METHODS FOR OBTAINING AND USING PLANTS AND PLANT PARTS WITH INCREASED NUTRIENT, OIL, AND/OR PROTEIN CONTENT

20220015370 · 2022-01-20

    Inventors

    Cpc classification

    International classification

    Abstract

    Methods for identifying Methylobacterium strains which can be used to increase mineral nutrient, vitamins, oil and/or protein content in plants are provided. Also provided are related methods of providing seed lots, food ingredients, feed ingredients, food, or feed with increased mineral nutrient, vitamins, oil and/or protein content. Methods of providing increased mineral nutrient and/or vitamin content, and/or increased oil and/or protein yield from plant seed lots are also provided.

    Claims

    1. A method for identifying a Methylobacterium strain that increases mineral nutrient, crude fat, seed oil, and/or protein content comprising: (i) treating a seed and/or a plant with at least a first Methylobacterium strain to obtain a treated seed and/or a treated plant; (ii) harvesting progeny seed from a mature treated plant, wherein the mature treated plant is grown from the treated seed or treated plant of step (i); (iii) harvesting progeny seed from a mature control plant wherein the mature control plant was grown from an untreated control seed or untreated control plant; (iv) determining mineral nutrient, oil and/or protein content in the progeny seed from the mature treated plant and from the mature control plant; and, (v) selecting a Methylobacterium strain that increases mineral nutrient, crude fat, seed oil, and/or protein content of the progeny seed from the mature treated plant in comparison to the mineral nutrient, crude fat, seed oil, and/or protein content from the progeny seed from the mature control plant.

    2. The method of claim 1, wherein additional seed and/or plants are separately treated with a second Methylobacterium strain in step (i), seed are separately harvested from mature treated plants in step (ii), oil and/or protein content are separately determined in the seed harvested from mature plants obtained from the first and second Methylobacterium strain treatments, and the Methylobacterium strain that increases crude fat, seed oil, and/or protein content in comparison to the other Methylobacterium strain and to the control plant is selected.

    3. The method of claim 1 or 2, wherein the mature control plant is grown from a seed or a plant treated with a reference Methylobacterium strain.

    4. The method of claim 3, wherein the reference Methylobacterium strain comprises Methylobacterium strain ISO10 (NRRL B-50938).

    5. The method of claim 1, wherein the selected Methylobacterium strain is not ISO10 (NRRL B-50938), ISO20 (NRRL B-67743), ISO19 (NRRL B-67742), or ISO18 (NRRL B-67741).

    6. The method of any one of claims 1, 2, or 5, wherein a Methylobacterium strain that increases seed oil content is obtained by selecting a Methylobacterium strain that increases seed oil content in comparison to the seed oil content from the control plant.

    7. The method of any one of claims 1, 2, or 5, wherein a Methylobacterium strain that increases seed protein content is obtained by selecting a Methylobacterium strain that increases seed protein content in comparison to the seed protein content from the control plant.

    8. A method of identifying a Methylobacterium strain that increases crude fat, seed oil, and/or protein content comprising: (i) treating a first seed or plant part with at least a first Methylobacterium strain and a second seed or plant part with a second Methylobacterium strain, (ii) planting a control seed or plant part, the first seed or plant part, and the second seed or plant part, wherein the control seed or plant part is not treated with the first Methylobacterium strain or the second Methylobacterium strain; (iii) harvesting one or more progeny seed from a plant grown from the first seed or plant part, from the plant grown from the second seed or plant part, and from the plant grown from the control seed or plant part; (iv) analyzing the progeny seed harvested from the plant grown from the first seed or plant part, from the plant grown from the second seed or plant part, and from the plant grown from the control seed or plant part for oil and/or protein content; and (v) selecting the Methylobacterium strain that provides progeny seed with the greatest increases in oil and/or protein content in comparison to progeny seed from the plant grown from the control seed, wherein the Methylobacterium strain is either the first Methylobacterium strain or the second Methylobacterium strain.

    9. The method of any one of claims 1, 2, 5, or 8, wherein the crude fat or oil content in the seed is determined.

    10. The method of claim 9, wherein the oil content in the seed is determined by a method comprising nuclear magnetic resonance (NMR), near infrared spectroscopy (NIRS), gas-chromatography-mass spectroscopy (GC-MS), gas-chromatography-flame ionization detection (GC-FID), thin layer chromatography-flame ionization detection, liquid chromatography (LC)-mass spectroscopy (MS), liquid chromatography (LC)-electrospray ionization (EI)-mass spectroscopy (MS), or liquid chromatography (LC)-electrospray ionization (EI)-tandem mass spectroscopy (MS).

    11. The method of any one of claims 1, 2, 5, or 8, wherein the protein content in the seed is determined.

    12. The method of claim 11, wherein the protein content in the seed is determined by a method comprising nuclear magnetic resonance (NMR), near infrared spectroscopy (NIRS), a colorimetric assay, liquid chromatography (LC)-mass spectroscopy (MS), or matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF)

    13. The method of claim 11, wherein the protein content in the seed is determined by determining nitrogen content of the seed.

    14. A method of producing a food or feed ingredient with increased mineral nutrient, crude fat, oil, and/or protein content comprising dehulling, delinting, crushing, macerating, grinding, and/or extracting a seed lot wherein at least 50%, 70%, 80%, 90%, or 95% of the seeds in the seed lot were harvested from mature plants grown from seeds and/or plants treated with an effective amount of a Methylobacterium strain, thereby obtaining a food or feed ingredient with increased mineral nutrient, oil and/or protein content.

    15. The method of claim 14, wherein the oil content of the food or feed ingredient is increased in comparison to the oil content in a control food or feed ingredient from a control seed lot harvested from mature control plants.

    16. The method of claim 14, wherein the oil content is increased by at least about 0.5% per gram dry or wet weight of the food or feed ingredient in comparison to oil content of a control food or feed ingredient.

    17. The method of claim 16, wherein oil content is increased by about 0.5% or 1% to about 3%, 4%, 5%, 6%, or 7% per gram dry or wet weight of the food or feed ingredient in comparison to oil content of a control food or feed ingredient.

    18. The method of claim 14, wherein protein content is increased by at least about 0.5% per gram dry or wet weight of the food or feed ingredient in comparison to protein content of a control food or feed ingredient.

    19. The method of claim 18, wherein protein content is increased by about 0.5% to about 1%, 2%, 3%, 4%, or 5% per gram dry or wet weight of the food or feed ingredient in comparison to protein content of a control food or feed ingredient.

    20. The method of any one of claims 14 to 19, further comprising packaging and/or labelling the food or feed ingredient in a container.

    21. The method of claim 20, wherein less than 5% of the food or feed ingredient in the container comprises food or feed ingredient obtained from seed that were not treated with an effective amount of a Methylobacterium strain.

    22. The method of claim 20, further comprising providing the packaged and/or labelled food or feed ingredient to a food or feed manufacturer.

    23. The method of any one of claims 14 to 19, further comprising the step of combining the feed ingredient comprising the crushed, macerated, ground, and/or extracted seed lot with one or more other ingredients to produce animal or fish feed.

    24. The method of claim 23, wherein the animal feed is a poultry, hog, dairy cow, or cattle feed.

    25. A method of producing a food or feed with increased mineral nutrient, crude fat, oil, and/or protein content comprising incorporating into the food or feed a processed or unprocessed food ingredient obtained from a seed lot wherein at least 50%, 70%, 80%, 90%, or 95% of the seeds in the seed lot were harvested from mature plants grown from seeds and/or plants treated with an effective amount of a Methylobacterium strain, thereby obtaining a food or feed with increased mineral nutrient, oil and/or protein content.

    26. The method of claim 25, wherein the unprocessed food ingredient comprises whole seed of the seed lot.

    27. The method of claim 25, wherein the processed food ingredient comprises delinted, crushed, ground, macerated, and/or extracted seed of the seed lot.

    28. The method of claim 25, wherein the oil content of the food or feed ingredient is increased in comparison to the oil content in a control food or feed ingredient from a control seed lot harvested from mature control plants.

    29. The method of claim 25, wherein the oil content is increased by at least about 0.5% per gram dry weight or wet of the food or feed ingredient in comparison to oil content of a control food or feed ingredient.

    30. The method of claim 29, wherein oil content is increased by about 0.5% or 1% to about 3%, 4%, 5%, 6%, or 7% per gram dry or wet weight of the food or feed ingredient in comparison to oil content of a control food or feed ingredient.

    31. The method of claim 25, wherein protein content is increased by at least about 0.5% per gram dry or wet weight of the food or feed in comparison to protein content of a control food or feed.

    32. The method of claim 31 wherein protein content is increased by about 0.5% to about 1%, 2%, 3%, 4%, or 5% per gram dry or wet weight of the food or feed in comparison to protein content of a control food or feed.

    33. The method of any one of claims 25 to 32, further comprising packaging and/or labelling the food or feed in a container.

    34. A method of improving seed oil yield from a seed lot comprising separating an oil-enriched fraction from a seed lot wherein at least 50%, 70%, 80%, 90%, or 95% of the seeds in the seed lot were harvested from mature plants grown from seeds and/or plants treated with an effective amount of a Methylobacterium strain.

    35. The method of claim 34, wherein the amount of oil in the fraction is increased in comparison to the amount of oil in a control fraction separated from a control seed lot harvested from mature control plants.

    36. The method of claim 34, wherein the mature control plants comprise plants that were grown from seeds and/or plants that were not treated with Methylobacterium.

    37. The method of claim 34, wherein the mature control plants comprise plants that were grown from seeds and/or plants that were treated with a reference Methylobacterium.

    38. The method of claim 34, wherein seed oil yield is increased by at least about 0.5% mass or weight of oil per kilogram seed in comparison to seed oil yield per kilogram control seed.

    39. The method of claim 34, wherein seed oil yield is increased by about 0.5% or 1% to about 3%, 4%, 5%, 6%, or 7% mass or weight of oil per kilogram seed in comparison to seed oil yield per kilogram control seed.

    40. The method of claim 34, wherein the seed protein yield in said seed lot is increased or is not reduced in comparison to the seed protein from a control seed lot.

    41. The method of claim 34, wherein the reference Methylobacterium strain comprises Methylobacterium strain ISO10 (NRRL B-50938), ISO20 (NRRL B-67743), ISO19 (NRRL B-67742), or ISO18 (NRRL B-67741).

    42. A method of improving seed protein yield from a seed lot comprising: (i) obtaining a seed lot wherein at least 50%, 70%, 80%, 90%, or 95% of the seed in the seed lot were harvested from mature plants grown from seeds and/or plants treated with an effective amount of a Methylobacterium strain; and (ii) separating a protein-enriched fraction from the seed lot.

    43. A method of improving seed protein yield from a seed lot comprising separating a protein-enriched fraction from a seed lot wherein at least 50%, 70%, 80%, 90%, or 95% of the seed in the seed lot were harvested from mature plants grown from seeds and/or plants treated with an effective amount of a Methylobacterium strain.

    44. The method of claim 42 or 43, wherein the amount of protein in the fraction is increased in comparison to the amount of protein in a control fraction separated from a control seed lot harvested from mature control plants.

    45. The method of claim 44, wherein the mature control plants comprise plants that were grown from seeds and/or plants that were not treated with Methylobacterium.

    46. The method of claim 44, wherein the mature control plants comprise plants that were grown from seeds and/or plants that were treated with a reference Methylobacterium.

    47. The method of claim 46, wherein the reference Methylobacterium strain comprises Methylobacterium strain ISO10 (NRRL B-50938).

    48. The method of claim 42 or 43, wherein seed protein yield is increased by at least about 0.5% mass or weight per kilogram seed in comparison to seed protein yield per kilogram control seed.

    49. The method of claim 48, wherein seed protein yield is increased by about 0.5% to about 1%, 2%, 3%, 4%, or 5% mass or weight of protein per kilogram seed in comparison to seed protein yield per kilogram control seed.

    50. A method of providing a seed lot with increased mineral nutrient, crude fat, oil, and/or protein content comprising harvesting a seed lot from mature plants grown from seeds and/or plants treated with an effective amount of a Methylobacterium strain, wherein at least 95% of the seeds in the harvested seed lot are obtained from the mature plants, wherein the harvested seed lot is packaged, contained or otherwise segregated from seed obtained from untreated plants.

    51. The method of claim 50, further comprising the step of analyzing the oil and/or protein content of the seed.

    52. The method of claim 50, further comprising providing the packaged, contained or otherwise segregated seed lot to a food or feed ingredient manufacturer.

    53. The method of claim 50, further comprising dehulling, delinting, crushing, macerating, grinding and/or extracting the harvested seed lot to produce a feed ingredient.

    54. The method of claim 50, wherein at least 50%, 70%, 80%, 90%, or 95% of the seed in the seed lot comprise the packaged, contained or otherwise segregated seed lot.

    55. The method of claim 50, further comprising the step of combining the feed ingredient comprising the delinted, crushed, macerated, ground, and/or extracted seed lot with one or more other ingredients to produce animal or fish feed.

    56. The method of claim 50, further comprising the step of combining whole seed of the seed lot with one or more other ingredients to produce animal feed.

    57. The method of claim 55 or 56, wherein the animal feed is a poultry, hog, dairy cow, or cattle feed.

    58. The method of any one of claims 1, 8, 14, 25, 34, 42, 43, or 50, wherein the seed, seed lot, plant part, or plant is a dicot plant seed, dicot plant seed lot, dicot plant part, or dicot plant.

    59. The method of claim 58, wherein the dicot plant seed, dicot plant seed lot, dicot plant part, or dicot plant is a soybean, Brassica sp., sunflower, cotton, flax, or peanut seed, seed lot, plant part, or plant.

    60. The method of claim 59, wherein the Brassica sp. seed, seed lot, plant part, or plant is a canola seed, seed lot, plant part, or plant.

    61. The method of claim 8, wherein the selected Methylobacterium strain is not ISO10 (NRRL B-50938).

    62. The method of any one of claims 14, 25, 34, 42, 43, or 50, wherein the crude fat or oil content of the seed lot, the food ingredient, or the feed ingredient is determined.

    63. The method of claim 62, wherein the oil content in the seed lot, feed ingredient, or food ingredient is determined by a method comprising nuclear magnetic resonance (NMR), near infrared spectroscopy (NIRS), gas-chromatography-mass spectroscopy (GC-MS), gas-chromatography-flame ionization detection (GC-FID), thin layer chromatography-flame ionization detection, liquid chromatography (LC)-mass spectroscopy (MS), liquid chromatography (LC)-electrospray ionization (EI)-mass spectroscopy (MS), or liquid chromatography (LC)-electrospray ionization (EI)-tandem mass spectroscopy (MS).

    64. The method of any one of claims 14, 25, 34, 42, 43, or 50, wherein the protein content in the seed lot, feed ingredient, or food ingredient is determined

    65. The method of claim 64, wherein the protein content in the seed lot, feed ingredient, or food ingredient is determined by a method comprising nuclear magnetic resonance (NMR), near infrared spectroscopy (NIRS), a colorimetric assay, liquid chromatography (LC)-mass spectroscopy (MS), or matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF).

    66. The method of claim 64, wherein the protein content in the seed lot, feed ingredient, or food ingredient is determined by determining nitrogen content of the seed.

    67. The method of any one of claims 25, 34, 42, 43, or 50, wherein the Methylobacterium strain is not ISO10 (NRRL B-50938).

    68. The method of any one of claims 14, 25, 34, 42, 43, or 52 to 56, wherein the Methylobacterium strain is ISO10 (NRRL B-50938), ISO20 (NRRL B-67743), ISO19 (NRRL B-67742), or ISO18 (NRRL B-67741).

    69. The method of any one of claims 1, 2, 5, or 8, wherein the oil and protein content in the seed are increased.

    70. A method for identifying a Methylobacterium strain that increases the content of at least one mineral nutrient and/or at least one vitamin in a plant or plant part comprising: (i) treating a seed and/or a plant with at least a first Methylobacterium strain to obtain a treated seed and/or a treated plant; (ii) harvesting a plant part from a cultivated plant, wherein the cultivated plant is grown from the treated seed or treated plant of step (i); (iii) harvesting a plant part from a cultivated control plant grown from an untreated control seed or untreated control plant; (iv) determining the content of at least one mineral nutrient and/or vitamin in the plant part from the cultivated plant and from the cultivated control plant; and, (v) selecting a Methylobacterium strain that increases the content of at least one mineral nutrient or vitamin in the cultivated plant or a plant part of the cultivated plant in comparison to the mineral nutrient or vitamin in the cultivated control plant or plant part.

    71. A method of identifying a Methylobacterium strain that increases the content of at least one mineral nutrient and/or at least one vitamin in a plant or plant part comprising: (i) treating a first seed or plant with at least a first Methylobacterium strain and a second seed or plant with a second Methylobacterium strain, (ii) harvesting a plant part from a cultivated plant grown from the first seed or plant, from a cultivated plant grown from the second seed or plant, and from a plant grown from a control seed or from a control plant; (iii) analyzing a plant part harvested from the cultivated plant grown from the first seed or plant, from the cultivated plant grown from the second seed or plant, and from a plant grown from the control seed or plant to determine the content of at least one mineral nutrient and/or vitamin, and (iv) selecting the Methylobacterium strain that provides the greatest increases in the content of the at least one mineral nutrient and/or vitamin in comparison to a plant part from a plant grown from the control seed, wherein the selected Methylobacterium strain is either the first Methylobacterium strain or the second Methylobacterium strain.

    72. A method of producing a food or feed with increased mineral nutrient, crude fat, oil, and/or protein content comprising incorporating into the food or feed a processed or unprocessed food ingredient obtained from a cultivated plant or plants grown from Methylobacterium-treated seeds, plants or plant parts, thereby obtaining a food or feed with increased mineral nutrient, vitamin, oil and/or protein content.

    73. The method of any one of claims 70-72 wherein the mineral nutrient is selected from nitrogen, phosphorus, potassium, iron, boron, magnesium and manganese.

    74. The method of claim 70 or 71 wherein said plant part is a seed.

    75. The method of claim 74 wherein said seed has increased oil and/or protein content.

    76. A plant or plant part having increased mineral nutrient, crude fat, seed oil, and/or protein content, wherein said plant, seed or plant part is harvested from a cultivated plant grown from a Methylobacterium-treated seed, plant or plant part, wherein said Methylobacterium provides for increased mineral nutrient, crude fat, seed oil, and/or protein content.

    77. The plant part according to claim 76, wherein said plant part is a seed, leaf, stem, flower, root, frit, or tuber.

    78. The plant part according to claim 76, wherein said plant part is a seed having increased seed oil, protein and/or mineral nutrient content.

    79. The method of any one of claims 70 to 75, wherein at least one of the first or second Methylobacterium is ISO20 (NRRL B-67743), ISO19 (NRRL B-67742), ISO18 (NRRL B-67741), or variants thereof, or wherein the Methylobacterium is ISO20 (NRRL B-67743), ISO19 (NRRL B-67742), ISO18 (NRRL B-67741), or variants thereof.

    80. The method of claim 71, wherein said second Methylobacterium is a variant of said first Methylobacterium.

    81. The method of claim 71, wherein said first Methylobacterium and said second Methylobacterium are variants of ISO20 (NRRL B-67743), ISO19 (NRRL B-67742), or ISO18 (NRRL B-67741)

    82. The plant part of any one of claims 76-78, wherein the Methylobacterium is ISO02 (NRRL B-50930), ISO03 (NRRL B-50931), ISO10 (NRRL B-50938), ISO20 (NRRL B-67743), ISO19 (NRRL B-67742), ISO18 (NRRL B-67741), or variants thereof.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS/FIGURES

    [0021] FIG. 1 is a schematic diagram of canola or rapeseed processing methods (Image by Heuzé V., AFZ; from Heuzé V., Tran G., Sauvant D., Lessire M., Lebas F., 2018. Rapeseed meal. Feedipedia, a program by INRA, CIRAD, AFZ and FAO. Published on the world wide web site “feedipedia.org/node/52”).

    [0022] FIG. 2 is a schematic diagram of soybean seed processing methods (Image by Tran, H., and Heuzé V., AFZ; from Heuzé V., Tran G., Kaushik S., 2017. Soybean meal. Feedipedia, a program by INRA, CIRAD, AFZ and FAO. Published on the world wide web site “feedipedia.org/node/674”).

    [0023] FIG. 3 shows a comparison of % nitrogen content of seed harvested from soybean plants treated with Methylobacterium ISO10 and untreated control seed (t=−2.4; p=0.042).

    [0024] FIG. 4 shows a comparison of % crude protein of seed harvested from soybean plants treated with Methylobacterium ISO10 and untreated control seed (t=−2.24; p=0.055).

    [0025] FIG. 5 shows a comparison of % crude fat content of seed harvested from soybean plants treated with Methylobacterium ISO10 and untreated control seed (t=−7.11; p<0.0001).

    [0026] FIG. 6 shows a comparison of % magnesium content of seed harvested from soybean plants treated with Methylobacterium ISO10 and untreated control seed (t=−4.47; p=0.0021).

    [0027] FIG. 7 shows a comparison of % potassium content of seed harvested from soybean plants treated with Methylobacterium ISO10 and untreated control seed (t=3.37; p=0.0098).

    [0028] FIG. 8 shows a comparison of % boron content of seed harvested from soybean plants treated with Methylobacterium ISO10 and untreated control seed (t=2.08; p=0.071).

    [0029] FIG. 9 shows a comparison of iron content of stage V1 leaf samples from soybean plants grown from seeds treated with Methylobacterium ISO10 and stage V1 leaf samples from soybean plants grown from untreated seeds.

    [0030] FIG. 10 shows a comparison of phosphorus content of stage V2 leaf samples from corn plants grown from seeds treated with Methylobacterium ISO15 and of stage V2 leaf samples from corn plants grown from untreated seeds.

    [0031] FIG. 11 shows a comparison of potassium content of stage V2 leaf samples from corn plants grown from seeds treated with Methylobacterium ISO15 and of stage V2 leaf samples from corn plants grown from untreated seeds.

    [0032] FIG. 12 shows a comparison of iron content of stage V2 leaf samples from corn plants grown from seeds treated with Methylobacterium ISO15 and of stage V2 leaf samples from corn plants grown from untreated seeds.

    [0033] FIG. 13 shows a comparison of manganese content of stage V2 leaf samples from corn plants grown from seeds treated with Methylobacterium ISO15 and of stage V2 leaf samples from corn plants grown from untreated seeds.

    DETAILED DESCRIPTION

    Definitions

    [0034] The term “and/or” where used herein is to be taken as specific disclosure of each of the two or more specified features or components with or without the other. Thus, the term “and/or” as used in a phrase such as “A and/or B” herein is intended to include “A and B,” “A or B,” “A” (alone), and “B” (alone). Likewise, the term “and/or” as used in a phrase such as “A, B, and/or C” is intended to encompass each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

    [0035] As used herein, the terms “include,” “includes,” and “including” are to be construed as at least having the features or encompassing the items to which they refer while not excluding any additional unspecified features or unspecified items.

    [0036] As used herein, the term “biological” refers to a component of a composition for treatment of plants or plant parts comprised of or derived from a microorganism. Biologicals include biocontrol agents, other beneficial microorganisms, microbial extracts, natural products, plant growth activators or plant defense agents. Non-limiting examples of biocontrol agents include bacteria, fungi, beneficial nematodes, and viruses. In certain compositions, a biological can comprise a mono-culture or co-culture of Methylobacterium, or a combination of Methylobacterium strains or isolates that have been separately cultured.

    [0037] As used herein, the term “Methylobacterium” refers to genera and species in the methylobacteriaceae family, including bacterial species in the Methylobacterium genus and proposed Methylorubrum genus (Green and Ardley (2018)). Methylobacterium includes pink-pigmented facultative methylotrophic bacteria (PPFM) and also encompasses the non-pink-pigmented Methylobacterium nodulans, as well as colorless mutants of Methylobacterium isolates. For example, and not by way of limitation, “Methylobacterium” refers to bacteria of the species listed below as well as any new Methylobacterium species that have not yet been reported or described that can be characterized as Methylobacterium or Methylorubrum based on phylogenetic analysis: Methylobacterium adhaesivum; Methylobacterium oryzae; Methylobacterium aerolatum; Methylobacterium oxalidis; Methylobacterium aquaticum; Methylobacterium persicinum; Methylobacterium brachiatum; Methylobacterium phyllosphaerae; Methylobacterium brachythecii; Methylobacterium phyllostachyos; Methylobacterium bullatum; Methylobacterium platani; Methylobacterium cerastii; Methylobacterium pseudosasicola; Methylobacterium currus; Methylobacterium radiotolerans; Methylobacterium dankookense; Methylobacterium soli; Methylobacterium frigidaeris; Methylobacterium specialis; Methylobacterium fujisawaense; Methylobacterium tardum; Methylobacterium gnaphalii; Methylobacterium tarhaniae; Methylobacterium goesingense; Methylobacterium thuringiense; Methylobacterium gossipiicola; Methylobacterium trifolii; Methylobacterium gregans; Methylobacterium variabile; Methylobacterium haplocladii; Methylobacterium aminovorans (Methylorubrum aminovorans); Methylobacterium hispanicum; Methylobacterium extorquens (Methylorubrum extorquens); Methylobacterium indicum; Methylobacterium podarium (Methylorubrum podarium); Methylobacterium iners; Methylobacterium populi (Methylorubrum populi); Methylobacterium isbiliense; Methylobacterium pseudosasae (Methylorubrum pseudosasae); Methylobacterium jeotgali; Methylobacterium rhodesianum (Methylorubrum rhodesianum); Methylobacterium komagatae; Methylobacterium rhodinum (Methylorubrum rhodinum); Methylobacterium longum; Methylobacterium salsuginis (Methylorubrum salsuginis); Methylobacterium marchantiae; Methylobacterium suomiense (Methylorubrum suomiense; Methylobacterium mesophilicum; Methylobacterium thiocyanatum (Methylorubrum thiocyanatum); Methylobacterium nodulans; Methylobacterium zatmanii (Methylorubrum zatmanii); or Methylobacterium organophilum.

    [0038] As used herein, the phrase “crude fat” refers to a diethyl ether extractable components of a given material (e.g., seed, seed meal, food or feed). Crude fat may include, but not limited to, true fats and oils, fatty acid esters, compound lipids, fat-soluble vitamins and provitamins (e.g., carotenoids), waxes, resins, and essential oils.

    [0039] As used herein, the phrase “oil content” as applied to a seed or any processed product or fraction thereof refers to the fraction or percentage of the total mass or weight of the seed, processed product, or fraction thereof that is oil. Oil content can be expressed as a percentage of the total dry or weight of the seed, processed product, or fraction thereof.

    [0040] As used herein, the term “oil” or phrase “seed oil” refers to the combination of triglycerides comprising saturated and/or unsaturated fatty acids, free saturated fatty acids, and free unsaturated fatty acids. Such fatty acids can include alpha-linolenic acid (C-18:3), linoleic acid (C-18:2), oleic acid (C-18:1), stearic acid (C-18:0), heptadecanoic (C-17:0), and/or palmitic acid (C-16:0).

    [0041] As used herein, the terms “include,” “includes,” and “including” are to be construed as at least having the features to which they refer while not excluding any additional unspecified features.

    [0042] As used herein, the phrase “protein content” as applied to a seed or any processed product or fraction thereof refers to the fraction or percentage of the total mass or weight of the seed, processed product, or fraction thereof that is protein. Protein content can be expressed as a percentage of the total dry or wet weight of the seed, processed product, or fraction thereof. Protein content can also be expressed as mass units of protein per mass units seed, processed product, or fraction thereof (e.g., grams protein per kilogram dry or wet weight of the seed, processed product, or fraction thereof).

    [0043] As used herein “mineral nutrients” are micronutrients or macronutrients required or useful for plants or plant parts including for example, but not limited to, nitrogen (N), potassium (K), calcium (Ca), magnesium (Mg), phosphorus (P), and sulfur (S), and the micronutrients chlorine (Cl), Iron (Fe), Boron (B), manganese (Mn), zinc (Z), copper (Cu), molybdenum (Mo) and nickel (Ni).

    [0044] As used herein, “vitamins” are organic compounds required in small amounts for normal growth and metabolism. Vitamins are important for human and/or animal growth and some vitamins have been reported to be beneficial to plants. Vitamins include but are not limited to vitamin A (including but not limited to all-trans-retinol, all-trans-retinyl-esters, as well as all-trans-beta-carotene and other provitamin A carotenoids), vitamin B1(thiamine), vitamin B2 (riboflavin), vitamin B3 (niacin), vitamin B5(pantothenic acid), vitamin B6 (pyridoxine), vitamin B7 (biotin), vitamin B9(folic acid or folate), vitamin B12 (cobalamins), vitamin C (ascorbic acid), vitamin D (calciferols), vitamin E (tocopherols and tocotrienols), and vitamin K (quinones).

    [0045] As used herein, the phrase “seed lot” refers to a collection of two or more seeds from one or more plants. In certain embodiments, a seed lot includes a collection of more than 10, 50, 100, 500, 1000 or more seeds from one or more plants.

    [0046] As used herein, the term “strain” shall include all isolates of such strain.

    [0047] As used herein, “variant” when used in the context of a Methylobacterium isolate, refers to any isolate that has chromosomal genomic DNA with at least 99%, 99.9, 99.8, 99.7, 99.6%, or 99.5% sequence identity to chromosomal genomic DNA of a reference Methylobacterium isolate, such as, for example, a deposited Methylobacterium isolate provided herein. A variant of an isolate can be obtained from various sources including soil, plants or plant material, and water, particularly water associated with plants and/or agriculture. Variants include derivatives obtained from deposited isolates. Methylobacterium isolates or strains can be sequenced (for example as taught by Sanger et al. (1977), Bentley et al. (2008) or Caporaso et al. (2012)) and genome-scale comparison of the sequences conducted (Konstantinos et al. (2005)) using sequence analysis tools (for example, BLAST, as taught by Altschul et al. (1990)).

    [0048] As used herein, “derivative” when used in the context of a Methylobacterium isolate, refers to any Methylobacterium that is obtained from a deposited Methylobacterium isolate provided herein. Derivatives of a Methylobacterium isolate include, but are not limited to, derivatives obtained by selection, derivatives selected by mutagenesis and selection, and genetically transformed Methylobacterium obtained from a Methylobacterium isolate. A “derivative” can be identified, for example based on genetic identity to the strain or isolate from which it was obtained and will generally exhibit chromosomal genomic DNA with at least 99%, 99.9, 99.8, 99.7, 99.6%, or 99.5% sequence identity to chromosomal genomic DNA of the strain or isolate from which it was derived.

    [0049] As used herein, the term “cultivate” means to grow a plant. A cultivated plant can be one grown and raised on a large agricultural scale or on a smaller scale, including for example a single plant.

    [0050] Where a term is provided in the singular, other embodiments described by the plural of that term are also provided.

    [0051] To the extent to which any of the preceding definitions is inconsistent with definitions provided in any patent or non-patent reference incorporated herein by reference, any patent or non-patent reference cited herein, or in any patent or non-patent reference found elsewhere, it is understood that the preceding definition will be used herein.

    FURTHER DESCRIPTION

    [0052] Various methods where Methylobacterium strains are used to increase the mineral nutrient, vitamin, oil and/or protein content in plants or plant parts harvested from plants grown from seed and/or plants comprising plant parts treated with the Methylobacterium are provided herein. In certain embodiments, Methylobacterium treatment of soil, a seed, a leaf, a fruit, a stem, a root, or a shoot can increase plant mineral nutrient, vitamin, crude fat, seed oil, and/or protein content in seeds or seed lots harvested from plants grown from the treated seed or plant comprising the treated plant part. In other embodiments, Methylobacterium treatment of soil, a seed, a leaf, a fruit, a stem, a root, or a shoot can increase the content of one or more mineral nutrients or vitamins in harvested plants or plant parts from plants grown from the Methylobacterium-treated plant parts or Methylobacterium-treated seeds provided herein. Methylobacterium soil treatments or applications can include, but are not limited to, in-furrow applications (e.g., before, during, and/or after seed deposition), soil drenches, distribution of granular or other dried formulations to the soil (e.g., before, during, and/or after seed deposition or plant growth). In certain embodiments, Methylobacterium treatment of a seed and/or plant can thus comprise any Methylobacterium soil treatment or application where the seed and/or plant is contacted and/or colonized by the Methylobacterium. Treatments or applications can include, but are not limited to, spraying, coating, partially coating, immersing, and/or imbibing the plant or plant parts with the Methylobacterium strains and compositions comprising the same provided herein. In certain embodiments, soil, a seed, a leaf, a fruit, a stem, a root, a tuber, or a shoot can be sprayed, immersed and/or imbibed with a liquid, semi-liquid, emulsion, or slurry of a composition provided herein. Such seed immersion or imbibition can be sufficient to provide for increased crude fat, seed oil, and/or protein content in a treated plant or plant grown from a treated seed in comparison to an untreated plant or plant grown from an untreated seed. In certain embodiments, plant seeds can be immersed and/or imbibed for at least 1, 2, 3, 4, 5, or 6 hours. Such immersion and/or imbibition can, in certain embodiments, be conducted at temperatures that are not deleterious to the plant seed or the Methylobacterium. In certain embodiments, the seeds can be treated at about 15 to about 30 degrees Centigrade or at about 20 to about 25 degrees Centigrade. In certain embodiments, seed imbibition and/or immersion can be performed with gentle agitation. Seed treatments can be effected with both continuous and/or a batch seed treaters. In certain embodiments, the coated seeds can be prepared by slurrying seeds with a coating composition comprising a Methylobacterium strain that increases mineral nutrient, vitamin, crude fat, seed oil, and/or protein content and air-drying the resulting product. Air-drying can be accomplished at any temperature that is not deleterious to the seed or the Methylobacterium, but will typically not be greater than 30 degrees Centigrade. The proportion of coating that comprises the Methylobacterium strain includes, but is not limited to, a range of 0.1 to 25% by weight of the seed or other plant part, 0.5 to 5% by weight of the seed or other plant part, and 0.5 to 2.5% by weight of the seed or other plant part. In certain embodiments, a solid substance used in the seed coating or treatment will have a Methylobacterium strain that increases mineral nutrient, vitamin, crude fat, seed oil, and/or protein content adhered to a solid substance by being grown in biphasic media comprising the Methylobacterium strain, solid substance, and liquid media. Methods for growing Methylobacterium in biphasic media include those described in U.S. Pat. No. 9,181,541, which is specifically incorporated herein in its entirety. In certain embodiments, compositions suitable for treatment of a seed or plant part with a Methylobacterium strain that increases mineral nutrient, vitamin, crude fat, seed oil, and/or protein content can be obtained by the methods provided in US Patent Application No. US 20160120188, which is specifically incorporated herein in its entirety. Various seed treatment compositions and methods for seed treatment disclosed in U.S. Pat. Nos. 5,106,648, 5,512,069, and 8,181,388 are incorporated herein by reference in their entireties and can be adapted for treating seeds with compositions comprising a Methylobacterium strain.

    [0053] In certain embodiments, the composition used to treat the seed or plant part can contain a Methylobacterium strain and an agriculturally acceptable excipient. Agriculturally acceptable excipients include, but are not limited to, woodflours, clays, activated carbon, diatomaceous earth, fine-grain inorganic solids, calcium carbonate and the like. Clays and inorganic solids that can be used with the include, but are not limited to, calcium bentonite, kaolin, china clay, talc, perlite, mica, vermiculite, silicas, quartz powder, montmorillonite and mixtures thereof.

    [0054] Agriculturally acceptable adjuvants that promote sticking to the seed that can be used include, but are not limited to, polyvinyl acetates, polyvinyl acetate copolymers, hydrolyzed polyvinyl acetates, polyvinylpyrrolidone-vinyl acetate copolymer, polyvinyl alcohols, polyvinyl alcohol copolymers, polyvinyl methyl ether, polyvinyl methyl ether-maleic anhydride copolymer, waxes, latex polymers, celluloses including ethylcelluloses and methylcelluloses, hydroxy methylcelluloses, hydroxypropylcellulose, hydroxymethylpropylcelluloses, polyvinyl pyrrolidones, alginates, dextrins, malto-dextrins, polysaccharides, fats, oils, proteins, karaya gum, jaguar gum, tragacanth gum, polysaccharide gums, mucilage, gum arabics, shellacs, vinylidene chloride polymers and copolymers, soybean-based protein polymers and copolymers, lignosulfonates, acrylic copolymers, starches, polyvinylacrylates, zeins, gelatin, carboxymethylcellulose, chitosan, polyethylene oxide, acrylamide polymers and copolymers, polyhydroxyethyl acrylate, methylacrylamide monomers, alginate, ethylcellulose, polychloroprene and syrups or mixtures thereof. Other useful agriculturally acceptable adjuvants that can promote coating include, but are not limited to, polymers and copolymers of vinyl acetate, polyvinylpyrrolidone-vinyl acetate copolymer and water-soluble waxes. Various surfactants, dispersants, anticaking-agents, foam-control agents, and dyes disclosed herein and in U.S. Pat. No. 8,181,388 can be adapted for use with compositions comprising a suitable Methylobacterium strain. In certain embodiments, the seed and/or seedling is exposed to the composition by providing the Methylobacterium strain in soil in which the plant or a plant arising from the seed are grown, or other plant growth media in which the plant or a plant arising from the seed are grown. Examples of methods where the Methylobacterium strain is provided in the soil include in furrow applications, soil drenches, and the like.

    [0055] In certain embodiments, a Methylobacterium strain that increases mineral nutrient, vitamin, crude fat, seed oil, and/or protein content used to treat a given species of seed or plant part can be a Methylobacterium strain that was isolated from a different plant species and is thus heterologous to the treated plant or plant part. Non-limiting examples of treatments of plant seed or other plant parts with a heterologous Methylobacterium include treatments of soybean, Brassica sp., sunflower, cotton, flax, or peanut seeds and parts with a Methylobacterium strain that was isolated from a plant other than a soybean, Brassica sp., sunflower, cotton, flax, or peanut plant, respectively.

    [0056] Non-limiting examples of treatments of plant seed or other plant parts with a Methylobacterium providing for increased content of one or more mineral nutrients, vitamins, crude fat, seed oil, and/or protein in a harvested plant part include treatments of corn, soybean, Brassica sp. (e.g., B. napus, B. rapa, B. juncea), alfafa, rice, rye, wheat, barley, oats, sorghum, millet (e.g. pearl millet (Pennisetum glaucum)), proso millet (Panicum miliaceum), foxtail millet (Setaria italica) finger millet (Eleuisine corocana), sunflower, safflower, tobacco, potato, peanuts, cotton, species in the genus Cannabis including, but not limited to, Cannabis sativa and industrial hemp varieties, sweet potato (Ipomoea botatus), cassava, coffee, coconut, pineapple, citrus trees, cocoa, tea, date palm, banana, apple, pear, grape, berry plants (including, but not limited to blackberry, raspberry, strawberry or blueberry plants), avocado, fig, guava, kiwi, mango, olive, papaya, cashew, macadamia, almond, sugar beets, sugarcane, tomatoes, peppers, carrots, celery, lettuce green beans, lima beans, peas, lentils, cucurbits (including, but not limited to cucumber, cantaloupe, melons, squash, pumpkin, and zucchini). In other embodiments, treated plants include ornamentals (including, but not limited to, azalea, hydrangea, hibiscus, roses, tulips, daffodils, petunias, canation, poinsettia, and chrysanthemum), conifers (including, but not limited to pines such as loblolly pine, slash pine. ponderosa pine lodge pole pine, and Monterey pine; Douglas-fir: Western hemlock: Sitka spruce: redwood true firs such as silver fir and balsam fir; and cedars such as Western red cedar and Alaska yellow-cedar) and turfgrass (including, but are not limited to, annual bluegrass, annual ryegrass, Canada bluegrass, fescue, bentgrass, wheatgrass. Kentucky bluegrass, orchard grass, ryegrass, redtop, Bermuda grass, St. Augustine grass, and zoysia grass). In certain embodiments, a Methylobacterium strain that increases mineral nutrient, vitamin, crude fat, seed oil, and/or protein content used to treat a given cultivar or variety of seed, plant or plant part can be a Methylobacterium strain that was isolated from a different plant species, or a different cultivar or variety of the plant species being treated, and is thus non-resident to the treated plant or plant part.

    [0057] Plant parts that have increased levels of one or more mineral nutrients, vitamins, crude fat, seed oil, and/or protein as the result of treatment with Methylobacterium as provided herein include, but are not limited to, leaves, stems, flowers, roots, seeds, fruit, tubers, coleoptiles, and the like.

    [0058] In some embodiments, a plant part having increased levels of one or more mineral nutrients, vitamins, crude fat, seed oil, and/or protein is a plant seed. Of particular interest for treatments of plant seed or other plant parts with Methylobacterium providing for increases in mineral nutrients, vitamins, crude fat, seed oil, and/or protein in harvested plant seeds are treatments of soybean, Brassica sp., sunflower, cotton, flax, or peanut seeds and parts. In some embodiments, such treatments are with a Methylobacterium strain that was isolated from a different species, cultivar or variety compared to the plant being treated.

    [0059] In certain embodiments, a manufactured combination composition comprising two or more Methylobacterium strains can be used to treat a seed or plant part in any of the methods provided herein. Such manufactured combination compositions can be made by methods that include harvesting monocultures of each Methylobacterium strain and mixing the harvested monocultures to obtain the manufactured combination composition of Methylobacterium. In certain embodiments, the manufactured combination composition of Methylobacterium can comprise Methylobacterium isolated from different plant species or from different cultivars or varieties of a given plant.

    [0060] In certain embodiments, an effective amount of the Methylobacterium strain or strains that increase mineral nutrient, vitamin, crude fat, seed oil, and/or protein content used in treatment of seeds or plant parts is a composition having a Methylobacterium titer of at least about 1×10.sup.6 colony-forming units per milliliter, at least about 5×10.sup.6 colony-forming units per milliliter, at least about 1×10.sup.7 colony-forming units per milliliter, at least about 5×10.sup.8 colony-forming units per milliliter, at least about 1×10.sup.9 colony-forming units per milliliter, at least about 1×10.sup.10 colony-forming units per milliliter, or at least about 3×10.sup.10 colony-forming units per milliliter. In certain embodiments, an effective amount of the Methylobacterium strain or strains that increase mineral nutrient, vitamin, crude fat, seed oil, and/or protein content used in treatment of seeds or plant parts is a composition with the Methylobacterium at a titer of about least about 1×10.sup.6 colony-forming units per milliliter, at least about 5×10.sup.6 colony-forming units per milliliter, at least about 1×10.sup.7 colony-forming units per milliliter, or at least about 5×10.sup.8 colony-forming units per milliliter to at least about 6×10.sup.10 colony-forming units per milliliter of a liquid or an emulsion. In certain embodiments, an effective amount of the Methylobacterium strain or strains that increase mineral nutrient, vitamin, crude fat, seed oil, and/or protein content used in treatment of seeds or plant parts is a composition with the Methylobacterium at least about 1×10.sup.6 colony-forming units per gram, at least about 5×10.sup.6 colony-forming units per gram, at least about 1×10.sup.7 colony-forming units per gram, or at least about 5×10.sup.1 colony-forming units per gram to at least about 6×10.sup.10 colony-forming units of Methylobacterium per gram of the composition. In certain embodiments, an effective amount of a composition provided herein that is sufficient to provide for increased mineral nutrient, vitamin, crude fat, seed oil, and/or protein content can be a composition with a Methylobacterium titer of at least about 1×10.sup.6 colony-forming units per gram, at least about 5×10.sup.6 colony-forming units per gram, at least about 1×10.sup.7 colony-forming units per gram, or at least about 5×10.sup.8 colony-forming units per gram to at least about 6×10.sup.10 colony-forming units of Methylobacterium per gram of particles in the composition containing the particles that comprise a solid substance wherein a mono-culture or co-culture of crude fat, seed oil, and/or protein content enhancing Methylobacterium strain or strains is adhered thereto. In certain embodiments, an effective amount of a composition provided herein that is sufficient to provide for increased mineral nutrient, vitamin, crude fat, seed oil, and/or protein content to a plant or plant part can be a composition with a Methylobacterium titer of at least about 1×10.sup.6 colony-forming units per mL, at least about 5×10.sup.6 colony-forming units per mL, at least about 1×10.sup.7 colony-forming units per mL, or at least about 5×10.sup.8 colony-forming units per mL to at least about 6×10.sup.10 colony-forming units of Methylobacterium per mL in a composition comprising an emulsion wherein a mono-culture or co-culture of a Methylobacterium strain or strains that increase mineral nutrient, vitamin, crude fat, seed oil, and/or protein content adhered to a solid substance is provided therein or grown therein. In certain embodiments, an effective amount of a composition provided herein that is sufficient to provide for increased mineral nutrient, vitamin, crude fat, seed oil, and/or protein content to a plant or plant part can be a composition with a Methylobacterium titer of at least about 1×10.sup.6 colony-forming units per mL, at least about 5×10.sup.6 colony-forming units per mL, at least about 1×10.sup.7 colony-forming units per mL, or at least about 5×10.sup.8 colony-forming units per mL to at least about 6×10.sup.10 colony-forming units of Methylobacterium per mL of in a composition comprising an emulsion wherein a mono-culture or co-culture of a Methylobacterium strain or strains that increase mineral nutrient, vitamin, crude fat, seed oil, and/or protein content is provided therein or grown therein. In certain embodiments, any of the aforementioned compositions comprising a mono-culture or co-culture of a Methylobacterium strain or strains that increase mineral nutrient, vitamin, crude fat, seed oil, and/or protein content can further comprise a mono- or co-culture of Rhizobium and/or Bradyrhizobium.

    [0061] An effective amount of a Methylobacterium strain or strains that increase mineral nutrient, vitamin, crude fat, seed oil, and/or protein content provided in a treatment of a seed or plant part is an amount that results in an increase in the mineral nutrient, vitamin, crude fat, seed oil, and/or protein content of seed or other plant parts harvested from a plant grown from the treated seed or plant comprising the treated plant part. In certain embodiments, an effective amount of a Methylobacterium strain or strains that increase mineral nutrient, vitamin, crude fat, seed oil, and/or protein content provided in a treatment of a seed or plant part is at least about 10.sup.3, 10.sup.4, 10.sup.5, or 10.sup.6 CFU per seed or treated plant part. In certain embodiments, an effective amount of Methylobacterium provided in a treatment of a seed or plant part is at least about 10.sup.3, 10.sup.4, 10.sup.5, or 10.sup.6 CFU to about 10.sup.7, 10.sup.8, 10.sup.9, or 10.sup.10 CFU per seed or treated plant part. In certain embodiments, the effective amount of Methylobacterium provided in a treatment of a seed or plant part is an amount where the CFU per seed or treated plant part will exceed the number of CFU of any resident naturally occurring Methylobacterium strain by at least 5-, 10-, 100-, or 1000-fold. In certain embodiments, the effective amount of Methylobacterium provided in a treatment of a seed or plant part is an amount where the CFU per seed or treated plant part will exceed the number of CFU of any resident naturally occurring Methylobacterium by at least 2-, 3-, 5-, 8-, 10-, 20-, 50-, 100-, or 1000-fold.

    [0062] Methylobacterium sp, strains are useful in certain methods provided herein. In one embodiment, the Methylobacterium strain includes certain Methylobacterium strains obtained from Methylobacterium species that include M. gregans, M. komagatae, and M. radiotolerans. Non-limiting examples of other Methylobacterium sp, strains of use in certain methods provided herein are disclosed in Table 1. Other Methylobacterium sp, strains useful in certain methods provided herein include variants of the Methylobacterium sp, strains disclosed in Table 1.

    TABLE-US-00001 TABLE 1 Methylobacterium sp. strain Isolate USDA ARS Deposit Identifier No. NLS NO. NRRL No..sup.1 Strain Source: Obtained from: Methylobacterium sp. #1 ISO01 NLS0046 NRRL B-50929 a soybean plant grown in Saint Louis County, Missouri, USA Methylobacterium sp. #2 ISO02 NLS0020 NRRL B-50930 a weed grown in Saint Louis County, Missouri, USA Methylobacterium sp. #3 ISO03 NLS0017 NRRL B-50931 a mint plant grown in Saint Louis County, Missouri, USA Methylobacterium sp. #4 ISO04 NLS0042 NRRL B-50932 a soybean plant grown in Saint Louis County, Missouri, USA Methylobacterium sp. #5 ISO05 NLS0089 NRRL B-50933 a broccoli plant grown in Saint Louis County, Missouri, USA Methylobacterium sp. #6 ISO06 NLS0068 NRRL B-50934 a corn plant grown in Saint Louis County, Missouri, USA Methylobacterium sp. #7 ISO07 NLS0065 NRRL B-50935 a corn plant grown in Saint Louis County, Missouri, USA Methylobacterium sp. #8 ISO08 NLS0069 NRRL B-50936 a corn plant grown in Saint Louis County, Missouri, USA Methylobacterium sp. #9 ISO09 NLS0062 NRRL B-50937 a corn plant grown in Saint Louis County, Missouri, USA Methylobacterium sp. #10 ISO10 NLS0064 NRRL B-50938 a corn plant grown in Saint Louis County, Missouri, USA Methylobacterium sp. #11 ISO11 NLS0021 NRRL B-50939 a lettuce plant grown in Saint Louis County, Missouri, USA Methylobacterium sp. #12 ISO12 NLS0066 NRRL B-5 0940 a corn plant grown in Saint Louis County, Missouri, USA Methylobacterium sp. #13 ISO13 NLS0037 NRRL B-50941 a tomato plant grown in Saint Louis County, Missouri, USA Methylobacterium sp. #14 ISO14 NLS0038 NRRL B-50942 a tomato plant grown in Saint Louis County, Missouri, USA Methylobacterium #15 ISO15 NLS0044 NRRL B-67339 a soybean plant grown in Saint Louis County, Missouri, USA Methylobacterium #16 ISO16 NLS0109 NRRL B-67340 a yucca plant grown in Saint Louis County, Missouri, USA Methylobacterium sp ISO18 NLS0648 NRRL B-67741 a Dionaea muscipula plant (#18) (Venus fly trap) grown in St. Charles, MO. Methylobacterium sp ISO19 NLS0662 NRRL B-67742 an Orchidaceae spp. plant (#19) (orchid) grown in Saint Louis County, Missouri, USA Methylobacterium sp ISO20 NLS0807 NRRL B-67743 a tomato plant grown in Saint (#20) Louis County, Missouri. USA Methylobacterium sp ISO26 NLS0610 Deposited under A Lagerstroemia indica (crape (#26) Budapest Treaty myrtle) plant grown in Saint with the NRRL. Louis County, Missouri, USA Peoria. IL. USA on Nov. 26. 2019 .sup.1Deposit number for strain deposited with AGRIGULTURAL RESEARCH SERVICE CULTURE COLLECTION (NRRL) of the National Center Agricultural Utilization Research, Agricultural Research Service, U.S. Department of Agriculture, 1815 North University Street, Peoria, Illinois 61604 U.S.A. under the terms of the Budapest Treaty on the International Recoginition of the Deposit of Microorganisms for the Purposes of Patent Procedure. Subject to 37 CFR §1.808(b), all restrictions imposed by the depositor on the availability to the public of the deposited material will be irrevocably removed upon the granting of any patent from this patent application.

    [0063] Variants of a Methylobacterium isolate listed in Table 1 include isolates obtained therefrom by genetic transformation, mutagenesis and/or insertion of a heterologous sequence. In some embodiments, such variants are identified by the presence of chromosomal genomic DNA with at least 99%, 99.9, 99.8, 99.7, 99.6%, or 99.5% sequence identity to chromosomal genomic DNA of the strain from which it was derived. In certain embodiments, such variants are distinguished by the presence of one or more unique DNA sequences that include: (i) a unique sequence of SEQ ID NOs: 1 to 3, SEQ ID NOs: 13 to 15, SEQ ID NOs: 25 to 27, SEQ ID NOs: 37 to 39, SEQ ID NOs: 49 to 51, and SEQ ID NOs: 61 to 73; or (ii) sequences with at least 98% or 99% sequence identity across the full length of SEQ ID NOs: 1 to 3, SEQ ID NOs: 13 to 15, SEQ ID NOs: 25 to 27, SEQ ID NOs: 37 to 39, SEQ ID NOs: 49 to 51, SEQ ID NOs: 61 to 73, and SEQ ID Nos:74 to 76.

    [0064] Co-assigned patent applications disclose additional specific uses of certain Methylobacterium strains of Table 1 such as: increasing corn yield (US20160295868); improving lettuce cultivation (U.S. Pat. No. 10,212,939); improving tomato growth (US20170086464); improving soy yield (US2016/0302423); improving fruit production (U.S. Pat. No. 10,111,438); controlling corn rootworm (US 20170238553); controlling root lesion nematodes(US20170164618); controlling root knot nematodes (U.S. Pat. No. 10,098,353); and controlling fungal disease (US20180295841 and WO2018106899) are each incorporated herein by reference in their entireties. In certain embodiments of the methods provided herein, the Methylobacterium strain or strains used to treat a seed and/or a plant part are selected from the group consisting of ISO01 (NRRL B-50929), ISO02 (NRRL B-50930), ISO03 (NRRL B-50931), ISO04 (NRRL B-50932), ISO05 (NRRL B-50933), ISO06 (NRRL B-50934), ISO07 (NRRL B-50935), ISO08 (NRRL B-50936), ISO09 (NRRL B-50937), ISO10 (NRRL B-50938), ISO11 (NRRL B-50939), ISO12 (NRRL B-50940), ISO13 (NRRL B-50941), ISO14 (NRRL B-50942), ISO16 (NRRL B-67340), ISO18(NRRL B-67741), ISO19 (NRRL B-67742), ISO20 (NRRL B-67743), variants thereof, or any combination thereof. In certain embodiments, one or more of the Methylobacterium strains used in the methods can comprise total genomic DNA (chromosomal and plasmid DNA) or average nucleotide identity (ANI) with at least 99%, 99.9, 99.8, 99.7, 99.6%, or 99.5% sequence identity or ANI to total genomic DNA of ISO01 (NRRL B-50929), ISO02 (NRRL B-50930), ISO03 (NRRL B-50931), ISO04 (NRRL B-50932), ISO05 (NRRL B-50933), ISO06 (NRRL B-50934), ISO07 (NRRL B-50935), ISO08 (NRRL B-50936), ISO09 (NRRL B-50937), ISO10 (NRRL B-50938), ISO11 (NRRL B-50939), ISO12 (NRRL B-50940), ISO13 (NRRL B-50941), ISO14 (NRRL B-50942), ISO16 (NRRL B-67340), ISO18(NRRL B-67741), ISO19 (NRRL B-67742), or ISO20 (NRRL B-67743). In certain embodiments, the percent ANI can be determined as disclosed by Konstantinidis et al., 2006. In certain embodiments of the methods provided herein, the Methylobacterium strain or strains used to treat a seed and/or a plant part is not the strain identified as either ISO10 or NLS0064 which was deposited under the NRRL accession No. NRRL B-50938. In certain embodiments of the methods provided herein, the strain identified as either ISO10 or NLS0064 which was deposited under the NRRL accession No. NRRL B-50938 is not used. In certain methods provided herein for identifying Methylobacterium that can improve crude fat, seed oil, and/or protein content, any of the aforementioned strains set forth in Table 1 can be used as a control or reference standard for comparison to one or more new test or candidate Methylobacterium isolates. In certain embodiments, the strain identified as either ISO10 or NLS0064 which was deposited under the NRRL accession No. NRRL B-50938 is used as a control or reference standard for comparison to one or more new test or candidate Methylobacterium isolates in a method of identifying a new Methylobacterium that can improve crude fat, seed oil, and/or protein content.

    [0065] In certain embodiments of the methods provided herein, seeds and/or plant parts are treated with both a Methylobacterium strain and at least one additional component. In some embodiments an additional component can be an additional active ingredient, for example, a pesticide or a second biological. In certain embodiments, the pesticide can be an insecticide, a fungicide, an herbicide, a nematicide or other biocide. The second biological could be a strain that improves yield or controls an insect, pest, fungi, weed, or nematode.

    [0066] Non-limiting examples of insecticides and nematicides include carbamates, diamides, macrocyclic lactones, neonicotinoids, organophosphates, phenylpyrazoles, pyrethrins, spinosyns, synthetic pyrethroids, tetronic and tetramic acids. In particular embodiments insecticides and nematicides include abamectin, aldicarb, aldoxycarb, bifenthrin, carbofuran, chlorantraniliporle, chlothianidin, cyfluthrin, cyhalothrin, cypermethrin, deltamethrin, dinotefuran, emamectin, ethiprole, fenamiphos, fipronil, flubendiamide, fosthiazate, imidacloprid, ivermectin, lambda-cyhalothrin, milbemectin, nitenpyram, oxamyl, permethrin, tioxazafen, spinetoram, spinosad, spirodichlofen, spirotetramat, tefluthrin, thiacloprid, thiamethoxam, and thiodicarb.

    [0067] Non-limiting examples of useful fungicides include aromatic hydrocarbons, benzimidazoles, benzthiadiazole, carboxamides, carboxylic acid amides, morpholines, phenylamides, phosphonates, quinone outside inhibitors (e.g. strobilurins), thiazolidines, thiophanates, thiophene carboxamides, and triazoles. Particular examples of fungicides include acibenzolar-S-methyl, azoxystrobin, benalaxyl, bixafen, boscalid, carbendazim, cyproconazole, dimethomorph, epoxiconazole, fluopyram, fluoxastrobin, flutianil, flutolanil, fluxapyroxad, fosetyl-Al, ipconazole, isopyrazam, kresoxim-methyl, mefenoxam, metalaxyl, metconazole, myclobutanil, orysastrobin, penflufen, penthiopyrad, picoxystrobin, propiconazole, prothioconazole, pyraclostrobin, sedaxane, silthiofam, tebuconazole, thifluzamide, thiophanate, tolclofos-methyl, trifloxystrobin, and triticonazole. Non-limiting examples of other biocides, include isothiazolinones, for example 1,2 Benzothiazolin-3-one (BIT), 5-Chloro-2-methyl-4-isothiazolin-3-one (CIT), 2-Methyl-4-isothiazolin-3-one (MIT), octylisothiazolinone (OIT), dichlorooctylisothiazolinone (DCOIT), and butylbenzisothiazolinone (BBIT); 2-Bromo-2-nitro-propane-1,3-diol (Bronopol), 5-bromo-5-nitro-1,3-dioxane (Bronidox), Tris(hydroxymethyl)nitromethane, 2,2-Dibromo-3-nitrilopropionamide (DBNPA), and alkyl dimethyl benzyl ammonium chlorides.

    [0068] Non-limiting examples of herbicides include ACCase inhibitors, acetanilides, AHAS inhibitors, carotenoid biosynthesis inhibitors, EPSPS inhibitors, glutamine synthetase inhibitors, PPO inhibitors, PS II inhibitors, and synthetic auxins, Particular examples of herbicides include acetochlor, clethodim, dicamba, flumioxazin, fomesafen, glyphosate, glufosinate, mesotrione, quizalofop, saflufenacil, sulcotrione, and 2,4-D.

    [0069] In some embodiments, the composition or method disclosed herein may comprise a Methylobacterium strain and an additional active ingredient selected from the group consisting of clothianidin, ipconazole, imidacloprid, metalaxyl, mefenoxam, tioxazafen, azoxystrobin, thiomethoxam, fluopyram, prothioconazole, pyraclostrobin, and sedaxane.

    [0070] In some embodiments, the composition or method disclosed herein may comprise an additional active ingredient, which may be a second biological. The second biological could be a biological control agent, other beneficial microorganisms, microbial extracts, natural products, plant growth activators or plant defense agent. Non-limiting examples of the second biological could include bacteria, fungi, beneficial nematodes, and viruses. In certain embodiments, the second biological can be a Methylobacterium. In certain embodiments, the second biological is a Methylobacterium listed in Table 1. In certain embodiments, the second biological can be a Methylobacterium selected from M. gregans, M radiotolerans, M extorquens, M. populi, M. salsuginis, M brachiatum, and M. komagatae.

    [0071] In certain embodiments, the second biological can be a bacterium of the genus Actinomycetes, Agrobacterium, Arthrobacter, Alcaligenes, Aureobacterium, Azobacter, Azorhizobium, Azospirillum, Azotobacter, Beijerinckia, Bacillus, Brevibacillus, Burkholderia, Chromobacterium, Clostridium, Clavibacter, Comomonas, Corynebacterium, Curtobacterium, Enterobacter, Flavobacterium, Gluconacetobacter, Gluconobacter, Herbaspirillum, Hydrogenophage, Klebsiella, Luteibacter, Lysinibacillus, Mesorhizobium, Methylobacterium, Microbacterium, Ochrobactrum, Paenibacillus, Pantoea, Pasteuria, Phingobacterium, Photorhabdus, Phyllobacterium, Pseudomonas, Rhizobium, Rhodococcus, Bradyrhizobium, Serratia, Sinorhizobium, Sphingomonas, Streptomyces, Stenotrophomonas, Variovorax, Xanthomonas and Xenorhadbus. In particular embodiments the bacteria is selected from the group consisting of Bacillus amyloliquefaciens, Bacillus cereus, Bacillus firmus, Bacillus, lichenformis, Bacillus pumilus, Bacillus sphaericus, Bacillus subtilis, Bacillus thuringiensis, Chromobacterium suttsuga, Pasteuria penetrans, Pasteuria usage, and Pseudomona fluorescens.

    [0072] In certain embodiments, the second biological is a Rhizobium or Bradyrhizobium, which is beneficial to growth of plants grown from treated seed and/or a plant comprising a treated plant part. Treatments of leguminous plant seeds or other plant parts including soybean and peanut with both a Methylobacterium strain or strains and the Rhizobium or Bradyrhizobium can result in an improvement in crude fat, seed oil, and/or protein content of seed harvested from a plant grown from the treated seed and/or plant parts in comparison to a control plant grown from seed and/or plant parts treated with just the Rhizobium or Bradyrhizobium (i.e., not treated with the Methylobacterium) and/or to a control plant grown from seed and/or plant parts that were not treated with a Methylobacterium strain and that were not treated with the Rhizobium or Bradyrhizobium.

    [0073] In certain embodiments the second biological can be a fungus of the genus Acremonium, Alternaria, Ampelomyces, Aspergillus, Aureobasidium, Beauveria, Botryosphaeria, Cladosporium, Cochliobolus, Colletotrichum, Coniothyrium, Embellisia, Epicoccum, Fusarium, Gigaspora, Gliocladium, Glomus, Laccaria, Metarhisium, Muscodor, Nigrospora, Paecilonyces, Paraglomus, Penicillium, Phoma, Pisolithus, Podospora, Rhizopogon, Scleroderma, Trichoderma, Typhula, Ulocladium, and Verticilium. In particular embodiments, the fungus is Beauveria bassiana, Coniothyrium minitans, Gliocladium vixens, Muscodor albus, Paecilomyces lilacinus, or Trichoderma polysporum.

    [0074] In further embodiments the second biological can be plant growth activators or plant defense agents including, but not limited to harpin, Reynoutria sachalinensis, jasmonate, lipochitooligosaccharides, and isoflavones.

    [0075] In further embodiments, the second biological can include, but are not limited to, various Bacillus sp., Pseudomonas sp., Coniothyrium sp., Pantoea sp., Streptomyces sp., and Trichoderma sp. Microbial biopesticides can be a bacterium, fungus, virus, or protozoan. Particularly useful biopesticidal microorganisms include various Bacillus subtilis, Bacillus thuringiensis, Bacillus pumilis, Pseudomonas syringae, Trichoderma harzianum, Trichoderma virens, and Streptomyces lydicus strains. Other microorganisms that are added can be genetically engineered or wild-type isolates that are available as pure cultures. In certain embodiments, it is anticipated that the second biological can be provided in the composition in the form of a spore.

    [0076] Seed lots comprising at least about 50%, 70%, 80%, 90%, 95%, 98%, or 99% of seeds harvested from mature plants grown from seeds and/or plants treated with an effective amount of a Methylobacterium strain or strains are provided herein. Such seed lots can exhibit increased crude fat, seed oil, and/or protein content and are thus useful in a variety of processes. In certain embodiments, such seed lots can be used as feedstock in methods of extracting oil and/or protein from seed. It is thus anticipated that the yield of oil and/or protein will be increased by use of the seed lots provided herein as feedstock in comparison to methods where seed lots obtained from commodity seed are used as feedstock. Such commodity seed would in general comprise seed harvested from mature plants grown from seeds and/or plants that were not treated with an effective amount of a Methylobacterium strain or strains. In certain embodiments, such seed lots can be used in methods of manufacturing a food or feed ingredient to obtain a food or feed ingredient with increased oil and/or protein content. In certain embodiments, the seed lot will comprise at least about 10, 20, 50, 100, 500, or 1000 seed. In certain embodiments, the seed lot will comprise at least about 10, 20, 50, 100, 500, or 1000 pounds or kilograms of seed. In certain embodiments, the seed lot will comprise at least about 100, 200, 500, 1000, 5000, or 10,000 bushels of seed. Seed lots can be packaged or contained in a bag, box, or other packaging suitable for storing and/or shipping. In certain embodiments, the seed lot can be packaged, stored, and/or shipped in a silo bag. In certain embodiments, such silo bags can comprise a triple layer of thick laminated extruded plastic (polyethylene) about 230-235 microns thick, where the two outer layers are white with a UV protective coating while the inner layer in contact with the seed is black (Ileleji, K. Use of Silo Bags for Commodity Grain Storage in Indiana, 2014; on the https internet site “extension.purdue.edu/article/6963”). In certain embodiments, a silo bag filled with a seed lot will comprise a tube of about 8 to 12 ft in diameter and up to about 200 ft in length and can hold about 8,000 to 12,000 bushels of seed. In certain embodiments, any of the aforementioned packaged seed lots can comprise a tag or label useful of identifying and tracking the seed lot. Such tags or labels can comprise a barcode, an RFID tag, or other identifiers. In certain embodiments, the tag or label will identify the seed lot as comprising at least about 50%, 70%, 80%, 90%, 95%, 98%, or 99% of seeds harvested from mature plants grown from seeds and/or plants treated with an effective amount of a Methylobacterium strain or strains. In certain embodiments, the tag or label will identify the seed lot as comprising at least about 50%, 70%, 80%, 90%, 95%, 98%, or 99% of seeds having an increased crude fat, seed oil, and/or protein content in comparison to commodity seed.

    [0077] In certain embodiments of the methods provided herein, the seed lots harvested from mature plants grown from seeds and/or plants treated with an effective amount of a Methylobacterium strain or strains are segregated from other seed lots comprising commodity seed that has not been uniformly subjected to such Methylobacterium treatments. Methods for achieving such segregation include: (1) planting and/or treating defined areas of a field with Methylobacterium-strain treated seed and/or with a Methylobacterium treatment (e.g., in furrow and/or foliar applications, soil drenches, and or any combination thereof); (2) separating the defined areas of a field from adjacent untreated areas with a unplanted or other border which permits separate harvest of seed from the mature plants; and/or (3) use of global position system (GPS) coordinates in the planting, treating, and or harvesting machinery to facilitate harvest of seed from mature plants grown from seeds and/or plants treated with an effective amount of a Methylobacterium strain or strains. Segregation and transfer of the seed lot to an oil and/or protein extraction plant, a food or feed ingredient manufacturing facility, or a food or feed manufacturing facility are also facilitated by use packaging, labelling, or tagging systems such as those described above.

    [0078] Seed lots comprising at least 50%, 70%, 80%, 90%, or 95% of the seeds harvested from mature plants grown from seeds and/or plants treated with an effective amount of a Methylobacterium strain or strains can also be used to obtain seed oil and/or seed protein-enriched fractions, to increase yield of protein- or oil-containing fractions from seed lots, to manufacture food or feed ingredients, or to manufacture food or feed. Schematic diagrams of certain seed processing methods are depicted in FIG. 1 (for Brassica sp, seeds including rapeseed and canola seed) and FIG. 2 (for soybean). FIGS. 1 and 2 are solely illustrative, as any seed processing methods can be employed. Such processes depicted in FIGS. 1 and 2 are also illustrative of processes which can be adapted for use with other oil seeds such as sunflower, flax, cotton, peanut, linseed, and the like. For example, cotton seed would be delinted in most instances where cottonseed was used as a feedstock.

    [0079] Food or feed ingredients obtained from the seed lots provided herein include crude or refined seed oil, pressed seed cake, pressed or double pressed seed meal, defatted or partially defatted seed meal or flakes, solvent extracted seed meal, desolventized seed meal, expandate resulting from passing processed seed materials through an expander, extrudate resulting from passage of processed seed materials through an extruder, and the like. In certain embodiments, the feed ingredients can comprise pressed seed cake or meal, defatted or partially defatted seed meal, solvent extracted seed meal, desolventized seed meal, expandate, or extrudate, which has been pelletized. An oil-enriched fraction obtained by the methods provided herein can thus comprise a crude oil (e.g., oil obtained from seed by a mechanical pressing or expelling of seed or a processed product thereof), a seed oil containing solvent fraction, or a desolventized oil obtained from a seed oil containing solvent fraction. Seed oil containing solvent fractions can be obtained by extraction of processed seed lot products with solvents such as hexane (e.g., mixed hexanes). Seed oil can also be prepared by supercritical fluid extraction (SFE; e.g., supercritical CO.sub.2) of processed seed lot products. Supercritical fluid extraction (e.g., supercritical CO.sub.2) of processed seed lot products methods described in the literature (e.g., Jokid et al., 2012) can be adapted for use with feedstock comprising seed lots provided herein. Processed seed lot products that can be subject to mechanical pressing or expelling and/or to solvent extraction include dehulled, delinted, crushed, macerated, and/or ground seed, expandate, and extrudate. Expandate is obtained by passage of seed materials through expanders, which subject processed seed material to high pressure, shear forces, and high temperatures for short time intervals of about a minute through steam injection. Commercial expanders include an Anderson oilseed expander (Anderson International, Stow, Ohio, USA), Andritz Expander (Andritz, Graz, Austria), Kahl expander (Amandus Kahl USA, Atlanta, Ga.), and the like. As used herein, an extrudate is defined as a material that is obtained by subjecting a seed material to pressure and/or shear forces without steam injection. A protein-enriched fraction produced by the methods provided herein can thus include pressed seed cake, pressed or double pressed seed meal, defatted or partially defatted seed meal or flakes, solvent extracted seed meal, desolventized seed meal, or expandate. A protein-enriched fraction can also include an aqueous fraction obtained by extracting dehulled, delinted, crushed, macerated, and/or ground seed, expandate, pressed seed cake, pressed or double pressed seed meal, defatted or partially defatted seed meal or flakes, solvent extracted seed meal, desolventized seed meal, and/or extrudate with water, a buffered aqueous solution, an acidic aqueous solution, a basic aqueous solution, or a salt-containing solution.

    [0080] Processed or unprocessed food or feed ingredients obtained from seed lots comprising at least 50%, 70%, 80%, 90%, or 95% of the seeds harvested from mature plants grown from seeds and/or plants treated with an effective amount of a Methylobacterium strain or strains can be used as ingredients in methods of making a food or feed with improved mineral nutrient, vitamin, oil and/or protein content. In certain embodiments, such processed food or feed ingredients can comprise dehulled, delinted, crushed flaked, defatted or partially defatted seed meal or seed cake, non-defatted seed meal from the seed lot or an oil and/or a protein enriched fraction from the seed lot. In certain embodiments, such unprocessed food ingredients can comprise whole seed from the seed lot. In certain embodiments, whole seed can be combined with silage, seed meal, additional vitamins (e.g., vitamins A, D, and/or E), additional mineral nutrients (e.g., calcium, sodium, iron, magnesium, manganese, cobalt, selenium, dyes, and/or amino acids (e.g., methionine and/or lysine) to provide animal feed. Such food or feed ingredients obtained from the seed lot can be incorporated into a food or feed by steps comprising at least one of combining, mixing, heating, extruding, pelletizing, molding, and or forming that food or feed ingredient into a food or feed product. In certain embodiments, the food or feed ingredients obtained from the seed lot can be incorporated into a food or feed with another food or feed ingredient by steps comprising at least one of combining, mixing, heating, extruding, pelletizing, molding, and or forming the food or feed ingredients into a food or feed product. Additional food or feed ingredients that can be incorporated into the food of feed product in combination with food or feed ingredients obtained from the seed lot include starches, hydrolyzed starches, modified starches, sugars, fiber, emulsifiers, flavorants, additional vitamins (e.g., vitamins A, D, and/or E), additional mineral nutrients (e.g., calcium, sodium, iron, magnesium, manganese, cobalt, selenium, dyes, amino acids (e.g., methionine and/or lysine), antimicrobial agents, and the like. Methods and compositions for making food-, pet food- or feed compositions comprising pellets, emulsions, fat compositions, and the like disclosed in U.S. Patent Appl. Pub. Nos. US20180125101, US20180103654, and/or US20170112159, which are each incorporated herein in their entireties, can be adapted for use with the food and feed ingredients provided herein to make food or feed products.

    [0081] Seed lots comprising at least 50%, 70%, 80%, 90%, or 95% of the seeds harvested from mature plants grown from seeds and/or plants treated with an effective amount of a Methylobacterium strain or strains can be used as feedstock to increase yield of oil in oil-enriched fractions in comparison to the yield obtained when control seed lots are used as feedstock. In this embodiment, oil yield is defined as the amount of oil in an oil-enriched fraction obtained per unit of seed lot feedstock used in an oil extraction process. In certain embodiments, oil yield can be expressed as the mass, or weight of oil in an oil-enriched fraction obtained from an oil extraction process per kilogram seed used in the process. In certain embodiments, oil yield can be expressed as the mass, or weight of oil in an oil-enriched fraction obtained from an oil extraction process per seed or per bushel of seed used in the process. In other embodiments, oil yield can be expressed as a volume of oil obtained or present in an oil-enriched fraction per kilogram seed used in the process. Separation steps that can be used in an oil extraction process to obtain an oil-enriched fraction can include mechanical pressing or expelling of seed or a processed seed product (e.g., non-defatted seed meal, flakes, expandate, or extrudate) to obtain a crude oil fraction. Separation steps that can be used to obtain an oil-enriched fraction can also include solvent or SFE extraction of a processed seed product (e.g., non-defatted seed meal, flakes, expandate, or extrudate) to obtain an oil-enriched fraction. In certain embodiments, seed oil yield can be improved relative to controls even with reduced energy inputs into an oil extraction process by using the aforementioned seed lots as feedstock. In certain embodiments, seed oil yield can be improved when temperatures of oil extraction processes (e.g., pressing, expansion, or extrudation) are reduced by at least 1%, 2%, 5%, 10%, or 20% in comparison to processes where a control seed lot (e.g., a seed lot obtained from plants or plants grown from seeds that were not treated with Methylobacterium) is processed under reduced temperatures. In certain embodiments, seed oil yield can be improved when temperatures of oil extraction processes (e.g., pressing, expansion, or extrudation) are reduced by about 1%, 2%, or 5%, to 10%, 20%, 30%, 40%, or 50% in comparison to processes where a control seed lot (e.g., a seed lot obtained from plants or plants grown from seeds that were not treated with Methylobacterium) is processed under the same reduced temperatures. In certain embodiments, seed oil yield can be improved when energy inputs into an oil extraction process are reduced by at least 1%, 2%, 5%, 10%, or 20% in comparison to processes where a control seed lot (e.g., a seed lot obtained from plants or plants grown from seeds that were not treated with Methylobacterium) is processed under the same reduced energy input conditions. In certain embodiments, seed oil yield can be improved when energy inputs into an oil extraction process are reduced by about 1%, 2%, or 5%, to about 10%, 20%, 30%, 40%, or 50% in comparison to processes where a control seed lot (e.g., a seed lot obtained from plants or plants grown from seeds that were not treated with Methylobacterium) is processed under the same reduced energy input conditions.

    [0082] Seed lots comprising at least 50%, 70%, 80%, 90%, or 95% of the seeds harvested from mature plants grown from seeds and/or plants treated with an effective amount of a Methylobacterium strain or strains can be used as feedstock to increase yield of protein in protein-enriched fractions in comparison to the yield obtained when control seed lots are used as feedstock in a protein extraction process. In this embodiment, protein yield is defined as the amount of protein in a protein-enriched fraction obtained per unit of seed lot feedstock used in a protein extraction process. In certain embodiments, protein yield can be expressed as the mass or weight of protein in a protein-enriched fraction obtained in a protein extraction process per kilogram seed used in the process. Separation steps that can be used to obtain a protein-enriched fraction can include delinting and/or dehulling of seed to obtain a protein-enriched fraction comprising delinted and/or dehulled whole seed. Separation steps that can be used to obtain a protein-enriched fraction can also include grinding, macerating, flaking, and/or drying of whole, delinted, or dehulled seed to obtain a protein enriched product comprising seed meal, flakes, and the like which can be non-defatted, defatted, or partially defatted. Separation steps that can be used to obtain a protein-enriched fraction can include mechanical pressing or expelling of seed or a processed seed product (e.g., non-defatted seed meal, flakes, expandate, or extrudate) to obtain a protein-enriched fraction comprising pressed seed meal or a seed cake. Separation steps that can be used to obtain a protein-enriched fraction can also include solvent or SFE extraction of a processed seed product (e.g., non-defatted seed meal, flakes, expandate, or extrudate) to obtain a protein-enriched fraction comprising defatted or partially defatted seed meal, flakes, expandate, or extrudate. In certain embodiments, seed protein yield can be improved relative to controls even with reduced energy inputs into a protein-enrichment process by using the aforementioned seed lots as feedstock. In certain embodiments, seed protein yield can be improved when temperatures of protein enrichment processes (e.g., pressing, expansion, or extrudation) are reduced by at least 1%, 5%, 10%, or 20% in comparison to processes where a control seed lot is processed under reduced temperatures. In certain embodiments, seed protein yield can be improved when temperatures of protein enrichment processes (e.g., pressing, expansion, or extrudation) are reduced by about 1%, 2%, or 5% to about 10% 20%, 30%, 40%, or 50% in comparison to processes where a control seed lot is processed under the same reduced temperatures. In certain embodiments, seed protein yield can be improved when energy inputs into an oil extraction process are reduced by at least 1%, 5%, 10%, or 20% in comparison to processes where a control seed lot is processed under the same reduced temperatures. In certain embodiments, seed protein yield can be improved when energy inputs into an oil extraction process are reduced by about 1%, 2%, or 5% to about 10%, 20%, 30%, 40%, or 50% in comparison to processes where a control seed lot is processed under the same reduced energy input conditions.

    [0083] Seed, seed lots, food ingredients, and feed ingredients with increased oil content are provided as are methods for obtaining and using such seed, seed lots, food ingredients, and feed ingredients. In certain embodiments, the oil content of the seed, seed lots, food ingredients, and feed ingredients is increased by at least about 0.5%, 1%, or 2% per gram dry or wet weight of the in comparison to oil content of a control seed, seed lot, food ingredient, or feed ingredient. In certain embodiments, oil content of the seed, seed lots, food ingredients, and feed ingredients is increased by about 0.5%, 1%, or 2% to about 3%, 4%, 5%, 6%, 7%, 8%, 9%, or 10% per gram dry or wet weight of seed, seed lots, food ingredients, and feed ingredients in comparison to oil content of a control seed, seed lot, food ingredient, or feed ingredient. Controls include seed or seed lots harvested from mature control plants grown from an untreated control seed or untreated control plant as well as food and feed ingredients obtained from these control seed or seed lots.

    [0084] Seed, seed lots, food ingredients, and feed ingredients with increased protein content are provided as are methods for obtaining and using such seed, seed lots, food ingredients, and feed ingredients. In certain embodiments, protein content is increased by at least about 0.5%, 1%, or 2% per gram dry or wet weight of the seed, seed lots, food ingredients, and feed ingredients in comparison to protein content of a control seed, seed lot, food ingredient, or feed ingredient. In certain embodiments, protein content of the seed, seed lots, food ingredients, and feed ingredients is increased by about 0.5% to about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or 10% per gram dry or wet weight of the seed, seed lots, food ingredients, and feed ingredients in comparison to protein content of a control seed, seed lot, food ingredient, or feed ingredient. Controls include seed or seed lots harvested from mature control plants grown from an untreated control seed or untreated control plant as well as food and feed ingredients obtained from these control seed or seed lots.

    [0085] Seed, seed lots, food ingredients, and feed ingredients with both increased oil and protein content are also provided as are methods for obtaining and using such seed, seed lots, food ingredients, and feed ingredients. In certain embodiments, protein content is increased by at least about 0.5%, 1%, or 2% per gram dry or wet weight of the seed, seed lots, food ingredients, and feed ingredients in comparison to protein content of a control seed, seed lot, food ingredient, or feed ingredient and oil content is increased by at least about 0.5%, 1%, or 2% per gram dry or wet weight of the in comparison to oil content of a control seed, seed lot, food ingredient, or feed ingredient. In certain embodiments, protein content is increased by about 0.5% to about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or 10% per gram dry or wet weight of the seed, seed lots, food ingredients, and feed ingredients in comparison to protein content of a control seed, seed lot, food ingredient, or feed ingredient and oil content is increased by about 0.5%, 1%, or 2% to about 3%, 4%, 5%, 6%, 7%, 8%, 9%, or 10% per gram dry or wet weight of the seed, seed lots, food ingredients, and feed ingredients in comparison to oil content of a control seed, seed lot, food ingredient, or feed ingredient. Controls include seed or seed lots harvested from mature control plants grown from an untreated control seed or untreated control plant as well as food and feed ingredients obtained from these control seed or seed lots.

    [0086] Plants, plant parts, food ingredients, and feed ingredients having increased levels of at least one mineral nutrient and/or at least one vitamin in comparison to a control plant, plant part, or feed ingredient are provided, as are methods for obtaining and using such plants, plant parts, food ingredients, and feed ingredients. In certain embodiments, the content of at least one mineral nutrient and/or at least one vitamin in the plants, plant parts, food ingredients, and feed ingredients is increased by at least about 1%, or 2% to about 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, or 30% per gram dry or wet weight in comparison to the content of the at least one mineral nutrient and/or at least one vitamin in a control plant, plant part, food ingredient, or feed ingredient. In other embodiments, the content of at least one mineral nutrient and/or at least one vitamin in the plants, plant parts, food ingredients, and feed ingredients is increased by more than 30%, including 35%, 40%, 45%, 50% or greater than 50% in comparison to the content of the at least one mineral nutrient and/or at least one vitamin in a control plant, plant part, food ingredient, or feed ingredient. In some embodiments, the content of more than one mineral nutrient and/or more than one vitamin is increased in a plant, plant part, food ingredient, and feed ingredient, and percent increases can vary for each of the mineral nutrients and/or vitamins, with each increased mineral nutrient and vitamin being increased by at least about 1%, or 2% to about 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, or 30% or more per gram dry or wet weight. Controls include plants or plant parts harvested from control plants grown from an untreated control seed or untreated control plant as well as food and feed ingredients obtained from these control plants or plant parts.

    [0087] The mineral nutrient, vitamin, crude fat, oil, and/or protein content of whole seed, protein-enriched fractions, oil-enriched fractions, food ingredients, feed ingredients, and the like obtained from seed lots comprising at least 50%, 70%, 80%, 90%, or 95% of the seeds harvested from mature plants grown from seeds and/or plants treated with an effective amount of a Methylobacterium strain or strains can be determined by a variety of different techniques or combinations of techniques. Crude fat can be determined by methods comprising diethyl ether extraction of a dried sample, evaporation of the diethyl ether, and weighing the dried material recovered from the diethyl ether extract (Theix et al., 2003). Examples of crude fat determination methods include AOAC (formerly Association of Official Analytical Chemists) 920.39 and AACC (formerly American Association of Cereal Chemists) 30-20. Oil content can be determined by methods comprising nuclear magnetic resonance (NMR), near infrared spectroscopy (NIRS), gas-chromatography-mass spectroscopy (GC-MS), gas-chromatography-flame ionization detection (GC-FID), thin layer chromatography-flame ionization detection, liquid chromatography (LC)-mass spectroscopy (MS), liquid chromatography (LC)-electrospray ionization (EI)-mass spectroscopy (MS), or liquid chromatography (LC)-electrospray ionization (EI)-tandem mass spectroscopy (MS). Methods of determining oil content of seeds in general and single seeds by NIRS disclosed in U.S. Patent Appl. Pub. US20190003931, incorporated herein by reference in its entirety, can be adapted for use in the methods disclosed herein. Protein content can be determined by methods comprising nuclear magnetic resonance (NMR), near infrared spectroscopy (NIRS), a colorimetric assay, liquid chromatography (LC)-mass spectroscopy (MS), or matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF). Assays for protein content can include colorimetric assays such as Lowry (Hartree, E. F., 1972) and Bradford (Bradford, 1976) assays. Protein content can also be determined indirectly by amino acid analysis or nitrogen determination (Maehre, et al., 2018). Nitrogen-based protein content determination methods include Dumas (Dumas, 1831) and Kjeldahl (Kjeldahl, 1883) methods. Nitrate and nitrite nitrogen content determination methods include Cadmium Reduction and Colorimetric analysis by Flow Injection system (Lachat); AOAC 968.07. Mineral Digestion can be accomplished by Open Vessel Microwave SW846-3051A (AOAC 991-10D(e)). Mineral analysis can be conducted by Inductively Coupled Argon Plasma (ICAP); AOAC 985.01. Mineral nutrients, vitamins, crude fat, oil, and protein content of seeds and various foods, feeds, feed ingredients, and food ingredients can also be determined by standard methods set forth by the AACC, AOAC in Official Methods of Analysis of AOAC INTERNATIONAL, 21st Edition (2019) and in the Codex Alimentarius of International Food Standards set forth by the Food and Agriculture Organization of the United Nations (FAO) or WHO (CXS 234-19991, Adopted in 1999).

    EXAMPLES

    Example 1. Effects of Methylobacterium Strain ISO10 (NRRL B-50938) Treatment of Soybean on Harvested Soybean Quality

    [0088] Soybean seeds (treated with standard seed applied fungicides and insecticides) were over-treated with Methylobacterium strain ISO10 at a rate of 10.sup.6 CFU per seed (NRRL B-50938) and grown at five distinct field locations in the Midwestern United States in the summer of 2018 in parallel with untreated control soybean plants. Locations were Cedar Falls, Iowa, Miami, Mo., Dana, Iowa, Whitewater, Wis. and Aurora, Nebr. Seed was harvested from the treated and untreated control (UTC) soybean plants and assayed for micro- and macronutrient compositions. The results of the experiments are shown in FIG. 3 (percentage (%) nitrogen), FIG. 4 percentage (%) crude protein), FIG. 5 (percentage (%) crude fat), FIG. 6 (percentage (%) Magnesium), FIG. 7 percentage (%) Potassium), and FIG. 8 (percentage (%) Boron). Welch's two-tailed t-test with Location as a random effect was used for all statistical contrasts. Grain was combined for all ISO10 and UTC plots at each of five (5) locations, giving a sample size of 5 observations per treatment for every variable. Nutrient and crude fat/protein contents were measured as the percentage of dry weight of the sample.

    [0089] Across the full panel of macro- and micronutrients tested and across crude protein & fat, ISO10 significantly altered the grain nutrient and quality profiles relative to the Untreated Control (UTC) (Table 2). Importantly, crude fat (determined by AACC\30-20) increased by 7.2% (p<0.0001) with ISO10 treatment. Crude protein and grain nitrogen contents (determined by AOAC (968.06) were higher with ISO10 treatment (0.7% increase for both, at significance levels of p=0.055 and 0.042, respectively). Grain magnesium content (determined by AOAC 975.03B(b)/AOAC 985.01) also increased significantly with ISO10 treatment (3.1% increase at p=0.0021). ISO10 treatment resulted in a significantly lower grain potassium content (3.3% decrease at p=0.0098) and marginally lower grain boron content (6.3% decrease at p=0.07) (as determined by AOAC 975.03B(b)/AOAC 985.01). Other macro- and micronutrients did not differ significantly between the ISO10 treatment and the UTC.

    TABLE-US-00002 TABLE 2 Mean nutrient contents on a dry weight basis, percent difference of ISO10 from UTC, and contrast p-values. % dif- Con- Nutrient ISO10 UTC ference trast type Nutrient (units) value value from UTC p-value Macro- Nitrogen (%) 6.392 6.348 +0.7% custom-character nutrient Phosphorus (%) 0.624 0.644 −3.2% 0.17 Potassium (%) 2.246 2.320 −3.3% custom-character Calcium (%) 0.390 0.356 +8.7% 0.40 Magnesium (%) 0.322 0.312 +3.1% custom-character Sulfur (%) 0.342 0.338 +1.2% 0.43 Micro- Zinc (ppm) 40 40 0 1.00 nutrient Manganese (ppm) 36.4 36.4 0 1.00 Iron (ppm) 79.6 78.0 +2.0% 0.57 Copper (ppm) 13.6 13.2 +2.9% 0.43 Boron (ppm) 37.8 40.2 −6.3% 0.071 Crude protein (%) 39.944 39.680 +0.7% 0.055 Crude fat (%) 18.512 17.272 +7.2% custom-character Bold italics indicate p < 0.05.

    Example 2. Effects of Methylobacterium Strain ISO10 (NRRL B-50938) Treatment of Soybean Seeds on Nutrient Content of Vegetative Tissue

    [0090] Soybean seeds were treated with Methylobacterium strain ISO10 at a rate of 10.sup.6 CFU per seed and grown in sterilized soil (30 seeds per flat) in a greenhouse in parallel with untreated soybean seeds. At 22 days after planting (V1 growth stage), 25 plants per flat were chosen randomly and the youngest fully expanded trifoliate leaf was cut off of each plant. The trifoliates were incubated in sample bags at 45° C. for 4 days to dry and analyzed (Table 3) for macronutrient and micronutrient content. A single-tailed unequal variances (Welch's) t-test was used to determine whether treatment with ISO10 resulted in a significant increase in nutrient content. Iron showed a significant enhancement relative to the UTC. Mean foliar iron content was 7.7% greater following treatment with ISO10, a statistically significant difference (p=0.0403). Results are shown in FIG. 9.

    TABLE-US-00003 TABLE 3 Mean nutrient contents on a dry weight basis, percent difference of ISO10 from UTC, and contrast p-values. % dif- Con- Nutrient ISO10 UTC ference trast type Nutrient (units) value value from UTC p-value Macro- Nitrogen (%) 3.034 3.064 −1.0% 0.71 nutrient NO3—N (%) 0.0038 0.0050 −24.0% 0.92 Phosphorus (%) 0.151 0.154 −1.9% 0.74 Potassium (%) 2.573 2.577 −0.2% 0.56 Calcium (%) 1.615 1.606 +0.6% 0.41 Magnesium (%) 0.522 0.517 +1.0% 0.39 Sulfur (%) 0.182 0.180 +1.1% 0.31 Micro- Zinc (ppm) 21.8 21.6 +0.9% 0.38 nutrient Manganese (ppm) 98.6 95.7 +3.0% 0.17 Iron (ppm) 132.1 122.7 +7.7% custom-character Copper (ppm) 5.4 5.5 −1.8% 0.63 Boron (ppm) 42.7 43.5 −1.8% 0.76 Bold italics indicate p < 0.05.

    Example 3. Effects of Methylobacterium Strain ISO20 (NRRL B-67743) Treatment of Corn on Nutrient Content of Vegetative Tissue

    [0091] Corn seeds were treated with Methylobacterium strain ISO20 at a rate of 10.sup.6 CFU per seed and grown in sterilized soil (30 seeds per flat) in a greenhouse in parallel with untreated corn seeds. At 22 days after planting (V2 growth stage), 15 or more plants per flat were chosen randomly and shoots were collected by cutting one inch above the soil line. The shoots were incubated in sample bags at 45° C. for 4 days to dry and analyzed for macronutrient and micronutrient content. A single-tailed unequal variances (Welch's) t-test was used to analyze the data to determine whether treatment with ISO15 resulted in a significant increase in nutrient content. Methylobacterium ISO15 significantly enhanced foliar content of four nutrients: phosphorus (P), potassium (K), iron (Fe) and manganese (Mn). Of the 12 nutrients tested, 9 were elevated over the UTC by treatment with ISO15. Results are shown in Table 4 and FIGS. 10-13.

    TABLE-US-00004 TABLE 4 Mean nutrient contents on a dry weight basis, percent difference of ISO20 from UTC, and contrast p-values. % ISO20 UTC difference Contrast Nutrient (units) value value from UTC p-value Nitrogen (%) 1.466 1.465 +0.1% 0.49 NO3—N (%) 0.0024 0.0021 +14.3% 0.17 Phosphorus (%) 0.227 0.201 +12.9% custom-character Potassium (%) 5.20 4.90 +6.1% custom-character Calcium (%) 0.839 0.815 +2.9% 0.28 Magnesium (%) 0.254 0.251 +1.2% 0.38 Sulfur (%) 0.216 0.226 −4.4% 0.80 Zinc (ppm) 22.8 21.6 +5.6% 0.15 Manganese (ppm) 136.3 122.3 +11.4% custom-character Iron (ppm) 89.3 75.6 +18.1% custom-character Copper (ppm) 6.13 6.33 −3.2% 0.73 Boron (ppm) 5.47 5.53 −1.1% 0.57 Bold italics indicate p < 0.05.

    Example 4 Detection or Identification of Methylobacterium Strains, Variants and Derivatives

    [0092] Assays are disclosed for detection or identification of specific Methylobacterium strains and closely related derivatives. Genomic DNA fragments unique to a Methylobacterium strain are identified and qPCR Locked Nucleic Acid (LNA) based assays are developed.

    [0093] Genomic DNA sequences of Methylobacterium strains are compared by BLAST analysis of approximately 300 bp fragments using a sliding window of from 1-25 nucleotides to whole genome sequences of over 1000 public and proprietary Methylobacterium isolates. Genomic DNA fragments are identified that have weak BLAST alignments, indicative of approximately 60-95% identity over the entire fragment, to corresponding fragments of a Methylobacterium of interest. Fragments from the NLS0109 genome corresponding to the identified weak alignment regions were selected for assay development and are provided as SEQ ID NOS: 1-3.

    TABLE-US-00005 TABLE 5 Target Fragment Sequences of NLS0109 SEQ ID Fragment NO Sequence ref1_135566 1 ACGGTCACCCCACGGACTGGGCGAGTACCTCACCGGTGTTCTA TCATAACGCCGAGTTAGTTTTCGACCGTCCCTTATGCGATGTA CCACCGGTGTCGGCAGCCGATTTCGTCCCACCGGGAGCTGGCG TTCCGGTTCAGACCACCATCATCGGTCACGATGTCTGGATTGG ACACGGGGCCTTCATCTCCCCCGGCGTGACTATAGGAAACGGC GCGATCGTCGGGGCCCAGGCGGTCGTCACAAGAGATGTCCCA CCCTATGCGGTAGTTGCTGGCGTCCCCGCGACCGTACGACGAT ref1_135772 2 CCAATAAAAGCGTTGGCCGCCTGGGCAACCCGATCCGAGCCT AAGACTCAAAGCGCAAGCGAACACTTGGTAGAGACAGCCCGC CGACTACGGCGTTCCAGCACTCTCCGGCTTTGATCGGATAGGC ATTGGTCAAGGTGCCGGTGGTGATGACCTCGCCCGCCGCAAGC GGCGAATTACTCGGATCAGCGGCCAGCACCTCGACCAAGTGT CGGAGCGCGACCAAAGGGCCACGTTCGAGGACGTTTGAGGCG CGACCAGTCTCGATAGTCTCATCGTCGCGGCGAAGCTGCACCT CGA ref1_169470 3 CGATGGCACCGACCTGCCATGCCTCTGCCGTCCGCGCCAGAAT GGTAAAGAGGACGAAGGGGGTAAGGATCGTCGCTGCAGTGTT GAGCAGCGACCAGAGAAGGGGGCCGAACATCGGCATCAAACC TCGATTGCCACTCGGACGCGAAGCGCGTCTTGAAGGAGGGAT GGAAGCGAAACGGCCGCAGAGTAACCGCCGACGAAAGATTGC ACCCCTCATCGAGCAGGATCGGAGGTGAAGGCAAGCGTGGGT TATTGGTAAGTGCAAAAAATATAATGGTAGCGTCAGATCTAGC GTTC

    [0094] Regions in SEQ ID NOS: 1-3 where corresponding regions in other Methylobacterium strains were identified as having one or more nucleotide mismatches from the NLS0109 sequence were selected, and qPCR primers designed using Primer3 software (Untergasser et al. (2012), Koressaar et al. (2007)) to flank the mismatch regions, have a melting temperature (Tm) in the range of 55-60 degrees, and to generate a PCR DNA fragment of approximately 100 bp. The probe sequence was designed with a 5′ FAM reporter dye, a 3′ Iowa Black FQ quencher, and contains one to six LNA bases (Integrated DNA Technologies, Coralville, Iowa). At least 1 of the LNA bases is in the position of a mismatch, while the other LNA bases are used to raise the Tm. The Tm of the probe sequence is targeted to be 10 degrees above the Tm of the primers. Primer and probe sequences for detection of specific detection of NLS0109 are provided as SEQ ID NOS: 4-12 in Table 6. Each of the probes contains a 5′ FAM reporter dye and a 3′ Iowa Black FQ quencher.

    TABLE-US-00006 TABLE 6 Primer and Probe Sequences for Specific Detection of NLS0109 SEQ ID Primer/Probe NO Sequence* NLS0109_ref1_135566_forward 4 CCTCACCGGTGTTCTA TCATAAC NLS0109_ref1_135566_reverse 5 CCGATGATGGTGGTCT GAAC NLS0109_ref1_135566_probe 6 CGTCCCTTATGCGATG TACCA NLS0109_ref1_135772_forward 7 GATCCGAGCCTAAGAC TCAAAG NLS0109_ref1_135772_reverse 8 GACCAATGCCTATCCG ATCAA NLS0109_ref1_135772_probe 9 AACACTTGGTAGAGAC AGCC NLS0109_ref1_169470_forward 10 AAGGAGGGATGGAAGC GAAAC NLS0109_ref1_169470_reverse 11 ATAACCCACGCTTGCC TTC NLS0109_ref1_169470_probe 12 CGCAGAGTAACCGCCG ACGAA *Bold and underlined letters represent the position of an LNA base

    [0095] Use of Primer/Probe Sets on Isolated DNA to Detect NLS0109 and Distinguish from Related Methylobacterium Isolates

    [0096] Each 10 ul qPCR reaction contains 5 ul of Quantabio PerfeCTa qPCR ToughMix 2× Mastermix, Low ROX from VWR, 0.5 ul of 10 uM forward primer, 0.5 ul of 10 uM reverse primer, 1 ul of 2.5 uM probe, 1 ul nuclease free water and 2 ul of DNA template. Approximately 1 ng of DNA template is used per reaction. The reaction is conducted in a ThermoFisher QuantStudio™ 6 Flex Real-Time PCR System with the following program: 95° C. for 3 min, then 40 cycles of 95° C. for 15 sec and 60° C. for 1 min. The analysis software on the PCR instrument calculates a threshold and Ct value for each sample. Each sample was run in triplicate on the same qPCR plate. A positive result is indicated where the delta Ct between positive and negative controls is at least 5.

    [0097] Use of the three primer/probe sets to distinguish NLS0109 from closely related isolates by analysis of isolated DNA is shown in Table 7 below. The similarity score shown for the related isolates takes into account both the average nucleotide identity and the alignment fraction between the isolates and NLS0109. One of the tested strains, NLS0730, was used as an additional positive control. NLS0730 is a clonal isolate of NLS109 which was obtained from a culture of NLS0109, which was confirmed by full genome sequencing as identical to NLS0109, and which scored positive in all three reactions. The similarity score of greater than 1.000 for this strain is likely the result of a slightly different assembly of the genome for this isolate compared to NLS0109. The delta Ct of approximately 15 or more between the NLS0109 and NLS0730 isolates and the water only control is consistent with the sequence confirmation of the identity of these isolates. Analysis of other isolates that are less closely related to NLS0109 results in delta Ct values similar to those for the water only control.

    TABLE-US-00007 TABLE 7 Similarity score Average Ct Value NLS# to NLS0109 Ref1_135566 Ref1_135772 Ref1_169470 NLS0730 1.005 21.08 21.31 20.35 NLS0109 1 21.97 22.62 22.08 NLS0731 0.181 No Ct 37.85 >37.91 NLS0644 0.87 >36.8  >38.31 No Ct NLS0700 0.88 >38.36 >38.36 >38.44 NLS0710 0.894 No Ct >37.47 >38.13 NLS0834 0.852 37.81 No Ct 37.97 NLS0939 0.862 37.94 38.37 >38.35 NLS0947 0.807 38.44 No Ct No Ct NLS1015 0.894 38.77 No Ct >37.91 NLS1217 0.872 37.64 37.20 37.96 H2O only >38.14  >35.92 >37.12

    [0098] Use of Primer/Probes for Detection of NLS109 on Treated Plant Materials.

    [0099] For detection of NLS0109 foliar spray treatment on corn: Untreated corn seeds were planted in field soil in the growth chamber and watered with non-fertilized R.O. water. After plants germinated and grew for approximately 3 weeks, they were transferred to the greenhouse. At V5 stage, plants were divided into 3 groups for treatment: foliar spray of NLS0109, mock foliar spray, and untreated. Plants receiving the foliar spray of NLS0109 were treated with 10× glycerol stock at the rate of 71.4 ul per plant using Solo sprayers. This converts to the rate of 10 L/acre in the field. Mock treated plants were sprayed with 71.4 ul water/plant. Untreated plants received no foliar spray treatment. Leaves were harvested two weeks after foliar spray treatment into sterile tubes and DNA from bacteria on the harvested leaves is isolated as described above. Each experiment was grown at least 2 times. As shown in Table 8, NLS0109 is detected on leaves harvested from corn plants treated by a foliar spray application of the Methylobacterium strains using all 3 primer probe sets, as demonstrated by delta Ct values of approximately 10 between the sample and the negative controls.

    TABLE-US-00008 TABLE 8 Average Ct Value Treatment Ref1_135566 Ref1_135772 Ref1_169470 Control (no application) 32.43 32.10 31.55 Control (mock application) 35.54 35.34 34.80 NLS0109 (10 L/acre equivalent) 23.36 22.88 22.66

    [0100] The above results demonstrate the use of genome specific primers and probes to detect Methylobacterium strain NLS0109 on various plant tissues following treatment with the strains and provide methods to distinguish NLS0109 from closely related isolates. Similar methods are developed for additional Methylobacterium strains, NLS0017, NLS0807, NLS0662 and NLS0648 using target sequence fragments and primer/probe pairs as shown in the Tables below.

    TABLE-US-00009 TABLE 9 Target Fragment Sequences of NLS0017 SEQ ID Fragment NO Sequence ref4_930 13 GCAAAACGACCTAATAGTTCTACAGCGGCATGC GCCAAGTCAGCGCGGTGAACAGTATACCTGGGA GCAACTTGTCCTCCGAAACCCACATAAAACAAA TTACTCCTGGCAGTGCCCAGTCCATCAAAATCG AATACAATATTTCTCGAGGAGGCATCTGTAATA GCCTGCCAAAGCAACAAAGCTATGGCGCCGTTA TGACTTTCATTGCTTCTGGTAGACATAAAATAA TATGCCGATTTGTGATCCCAAATGTAGAATATT GCCGCATCAATTGCGCCAAGTTTATTTCGGATC GAT ref1_142021 14 GGCGCCAACGGTATGATCGCATGATTTTCCTGC GGCATAGCTTGCGGGAATGGCGTATTTGGCGCT CTCCTCAGGAATTTCTAAGGGCATACGCAGGAA CTCTACAGCACTTTTACTGGTATTTTGTAGTGA CAGCGGAGGAGGCTGGTGCTCAAGGTAATCGTG ATGAAGTGATCCGGGCCATTCGGGGCGCGTTTC TAGTCTTTCCAATCCGCGCCCTGTACCACGTAT TACGCCGGACCGGTCTGCGCCGCGCCGCCCTCT TGACCGCCCTAAATGTCTAAGAGCGTCTAACAA AGC ref1_142636 15 GACGATATCGCTCATCTTCACTGCATTGAAGCT GGTGCCGTACTGCATAGGGATGAAAAAGTGATG CGGATAGACGGCTGACGGGAAAGCGCCTGGTCG ATCGAAGACTTTGCTGACGAGGTTGTGGTAGCC CCGGATATAGGCATCGAAGGCCGGGACGTTGAT CCCATCCTTTGCCTTATCTTGACTGGCGTCGTC GCGTGCCGTCAGAACGGGCACGTCGCAGGTCAT CGAGGCCAGCACCTTGCGGAACACCTGCGTTCC GCCGTTGGGATTATCGACGGCGAACGCGGTGGC CGC

    TABLE-US-00010 TABLE 10 Primer and Probe Sequences for Specific Detection of NLS0017 SEQ ID Primer/Probe NO Sequence* NLS0017_ref4_930_forward 16 GTCCTCCGAAACCCACAT AAA NLS0017_ref4_930_reverse 17 CTACCAGAAGCAATGAAA GTCAT NLS0017_ref4_930_probe 18 TCTGTAATAGCCTGCCAA AGCA NLS0017_ref1_142021_forward 19 GGCTGGTGCTCAAGGTAA T NLS0017_ref1_142021_reverse 20 ACATTTAGGGCGGTCAAG AG NLS0017_ref1_142021_probe 21 ATGAAGTGATCCGGGCCA T NLS0017_ref1_142636_forward 22 CCGTACTGCATAGGGATG AAA NLS0017_ref1_142636_reverse 23 TAAGGCAAAGGATGGGAT CAA NLS0017_ref1_142636_probe 24 TTGCTGACGAGGTTGTGG TAG *Bold and underlined letters represent the position of an LNA base

    TABLE-US-00011 TABLE 11 Target Fragment Sequences of NLS0807 SEQ ID Fragment NO Sequence ref1_458355 25 CAACTATGTAGACCCGACGGTGCGATTTCACTTCGCAAAGCCG CAGGGCAGCACCCTTGCGCTCAATGTTGACGCCAGCGTGATCT ATACTATTACCGTCACGCACACGCAGGGCGGCGTACAGATTCA TCGCGAGAGTAAGAACCACCATCAGACCATCACGCGCAGCGA CCTGAGCAAGCAGTTCGGCGTTGGTGTGGCCGACCAGCTGAC GCGCGATCAGGTCATGAAGGTGATCGAGTCGGCATTTCGCGA CGCTACCCGCTAAGATCGGCGCCCACGAAACGCTACGAGACT AGG ref1_459688 26 AGCCGGCATCTTGTTCAAGGCGCTCACCTCGACGCCGACGCTG TAGGCGACTTGAGAGGGCGTCTCATATGAACGAAGCATCTTCG CGTAGAGAACCTTCTTGTTCTCCTGCGTGATGTTCGCTTTGCAG ACGTTGACTGCCGCCATGAACGCCGAAGCCTTGCGCGCTTCAT CGTAATCGCCTGCGAAGGCGGGTAGTGAAAAGCTTAGTGCAA TGGCAAACACAGCCGCCGAACGTCGCATGGTATCCGTCCCCG ATTGACGGCAGTGCCGCCATATCTCGGCTTTAGCAGAGCTGAT ref1_3158527 27 AACCTGCGCCGGCCGAGGTTTCGCGAGCCGTCGCCACGGGCA ACGCCTCGCCCGCGATGTGCAAAAAAGTCCCCGGCACTTCGCG CCGTCGTCCGATCCACGACCGCGAATTTCTCAACGAGTACAAG GTGCTTATGGGAGATCCGAGCGTCCGTCCCGGAGCCCGAGAC CGCGCGGCCCGAGTAATAGGCGAAAAAGACTCCTACTCCTCG GGCTTCTCGGGCCCCCTCAGCAACATCTACGCTTGCCGCCCAT CACCCTGGCGGGAGATCAGCGACGAGACACAGGCCCACTTCG CCC

    TABLE-US-00012 TABLE 12 Primer and Probe Sequences for Specific Detection of NLS0807 SEQ ID Primer/Probe NO Sequence* NLS0807_ref1_458355_forward 28 TTGACGCCAGCGTGA TCTATAC NLS0807_ref1_458355_reverse 29 GTGATGGTCTGATGG TGGTTCT NLS0807_ref1_458355_probe 30 TATTACCGTCACGCA CACG NLS0807_ref1_459688_forward 31 CTTCGCGTAGAGAAC CTTCTTGTT NLS0807_ref1_459688_reverse 32 CTTCGCAGGCGATTA CGATGAA NLS0807_ref1_459688_probe 33 CGTGATGTTCGCTTT GCAGA NLS0807_ref1_3158527_forward 34 CCGCGAATTTCTCAA CGAGTACA NLS0807_ref1_3158527_reverse 35 GCCCGAGGAGTAGGA GTCTTT NLS0807_ref1_3158527_probe 36 AGGTGCTTATGGGAG ATCCG *Bold and underlined letters represent the position of an LNA base

    [0101] Use of the primer/probe sets to distinguish NLS0807 from closely related isolates by analysis of isolated DNA is shown in Table 13 below. The similarity score shown for the related isolates takes into account both the average nucleotide identity and the alignment fraction between the isolates and NLS0807. Two of the tested strains, NLS0821 and NLS0044, were used as additional positive controls since a similarity score of 1.00 indicates they are nearly identical to NLS0807. Consistently low Ct values from qPCR using NLS0807 as the DNA template and no detection in the water only control is consistent with the sequence confirmation of the identity of these isolates. Analysis of other isolates that are less closely related to NLS0807 results in no detection similar to those for the water only control.

    TABLE-US-00013 TABLE 13 Similarity to Average Ct Value NLS# NLS0807 ref1_459688 ref1_3158527 ref1_458355 NLS0807 1.00 22.39 24.09 23.10 NLS0821 1.00 22.49 24.04 22.96 NLS0044 1.00 22.49 23.86 22.90 Strain A 0.95 UDT UDT UDT Strain B 0.94 UDT UDT UDT Strain C 0.93 UDT UDT UDT Strain D 0.93 UDT UDT UDT water only (neg control) — UDT UDT UDT

    TABLE-US-00014 TABLE 14 Target Fragment Sequences of NLS0648 SEQ ID Fragment NO Sequence ref1_1185955 37 AGTCATTGATCAAGCAACCCCTATTGAGTTGGATATCGAAGGA TCAAGGTCGCGTCAATAGATGCATCTATCAGGCCAAATGTCGC TTTTCAAGAATGGCTCTTTCGAAGCTATCTTTATAATCGCTCGC CATTCTCTCATTACCAAAATCGACCTTAACTAGCTCGACATTG ATGCGAGCAGCTCCGGCAAACGAGGAGAGATTGACCTTAAAG GAATTGAACGCCTCAAGCAATTCAGACACATTACCAGGAGTG CTATAGCAACAACCAGACCCATATCGGTCAATAACCTCTTTTA ref1_3282585 38 CGCAAAACGATTTATCACTGCCATCTTGTTGTTTGATAACCCTT TTTTACCAGACGTTATGCTGGGCGAGAAAGAGGACTAGCAGA TCGGAGCGGTATCGCGATTTTTCGGTAGTTCGCGCCTACAACA GGATAAGATCCGATAGTGAAGCAACATGGCTGTTTTTTGATTT GTAAGTCAGCAACTTAAGCAGCCAGCCTATCTGCCGTCGCAGA CGCTTGAGGCATCGGGCAGCATCTTAGAAAAGGTGGCAGTAA TTGCCACAGCGGAACGTAGCGGCACGGATAAGCACGCAGGGT C ref1_4194637 39 CCCATCTGGACCCAATATCCCCTTCATCGACAATTCCCGAGTA AGTGTGGGTTCGAGGATTTCGCGAAACAGCCTTGTTCGTTCCT CCGGCCTTAAAATTGGCGTGCCGTCGGGAGATCGATAGGCATC CCTTACCTGCCTTTCGACCGCCGGCACACGCGCGCCGGTCGTC GTGTTCACGGCCACGGAATGGACGAAGGTGCGCCGCTCATTTC GCTCGTTTGCCGTCTCCACCATCCAGGAGGCCAGCAGGACGGT TTCGTCTCGACCGCCGGTCACACACACCGCAAGGGACTCAGG

    TABLE-US-00015 TABLE 15Primer and Probe Sequences for Specific Detection of NLS0648 SEQ ID Primer/Probe NO Sequence* NLS0648_ref1_1185955_forward 40 TCGCTCGCCATTCTC TCATTAC NLS0648_ref1_1185955_reverse 41 AGGTCAATCTCTCCT CGTTTGC NLS0648_ref1_1185955_probe 42 TCGACATTGATGCGA GCA NLS0648_ref1_3282585_forward 43 TTCGCGCCTACAACA GGATAAG NLS0648_ref1_3282585_reverse 44 CAGATAGGCTGGCTG CTTAAGTT NLS0648_ref1_3282585_probe 45 TCCGATAGTGAAGCA ACA NLS0648_ref1_4194637_forward 46 GAGTAAGTGTGGGTT CGAGGATTT NLS0648_ref1_4194637_reverse 47 AGGTAAGGGATGCCT ATCGATCT NLS0648_ref1_4194637_probe 48 CGGAGGAACGAACAA GGC *Bold and underlined letters represent the position of an LNA base

    TABLE-US-00016 TABLE 16 Target Fragment Sequences of NLS0662 SEQ ID Fragment NO Sequence NLS0662_ref1_4871392 49 ACCTGCTAAAATCACGTCCTCTCAGATTGAAAAAT CATTGAAGAAACGTGTCGAACGATTGCCGGGGATT ATGACGTTAGATCAATTGAAAAATACAAGCTTTGA AATTGAGTTACAGCCAAAAGATGCCCCGGATCCGG ACCCATCAGACTTCGGTGGCTAGTTCGAGCCAAAC TCGAACGTCGCCATGGCGCGCAAGTCGCAATACCA TTTCACAGCGCAGCGGTTATTTCGTTGTACACTGTA GCAATGCGTCGGCTTGCGCGCTTCCGCTGGCGATC AAAGGTCCGCCGATTTACG NLS0662_ref1_1266930 50 TCCCGAACATACAATGGAGGAAGCGTGTGGTAGGC CAATTTGTAACGAAATATGGCATCGGTCACGGCTC TCTCAATAAATTCGATCTCAAGTCTTCTGAACGAG CATGCCTCATCCTTATCCTGAGCGAACGCCTGCCA GTTTGCAGTCATTCCAACATACATAGCCAAAAAGG CGAGGTAGACCTTCATACGGGCACCTCAATCGTCC CCATTCGTTCAAGCTCCTTCAAGATAACAGCCGCA CCACATTGCTGAGATCGAAGATTCGGATCAAATAT TCCATCAAATTTATACTTTC NLS0662_ref1_17614 51 GCATCCTTTGCGCTCGCAGGCCTAAGGTCAAGCCC GGTTACTTCGTTTGGTAGAACGAGGTAGACGATGC CTAGTCTTAAGGTGGCCCATGTTAACCAACAGGGC CAGAACATGATTATAGTTCCGTTAGATGCCAACTT CGGTTACAAAACCGATGGTGAGCAGTCCGACATCA TGTTCGAAATACAGGACGCGGCGCGGTCCGCCGGT CTTGCGGGTGCCGTAGTAGCGTTCTGGCAGTCAGG TGGACAAACCCGTTTCCGGGGCCCGGCTCCGTGGC ACCCATTCCTTCGCAGCCTC

    TABLE-US-00017 TABLE 17 Primer and Probe Sequences for Specific Detection of NLS0662 SEQ ID Primer/Probe NO Sequence* NLS0662_ref1_4871392_forward 52 GCGCAAGTCGCAAT ACCATTTC NLS0662_ref1_4871392_reverse 53 CGTAAATCGGCGGA CCTTTGA NLS0662_ref1_4871392_probe 54 CGCAGCGGTTATTT CGTTG NLS0662_ref1_1266930_forward 55 ACGAGCATGCCTCA TCCTTATC NLS0662_ref1_1266930_reverse 56 CGATTGAGGTGCCC GTATGAA NLS0662_ref1_1266930_probe 57 TGCCAGTTTGCAGT CATTCC NLS0662_ref1_17614_forward 58 CCCGGTTACTTCGT TTGGTAGAA NLS0662_ref1_17614_reverse 59 CGAAGTTGGCATCT AACGGAACTA NLS0662_ref1_17614_probe 60 TGGCCCATGTTAAC CAACAG *Bold and underlined letters represent the position of an LNA base

    [0102] Use of Primer/Probes for Detection of NLS0807 on Treated Plant Materials

    [0103] Detection of NLS0807 from In-Furrow Treated Corn Roots

    [0104] At planting, corn seeds in soil were drenched with NLS0807 and control strains from frozen glycerol stock to simulate in-furrow treatment. To obtain a final concentration of 10.sup.7 CFU/seed, 100 ul of each strain at 10.sup.8 CFU/ml is inoculated onto each seed placed in the dibble holes in soil. A 1/10 dilution series is made for lower concentration targets. For control treatment, 100 ul Milli-Q water is applied to each corn seed placed in the dibble holes in soil. Pots containing treated seeds are placed in a growth chamber for approximately two weeks and watered with unfertilized RO water every 1-2 days to keep soil moist. After 2 weeks of growth, roots of about 9 plants per replicate sample were harvested into sterile tubes. Each treatment had at least 2 replicate samples in each experiment, and each experiment was conducted at least 3 times.

    [0105] DNA from bacteria on the harvested corn roots is isolated as follows. Individual roots are submerged in 20 mL of phosphate-buffered saline (PBS) (137 mM NaCl, 10 mM Phosphate, 2.7 mM KCl, and a pH of 7.4) in 50 mL conical tubes. Tubes are vortexed for 10 minutes, and then sonicated for 10 minutes. Root tissue is removed, and the remaining supernatant from multiple roots of the same sample are combined and centrifuged at 7500×g for 10 minutes. This process is repeated until there is one tube for each sample. The moist soil pellet is vortexed until it evenly coats the tube wall. Tubes are placed into a laminar flow hood with caps removed and open ends of the tubes facing the air blowers. Once dry, samples are stored at room temperature. 250 mg dried soil is used as input for DNA extraction using Qiagen DNeasy PowerSoil HTP 96 kit (Cat #12955-4) using manufacturer protocols.

    [0106] Primers and probes for NLS0807 disclosed in Table 12 above are used in qPCR reactions to detect the presence of NLS0807 specific fragments provided in Table 11. Each 10 ul qPCR reaction contains 5 ul of Quantabio PerfeCTa qPCR ToughMix 2× Mastermix, Low ROX from VWR, 0.5 ul of 10 uM forward primer, 0.5 ul of 10 uM reverse primer, 1 ul of 2.5 uM probe, 1 ul nuclease free water and 2 ul of DNA template. Approximately 1 ng of DNA template is used per reaction. The reaction is conducted in a ThermoFisher QuantStudio™ 6 Flex Real-Time PCR System with the following program: 95° C. for 3 min, then 40 cycles of 95° C. for 15 sec and 60° C. for 1 min. The analysis software on the PCR instrument calculates a threshold and Ct value for each sample. Each sample is run in triplicate on the same qPCR plate. A positive result is indicated where the delta Ct between positive and negative controls is at least 5.

    [0107] Use of Primer/Probes for Detection of Variants of Additional Table 1 Methylobacterium Isolates

    [0108] Variants of Methylobacterium isolates listed in Table 1 are identified by the presence of DNA fragments as described above. Unique fragments for use in such methods are provided in Table 18.

    TABLE-US-00018 TABLE 18 SEQ ID Strain Fragment NO Sequence NLS0020 ref3_25009 61 GCCCTTCTGTCAGGCGATATTGTATAATGGCGTTGCCC CAATAGAAGCAGCCATTCGTGCGAGGGCAGCAGCGA CGCTAGGTCGAAAGAGCATCCTAATCTCGATCAAGAT GCGACTGAGATTTCTGATGAAAATATCTAGACACAAG CAAAGCTGGTGAAATTACAACGATCATGGCGACAATT GCGGCCAATTCGGCCGGAACTTGAAGGAACATAAAA ATGAATATTACAAATATACCGCAAAGCATGTAGAGTT GCTACACCAAGGGTCGGGACGTCCAAAAAAACTCACT GAGGA NLS0020 ref3_25219 62 GGAACATAAAAATGAATATTACAAATATACCGCAAA GCATGTAGAGTTGCTACACCAAGGGTCGGGACGTCCA AAAAAACTCACTGAGGAAGTCGACTGGAAGCACGAG GCGCCCCCCCCAGGAGCGGGGCGACCGGCAAGGGGG CCCGCAATTGTCGCCATGATCGACCAGCTTAGGTAGG ATCCTCTTTCGACCTAACGAATGGCTGCTTCTATTGGG GCAACGCCATTATACAATATCGCCTGACCATCTGGAA CGCGGCCCGGTCCACCGGCAGGTTGGCGACGACAGC GTCGGAG NLS0020 ref1_4361220 63 CGGCGTCGACCAGCCGGGCGAACTGCTTGGGCATGCT CTCCCGCGACGCCGGCCACAGCCGCGTCCCCGTCCCT CCGCACAGGATCATCGGGTGGATTTGAAAGGCAAAA CGGGACATCAGGATAGGCCGCTCAGGCGTTGGCGCTG AGGCGCTTGATGTCGGCGTCGACCATCTCGGTGATCA GCGCCTCGAGGCTGGTCTCGGCCTCCCAGCCGAAGGT CGCCTTGGCCTTGGCGGGGTTGCCCAGCAGCACCTCG ACCTCTGCCGGCCGGAACAGCGCCGGGTCGACGATCA GGTGG NLS0020 ref1_4602420 64 CTGGACATGCGCCCACCCCGGCCAAGTCCGACCGCAC CGGCAACCGCTCCTGTAGTCGTCGTCATCGTTCTCACC CCTGAGGCGGAGACCGTCCGCTAACGGGGTGTCTCAA GCAACCGTGGGGCGGAGGAACACGCACGTAGTCGCG TTTCAAGGTTCGCACGAACGCCTCGGCCATGCCGTTG CTCTGCGGGCTCTCCAGCGGCGTCGTTTTTGGCACCA AACCAAGGTCGCGGGCGAAGCGGCGCGTGTCGCGGG GACTGTCAGGAATTTCGTGTGGGGGCGGCCATAGTGG ATCCG NLS0089 ref1_194299 65 GGAAATCGGCTTCAAGTACGACGTCACGCCGGCCATG CAGGTCACGGGTGCACTGTTCAATCTCGAGCGCGACA ACCAGCCGTTCCCCTCGAACGTGGAGTCCGGCCTCGT CCTTGGCGCAGGTCAGACACGCACCCAGGGCGCGGA AATCGGCCTGGCCGGCTATCTAACCGATTGGTGGCAG GTCTTTGGCGGCTACGCTTATACCGAGGCACGCGTAC TCTCGCCACTGGAAGACGATGGAGACGTGATCGCAGC AGGTAATCTCGTCGGCAACGTTCCGCTAAATACTTTC AGTCT NLS0089 ref1_194305 66 CGGCCTGGCCGGCTATCTAACCGATTGGTGGCAGGTC TTTGGCGGCTACGCTTATACCGAGGCACGCGTACTCT CGCCACTGGAAGACGATGGAGACGTGATCGCAGCAG GTAATCTCGTCGGCAACGTTCCGCTAAATACTTTCAGT CTGTTCAACAAGTTCGATATCAACGAGAATTTCTCCG TTGCTCTGGGCTATTACTATCAGGATGCCAGCTTTGCC TCCTCAGACAATGCAGTGCGTTTGCCAAGTTATTCGC GGTTCGATGGCGGGTTGTTCTATCGATTCGACGAGTT GAC NLS0089 ref1_194310 67 ACGTTCCGCTAAATACTTTCAGTCTGTTCAACAAGTTC GATATCAACGAGAATTTCTCCGTTGCTCTGGGCTATTA CTATCAGGATGCCAGCTTTGCCTCCTCAGACAATGCA GTGCGTTTGCCAAGTTATTCGCGGTTCGATGGCGGGTT GTTCTATCGATTCGACGAGTTGACACGCGTTCAGCTT AGCGTCGAGAACATTTTCGACAGGCGTTACATCATCA ACTCCAACAACAACAACAACCTCACGCCTGGCGCGCC GAGAACAGTCCGCGTGCAATTGATCGCTCGGTTCTAA A NLS0042 ref1_86157 68 AGCCCACAAGCCTGATGCACTTAACTACATCCTCTAA TGTCGCGCCAATTTGCTTGGCGGCAGGGGATGTTGTA TCGTCATAGGCTTGTCTAACCGGAACTTGTTTGCCAAT CTCTTTGGCGATCGCAACCGCCATCTCGTGTTCGTCAA CCATGTGCGCGTTCCTCTAATTGCACTCATGGTGCCAC GTGCACCTCCGATCGTCTCGTGTCTAGAATGAAGGTG GGAACAACCTTACACAGGCTTTCGCGACGCGCGAATT TCTGGTTTCTCCGCCTCGGATGTGGGTTTGAGCGCTTC NLS0042 ref1_142469 69 CTTTTCATTTGTCATGATCTCGACCAAGGTATTCACGG CAAGCTCGGTCTGTTGCTTAGCAAGTGCCTGAACTTC GCGAACGATCGGCTCTCGACCCTTCGGGTTCGAGACC TGTCCCTTTTGAAAACCACGTGCCCTACACTTTTCGGG ATCAAGGTGCGGGTTGGCTTTGGTCAAAATTCTCTGG CGTCCCATTACACGCCCTCCGCATCATCGTTCCCGCGA ACGATCTGACCCCCGACTTCCGCGAGGAAGCGTGTGG CGTGATCCTCGAAGCGGAATGCCACCTCGAACTGTTC C NLS0042 ref1_142321 70 CAGCAGCAAGCAGATCGTTGAAAACCGCTTGAACCGC ATCTTGATCGGGACCGGAACCAATCAGGTCATCTAGG TAAACCGAGACGTAAACTCGTTTGCGCTCGGCATCTT TCAGAACGTCCGTGATGCCAGACCGCATTAGTACCAT CGTCGCCAAGGCGGGCGACTGAACGAAGCCGATCGG CAGAGAGTAACGGGGACCGCCCCTAATCGGGTTGCG AACGCAAGACCACTTAGCAAAGGTTCGAGCACGGCC GAACTTCGCATGGTGGAGAGCCGCGGCAACACGGTTC CGTGATA NLS0064 ref1_153668 71 TAGACATTCCAACAAACCGGCAAGAGGCTCGTCCTCA CTCGAGGATTTGTTGGGACTTGCATGATGTCGAAGCG GAGCCGTTATGACCTGGGTGCGATCATGCGCCGAGCA TGGGAGATGGCTCGGGAGGCGGCATTCGCGGTTGGCG AGCGGGCACGGACTCACCTTGCTGCCGCGATGCGCAG CGCGTGGGCCGAAGCCAAGTTGGCACTCGCGCCCACG AAGACGGAGCAGGATCGTCTCTCTCCGAGCGACATGA TCGGACATGAGGACGCCTACCAAGGCCGGGTTCTAAA ATAT NLS0064 ref1_3842117 72 AAGATGGATACGACAAGCGCGATTACATTATTTGCGA AATAGATGGACAAATAAAAGACAAAGGACTGATGTA TTTCCTTAAATCTGGACAAGTTGACCTCTTTCACATAG AAGTCACCACTCCCTTTGGGACAATTTGGTGTCACGA AAACATAGAGGCCGAACTTCTTAGCTGAATTATCGCG CTCCGGGTTCTTATGCGGCTGAGTGAAGCGCGGGACA GCTTGCGAGCAGGGCCGCCAATGGCAGCCGGGATGA CACAATGCTCGGTCTCCCGACGCTTCTTCAATCGGGA GCGCT NLS0064 ref1_3842278 73 AGCTGAATTATCGCGCTCCGGGTTCTTATGCGGCTGA GTGAAGCGCGGGACAGCTTGCGAGCAGGGCCGCCAA TGGCAGCCGGGATGACACAATGCTCGGTCTCCCGACG CTTCTTCAATCGGGAGCGCTTCGCAGCCCGGGGCGGC GCGCTCATGCGTCACGACCTGGGCCCTGCGCACCTTC GCGGCCCCGCCGTCCCGGCAGATCCCTGATGCCCCAA GTGGGCGGCCACTCCATCAAAGAACCCCGGCCTGTGG CAGATCTCGTAGGCATACCGAGGTTCCGCAGTGCCCC CACC NLS0610 ref1_2810264 74 ACCGAAGGCGTCCCCGGACACGAAGGCCTGAAACAC CATATCTGTGGCGATCAGGCCGACGTGGTCGCGGACT TCAACTGGCAGAGAATGCCAGGCCGCTTCGATTTCAG ATGATACTGGTACGGACATAGGAGCGGCTTAGCTTTC TCAGTGCAAATGTGATTGATTCCGGCTCAAAAATGAT CTTGATCGGACGAGACGTTTTCAATCCATGTCGTGTTG CCATCGCCGATCGGTGCGTCAAGAGACAGATGGCGCC GACCGTAGATACGCGTTCGGGTTGCCCGCACCGCTTC TCCA NLS0610 ref1_322980 75 GGAGGTGTGATCTGATGATGTGCTGGATGAAATT GGCGGTCGAGCACTTGTTCAGCTTGGCCAGCTCG ACGAGATCGGCGTGATGCTCGGCGTCGATCAGGA TGTTCAGCGAGACCGGACGTACGCAGGACTTGGT ATTAGCGCCGTTGCGCATCAGCTTGCAGCCTTGC TCTGCTTCTCAGCGTGCCGCGTCAGGATGACCCT GATGTAGCTGTTGAGGTTGATGCCGTAATAGCCT GCGGACTCTGTGAGATCCCGGCGAAGATCGTCGG CGAGGGTCAGGCGGATGGTGCTGGTCGG NLS0610 ref1_2785241 76 AAGTAACCGCTCAACATGATCTTCAGCATGTTGT CCAACAGCAGGAGAATACATGTAATTCACCATGA CCGGCAAGCTGCGACTGGCCATTGCTTCCACCGC TTGAATGTAGCGATCGAATTTCGCAAAATCAGGG TGGAATGAAAATATCGAACCAAACTGCGAGCCTT GAATCCGTTCTGCAAAATTATCGAAAAATTTTCT TGGCCGACTGCCGTTCGAAAACATTCTTACGTTT ACATGCGGCCCGCCTGAAACAAGACAGTCTACCA GCTCTGGGAAATGGGGGTGAAGGGTCGG

    Example 5. Analysis of Effects of Methylobacterium Strains on Nutrient Content of Soybean Vegetative Tissues and on Oil, Protein and Nutrient Content of Seeds of Canola, Corn, Soybean and Wheat

    [0109] Soybean seeds treated as described in Example 1 were grown in multiple field locations in the Midwestern United States in the summer of 2019 in parallel with untreated control soybean plants. Seeds from Canola and wheat were similarly treated and tested. For analysis of field grown corn plants, Methylobacterium strains were applied in-furrow at planting. Strains and strain combinations evaluated are shown in Table 19 below.

    TABLE-US-00019 TABLE 19 Crop Methylobacterium strain(s) Canola NLS0017 Canola NLS0020 Canola NLS0064 Canola NLS0610 Canola NLS0017 + NLS0064 Canola NLS0064 + NLS0066 Canola NLS0017 + NLS0109 Corn NLS0042 Corn NLS0807 Corn NLS0020 + NLS0042 Corn NLS0042 + NLS0807 Corn NLS0648 Corn NLS0662 Corn NLS0017 + NLS662 Soybean (+Rhizobia treatment) NLS0064 Soybean (+Rhizobia treatment) NLS0610 Soybean (+Rhizobia treatment) NLS0934 Soybean (+Rhizobia treatment) NLS0017 + NLS0109 Soybean NLS0017 Soybean NLS0064 Soybean NLS0089 Soybean NLS0109 Soybean NLS0020 Soybean NLS0648 Soybean NLS0017 + NLS0109 Soybean NLS0807 Wheat NLS0017 Wheat NLS0021 Wheat NLS0044 Wheat NLS0064 Wheat NLS0089 Wheat NLS0109

    [0110] Preliminary analysis of soybean vegetative issue indicates increase micronutrients were obtained by treatment with Methylobacterium strains, including increased boron in RI stage vegetative tissue in soybean plants grown from ISO003 and ISO018-treated seeds, and increased iron in V6 stage vegetative tissue in soybean plants grown from ISO002-treated seeds.

    REFERENCES

    [0111] Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248-254. [0112] Dumas, Ann. Chim. Phys. 1831, T47, 198-213. [0113] Green, P. N. 2005. Methylobacterium. In Brenner, D. J., N. R. Krieg, and J. T. Staley (eds.). “Bergey's Manual of Systematic Bacteriology. Volume two, The Proteobacteria. Part C, The alpha-, beta-, delta-, and epsilonproteobacteria.” Second edition. Springer, New York. Pages 567-571. [0114] Green, P. N. 2006. Methylobacterium. In Dworkin, M., S. Falkow, E. Rosenberg, K.-H. Schleifer, and E. Stackebrandt (eds.). “The Prokaryotes. A Handbook on the Biology of Bacteria. Volume 5. Proteobacteria: Alpha and Beta Subclasses.” Third edition. Springer, New York. Pages 257-265. [0115] Green, P. N. and Ardley, J. K. 2018. Review of the genus Methylobacterium and closely related organisms: a proposal that some Methylobacterium species be reclassified into a new genus, Methylorubrum gen. nov. Int J Syst Evol Microbiol. 2018 September; 68(9):2727-2748. doi: 10.1099/ijsem.0.002856. [0116] Hartree, E. F. Determination of protein: a modification of the Lowry method that gives a linear photometric response. Anal. Biochem. 1972, 48, 422-427. [0117] Jokić, S., Nagy, B, Zeković, Z., Vidović, S., Bilić, M., Velić, D., Simándi, B. 2012 Effects of supercritical CO.sub.2 extraction parameters on soybean oil yield. Food and Bioproducts Processing 90(4): 4, 693-699. [0118] Konstantinidis K. T., Ramette A., Tiedje J. M. (2006). The bacterial species definition in the genomic era. Philos Trans R Soc Lond B Biol Sci 361: 1929-1940. [0119] Kjeldahl, J. Anal. Chem. 1883, 22, 366-382. [0120] Lidstrom, M. E. 2006. Aerobic methylotrophic prokaryotes. In Dworkin, M., S. Falkow, E. Rosenberg, K.-H. Schleifer, and E. Stackebrandt (eds.). “The Prokaryotes. A Handbook on the Biology of Bacteria. Volume 2. Ecophysiology and biochemistry.” Third edition. Springer, New York. Pages 618-634. [0121] Maehre, H. K., Dalheim, L., Edvinsen, G. K., Elvevoll, E. O., and Jensen, I. J. (2018) Protein Determination-Method Matters. Foods 7(1), 5; doi:10.3390/foods7010005. [0122] Sy, A., Giraud, E., Jourand, P., Garcia, N., Willems, A., De Lajudie, P., Prin, Y., Neyra, M., Gillis, M., Boivin-Masson, C., and Dreyfus, B. 2001. Methylotrophic Methylobacterium Bacteria Nodulate and Fix Nitrogen in Symbiosis with Legumes. Jour. Bacteriol. 183(1):214-220. [0123] Thiex, N.J., Anderson, S., and Gildemeister, B. 2003.: Journal Of AOAC International VOL. 86, NO. 2, 2003.

    [0124] The breadth and scope of the present disclosure should not be limited by any of the above-described embodiments, but should be defined only in accordance with the following claims and their equivalents.