injury; (14) trauma; (15) cardiac inflammation; (16) cardiac edema; (17) and endocarditis (bacterial, viral, or fungal).
12. The method of claim 10, wherein the subject has suffered or is at risk of myocardial infarction.
13. The method of claim 1, wherein the reelin polypeptide comprises SEQ ID NO: 1 or a fragment thereof.
14. The method of claim 1, wherein administration comprises providing the reelin polypeptide to the subject in a collagen patch.
15. The method of claim 1, wherein the reelin polypeptide is recombinant.
16. A composition comprising: a reelin polypeptide embedded in a collagen patch.
17. The composition of claim 16, wherein the reelin polypeptide comprises SEQ ID NO: 1.
18. The method of claim 6, wherein administration comprises providing the reelin polypeptide to the subject in a collagen patch.
19. The method of claim 10, wherein administration comprises providing the reelin polypeptide to the subject in a collagen patch.
20. The method of claim 19, wherein the subject has suffered or is at risk of myocardial infarction.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0007]
[0008]
[0009]
[0010]
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
DETAILED DESCRIPTION
[0036] The present invention is described herein using several definitions, as set forth below and throughout the application.
[0037] As used in this specification and the claims, the singular forms “a,” “an,” and “the” include plural forms unless the context clearly dictates otherwise. For example, the term “a polypeptide fragment” should be interpreted to mean “one or more a polypeptide fragments” unless the context clearly dictates otherwise. As used herein, the term “plurality” means “two or more.”
[0038] As used herein, “about,” “approximately,” “substantially,” and “significantly” will be understood by persons of ordinary skill in the art and will vary to some extent on the context in which they are used. If there are uses of the term which are not clear to persons of ordinary skill in the art given the context in which it is used, “about” and “approximately” will mean up to plus or minus 10% of the particular term and “substantially” and “significantly” will mean more than plus or minus 10% of the particular term.
[0039] As used herein, the terms “include” and “including” have the same meaning as the terms “comprise” and “comprising.” The terms “comprise” and “comprising” should be interpreted as being “open” transitional terms that permit the inclusion of additional components further to those components recited in the claims. The terms “consist” and “consisting of” should be interpreted as being “closed” transitional terms that do not permit the inclusion of additional components other than the components recited in the claims. The term “consisting essentially of” should be interpreted to be partially closed and allowing the inclusion only of additional components that do not fundamentally alter the nature of the claimed subject matter.
[0040] As used herein, the term “subject” may be used interchangeably with the term “patient” or “individual” and may include an “animal” and in particular a “mammal.” Mammalian subjects may include humans and other primates, domestic animals, farm animals, and companion animals such as dogs, cats, guinea pigs, rabbits, rats, mice, horses, cattle, cows, and the like.
[0041] The disclosed methods and compositions may be utilized to treat a subject in need thereof. A “subject in need thereof” is intended to include a subject having or at risk for developing diseases or disorders of the heart. In addition to trauma, exemplary disease or conditions that negatively affect the heart and that may be treated via the compositions and methods herein, include disease or conditions such as but not limited to: (1) coronary artery disease; (2) arrhythmia; (3) bradycardia; (4) tachycardia; (5) congenital heart disease or defect; (6) myocardial infarction (heart attack); (7) cardiomyopathy; (8) heart valve disease; (9) pericardial disease; (10) rheumatic heart disease; (11) stroke; (12) heart failure; (13) ischemia/reperfusion injury; (14) trauma; (15) cardiac inflammation; (16) cardiac edema; (17) and endocarditis (bacterial, viral, or fungal). In some embodiments, the disclosed methods and composition are useful to treat the heart after MI. In some embodiments, the methods and compositions disclosed herein are useful to treat (e.g., alleviate, prevent, or decrease, reduce frequency of) at least one symptom of a cardiac disease, condition, or injury in a subject in need thereof. By way of example but not by way of limitation, a subject in need thereof may be exhibiting one or more of the following symptoms: (1) arrhythmia; (2) tachycardia; (3) bradycardia; (4) chest pain (angina); (5) fainting; (6) swollen feet or ankles; (7) cyanosis; (8) dizziness; (9) decreased cardiac lymphatics; (10) cardiac fluid accumulation and/or cardiac inflammation; (11) decreased systolic function; (12) atherosclerotic plaque formation; (13) delayed cardiac healing process and cardiac repair; (14) adverse cardiac remodeling; (15) shortness of breath; (16) weakness or fatigue.
[0042] The terms “polynucleotide,” “polynucleotide sequence,” “nucleic acid” and “nucleic acid sequence” refer to a nucleotide, oligonucleotide, polynucleotide (which terms may be used interchangeably), or any fragment thereof. These phrases also refer to DNA or RNA of genomic, natural, or synthetic origin (which may be single-stranded or double-stranded and may represent the sense or the antisense strand).
[0043] Polynucleotides
[0044] The terms “nucleic acid” and “oligonucleotide,” as used herein, may refer to polydeoxyribonucleotides (containing 2-deoxy-D-ribose), polyribonucleotides (containing D-ribose), and to any other type of polynucleotide that is an N glycoside of a purine or pyrimidine base. There is no intended distinction in length between the terms “nucleic acid”, “oligonucleotide” and “polynucleotide”, and these terms will be used interchangeably. These terms refer only to the primary structure of the molecule. Thus, these terms include double- and single-stranded DNA, as well as double- and single-stranded RNA. For use in the present methods, an oligonucleotide also can comprise nucleotide analogs in which the base, sugar, or phosphate backbone is modified as well as non-purine or non-pyrimidine nucleotide analogs.
[0045] Oligonucleotides can be prepared by any suitable method, including direct chemical synthesis by a method such as the phosphotriester method of Narang et al., 1979, Meth. Enzymol. 68:90-99; the phosphodiester method of Brown et al., 1979, Meth. Enzymol. 68:109-151; the diethylphosphoramidite method of Beaucage et al., 1981, Tetrahedron Letters 22:1859-1862; and the solid support method of U.S. Pat. No. 4,458,066, each incorporated herein by reference. A review of synthesis methods of conjugates of oligonucleotides and modified nucleotides is provided in Goodchild, 1990, Bioconjugate Chemistry 1(3): 165-187, incorporated herein by reference.
[0046] Regarding polynucleotide sequences, the terms “percent identity” and “% identity” refer to the percentage of residue matches between at least two polynucleotide sequences aligned using a standardized algorithm. Such an algorithm may insert, in a standardized and reproducible way, gaps in the sequences being compared in order to optimize alignment between two sequences, and therefore achieve a more meaningful comparison of the two sequences. Percent identity for a nucleic acid sequence may be determined as understood in the art. (See, e.g., U.S. Pat. No. 7,396,664, which is incorporated herein by reference in its entirety). A suite of commonly used and freely available sequence comparison algorithms is provided by the National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool (BLAST), which is available from several sources, including the NCBI, Bethesda, Md., at its website. The BLAST software suite includes various sequence analysis programs including “blastn,” that is used to align a known polynucleotide sequence with other polynucleotide sequences from a variety of databases. Also available is a tool called “BLAST 2 Sequences” that is used for direct pairwise comparison of two nucleotide sequences. “BLAST 2 Sequences” can be accessed and used interactively at the NCBI website. The “BLAST 2 Sequences” tool can be used for both blastn and blastp (discussed above).
[0047] Regarding polynucleotide sequences, percent identity may be measured over the length of an entire defined polynucleotide sequence, for example, as defined by a particular SEQ ID number, or may be measured over a shorter length, for example, over the length of a fragment taken from a larger, defined sequence, for instance, a fragment of at least 20, at least 30, at least 40, at least 50, at least 70, at least 100, or at least 200 contiguous nucleotides. Such lengths are exemplary only, and it is understood that any fragment length supported by the sequences shown herein, in the tables, figures, or Sequence Listing, may be used to describe a length over which percentage identity may be measured.
[0048] Regarding polynucleotide sequences, “variant,” “mutant,” or “derivative” may be defined as a nucleic acid sequence having at least 50% sequence identity to the particular nucleic acid sequence over a certain length of one of the nucleic acid sequences using blastn with the “BLAST 2 Sequences” tool available at the National Center for Biotechnology Information's website. (See Tatiana A. Tatusova, Thomas L. Madden (1999), “Blast 2 sequences—a new tool for comparing protein and nucleotide sequences”, FEMS Microbiol Lett. 174:247-250). Such a pair of nucleic acids may show, for example, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length.
[0049] Nucleic acid sequences that do not show a high degree of identity may nevertheless encode similar amino acid sequences due to the degeneracy of the genetic code where multiple codons may encode for a single amino acid. It is understood that changes in a nucleic acid sequence can be made using this degeneracy to produce multiple nucleic acid sequences that all encode substantially the same protein. For example, polynucleotide sequences as contemplated herein may encode a protein and may be codon-optimized for expression in a particular host. In the art, codon usage frequency tables have been prepared for a number of host organisms including humans, mouse, rat, pig, E. coli, plants, and other host cells.
[0050] A “recombinant nucleic acid” is a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two or more otherwise separated segments of sequence. This artificial combination is often accomplished by chemical synthesis or, more commonly, by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques known in the art. The term recombinant includes nucleic acids that have been altered solely by addition, substitution, or deletion of a portion of the nucleic acid. Frequently, a recombinant nucleic acid may include a nucleic acid sequence operably linked to a promoter sequence. Such a recombinant nucleic acid may be part of a vector that is used, for example, to transform a cell.
[0051] The nucleic acids disclosed herein may be “substantially isolated or purified.” The term “substantially isolated or purified” refers to a nucleic acid that is removed from its natural environment, and is at least 60% free, preferably at least 75% free, and more preferably at least 90% free, even more preferably at least 95% free from other components with which it is naturally associated.
[0052] The term “hybridization,” as used herein, refers to the formation of a duplex structure by two single-stranded nucleic acids due to complementary base pairing. Hybridization can occur between fully complementary nucleic acid strands or between “substantially complementary” nucleic acid strands that contain minor regions of mismatch. Conditions under which hybridization of fully complementary nucleic acid strands is strongly preferred are referred to as “stringent hybridization conditions” or “sequence-specific hybridization conditions”. Stable duplexes of substantially complementary sequences can be achieved under less stringent hybridization conditions; the degree of mismatch tolerated can be controlled by suitable adjustment of the hybridization conditions. Those skilled in the art of nucleic acid technology can determine duplex stability empirically considering a number of variables including, for example, the length and base pair composition of the oligonucleotides, ionic strength, and incidence of mismatched base pairs, following the guidance provided by the art (see, e.g., Sambrook et al., 1989, Molecular Cloning-A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York; Wetmur, 1991, Critical Review in Biochem. and Mol. Biol. 26(3/4):227-259; and Owczarzy et al., 2008, Biochemistry, 47: 5336-5353, which are incorporated herein by reference).
[0053] The term “promoter” refers to a cis-acting DNA sequence that directs RNA polymerase and other trans-acting transcription factors to initiate RNA transcription from the DNA template that includes the cis-acting DNA sequence.
[0054] As used herein, “an engineered transcription template” or “an engineered expression template” refers to a non-naturally occurring nucleic acid that serves as substrate for transcribing at least one RNA. As used herein, “expression template” and “transcription template” have the same meaning and are used interchangeably. Engineered transcription templates include nucleic acids composed of DNA or RNA. Suitable sources of DNA for use in a nucleic acid for an expression template include genomic DNA, cDNA and RNA that can be converted into cDNA. Genomic DNA, cDNA and RNA can be from any biological source, such as a tissue sample, a biopsy, a swab, sputum, a blood sample, a fecal sample, a urine sample, a scraping, among others. The genomic DNA, cDNA and RNA can be from host cell or virus origins and from any species, including extant and extinct organisms.
[0055] The polynucleotide sequences contemplated herein may be present in expression vectors. For example, the vectors may comprise a polynucleotide encoding an ORF of a protein operably linked to a promoter. “Operably linked” refers to the situation in which a first nucleic acid sequence is placed in a functional relationship with a second nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. Operably linked DNA sequences may be in close proximity or contiguous and, where necessary to join two protein coding regions, in the same reading frame. Vectors contemplated herein may comprise a heterologous promoter operably linked to a polynucleotide that encodes a protein. A “heterologous promoter” refers to a promoter that is not the native or endogenous promoter for the protein or RNA that is being expressed.
[0056] As used herein, “expression” refers to the process by which a polynucleotide is transcribed from a DNA template (such as into mRNA or another RNA transcript) and/or the process by which a transcribed mRNA is subsequently translated into peptides, polypeptides, or proteins. Transcripts and encoded polypeptides may be collectively referred to as “gene product.”
[0057] The term “vector” refers to some means by which nucleic acid (e.g., DNA) can be introduced into a host organism or host tissue. There are various types of vectors including plasmid vector, bacteriophage vectors, cosmid vectors, bacterial vectors, and viral vectors. As used herein, a “vector” may refer to a recombinant nucleic acid that has been engineered to express a heterologous polypeptide (e.g., the fusion proteins disclosed herein). The recombinant nucleic acid typically includes cis-acting elements for expression of the heterologous polypeptide.
[0058] Polypeptides
[0059] The terms “amino acid” and “amino acid sequence” refer to an oligopeptide, peptide, polypeptide, or protein sequence (which terms may be used interchangeably), or a fragment of any of these, and to naturally occurring or synthetic molecules. Where “amino acid sequence” is recited to refer to a sequence of a naturally occurring protein molecule, “amino acid sequence” and like terms are not meant to limit the amino acid sequence to the complete native amino acid sequence associated with the recited protein molecule.
[0060] The amino acid sequences contemplated herein may include one or more amino acid substitutions relative to a reference amino acid sequence. For example, a variant polypeptide may include non-conservative and/or conservative amino acid substitutions relative to a reference polypeptide. “Conservative amino acid substitutions” are those substitutions that are predicted to interfere least with the properties of the reference polypeptide. In other words, conservative amino acid substitutions substantially conserve the structure and the function of the reference protein. The following Table provides a list of exemplary conservative amino acid substitutions.
TABLE-US-00001 Original Residue Conservative Substitution Ala Gly, Ser Arg His, Lys Asn Asp, Gln, His Asp Asn, Glu Cys Ala, Ser Gln Asn, Glu, His Glu Asp, Gln, His Gly Ala His Asn, Arg, Gln, Glu Ile Leu, Val Leu Ile, Val Lys Arg, Gln, Glu Met Leu, Ile Phe His, Met, Leu, Trp, Tyr Ser Cys, Thr Thr Ser, Val Trp Phe, Tyr Tyr His, Phe, Trp Val Ile, Leu, Thr
[0061] Conservative amino acid substitutions generally maintain one or more of: (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a beta sheet or alpha helical conformation, (b) the charge or hydrophobicity of the molecule at the site of the substitution, and/or (c) the bulk of the side chain. Non-conservative amino acid substitutions generally do not maintain one or more of: (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a beta sheet or alpha helical conformation, (b) the charge or hydrophobicity of the molecule at the site of the substitution, and/or (c) the bulk of the side chain. A “variant” of a reference polypeptide sequence may include a conservative or non-conservative amino acid substitution relative to the reference polypeptide sequence,
[0062] The disclosed peptides may include an N-terminal esterification (e.g., a phosphoester modification) or a pegylation modification, for example, to enhance plasma stability (e.g. resistance to exopeptidases) and/or to reduce immunogenicity.
[0063] A “deletion” refers to a change in a reference amino acid sequence (e.g., SEQ ID NO:1 (human reelin polypeptide sequence) or SEQ ID NO:2 (rat reelin polypeptide sequence) that results in the absence of one or more amino acid residues. A deletion removes at least 1, 2, 3, 4, 5, 10, 20, 50, 100, or 200 amino acids residues or a range of amino acid residues bounded by any of these values (e.g., a deletion of 5-10 amino acids). A deletion may include an internal deletion or a terminal deletion (e.g., an N-terminal truncation or a C-terminal truncation of a reference polypeptide). A “variant” of a reference polypeptide sequence may include a deletion relative to the reference polypeptide sequence.
[0064] The words “insertion” and “addition” refer to changes in an amino acid sequence resulting in the addition of one or more amino acid residues. An insertion or addition may refer to 1, 2, 3, 4, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, or 200 amino acid residues or a range of amino acid residues bounded by any of these values (e.g., an insertion or addition of 5-10 amino acids). A “variant” of a reference polypeptide sequence may include an insertion or addition relative to the reference polypeptide sequence.
[0065] A “fusion polypeptide” refers to a polypeptide comprising at the N-terminus, the C-terminus, or at both termini of its amino acid sequence a heterologous amino acid sequence, for example, a heterologous amino acid sequence (e.g., a fusion partner) that extends the half-life of the fusion polypeptide in the tissue of interest, such as serum, plasma, or in the eye. A “variant” of a reference polypeptide sequence may include a fusion polypeptide comprising the reference polypeptide.
[0066] A “fragment” is a portion of an amino acid sequence which is identical in sequence to but shorter in length than a reference sequence (e.g., SEQ ID NO:1 or SEQ ID NO:2). A fragment may comprise up to the entire length of the reference sequence, minus at least one amino acid residue. For example, a fragment may comprise from 5 to 1000 contiguous amino acid residues of a reference polypeptide. In some embodiments, a fragment may comprise at least 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 150, 250, or 500 contiguous amino acid residues of a reference polypeptide; or a fragment may comprise no more than 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 150, 250, or 500 contiguous amino acid residues of a reference polypeptide; or a fragment may comprise a range of contiguous amino acid residues of a reference polypeptide bounded by any of these values (e.g., 40-80 contiguous amino acid residues). Fragments may be preferentially selected from certain regions of a molecule. The term “at least a fragment” encompasses the full length polypeptide. A “variant” of a reference polypeptide sequence may include a fragment of the reference polypeptide sequence.
[0067] “Homology” refers to sequence similarity or, interchangeably, sequence identity, between two or more polypeptide sequences. Homology, sequence similarity, and percentage sequence identity may be determined using methods in the art and described herein.
[0068] The phrases “percent identity” and “% identity,” as applied to polypeptide sequences, refer to the percentage of residue matches between at least two polypeptide sequences aligned using a standardized algorithm. Methods of polypeptide sequence alignment are well-known. Some alignment methods take into account conservative amino acid substitutions. Such conservative substitutions, explained in more detail above, generally preserve the charge and hydrophobicity at the site of substitution, thus preserving the structure (and therefore function) of the polypeptide. Percent identity for amino acid sequences may be determined as understood in the art. (See, e.g., U.S. Pat. No. 7,396,664, which is incorporated herein by reference in its entirety). A suite of commonly used and freely available sequence comparison algorithms is provided by the National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool (BLAST) (Altschul, S. F. et al. (1990) J. Mol. Biol. 215:403 410), which is available from several sources, including the NCBI, Bethesda, Md., at its website. The BLAST software suite includes various sequence analysis programs including “blastp,” that is used to align a known amino acid sequence with other amino acids sequences from a variety of databases.
[0069] Percent identity may be measured over the length of an entire defined polypeptide sequence, for example, as defined by a particular SEQ ID number, or may be measured over a shorter length, for example, over the length of a fragment taken from a larger, defined polypeptide sequence, for instance, a fragment of at least 15, at least 20, at least 30, at least 40, at least 50, at least 100, at least 150, at least 200, at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, at least 550, at least 600, at least 650, or at least 700 contiguous amino acid residues; or a fragment of no more than 15, 20, 30, 40, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, or 700 amino acid residues; or over a range bounded by any of these values (e.g., a range of 500-600 amino acid residues) Such lengths are exemplary only, and it is understood that any fragment length supported by the sequences shown herein, in the tables, figures or Sequence Listing, may be used to describe a length over which percentage identity may be measured.
[0070] In some embodiments, a “variant” of a particular polypeptide sequence may be defined as a polypeptide sequence having at least 20% sequence identity to the particular polypeptide sequence over a certain length of one of the polypeptide sequences using blastp with the “BLAST 2 Sequences” tool available at the National Center for Biotechnology Information's website. (See Tatiana A. Tatusova, Thomas L. Madden (1999), “Blast 2 sequences—a new tool for comparing protein and nucleotide sequences”, FEMS Microbiol Lett. 174:247-250). Such a pair of polypeptides may show, for example, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length of one of the polypeptides, or range of percentage identity bounded by any of these values (e.g., range of percentage identity of 80-99%).
[0071] Reelin
[0072] The disclosed methods of treatment and pharmaceutical composition utilize and/or include a reelin polypeptide or a functional fragment or variant thereof, or a nucleotide sequence encoding a reelin polypeptide or a functional fragment or variant thereof.
[0073] The amino acid sequence of human reelin is provided as SEQ ID NO: 1.
TABLE-US-00002 SEQ ID NO: 1 1 mersgwarqt fllalllgat lraraaagyy prfspffflc thhgelegdg eqgevlislh 61 iagnptyyvp gqeyhvtist stffdgllvt glytstsvqa sqsiggssaf gfgimsdhqf 121 gnqfmcsvva shvshlpttn lsfiwiappa gtgcvnfmat athrgqvifk dalaqqlceq 181 gaptdvtvhp hlaeihsdsi ilrddfdsyh qlqlnpniwv ecnncetgeq cgaimhgnav 241 tfcepygpre littglnttt asvlqfsigs gscrfsysdp siivlyaknn sadwiqleki 301 rapsnvstii hilylpedak genvqfqwkq enlrvgevye acwaldnili insahrqvvl 361 edsldpvdtg nwlffpgatv khscqsdgns iyfhgnegse fnfattrdvd Istediqeqw 421 seefesqptg wdvlgavigt ecgtiesgls mvflkdgerk lctpsmdttg ygnlrfyfvm 481 ggicdpgnsh endiilyaki egrkehitld tlsyssykvp slvsvvinpe lqtpatkfcl 481 ggicdpgnsh endiilyaki egrkehitld tlsyssykvp slvsvvinpe lqtpatkfcl 541 rqknhqghnr nvwavdffhv lpvlpstmsh miqfsinlgc gthqpgnsvs lefstnhgrs 601 wsllhteclp eicagphlph stvyssenys gwnritiplp naaltrntri rwrqtgpilg 661 nmwaidnvyi gpsclkfcsg rgqctrhgck cdpgfsgpac emasqtfpmf isesfgssrl 721 ssyhnfysir gaevsfgcgv lasgkalvfn kegrrqlits fldssqsrfl qftlrlgsks 781 vlstcrapdq pgegvllhys ydngitwkll ehysylsyhe priisvelpg dakqfgiqfr 841 wwqpyhssqr edvwaideii mtsvlinsis ldftnlvevt qslgfylgnv qpycghdwtl 901 cftgdsklas smryvetqsm qigasymiqf slvmgcgqky tphmdnqvkl eystnhgltw 961 hlvqeeclps mpscqeftsa siyhaseftq wrrvivllpq ktwssatrfr wsqsyytaqd 1021 ewaldsiyig qqcpnmcsgh gscdhgicrc dqgyqgtech peaalpstim sdfenqngwe 1081 sdwqevigge ivkpeggcgv issgsslyfs kagkrqlvsw dldtswvdfv qfyiqigges 1141 ascnkpdsre egvllqysnn ggiqwhllae myfsdfskpr fvylelpaaa ktpctrfrww 1201 qpvfsgedyd qwavddiiil sekqkqiipv inptlpqnfy ekpafdypmn qmsvwlmlan 1261 egmvknetfc aatpsamifg ksdgdrfavt rdltlkpgyv lqfklnigca nqfsstapvl 1321 1qyshdagms wflvkegcyp asagkgcegn srelseptmy htgdfeewtr itiviprsla 1381 ssktrfrwiq esssqknvpp fgldgvyise pcpsycsghg dcisgvcfcd lgytaaqgtc 1441 vsnvpnhnem fdrfegklsp lwykitgaqv gtgcgtlndg kslyfngpgk reartvpldt 1501 rnirlvqfyi qigsktsgit cikprtrneg livqysndng ilwhllreld fmsflepqii 1561 sidlpqdakt patafrwwqp qhgkhsaqwa lddvligmnd ssqtgfqdkf dgsidlqanw 1621 yriqggqvdi dclsmdtali ftenigkpry aetwdfhvsa stflqfemsm gcskpfsnsh 1681 svqlqysInn gkdwhlvtee cvpptigclh ytessiytse rfqnwkritv ylplstispr 1741 trfrwigany tvgadswaid nvvlasgcpw mcsgrgicda grcvcdrgfg gpycvpvvpl 1801 psilkddfng nlhpdlwpev ygaergning etiksgtsli fkgeglrmli srdldctntm 1861 yvqfslrfia kstpershsi llqfsisggi twhlmdefyf pqttnilfin vplpytaqtn 1921 atrfrlwqpy nngkkeeiwi vddfiidgnn vnnpvmlldt fdfgprednw ffypggnigl 1981 ycpysskgap eedsamvfvs nevgehsitt rdlnvnenti iqfeinvgcs tdsssadpvr 2041 lefsrdfgat whlllplcyh ssshvsslcs tehhpsstyy agtmqgwrre vvhfgklhlc 2101 gsvrfrwyqg fypagsqpvt waidnvyigp qceemcngqg scingtkcic dpgysgptck 2161 istknpdflk ddfegqlesd rfllmsggkp srkcgilssg nnlffnedgl rmlmtrdldl 2221 sharfvqffm rlgcgkgvpd prsqpvllqy singglswsl lqeflfsnss nvgryialei 2281 plkarsgstr lrwwqpseng hfyspwvidq iliggnisgn tvleddfttl dsrkwllhpg 2341 gtkmpvcgst gdalvfieka stryvvstdv avnedsflqi dfaascsvtd scyaieleys 2401 vdlglswhpl vrdclptnve csryhlqril vsdtinkwtr itlplppytr sqatrfrwhq 2461 papfdkqqtw aidnvyigdg cidmcsghgr ciggncvcde qwgglycddp etslptqlkd 2521 nfnrapssqn wltvnggkls tvcgavasgm alhfsggcsr llvtvdlnlt naefiqfyfm 2581 ygclitpnnr nqgvlleysv nggitwnllm eifydqyskp gfvnillppd akeiatrfrw 2641 wqprhdgldq ndwaidnvli sgsadqrtvm ldtfssapvp qherspadag pvgriafdmf 2701 medktsvneh wlfhddctve rfcdspdgvm lcgshdgrev yavthdltpt egwimqfkis 2761 vgckvsekia qnqihvqyst dfgvswnylv pqclpadpkc sgsvsqpsvf fptkgwkrit 2821 yplpeslvgn pvrfrfyqky sdmqwaidnf ylgpgcldnc rghgdclreq cicdpgysgp 2881 ncylthtlkt flkerfdsee ikpdlwmsle ggstctecgi laedtalyfg gstvrqavtq 2941 dldlrgakfl qywgrigsen nmtschrpic rkegvlldys tdggitwtll hemdyqkyis 3001 vrhdyillpe daltnttrlr wwqpfvisng ivvsgveraq waldniligg aeinpsqlvd 3061 tfddegtshe enwsfypnav rtagfcgnps fhlywpnkkk dkthnalssr eliiqpgymm 3121 qfkivvgcea tscgdlhsvm leytkdarsd swqlvqtqcl psssnsigcs pfqfheatiy 3181 nsvnssswkr itiqlpdhvs ssatqfrwiq kgeetekqsw aidhvyigea cpklcsghgy 3241 cttgaicicd esfqgddcsv fshdlpsyik dnfesarvte anwetiqggv igsgcgqlap 3301 yahgdslyfn gcqirqaatk pldltraski mfvlqigsms qtdscnsdls gphavdkavl 3361 lqysvnngit whviaqhqpk dftqaqrvsy nvplearmkg vllrwwqprh ngtghdqwal 3421 dhvevvlvst rkqnymmnfs rqhglrhfyn rrrrslrryp
[0074] The amino acid sequence of mouse reelin is provided as SEQ ID NO: 2.
TABLE-US-00003 SEQ ID NO: 2 1 mergcwapra lvlavlllla tlraraatgy yprispfffl cthhgelegd geqgevlisl 61 hiagnptyyv pgqeyhvtis tstffdgllv tglytstsiq ssqsiggssa fgfgimsdhq 121 fgnqfmcsvv ashvshlptt nlsfvwiapp agtgcvnfma tathrgqvif kdalaqqlce 181 qgapteatay shlaeihsds vilrddfdsy qqlelnpniw vecsncemge qcgtimhgna 241 vtfcepygpr eltttclntt tasvlqfsig sgscrfsysd psitvsyakn ntadwiqlek 301 irapsnvstv ihilylpeea kgesvqfqwk qdslrvgevy eacwaldnil vinsahrevv 361 lednldpvdt gnwlffpgat vkhscqsdgn siyfhgnegs efnfattrdv dlstedigeq 421 wseefesqpt gwdilgavvg adcgtvesgl slvflkdger klctpymdtt gygnlrfyfv 481 mggicdpgvs hendiilyak iegrkehial dtltyssykv pslvsvvinp elqtpatkfc 541 lrqkshqgyn rnvwavdffh vlpvlpstms hmiqfsinlg cgthqpgnsv slefstnhgr 601 swsllhtecl peicagphlp hstvysseny sgwnritipl pnaaltrdtr irwrqtgpil 661 gnmwaidnvy igpsclkfcs grgqctrhgc kcdpgfsgpa cemasqtfpm fisesfgsar 721 Issyhnfysi rgaevsfgcg vlasgkalvf nkdgrrqlit sfldssqsrf lqftlrlgsk 781 svlstcrapd qpgegvllhy sydngitwkl lehysyvnyh epriisvelp ddarqfgiqf 841 rwwqpyhssq gedvwaidei vmtsvlfnsi sldftnlvev tqslgfylgn vqpycghdwt 901 lcftgdskla ssmryvetqs mqigasymiq fslvmgcgqk ytphmdnqvk leysanhglt 961 whlvqeeclp smpscqefts asiyhaseft qwrrvtvvlp qktwsgatrf rwsqsyytaq 1021 dewaldniyi gqqcpnmcsg hgscdhover cdqgyqgtec hpeaalpsti msdfenpssw 1081 esdwgevigg evvkpeggcg vvssgsslyf skagkrqlvs wdldtswvdf vqfyiqigge 1141 saacnkpdsr eegillqysn nggiqwhlla emyfsdfskp rfvylelpaa gktpctrfrw 1201 wkpvfsgedy dqwavddiii lsekqkqvip vvnptlpqnf yekpafdypm nqmsvwlmla 1261 negmakndsf cattpsamvf gksdgdrfav trdltlkpgy vlqfklnigc tsqfsstapv 1321 llqyshdagm swfllkegcf pasaakgceg nsrelseptv yytgdfeewt ritiaiprsl 1381 assktrfrwi qesssqknvp pfgldgvyis epcpsycsgh gdcisgvcfc dlgytaaqgt 1441 cvsntpnhse mfdrfegkls plwykitggq vgtgcgtlnd grslyfnglg kreartvpld 1501 trnislvqfy iqigsktsgi tyitprarye glvvqysndn gilwhllrel dfmsflepqi 1561 isidlpreak tpatafrwwq pqhgkhsaqw algdvligvn dssqtgfqdk ldgsidlqan 1621 wyriqggqvd idclsmdtal iftenignpr yaetwdfhvs essflqwemn mgcskpfsga 1681 hgiqlqysln ngkdwqlvte ecvpptigcv hytesstyts erfqnwrrvt vylplatnsp 1741 rtrfrwiqtn ytvgadswai dnvilasgcp wmcsgrgicd sgrcvcdrgf ggpfcvpvvp 1801 lpsilkddfn gnlhpdlwpe vygaergnln getiksgtcl ifkgeglrml isrdldctnt 1861 myvqfslrfi akgtpershs illqfsvsgg vtwhlmdefy fpqttsilfi nvplpygaqt 1921 natrfrlwqp ynngkkeeiw iiddfiidgn nlnnpvllld tfdfgpredn wffypggnig 1981 lycpysskga peedsamvfv snevgehsit trdlsvnent iiqfeinvgc stdsssadpv 2041 rlefsrdiga twhlllplcy hssslvsslc stehhpssty yagttqgwrr evvhfgklhl 2101 cgsvrfrwyq gfypagsqpv twaidnvyig pqceemcygh gscingtkci cdpgysgptc 2161 kistknpdfl kddfegqles drfllmsggk psrkcgilss gnnlffnedg Irmlvtrdld 2221 lsharfvqff mrlgcgkgvp dprsqpvllq yslngglsws llqeflfsns snvgryiale 2281 mplkarsgst rlrwwqpsen ghfyspwvid qiliggnisg ntvleddfst ldsrkwllhp 2341 ggtkmpvcgs tgdalvfiek astryvvttd iavnedsflq idfaascsvt dscyaieley 2401 svdlglswhp lvrdclptnv ecsryhlqri lvsdtfnkwt ritlplpsyt rsqatrfrwh 2461 qpapfdkqqt waidnvyigd gcldmcsghg rcvqgscvcd eqwgglycde petslptqlk 2521 dnfnrapsnq nwltvsggkl stvcgavasg lalhfsggcs rllvtvdlnl tnaefiqfyf 2581 mygclitpsn rnqgvlleys vnggitwill meifydqysk pgfvnillpp dakeiatrfr 2641 wwqprhdgld qndwaidnvl isgsadqrtv mldtfssapv pqherspada gpvgriafem 2701 fledktsvne nwlfhddctv erfcdspdgv mlcgshdgre vyavthdltp tenwimqfki 2761 svgckvpeki aqnqihvqfs tdfgvswsyl vpqclpadpk csgsvsqpsv ffptegwkri 2821 typlpesltg npvrfrfyqk ysdvqwaidn fylgpgcldn cgghgdclke qcicdpgysg 2881 pncylthslk tflkerfdse eikpdlwmsl eggstctecg vlaentalyf ggstvrqait 2941 qdldlrgakf lqywgrigse nnmtschrpv crkegvlldf stdggitwtl lhemdfqkyi 3001 svrhdyillp egaltnttrl rwwqpfvisn glvvsgvera qwaldnilig gaeinpsqlv 3061 dtfddegssh eenwsfypna vrtagfcgnp sfhlywpnkk kdkthnalss reliiqpgym 3121 mqfkivvgce atscgdlhsv mleytkdars dswqlvqtqc lpsssnsigc spfqfheati 3181 ynavnssswk ritiqlpdhv sssatqfrwi qkgeetekqs waidhvyige acpklcsghg 3241 ycttgavcic desfqgddcs vfshelpsyi kdnfesarvt eanwetiqgg vigsgcgqla 3301 pyahgdslyf ngcqirgaat kpldltrask imfvlqigsp aqtdscnsdl sgphtvdkav 3361 llqysvnngi twhviaqhqp kdftqaqrvs ynvplearmk gvllrwwqpr hngtghdqwa 3421 ldhvevvlvs trkqnymmnf srqhglrhfy nrrrrslrry p
[0075] Reelin (RELN) is a large, secreted extracellular matrix glycoprotein that helps regulate processes of neuronal migration and positioning in the developing brain by controlling cell-cell interactions. In addition to its role in early development, reelin is also produced and is active in the adult brain. In the adult brain, reelin modulates synaptic plasticity by enhancing the induction and maintenance of long-term potentiation. Reelin also stimulates dendrite and dendritic spine development and regulates the continuing migration of neuroblasts generated in adult neurogenesis sites like the subventricular and subgranular zones. It was previously shown that Reelin is also expressed and secreted by lymphatic endothelial cells and regulates collecting lymphatic vessel maturation. Reelin also plays a role in atherosclerosis by enhancing vascular inflammation.
[0076] Reelin's name comes from the abnormal reeling gait of reeler mice, which were later found to have a deficiency of this brain protein and were homozygous for mutation of the RELN gene. The primary phenotype associated with loss of reelin function is a failure of neuronal positioning throughout the developing central nervous system (CNS). The mice heterozygous for the reelin gene, while having little neuroanatomical defects, display the endophenotypic traits linked to psychotic disorders.
[0077] Not surprisingly, reelin has been implicated in pathogenesis of several brain diseases. For example, the expression of the protein has been found to be significantly lower in subjects diagnosed with schizophrenia and psychotic bipolar disorder, but the cause of this observation remains uncertain, as studies show that psychotropic medication itself affects reelin expression. Moreover, epigenetic hypotheses aimed at explaining the changed levels of reelin expression are controversial. Total lack of reelin causes a form of lissencephaly, and reelin may also play a role in Alzheimer's disease, temporal lobe epilepsy and autism. Congenital lymphedema and accumulation of chylous ascites has also been reported in patients with homozygous mutations in REELIN. At least three patients with such mutation exhibited persistent neonatal lymphedema and one has accumulation of chyle. Reelin deletion in mice has been demonstrated to result in impaired maturation of collecting lymphatic vessels, suggesting that collecting vessel dysfunction may underlie the lymphatic defects observed in patients.
[0078] Loss of Reelin protects against atherosclerosis by reducing leukocyte-endothelial cell adhesion and lesion macrophage accumulation (Ding Y, Huang L, Xian X, Yuhanna I S, Wasser C R, Frotscher M, Mineo C, Shaul P W, Herz J. Loss of Reelin protects against atherosclerosis by reducing leukocyte-endothelial cell adhesion and lesion macrophage accumulation. Sci Signal. 2016 Mar. 15; 9(419):ra29).
[0079] Reelin is found not only in the brain but also in the liver, thyroid gland, adrenal gland, Fallopian tube, breast and in comparatively lower levels across a range of anatomical regions.
[0080] Reelin (human) is composed of 3461 amino acids with a relative molecular mass of 388 kDa. It also has serine protease activity.
[0081] At the N terminus, reelin contains a 27 amino acid cleavable signal peptide and a small region of similarity with F-spondin, a protein secreted by floor plate cells in the developing neural tube. At the C terminus of reelin there is a stretch of positively charged amino acids. The main body of the protein comprises a series of eight internal repeats of 350-390 amino acids, each containing two related subdomains that flank a pattern of conserved cysteine residues known as an EGF-like motif. These cysteine-rich regions resemble those found in other extracellular proteins, whereas the flanking subdomains appear to be unique to reelin.
[0082] The final reelin domain contains a highly basic and short C-terminal region (CTR) with a length of 32 amino acids. This region is highly conserved, being 100% identical in all investigated mammals. It was thought that the CTR is necessary for reelin secretion, because the Orleans reeler mutation, which lacks a part of 8th repeat and the whole CTR, is unable to secrete the misshaped protein, leading to its concentration in cytoplasm. However, other studies have shown that the CTR is not essential for secretion itself, but mutants lacking the CTR were much less efficient in activating downstream signaling events.
[0083] Reelin is cleaved in vivo at two sites located after domains 2 and 6—approximately between repeats 2 and 3 and between repeats 6 and 7, resulting in the production of three fragments. This splitting does not decrease the protein's activity, as constructs made of the predicted central fragments (repeats 3-6) bind to lipoprotein receptors, trigger Dab1 phosphorylation and mimic functions of reelin during cortical plate development. Moreover, the processing of reelin by embryonic neurons may be necessary for proper corticogenesis.
[0084] The inventors' results show that in the heart, reelin produced by lymphatics acts mainly upon the Integrin β1 signaling pathway in cardiomyocytes, although the participation of other receptors cannot be conclusively ignored. Two types of experiments, disclosed herein, illustrate this. 1) Removal of the reelin gene results in smaller hearts at embryonic stages. Also, cardiac function was impaired after myocardial infarction (MI) at postnatal day 14 and 21 as determined by echocardiography. 2) Full length reelin protein was delivered directly into adult mouse hearts using well-established bioengineered collagen patches as a scaffold to deliver recombinant reelin protein into the heart of wild-type animals. Reelin containing patches and control patches were surgically sutured onto approximately 2-month old injured hearts immediately following acute MI. Cardiac function was evaluated weekly (1-6 weeks after MI) and ejection fraction (EF) was significantly improved in mice with reelin patches. Consistent with this improved heart function, cardiomyocyte cell death and the size of the fibrotic tissue was remarkably reduced in the reelin patched mice 42 days after MI. Accordingly, reelin protein is useful for the treatment of cardiac injury; in some embodiments, full-length reelin protein is administered. In some embodiments, one or more reelin protein fragments is used (e.g., one or more reelin isoforms). In some embodiments, the reelin protein or fragment thereof is recombinant.
[0085] Reelin's control of cell-cell interactions is thought to be mediated by binding of reelin to the two members of low density lipoprotein receptor gene family: VLDLR and the ApoER2. The two main reelin receptors seem to have slightly different roles: VLDLR conducts the stop signal, while ApoER2 is essential for the migration of late-born neocortical neurons. It also has been shown that the N-terminal region of reelin, a site distinct from the region of reelin shown to associate with VLDLR/ApoER2 binds to the alpha-3-beta-1 integrin receptor.
[0086] Reelin activates the signaling cascade of Notch-1, inducing the expression of FABP7 and prompting progenitor cells to assume radial glial phenotype. In addition, corticogenesis in vivo is highly dependent upon reelin being processed by embryonic neurons, which are thought to secrete some as yet unidentified metalloproteinases that free the central signal-competent part of the protein.
[0087] In the methods and compositions disclosed herein, reelin polypeptide, or fragments thereof, can be isolated e.g., from mammalian, yeast, or bacterial cells in culture by methods well known in the art. Recombinant reelin protein is also commercially available.
[0088] Reelin Variants
[0089] The disclosed reelin variants may be modified so as to comprise an amino acid sequence, or modified amino acids, or non-naturally occurring amino acids, such that the disclosed reelin variants cannot be said to be naturally occurring. In some embodiments, the disclosed reelin variants are modified and the modification is selected from the group consisting of acylation, acetylation, formylation, lipolylation, myristoylation, palmitoylation, alkylation, isoprenylation, prenylation, and amidation. An amino acid in the disclosed polypeptides may be thusly modified, but in particular, the modifications may be present at the N-terminus and/or C-terminus of the polypeptides (e.g., N-terminal acylation or acetylation, and/or C-terminal amidation). The modifications may enhance the stability of the polypeptides and/or make the polypeptides resistant to proteolysis.
[0090] The disclosed reelin variants may be modified to replace a natural amino acid residue by an unnatural amino acid. Unnatural amino acids may include, but are not limited to an amino acid having a D-configuration, an N-methyl-α-amino acid, a non-proteogenic constrained amino acid, or a β-amino acid.
[0091] The disclosed reelin variants may be modified in order to increase the stability of the reelin variants in the target tissue, such as the heart. For example, the disclosed peptides may be modified in order to make the peptides resistant to peptidases. The disclosed peptides may be modified to replace an amide bond between two amino acids with a non-amide bond. For example, the carbonyl moiety of the amide bond can be replaced by CH2 (i.e., to provide a reduced amino bond: —CH2-NH—). Other suitable non-amide replacement bonds for the amide bond may include, but are not limited to: an endothiopeptide, —C(S)—NH, a phosphonamide, —P(O)OH—NH—), the NH-amide bond can be exchanged by O (depsipeptide, —CO—O—), S (thioester, —CO—S—) or CH.sub.2 (ketomethylene, —CO—CH.sub.2—). The peptide bond can also be modified as follows: retro-inverso bond (—NH—CO—), methylene-oxy bond (—CH.sub.2—), thiomethylene bond (—CH.sub.2—S—), carbabond (—CH.sub.2—CH.sub.2—), hydroxyethylene bond (—CHOH—CH.sub.2—) and so on, for example, to increase plasma stability of the peptide sequence (notably towards endopeptidases).
[0092] The disclosed reelin variants may include a non-naturally occurring N-terminal and/or C-terminal modification. For example, the N-terminal of the disclosed peptides may be modified to include an N-acylation or a N-pyroglutamate modification (e.g., as a blocking modification). The C-terminal end of the disclosed peptides may be modified to include a C-amidation. The disclosed peptides may be conjugated to carbohydrate chains (e.g., via glycosylation to glucose, xylose, hexose), for example, to increase plasma stability (notably, resistance towards exopeptidases).
[0093] The disclosed polypeptides or variants or fragments of reelin may include a deletion relative to full-length reelin (e.g., SEQ ID NO:1). The disclosed polypeptide fragments may include a deletion selected from an N-terminal deletion, a C-terminal deletion, and both, relative to full-length reelin. Further, in some embodiments the disclosed polypeptide fragments may include an internal deletion. The deletion may remove at least about 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, 100, 150, 200 amino acids or more of full-length reelin.
[0094] Pharmaceutical Compositions
[0095] The compositions disclosed herein may include pharmaceutical compositions comprising a reelin polypeptide, variants and/or fragments thereof, and may be formulated for administration to a subject in need thereof. Compositions may include one, or more than one, different reelin polypeptide and/or variant(s) (e.g., a composition may include one or more of SEQ ID NO:1, SEQ ID NO: 1 and fragments thereof). Such compositions can be formulated and/or administered in dosages and by techniques well known to those skilled in the medical arts taking into consideration such factors as the age, sex, weight, and condition of the particular patient, and the route of administration.
[0096] The compositions may include pharmaceutical solutions comprising carriers, diluents, excipients, preservatives, and surfactants, as known in the art. Further, the compositions may include preservatives (e.g., anti-microbial or anti-bacterial agents such as benzalkonium chloride). The compositions also may include buffering agents (e.g., in order to maintain the pH of the composition between 6.5 and 7.5).
[0097] The pharmaceutical compositions may be administered therapeutically. In therapeutic applications, the compositions are administered to a patient in an amount sufficient to elicit a therapeutic effect (e.g., a response which cures or at least partially arrests or slows symptoms and/or complications of disease (i.e., a “therapeutically effective dose”).
[0098] In some embodiments, compositions are formulated for systemic delivery, such as oral or parenteral delivery (e.g., intraarterially, intravenously, intraperitoneally, subcutaneously, or intramuscularly). In some embodiments, the pharmaceutical compositions are administered via intracoronary, epicardial, or endocardial injection. In some embodiments, compositions are formulated for site-specific administration, such as topical administration. By way of example, but not by way of limitation, in some embodiments, compositions are formulated for administration via a collagen patch. The collagen patch can be placed in contact with the tissue to be treated (e.g., cardiac tissue), and the therapeutic composition is then released to the tissue. In other embodiments, the reelin protein or fragment thereof is administered to the subject, e.g., the subject's heart, via viral particles.
[0099] In some embodiments, compositions are formulated for delivery by viral particles. Their high stability, easily modifiable surface, and enormous diversity in shape and size, distinguish viruses from synthetic nanocarriers used for drug delivery. Several animal viruses are widely recognized as delivery vehicles or “vectors” for gene therapy (e.g., viral vectors for a nucleic acid that is capable of expressing a reelin polypeptide or variant thereof), and can also be employed as nanocarriers (e.g., carrying a reelin polypeptide or variant thereof). In addition, plant and bacterial viruses (e.g., phages) have been investigated and applied as drug carriers. The genetic material within the capsids or coat of viruses and phages can be removed to produce empty viral-like particles that are replication-deficient and can then be loaded with therapeutic agents, for example reelin polypeptide and/or variant(s) thereof. Exemplary viruses include, but are not limited to phages such as M13, T4, T7, MS2, and λ, the tobacco mosaic virus (TMV), cowpea chlorotic mottle virus (CCMV), and cowpea mosaic virus (CMV).
[0100] In some embodiments, compositions are formulated for delivery as nanoparticles. In one aspect, the present invention provides a nanoparticle-polypeptide complex comprising a bioactive polypeptide (e.g., a reelin polypeptide or variant thereof) in association with a nanoparticle. The nanoparticle can be a lipid-based nanoparticle, a superparamagnetic nanoparticle, a nanoshell, a semiconductor nanocrystal, a quantum dot, a polymer-based nanoparticle, a silicon-based nanoparticle, a silica-based nanoparticle, a metal-based nanoparticle, a fullerene or a nanotube. In some embodiments, the nanoparticle is a lipid-based nanoparticle or a superparamagnetic nanoparticle. Non-limiting examples of lipid-based nanoparticles include liposomes and DOTAP:cholesterol vesicles. A nanoparticle-polypeptide complex can contain a second bioactive polypeptide in association with the nanoparticle, and/or one or more additional active agents.
[0101] The therapeutic composition may include, in addition to a reelin polypeptide, or variants thereof, one or more additional active agents. By way of example, the one or more active agents may include an antibiotic, anti-inflammatory agent, a steroid, or a non-steroidal anti-inflammatory drug.
[0102] According to various aspects, a reelin polypeptide, or variant thereof, and optionally the one or more active or inactive agents may be present in the composition as particles or may be soluble. By way of example, in some embodiments, micro particles or microspheres may be employed, and/or nanoparticles may also be employed, e.g., by utilizing biodegradable polymers and lipids to form liposomes, dendrimers, micelles, or nanowafers as carriers for targeted delivery of the reelin polypeptide or variant thereof. In some embodiments, polymeric implants may be used. By way of example, but not by way of limitation, in some embodiments, a therapeutic composition comprising a reelin polypeptide or variant thereof is applied to a collagen patch.
[0103] In some embodiments, the composition formulated for administration comprises between 0.1 ng and 500 mg/ml of the reelin peptide, or variant thereof. In some embodiments, the compositions if formulated such that between 0.1 ng and 500 μg of the reelin peptide, or variant thereof is administered to a subject. In some embodiments, the compositions if formulated such that between about 1 and 100 μg, between about 100 and 200 μg, between about 200 and 400 μg, between about 300 and 500 μg, between about 10 and 50 μg, or about 15-30 μg or about 20 μg of reelin protein is provided. In some embodiments, the composition is formulated such that between about 10 fmol and 500 pmol is administered to the subject.
[0104] Cardiac Diseases, Conditions, and Injuries
[0105] Provided herein are compositions and methods useful to treat disease, conditions, or injuries of the heart to a subject in need thereof. Subjects suitable for the disclosed methods of treatment may include, but are not limited to, subjects having or at risk for developing disease, conditions or injury that negatively affect the heart. By way of example, but not by way of limitation, in some embodiments, such subjects are suffering from, or at risk of one or more of (1) coronary artery disease; (2) arrhythmia; (3) bradycardia; (4) tachycardia; (5) congenital heart disease or defect; (6) myocardial infarction (heart attack); (7) cardiomyopathy; (8) heart valve disease; (9) pericardial disease; (10) rheumatic heart disease; (11) stroke; (12) heart failure; (13) ischemia/reperfusion injury; (14) trauma; (15) cardiac inflammation; (16) cardiac edema; (17) and endocarditis (bacterial, viral, or fungal).
[0106] In some embodiments, the heart disease, condition or injury result in one or more symptoms, including, but not limited to (1) arrhythmia; (2) tachycardia; (3) bradycardia; (4) chest pain (angina); (5) fainting; (6) swollen feet or ankles; (7) cyanosis; (8) dizziness; (9) decreased cardiac lymphatics; (10) cardiac fluid accumulation and/or cardiac inflammation; (11) decreased systolic function; (12) atherosclerotic plaque formation; (13) delayed cardiac healing process and cardiac repair; (14) adverse cardiac remodeling; (15) shortness of breath; (16) weakness or fatigue.
[0107] In some embodiments, the cardiac disease, condition, or injury includes myocardial infarction.
[0108] Causes of cardiac diseases, conditions, or injuries are not intended to be limiting and can include any one or more of the following: trauma, infections (bacterial, viral, fungal), sensitivity to non-infectious bacteria or toxins, allergies, transplant, cancer, exposure to toxins, genetic predisposition, congenital conditions, lifestyle choices, age.
[0109] Methods of diagnosing cardiac diseases, conditions, and injuries, and method for monitoring improvement in the symptoms of such disease, condition, and injuries (e.g., during and/or after treatment) include but are not limited to echocardiogram, transesophageal echocardiography (TEE), electrocardiogram (ECG or EKG), magnetic resonance imaging (MRI), CT scan, exercise/cardiac stress test, pharmacologic stress test, tilt test, ambulatory rhythm monitoring tests, coronary angiogram, physical examination including blood pressure, heart rate monitor, pulse oximeter, and patient interview.
[0110] Methods
[0111] Disclosed herein are methods of treating a cardiac condition that comprises administering to a patient in need thereof, a pharmaceutical composition comprising a reelin polypeptide, or a fragment or variant thereof. In some embodiments, the subject is diagnosed or is at risk of developing a disease or condition that negatively impacts the heart such as, but not limited to (1) coronary artery disease; (2) arrhythmia; (3) bradycardia; (4) tachycardia; (5) congenital heart disease or defect; (6) myocardial infarction (heart attack); (7) cardiomyopathy; (8) heart valve disease; (9) pericardial disease; (10) rheumatic heart disease; (11) stroke; (12) heart failure; (13) ischemia/reperfusion injury; (14) trauma; (15) cardiac inflammation; (16) cardiac edema; (17) endocarditis (bacterial, viral, or fungal); (18) cancer. In some embodiments, the subject exhibits one or more symptoms, which may include, but are not limited to (1) arrhythmia; (2) tachycardia; (3) bradycardia; (4) chest pain (angina); (5) fainting; (6) swollen feet or ankles; (7) cyanosis; (8) dizziness; (9) decreased cardiac lymphatics; (10) cardiac fluid accumulation and/or cardiac inflammation; (11) decreased systolic function; (12) atherosclerotic plaque formation; (13) delayed cardiac healing process and cardiac repair; (14) adverse cardiac remodeling; (15) shortness of breath; (16) weakness or fatigue.
[0112] In some embodiments, the composition is formulated for systemic delivery, and methods include administration via oral or parenteral delivery. In some embodiments, minimally invasive microneedles and/or iontophoresis may be used to administer the composition. In some embodiments, the composition is formulated for delivery via viral particles.
[0113] In some embodiments, the methods include administration a therapeutic composition comprising a reelin polypeptide, or variant or fragment thereof, to a subject by contacting the subject heart tissue with a collagen patch embedded with the therapeutic composition.
[0114] In some embodiments, the methods include administration of the therapeutic compositions once per day; in some embodiments, the composition may be administered multiple times per day, e.g., at a frequency of one or two times per day, or at a frequency of three or four times per day or more. In some embodiments, the methods include administration of the composition once per week, once per month, or as symptoms dictate. In
[0115] In some embodiments, the composition is administered such between about 0.1 ng and 500 mg/ml of the reelin peptide, or variant thereof reaches the heart of the subject. In some embodiments, the composition is administered such between about 0.1 ng and 500 μg of the reelin peptide, or variant thereof reaches the heart of a subject. In some embodiments, the compositions if formulated such that between about 1 and 100 μg, between about 100 and 200 μg, between about 200 and 400 μg, between about 300 and 500 μg, between about 10 and 50 μg, or about 15-30 μg or about 20 μg of reelin reaches the heart of the subject. In some embodiments, the composition is administered such between about 10 fmol and 500 pmol reaches the heart of the subject.
[0116] In some embodiments, the treatment reduces, alleviates, prevents, or otherwise lessens the symptoms of the disease or condition more quickly than if no treatment is provided to a subject suffering the same or similar disease, condition or injury.
[0117] In some embodiments, improvements in the condition of the subject's heart is observed more quickly than if no treatment is provided for the same or similar condition or disease.
[0118] By way of example, in some embodiments, improvements in the condition of the subject's heart is observed within about 6 hours, within about 12 hours, or within about 24 hours of administration of the composition. In some embodiments, improvements in the condition of the subject's heart is observed within about 1 to about 3 days; within about 3 to about 5 days, or within about a week of the first administration. In some embodiments, improvements in the condition of the subject's heart is observed within about 10 days, about 14 days or within about 1 month of the first administration.
EXAMPLES
[0119] The following examples are illustrative and should not be interpreted to limit the scope of the claimed subject matter.
Example 1. Lymphoangiocrine Signals Promote Cardiac Growth and Repair
Abstract
[0120] Recent studies suggested a beneficial role of lymphatics in restoring heart function after cardiac injury.sup.1-6. The inventors report that in mice lymphatics promote cardiac growth, repair and protection. The inventors show that a lymphoangiocrine signal produced by lymphatic endothelial cells (LECs) controls cardiomyocyte (CM) proliferation and survival during heart development, improves neonatal cardiac regeneration and is cardioprotective after myocardial infarction (MI). Mutant embryos devoid of LECs develop smaller hearts consequence of reduced CM proliferation and increased CM apoptosis. Culturing primary mouse CMs in LEC-conditioned media increases CM proliferation and survival, indicating that LECs produce lymphoangiocrine signals controlling CM homeostasis. Characterization of the LEC secretome identified Reelin as a key player responsible for such function. Moreover, the inventors report that LEC-specific Reln-null embryos also develop smaller hearts, that Reelin is required for efficient heart repair and function following neonatal MI, and that cardiac delivery of REELIN using collagen patches improves adult heart function after MI through a cardioprotective effect. These results identify a novel lymphoangiocrine role of LECs during cardiac development and injury response, and Reelin as an important mediator of this function.
[0121] Results
[0122] The molecular and functional characterization of the lymphatic vasculature has greatly improved.sup.1. Recent data suggest that natural or therapeutic formation of new lymphatics (lymphangiogenesis) correlates with improved systolic function after experimental MI; it delays atherosclerotic plaque formation, facilitates the healing process after MI, and can be a natural response to fluid accumulation into the myocardium during cardiac edema.sup.2,3,4. These new findings argue that stimulation of lymphangiogenesis in the infarcted heart could improve cardiac function and prevent adverse cardiac remodeling.sup.3.
[0123] Studies in mouse and zebrafish suggested that newly formed lymphatics provided a route for the clearance of immune cells in the injured heart, and therefore promote cardiac repair.sup.5,6. However, whether lymphatics have additional functional roles during heart development and cardiac repair is not known.
[0124] Lymphatics Regulate Heart Growth
[0125] As previously reported.sup.2, at around E14.5 cardiac lymphatics become evident, particularly over the dorsal side of the heart (
[0126] Decreased CM Mass Causes Heart Size Reduction
[0127] H&E staining confirmed that the overall size of the ventricles in Prox1.sup.ΔLEC/ΔLEC embryos is smaller; however, cardiac valves appear normal (
[0128] To support these findings, the inventors performed similar analysis using another mouse model without lymphatics. Accordingly, the inventors used Vegfr3.sup.kd/kd, a natural occurring mouse strain with a point mutation in the kinase domain of VEGFR3 that impacts Vegfr3 signaling and therefore, lymphatic development.sup.11. As seen in
[0129] To investigate the molecular basis of this lymphatics-dependent defects, the inventors performed RNA sequencing (RNA-seq) of the ventricular portions of E17.5 control and Prox1.sup.ΔLEC/ΔLEC hearts. Gene set expression analysis (GSEA) revealed that genes and pathways related to cell cycle were greatly reduced; instead, expression of genes and pathways involved in apoptosis were enriched (
[0130] LEC Media Promotes CM Proliferation
[0131] Signaling between blood endothelial cells (BECs) and CMs is important during cardiac growth and repair.sup.12,13. To evaluate whether LECs produce lymphoangiocrine signals promoting CM proliferation and survival, the inventors first cultured human iPSCs-derived CMs (hiPSC-CMs) with LECs-conditioned media obtained from culturing commercially available human dermal LECs. AKT and ERK signaling was then examined since phosphorylated AKT and ERK (p-AKT and p-ERK) are frequently used as readouts of proliferative signaling. As seen in
[0132] Reelin is Required for Heart Growth
[0133] To identify such secreted factor/s the inventors performed mass spectrometry of the LEC conditioned media and identified 317 unique proteins. From that list, the inventors initially focused on all secreted proteins by comparing changes in their expression levels in the RNAseq dataset described above. Among those candidates, Reelin is greatly reduced in Prox1.sup.ΔLEC/ΔLEC hearts (log 2 fold change: −0.6098 compared to control). Indeed, qPCR analysis confirmed about 80% reduction in Reln expression in Prox1.sup.ΔLEC/ΔLEC hearts (
[0134] Importantly, the heart size of E17.5 Reln.sup.−/− embryos.sup.17 was also significantly reduced, but cardiac lymphatics appear normal (
[0135] Reelin Signaling Requires Integrinβ1
[0136] Previous studies about the role of Reelin during neuronal development, neuronal migration and in tumor cells identified VLDLR.sup.15, ApoER2.sup.20,21 and integrinβ1.sup.22,23 as Reelin receptors. Upon its binding to those receptors, Reelin stimulates intracellular signaling transduction through the phosphorylation of the intracellular protein Disabled-1 (Dab1) and the activation of PI3K/AKT/GSK3β.sup.24 and mToR.sup.25 signaling cascades. Integrinβ1 has been shown to play important roles in heart development, as its deletion in embryonic CMs results in smaller hearts with reduced CM proliferation.sup.26. Therefore, the inventors investigated whether LEC-derived Reelin regulates CM proliferation and survival by regulating Integrinβ1 signaling. Western analysis confirmed that LEC conditioned media treated CMs increased the activity of Integrinol and Reelin downstream signals such as FAK, Dab1, AKT and ERK; in contrast, LEC conditioned media from Reln deficient LECs failed to induce Integrinβ1 signaling activity (
[0137] Neonatal Heart Repair Requires Reelin
[0138] At E17.5, Reelin is highly expressed in cardiac lymphatics nearby the epicardium, as well as in the base of the myocardium; however, its expression levels get steadily reduced from P2 to P14, such that at P14 it is barely detected (
[0139] Since this reduction in Reelin expression coincides with the loss of cardiac regenerative potential in mice.sup.27, the inventors first examined Reln role in WT mouse neonatal cardiac regeneration. The inventors performed neonatal MI at P2 and the analysis of P7 pups showed Lyve1-expressing lymphatics in both, the infarcted and the nearby non-infarcted cardiac tissue. Reelin expression was re-activated in the infarcted hearts, with higher levels in the infarcted area and low in the non-infarcted tissue (
[0140] Reelin Improves Adult MI Recovery
[0141] The inventors next assessed whether delivery of Reelin directly into the heart could improve cardiac repair in adult WT mice after MI. The inventors took advantage of well-established bioengineered collagen patches.sup.28,29 as a scaffold to deliver recombinant REELIN protein into the heart. REELIN-containing patches and control patches were surgically sutured onto approximately 2-month old injured hearts immediately following acute MI (
DISCUSSION
[0142] Using mouse embryos devoid of LECs or Reelin-producing LECs, the inventors demonstrate that their hearts are smaller as a consequence of increased CM apoptosis and reduced CM proliferation. The inventors showed that the percentage of CMs is significantly reduced in E17.5 Prox1.sup.ΔLEC/ΔLEC and Reln.sup.ΔLEC/ΔLEC hearts, suggesting that communication between LECs and CMs is required for CM survival during cardiac development. The inventors also found that LEC-conditioned medium increases CM survival and prevents CM apoptosis consequence of hypoxia; a result suggesting potent LEC lymphoangiocrine cardioprotective effects. The inventors identified Reelin as a factor performing such functional role likely via the Integrinβ1 signaling pathway, both in vivo and in vitro. Finally, the inventors provide some additional insight about the proposed beneficial roles of lymphatics on cardiac repair by showing that at least partially, is mediated by Reelin activity. The inventors demonstrate Reelin relevance in the endogenous cardiac regenerative ability by showing that following MI at P2, Reelin expression in LECs is particularly reactivated in the MI area of wild-type mice, and that Reln.sup.−/− mice do not fully regenerate. The inventors found that Reelin is required for CM proliferative activity at P7, although proliferation was not completely abolished in Reln.sup.−/− pups, indicating that other factors contribute to CM proliferation. Cardiomyocytes apoptosis was also increased in Reln.sup.−/− mice during an extended period after MI (up to P21), suggesting that in addition to the reduced proliferation, loss of CM protection underlies the inability of Reln.sup.−/− postnatal hearts to fully regenerate.
[0143] The inventors also demonstrate that exogenously applied Reelin is useful for cardiac repair in the adult heart after MI. Whereas during cardiac growth and in neonatal cardiac regeneration Reelin promotes both, CM proliferation and survival, in the adult heart Reelin beneficial activity on cardiac function seems to be mostly consequence of reduced CM cell death and a smaller scarred myocardial area, both features indicative of a cardioprotective effect.
[0144] Although these results argue that Reelin regulation of Integrin mediated signaling is specifically critical for CM proliferation and survival, it is likely that alternative signals or receptors mask similar effects on other cardiac cell types such as fibroblasts and BECs. Furthermore, it is also likely that Reelin and/or other lymphoangiocrine signals play similar homeostatic roles in other organs.
[0145] In summary, this study highlights the importance of LECs and REELIN during heart growth and repair, and provides some ideas about possible paths to improve cardiac regeneration and cardio-protection in mammals. These results suggest that the use of REELIN could be a valuable therapeutic approach to improve cardiac function in humans.
[0146] Reelin Null Mouse
[0147] The experiments above determined that a) Reelin is required for normal cardiac growth during development b) is required for neonatal heart regeneration as Reelin null hearts fail to properly regenerate c) Reelin improves cardiac function after MI as addition of collagen patches containing Reelin after MI in adult mice improve cardiac repair.
[0148] To further validate and expand those results, particularly those about the role of Reelin in cardiac repair in the adult heart after MI, conditional null Reelin adult mice were generated, where Reelin was specifically removed from lymphatic endothelial cells (LECs) by crossing Reln floxed mice with VE-CadCreERT2 mice. Considering that in endothelial cells, Reln is mainly expressed in LECs, that cross generated LEC-specific Reln conditional null adult mice following tamoxifen injections in 6-8 weeks old mice [VE-CadCreERT2,Reln.sup.f/f(Reln.sup.ΔEC/ΔEC)]. Acute myocardial infarction (MI) was performed then two weeks after tamoxifen injections in Reln.sup.ΔEC/ΔEC and littermate controls. Four weeks later, echocardiography revealed significantly impaired cardiac function (EF %) in Reln.sup.ΔEC/ΔEC mice compared to littermate controls. Masson's trichrome staining also shows increased cardiac fibrotic area in Reln.sup.ΔEC/ΔEC mice 4 weeks post-MI. Quantification of the percentage of fibrotic area is shown in the right panel.*p<0.05 by unpaired student t test.
[0149] Methods
[0150] Mouse Models
[0151] LEC-specific Prox1 deficient mice were generated by crossing Prox1.sup.f/f mice7 with Cad5(PAC)-CreER.sup.T2 mice.sup.10. These mice are maintained in a mixed C57B6 and NMRI background. LEC-specific Reln deficient mice were generated by crossing Reln.sup.f/f mice.sup.18 with Prox1CreER.sup.T2 mice.sup.19. These mice are in a mixed 129, FVB and C57B6 background. Reln.sup.+/− mice were kindly provided by Dr. Bianka Brunne and are originally from the Jackson laboratory and are maintained in a mixed Balb/c and C57B6 background. For induction of Cre mediated recombination in Prox1.sup.ΔLEC/ΔLEC and Reln.sup.ΔLEC/ΔLEC embryos, two consecutive intraperitoneal tamoxifen (TAM) injections of 5 mg/40 g were administered to pregnant dams. IntegrinΔ1.sup.f/f mice and MhcCre mice were obtained from the Jackson laboratory and are in a mixed C57B6 and NMRI background. These strains were bred to generate MhcCre; Integrin β1.sup.f/f mice that were crossed with Reln.sup.+/− mice to obtain MhcCre; Integrinβ1.sup.f/f; Reln.sup.+/− (β1.sup.ΔCM/+; Reln.sup.+/−) embryos. Heterozygous mice carrying the kinase-dead Flt4.sup.Chy allele (Vegfr.sup.3kd) (MRC Harwell) were described previously.sup.30 and are maintained in the NMRI background. Twelve-weeks-6 month old mice of both sexes were used for breeding and experiments. Mice were not randomized into experimental groups, but were age and sex-matched and littermates were used whenever possible. All animal husbandry was performed in accordance with protocols approved by Northwestern University and UT Southwestern Medical Center Institutional Animal Care and Use Committee, as well as Animal Experimentation Review Board of the Semmelweis University. Animal facilities are equipped with a 14:10 or 12:12 light cycle. Temperatures are maintained between 18-23° C. with 40-60% humidity.
[0152] Mouse Embryonic CM Isolation
[0153] CMs were isolated from E15.5-17.5 mouse embryos using the Pierce Primary Cardiomyocyte Isolation Kit (Thermo Fisher). Briefly, ventricles were isolated from embryonic hearts and minced and washed with cold HBSS and further digested according to the manufacture instructions. To examine the relative CM cell size, dissociated cells were cultured in DMEM containing 10% FBS o/n and then cells were fixed in 4% PFA for immunostaining. For any other experiments, primary cells were cultured in DMEM containing 10% FBS and cardiomyocyte growth supplements for 3-4 days before experiments.
[0154] Human iPSC Derived-CMs (hiPSC-CMs)
[0155] Cardiac differentiation was performed using the CDM3 (chemically defined medium, three components) system as described with slight modifications.sup.31,32 hiPSCs are split at 1:15 ratios and grown in B8 medium for 4 days reaching ˜80% confluence. On day 0, B8 medium is changed to CDM3.sup.31, consist ng of RPMI 1640 (Corning, 10-040-CM), 500 μg/ml fatty acid-free bovine serum albumin(GenDEPOT), and 200 μg/ml 1-ascorbic acid 2-phosphate (Wako), supplemented with 6 μM of CHIR99021 (LC Labs, C-6556). After 24 hours (day 1), medium is changed to CDM3. On day 2, medium is changed to CDM3 supplemented with 2 μM of Wnt-C59 (Biobyt, orb181132). Medium is then changed every other day for CDM3 starting on day 4. Contracting cells are noted from day 7. On day 16 of differentiation, CMs are dissociated using DPBS for 20 min at 37° C. followed by 1:200 Liberase TH (Roche) diluted in DPBS for 20 min at 37° C., centrifuged at 300 g for 5 min, and filtered through a 100 μm cell strainer (Flacon). The purity of the differentiated cells was determined by expression of CM cell marker TNNT2 using flow cytometry. Only cell lines that show over 85% are TNNT2+ were used for experiments.
[0156] LEC-Conditioned Medium
[0157] Human dermal LECs were purchased from Lonza and cultured with endothelial basal medium (EBM) complemented with supplement mix (Lonza). Passages 4 or 5 were cultured in 10 cm dishes until confluent, washed with cold PBS three times and then 8 ml of serum free DMEM (without phenol red) with penicillin/streptomycin was added. Cells were then cultured o/n before collecting the conditioned media that was filtered through a 0.22 μm pore membrane (Millipore). Control conditioned media (DMEM) was prepared in the same way but without LECs.
[0158] siRNA Knockdown
[0159] Human LECs were transfected as described previously.sup.33. Briefly, P4 human LECs were transfected with scrambled or Reln siRNA (Santa Cruz) with Lipofectamine 2000 (Invitrogen), according to the manufacture's instruction. After 48 h, cells were washed and replaced with DMEM and further cultured o/n to collect the conditioned media. LECs were collected and qPCR was performed to check transfection efficiency.
[0160] LEC-Conditioned Media Treatment
[0161] To examine the effects of the LECs conditioned media, mouse primary CM or human iPSC-CM were cultured in 12 well plates (about 80% confluence), and cells were treated either with DMEM, conditioned media, conditioned media from scrambled siRNA treated LECs (siCtrl-conditioned), conditioned media from siReln treated LECs (siReln− conditioned) or conditioned media with Integrin 31 blocking antibodies (10 μg/ml, BD Biosciences) o/n. Cells were either fixed in 4% PFA for immunofluorescent staining, or lysed in RIPA buffer for Western blot analysis.
[0162] Reelin Conditioned Media and Treatment
[0163] HEK-293T cells (ATCC) were cultured in DMEM with 10% fetal bovine serum and transfected with the Reelin cDNA construct pCrl, kindly provided by Dr. Gabriella D'Arcangelo using Lipofectamine 2000 (Invitrogen). Control cells were mock transfected in the same way without adding the vector. Twenty-four hours after transfection, the medium was changed to serum free DMEM and Reelin conditioned medium and mock conditioned media (control) were collected two days after the medium change. The conditioned medium was filtered through a 0.22 μm pore membrane. To examine the effects of the Reelin conditioned media, mouse primary CM were starved o/n with DMEM and stimulated for 30 min with Reelin conditioned media (supernatant from transfected cells) or control media (supernatant from mock-transfected cells). To examine the Reelin/Integrinp 1 pathway, primary CM were treated in the presence or absence of Integrin β1 blocking antibodies (10 μg/ml, BD Biosciences) for 3 h prior to Reelin conditioned media treatment.
[0164] Western Blot Analysis
[0165] To examine signaling changes in primary CMs or iPSC-CMs, cells were lysed in RIPA buffer and subject to Western blot analysis. The following primary antibodies were used: p-AKT (Rabbit, Cell Signaling, 4060, 1:500), p-ERK (Rabbit, Cell Signaling, 4370, 1:1,000), total AKT (Rabbit, Cell Signaling, 4691, 1:500), total ERK (Rabbit, Cell Signaling, 4695, 1:500), p-Dab1 (Rabbit, Cell Signaling, 3327S, 1:100), p-FAK (Rabbit, Cell Signaling, 3284 1:200), integrin 31 (Mouse, BD, 610467, 1:100), Gapdh (Rabbit, Santa Cruz, sc32233, 1:5,000). Blots were imaged using a ChemiDock imaging system (Bio-Rad) and bands were acquired using Quantity One 1-D software. Quantification of Western blot was analyzed using ImageJ 1.51. Included images are representative blots. All raw data used for the quantifications is included in the Figures.
[0166] Mass Spectrometry Analysis of LEC Conditioned-Media
[0167] 50 ml of LEC-conditioned was collected from five 10-cm dishes of cultured LECs and filtered through a 22 μm pore membrane as mentioned above. LEC-conditioned media was further concentrated into 500 uls using the Protein-Concentrate Kit (Millipore) according to the manufacture's instruction. Protein concentration was then measured by the BCA protein assay (Thermo Fisher). Experiments were repeated three times and three biological samples were submitted to Northwestern Proteomics Core for untargeted quantitative proteomics analyses by Label-free Quantitative Proteomics: Briefly, samples were analyzed using an UltiMate™ 3000 RSLCnano system (ThemoFisher Scientific, CA) that is coupled with electrospray ionization (ESI) to a linear ion trap (LTQ) Orbitrap mass spectrometer (iLTQ-Orbitrap, ThermoFisher, CA). The resulting raw mass spectra from all three replicates were analyzed by the MaxQuant search engine (version 1.6.0.16) using UniprotKB human database with the allowance of up to 2 missed cleavages and precursor mass tolerance of 20 p.p.m. The secretome was acquired using software Scaffold 4 and annotated using Gene Ontology (GO), which assigns putative cellular compartmentalization, biological process and molecular functions.
[0168] ELISA
[0169] To validate the presence of Reelin in the LECs conditioned media, 3 different batches of commercial LECs were cultured and their conditioned media was collected as described. Sandwich enzyme-linked immunosorbent assay (ELISA) was performed to examine the relative levels of Reelin in the 3 different batches of LECs conditioned media. Briefly, conditioned media were pre-coated to Nunc MaxiSorp™ Flat-Bottom 96-well plates (Invitrogen) o/n and blocked with 5% milk in TBST. Plates were then incubated with Reelin primary antibody (R&D, AF3820, 1:100) and followed by incubation with HRP conjugated Donkey anti-goat antibody (Jackson ImmunoResearch, 705-035-003, 1:1000). Subsequently, plates were washed and the substrate solution (3,3,5,5-tetramethylbenzidine liquid substrate system for ELISA, Abcam) was added. The reaction was stopped by adding 2N H.sub.2SO.sub.4, and plates were measured at 450 nm using the Opsys Mr microplate reader (Dynex Technologies). Relative Reelin levels in different batches of conditioned media were quantified by OD intensity.
[0170] FACS Analyses and Sorting
[0171] For analysis of percentages of CMs in the heart, whole E17.5 ventricles were dissociated from control and Prox1.sup.ΔLEC/ΔLEC hearts using the Pierce Primary Cardiomyocyte Isolation Kit (Thermo Fisher). Cells were fixed and permeabilized using a Permeabilization kit for intracellular staining (eBioscience) following the manufacturer's instruction. Cells were then incubated with Cy3-conjugated mouse anti-cardiac Troponin C antibody (Abcam, ab45931, 1:100) and Hoechst 33342 (Invitrogen, 1:1000) at room temperature for 1 h. Cells were washed and percentage of cTnC+ CMs was determined after 20,000 total cell counts by flow cytometry. Percentage of polyploidy CMs was determined by Hoechst 33342 intensity. Flow data was collected using the flow software BD FACS Diva 8.0.3 and analyzed by FlowJo v10.
[0172] For analysis of the purity of differentiated hiPSC-CM, dissociated CMs were fixed with 4% PFA and permeabilized using 0.5% saponin. Cells were then incubated with 647-conjugated mouse anti-cardiac TNNT2 antibody (BD Biosciences, clone 13-11, 1:200) for 1 h. Cells were washed and percentage of TNNT2+CM was determined after 10,000 total cell counts by flow cytometry.
[0173] Neonate Myocardial Infarction
[0174] Neonatal myocardial infarction was performed in P2 pups. Briefly, P2 pups were anaesthetized under isoflurane anesthesia (1-2%). Once pups did not respond to toe pinch, they were moved to a cold platform to undergo hypothermia anesthesia. Each neonate undergoes acute myocardial infarction by ligation of the left anterior descending coronary artery. Thoracic wall incisions were sutured and the wound closed using skin adhesive. Pups were warmed on a warm pad. After confirmation of spontaneous movement pups received a dose of subcutaneous buprenorphine (0.05 mg/kg). Once neonate recovered from hypothermia, they are moved back to its fostering mother's cage.
[0175] Compressed Collagen Patches
[0176] Compressed acellular collagen patches were prepared as described previously. Briefly, control collagen patches were prepared by adding 1.1 ml DMEM to 0.9 ml of sterile rat tail type I collagen solution in acetic acid (3.84 mg/ml, Millipore) and neutralized with 0.1 M NaOH (˜50 μl). REELIN collagen patches were prepared by adding 20 μg of recombinant human REELIN protein (R&D) into the collagen mix. Then, 0.9 ml of the collagen solution was added into one well of 24-well plates and placed into a tissue culture incubator for 30 min at 37° C. for polymerization. Polymerized collagen gel was then compressed by application of a static compressive stress of ˜1,400 Pa for 5 min as described.sup.28. Each collagen patch was then trimmed to 3 even pieces for application in vivo.
[0177] Myocardial Infarction and Insertion of Collagen Patches in Adult Mice
[0178] Nine-11 week-old NMRI female mice were anaesthetized using an isoflurane inhalational chamber, endotracheally intubated using a 22-gauge angiocatheter and connected to a small animal volume-control ventilator (Harvard Apparatus, Holliston, MA). All mice underwent acute myocardial infarction by ligation of the left anterior descending coronary artery and ligation was considered successful when the LV wall turned pale. Immediately after ligation, prepared collagen patches (with and without REELIN) were sutured (at two points) onto the surface of the ischaemic myocardium (
[0179] Echocardiography
[0180] Two-dimensional echocardiograms were measured on a 55 MHz probe using Vevo 3100 micro-ultrasound imaging system (VisualSonics), short axis views of the left ventricles were taken at the level of papillary muscles and used to calculate end-diastolic and—systolic dimensions using Vevo LAB 3.2.6 software (VisualSonics). All echocardiography measurements were performed in a blinded manner.
[0181] Histology, Immunohistochemistry and Immunofluorescent Staining
[0182] For H&E staining, samples were embedded in paraffin and sectioned longitudinally at 6 um thickness and staining was performed according to standard protocols.
[0183] For whole mount heart staining, isolated hearts were fixed in 4% PFA o/n and blocked. Antibodies were used as followed: Lyve1 (Goat, R&D, AF2125, 1:200), Endomucin (Rat, Invitrogen, 14-5851-82, 1:500), Reelin (Goat, R&D, AF3820, 1:50), Prox1 (Goat, R&D, AF2727, 1:100) and Cy3-conjugated α-SMA (Mouse, Sigma, C6198, 1:300). Cy3-conjugated donkey anti-goat (Jackson ImmunoResearch, 705-165-147, 1:300) and Cy5-conjugated donkey anti-rat (Jackson ImmunoResearch, 712-175-150, 1:300) were used for immunofluorescent staining.
[0184] For cryosections, embryos or isolated hearts were fixed in 4% PFA o/n and dehydrated in 30% sucrose. Samples were embedded in OCT compound and frontal sectioned at 10-um thickness to show four chambers. Primary antibodies were used as follows: α-Actinin (Mouse, Sigma, A7811, 1:500), cardiac Troponin C (Mouse, Abcam ab8295, 1:1000), Ki67 (Rabbit, Invitrogen, SP6, MA5-14520, 1:200), active Caspase-3 (Rabbit, BD Pharmingen, C92-605, 559565, 1:200), Lyve1 (Goat, R&D, AF2125, 1:200), Reelin (Goat, R&D, AF3820, 1:50), Lyve1 (Rabbit, AngioBio, 11-034, 1:500), Prox1 (Rabbit, AngioBio, 11002, 1:500), Prox1 (Goat, R&D, AF2727, 1:100) and Mef2c (Rabbit, LSBio, LSC356188, 1:1000). Secondary antibodies were used as follows: Alexa 488-conjugated donkey anti-rabbit (Invitrogen, A21206, 1:300); Alexa 488-conjugated donkey anti-goat (Invitrogen, A11055, 1:300); Cy3-conjugated donkey anti-rabbit (Jackson ImmunoResearch, 711-165-152, 1:300); Alexa 488-conjugated donkey antimouse (Invitrogen, A21202, 1:300); Cy3-conjugated donkey anti-goat (Jackson ImmunoResearch, 705-165-147, 1:300) and Cy5-conjugated donkey anti-goat (Jackson ImmunoResearch, 705-495-147, 1:300).
[0185] For cell staining, cells were fixed in 4% PFA for 30 min on ice, blocked, and incubated with primary antibody against α-Actinin (Mouse, Sigma, A7811, 1:500), cardiac Troponin C (Mouse, Abcam, ab8295, 1:1000), Ki67 (Rabbit, Invitrogen, SP6, MA5-14520, 1:200), Prox1 (Goat, R&D, AF2727, 1:100) and active Caspase-3 (Rabbit, BD Pharmingen, C92-605, 559565, 1:200). Secondary antibodies were used as follows: Alexa 488-conjugated donkey anti-mouse (Invitrogen, A21202, 1:300) and Cy3-conjugated donkey anti-rabbit (Jackson ImmunoResearch, 711-165-152, 1:300). At least 3 heart samples per genotype were used for whole mount staining and 3 sections per heart per staining for immunohistochemistry and immunofluorescent staining, respectively. Cell staining was repeated at least 3 times.
[0186] For Masson's Trichrome staining, mouse hearts were harvested and fixed in 4% PFA and embedded. Paraffin sections were cut from apex to base into serial sections at 0.8 μm thickness. Masson's trichrome staining was performed according to standard procedures (Sigma) and used for detection of fibrosis. Scar size was quantified using NIH ImageJ 1.51 software and the percentage of the fibrosis area was calculated relative to left ventricle area.
[0187] EdU Administration
[0188] To examine the EdU incorporation in Prox1.sup.ΔLEC/ΔLEC, Vegfr3.sup.kd/kd, β1.sup.ΔCM/+; Reln.sup.+/− or Prox1.sup.ΔLEC/ΔLEC strains, 5-ethynyl-2′-deoxyuridine (EdU, 3 mg/mouse) was administered into pregnant females by intraperitoneal injections. 2 h after injections, mice were euthanized and hearts, livers and kidney collected and cryosectioned as described above. To examine EdU incorporation in control or REELIN patched treated mice after MI, EdU (3 mg/mouse) was injected intraperitoneally for 3 days starting 4 days after MI. Hearts were collected at day 7 and subjected to EdU immunohistochemistry using Click-iT® EdU Alexa Fluor® 488 Imaging Kit (Life Technologies) according to the manufacture's instruction.
[0189] Quantitative Reverse Transcription PCR (qRT-PCR)
[0190] Total RNAs was extracted using RNeasy Mini Kit (Qiagen). cDNA was generated (Clontech Laboratories) and 20 ng used for qRT-PCR using Power SYBR Green PCR Master Mix (Life Technologies) on a StepOnePlus Real-Time PCR system (Applied Biosystems). At least three individual samples per group were performed for each run of qPCR. Primer sequences used in this study are listed below.
TABLE-US-00004 For mouse qPCR: Bcl2l11: (SEQ ID NO: 3) GAGATACGGATTGCACAGGA, (SEQ ID NO: 4) ATTTGAGGGTGGTCTTCAGC; P21 (SEQ ID NO: 5) GAAAGAAGCGGAAGATCCTCC, (SEQ ID NO: 6) GGGCCTCAGGGATTGTTTGG; Pdcd4 (SEQ ID NO: 7) GAAATTGGATTTCCGCATCT, (SEQ ID NO: 8) TAACCGCTTCACTTCCATT; Stat1: (SEQ ID NO: 9) AGGGGCCATCACATTCACAT, (SEQ ID NO: 10) AGATACTTCAGGGGATTCTC; Trp53ip1: (SEQ ID NO: 11) TCCTCAGCAGAGCACACTTC, (SEQ ID NO: 12) TCCATTGGACAGGACTCAAA; Cdc6: (SEQ ID NO: 13) AGGGTGACTTTGAGCCAAGA, (SEQ ID NO: 14) ATGAAGATTCTGGGGGCTCT; E2f1: (SEQ ID NO: 15) TGCAGAAACGGCGCATCTAT, (SEQ ID NO: 16) CCGCTTACCAATCCCCACC; Pcna: (SEQ ID NO: 17) TTGCACGTATATGCCGAGACC, (SEQ ID NO: 18) GGTGAACAGGCTCATTCA TCTCT; Mcm5: (SEQ ID NO: 19) GGAGGCTATTGTGCGCATTG, (SEQ ID NO: 20) CTGGTCCTCCTGGGTAGTGA; Ccne2: (SEQ ID NO: 21) TCTGTGCATTCTAGCCATCG, (SEQ ID NO: 22) ACAAAAGGCACCATCCAGTC; Reelin: (SEQ ID NO: 23) GGACTAAGAATGCTTATTTCC, (SEQ ID NO: 24) GGAAGTAGAATTCATCCATCAG; Rlp32: (SEQ ID NO: 25) GCCTCTGGTGAAGCCCAAG, (SEQ ID NO: 26) TTGTTGCTCCCATAACCGATGT, For human qPCR: (SEQ ID NO: 27) Reelin: CAATCTGAATGGCGAAACC, (SEQ ID NO: 28) CTTTCGCTATAAATCGGAGAGAGA; Gapdh: (SEQ ID NO: 29) TGACCACAGTCCATGCCATC, (SEQ ID NO: 30) GACGGACACATTGGGGGTAG; MMRN1: (SEQ ID NO: 31) TTGGATTGGAGGTGCTGTC, (SEQ ID NO: 32) GCCTGGTTGGTGTGTATCA; THBS1: (SEQ ID NO: 33) CACCAACCGCATTCCAGAG, (SEQ ID NO: 34) TCAGGGATGCCAGAAGGAG; HSPG2: (SEQ ID NO: 35) CTCCATCGTCATCTCCGTCT, (SEQ ID NO: 36) GTCTGCCCTTCTGCCACTC; FN1: (SEQ ID NO: 37) CCATCGCAAACCGCTGCCAT; (SEQ ID NO: 38) AACACTTCTCAGCTATGGGCTT; FSTL1: (SEQ ID NO: 39) CGATGGACACTGCAAAGAGA, (SEQ ID NO: 40) CCAGCCATCTGGAATGATCT; LAMA4: (SEQ ID NO: 41) GCGGCCGAGAAATGCA, (SEQ ID NO: 42) AGTCGCAGGGCACACATTC; SERPINE1: (SEQ ID NO: 43) ACAAGTTCAACTATACTGAGTTCACCACGCCC, (SEQ ID NO: 44) TGAAACTGTCTGAACATGTCGGTCATTCCC.
[0191] All sequences are included forward and reversed and are annotated from 5′ to 3.
[0192] RNAseq
[0193] Total RNA was extracted using the RNeasy Mini Kit (Qiagen) according to the manufacturer's instructions. Extracted total RNAs were quantitated by NanoDrop and RNA integrity number value measured with an Agilent Bioanalyzer. In all RNAseq samples, quality control was performed using the 2100 Bioanalyzer (Agilent). RNA library was prepared using the TruSeq mRNA-Seq Library Prep and sequenced using the HiSEQ Next-generation Sequencing System at the NUSeq Core.
[0194] Imaging Acquisition and Quantification
[0195] Confocal images in
[0196] Statistical Analysis
[0197] No statistical analysis was used to predetermine sample size. Statistical analysis was performed using GraphPad Prism 7 and Microsoft Excel 2016. Differences between two groups were determined by two-tailed unpaired t-test, and differences between multiple groups were calculated using one-way ANOVA or two-way ANOVA. Differences with p<0.05 (*), p<0.01 (**), and p<0.001 (***) were considered statistically significant.
[0198] RNAseq raw data have been deposited to the Gene Expression Omnibus (GEO) repository with accession number GSE158504.
REFERENCES
[0199] 1. Oliver, G., Kipnis, J., Randolph, G. J. & Harvey, N. L. The Lymphatic Vasculature in the 21st Century: Novel Functional Roles in Homeostasis and Disease. Cell 182, 270-296 (2020). [0200] 2. Klotz, L. et al. Cardiac lymphatics are heterogeneous in origin and respond to injury. Nature 522, 62-7 (2015). [0201] 3. Vuorio, T., Tirronen, A. & Yla-Herttuala, S. Cardiac Lymphatics—A New Avenue for Therapeutics? Trends in Endocrinology and Metabolism 28, 285-296 (2017). [0202] 4. Henri, O. et al. Selective Stimulation of Cardiac Lymphangiogenesis Reduces Myocardial Edema and Fibrosis Leading to Improved Cardiac Function Following Myocardial Infarction. Circulation 133, 1484-97; discussion 1497 (2016). [0203] 5. Vieira, J. M. et al. The cardiac lymphatic system stimulates resolution of inflammation following myocardial infarction. J. Clin. Invest 128, 3402-3412 (2018). [0204] 6. Harrison, M. R. et al. Late developing cardiac lymphatic vasculature supports adult zebrafish heart function and regeneration. Elife 8, pii: e42762 (2019). [0205] 7. Harvey, N. L. et al. Lymphatic vascular defects promoted by Prox1 haploinsufficiency cause adult-onset obesity. Nat. Genet. 37, 1072-1081 (2005). [0206] 8. Wigle, J. T. & Oliver, G. Prox1 function is required for the development of the murine lymphatic system. Cell 98, 769-778 (1999). [0207] 9. Johnson, N. C. et al. Lymphatic endothelial cell identity is reversible and its maintenance requires Prox1 activity. Genes Dev 22, 3282-3291 (2008). [0208] 10. Sorensen, I., Adams, R. H. & Gossler, A. DLL1-mediated Notch activation regulates endothelial identity in mouse fetal arteries. Blood 113, 5680-8 (2009). [0209] 11. Zhang, L. et al. VEGFR-3 ligand-binding and kinase activity are required for lymphangiogenesis but not for angiogenesis. Cell Res. 20, 1319-1331 (2010). [0210] 12. Ross, O. N., Moore, C. M., Suggett, D. J., Macintyre, H. L. & Geider, R. J. Endothelial-Cardiomyocyte Interactions in Cardiac Development and Repair. Annu. Rev Physiol 68:1-736, 1835-1852 (2006). [0211] 13. Brutsaert, D. L. & Cotran, R. S. Cardiac endothelial-myocardial signaling: its role in cardiac growth, contractile performance, and rhythmicity. Physiol. Rev. 83, 59-115 (2003). [0212] 14. Jossin, Y. Neuronal Migration and the Role of Reelin During Early Development of the Cerebral Cortex. Mol. Neurobiol. 30, 225-252 (2004). [0213] 15. D'Arcangelo, G. Reelin in the Years: Controlling Neuronal Migration and Maturation in the Mammalian Brain. Adv. Neurosci. 2014, 1-19 (2014). [0214] 16. Lutter, S., Xie, S., Tatin, F. & Makinen, T. Smooth muscle-endothelial cell communication activates Reelin signaling and regulates lymphatic vessel formation. J. Cell Biol. 197, 837-849 (2012). [0215] 17. D'Arcangelo, G. et al. A protein related to extracellular matrix proteins deleted in the mouse mutant reeler. Nature 374, 719-723 (1995). [0216] 18. Lane-Donovan, C. et al. Reelin protects against amyloid R toxicity in vivo. Sci. Signal. 8, ra67-ra67 (2015). [0217] 19. Srinivasan, R. S. et al. Lineage tracing demonstrates the venous origin of the mammalian lymphatic vasculature. Genes and Development 21, 2422-2432 (2007). [0218] 20. Trommsdorff, M. et al. Reeler/Disabled-like disruption of neuronal migration in knockout mice lacking the VLDL receptor and ApoE receptor 2. Cell 97, 689-701 (1999). [0219] 21. Hiesberger, T. et al. Direct binding of Reelin to VLDL receptor and ApoE receptor 2 induces tyrosine phosphorylation of disabled-1 and modulates tau phosphorylation. Neuron 24, 481-9 (1999). [0220] 22. Lin, L. et al. Reelin promotes the adhesion and drug resistance of multiple myeloma cells via integrin β1 signaling and STAT3 Oncotarget 7, (2016). [0221] 23. Dulabon, L. et al. Reelin binds alpha3beta1 integrin and inhibits neuronal migration. Neuron 27, 33-44 (2000). [0222] 24. Beffert, U. et al. Reelin-mediated Signaling Locally Regulates Protein Kinase B/Akt and Glycogen Synthase Kinase 30. J. Biol. Chem. 277, 49958-49964 (2002). [0223] 25. Jossin, Y. & Goffinet, A. M. Reelin signals through phosphatidylinositol 3-kinase and Akt to control cortical development and through mTor to regulate dendritic growth. Mol. Cell. Biol. 27, 7113-24 (2007). [0224] 26. Ieda, M. et al. Cardiac fibroblasts regulate myocardial proliferation through beta1 integrin signaling. Dev. Cell 16, 233-44 (2009). [0225] 27. Porrello, E. R. et al. Transient Regenerative Potential of the Neonatal Mouse Heart. Science 331, 1078-1080 (2011). [0226] 28. Wei, K. et al. Epicardial FSTL1 reconstitution regenerates the adult mammalian heart. Nature 525, 479-485 (2015). [0227] 29. Serpooshan, V. et al. The effect of bioengineered acellular collagen patch on cardiac remodeling and ventricular function post myocardial infarction. Biomaterials 34, 9048-9055 (2013). [0228] 30. Karkkainen, M. J. et al. A model for gene therapy of human hereditary lymphedema. Proc. Natl. Acad. Sci 98, 12677-82. (2001). [0229] 31. Burridge, P. W. et al. Chemically defined generation of human cardiomyocytes. Nat. Methods 11, 855-860 (2014). [0230] 32. Burridge, P. W., Holmström, A. & Wu, J. C. Chemically Defined Culture and Cardiomyocyte Differentiation of Human Pluripotent Stem Cells. in Current Protocols in Human Genetics 87, 21.3.1-21.3.15 (John Wiley & Sons, Inc., 2015). [0231] 33. Liu, X. et al. Rasip1 controls lymphatic vessel lumen maintenance by regulating endothelial cell junctions. Development 145, dev165092 (2018).
[0232] It will be readily apparent to one skilled in the art that varying substitutions and modifications may be made to the invention disclosed herein without departing from the scope and spirit of the invention. The invention illustratively described herein suitably may be practiced in the absence of any element or elements, limitation or limitations which is not specifically disclosed herein. The terms and expressions which have been employed are used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention. Thus, it should be understood that although the present invention has been illustrated by specific embodiments and optional features, modification and/or variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention.
[0233] Citations to a number of patent and non-patent references may be made herein. Any cited references are incorporated by reference herein in their entireties. In the event that there is an inconsistency between a definition of a term in the specification as compared to a definition of the term in a cited reference, the term should be interpreted based on the definition in the specification.