OPTIMIZED ZIKA VIRUS ENVELOPE GENE AND EXPRESSION THEREOF

Abstract

The present invention is directed to the expression and secretion the Zika virus envelope protein. Elements of the pre-membrane and envelope sequence have been modified to enhance the expression of the envelope protein as a secreted product in the culture medium of transformed insect cell lines. The expressed and purified product is suitable as a vaccine antigen.

Claims

1-27. (canceled)

28. An expression vector comprising a DNA sequence encoding a Zika virus pre-membrane and envelope protein, wherein expression of the DNA sequence results in secretion of a soluble envelope protein in the culture medium.

29. The expression vector of claim 28, wherein the DNA sequence comprises SEQ ID NO:1.

30. The expression vector of claim 28, further comprising an expression cassette that comprises SEQ ID NO:7.

31. An expression vector for expression and secretion of heterologous proteins in cultured insect cells, wherein the expression vector comprises the expression cassette shown in SEQ ID NO:7.

32. The use of the expression vector in claim 28, wherein the expression vectors are used in Drosophila cells.

33. The use of the expression vector in claim 28, wherein the expression vectors are used in Drosophila melanogaster Schneider 2 (S2) cells.

34. A vaccine comprising an effective amount of purified Zika virus envelope protein (E), wherein the protein is secretable into growth medium when expressed recombinantly in a host cell; and an effective amount of adjuvant, wherein the vaccine induces the production of neutralizing antibodies in human subjects.

35. The vaccine of claim 34 wherein the E protein is recombinantly produced and expressed in insect host cells.

36. The vaccine of claim 34 wherein the E protein is recombinantly produced and expressed in Drosophila melanogaster S2 host cells.

37. The vaccine of claim 34, wherein the adjuvant is an aluminum-based adjuvant (Alum), a saponin-based adjuvant, monophospholipid-based adjuvant, or combination thereof.

38. The vaccine of claim 34, for use in immunodeficient populations.

39. The vaccine of claim 34, wherein the E protein is encoded by a nucleic acid sequence beginning at nucleotide 505 of SEQ ID NO:5.

40. The vaccine of claim 34, wherein the E protein begins at amino acid residue 169 of SEQ ID NO:6.

41. A method for raising a protective immune response in a person, comprising administering in a therapeutically acceptable manner a therapeutically effective amount of the vaccine of claim 34.

42. A method of providing immune protection in humans against Zika virus induced disease comprising administering an effective amount of the vaccine of claim 34 thereby providing protection from Zika disease.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0036] FIG. 1 shows pre-membrane and envelope sequence of Zika virus French Polynesia strain H/PF/2013 (SEQ ID NO:5) with translation (SEQ ID NO:6)

[0037] FIG. 2 shows codon optimized pre-membrane and envelope (80E) sequence of Zika virus (SEQ ID NO:1)

[0038] FIG. 3 shows expression of codon optimized ZIPFP-80E-CoOp in Drosophila S2 cells. Samples were run on 10% SDS PAGE gel under non-reducing conditions and stained with Coomassie Blue.

[0039] FIG. 4 shows a comparison of flavivirus secretion signals at the prM-E junction along with an optimized synthetic secretion signal for expression of the Zika virus envelope protein (SEQ ID NOS: 8-21).

[0040] FIG. 5 is an alignment of flavivirus envelope proteins at the 80E junction (SEQ ID NOS: 22-37).

[0041] FIGS. 6A-6B show ELISA titration results from mice serum following two or three doses of ZIKFP-80E-CoOp formulated with multiple adjuvants.

[0042] FIGS. 7A-7B show PRNT titration results from mice serum following two or three doses of ZIKFP-80E-CoOp formulated with multiple adjuvants.

[0043] FIG. 8 shows expression of ZIPFP-80E-WT, ZIKFP-80E-CoOp and ZIKFP OpE-436-CoOp in Drosophila S2 cells. Samples were run 10% SDS PAGE gel under non-reducing conditions and stained with Coomassie Blue.

DETAILED DESCRIPTION OF THE INVENTION

[0044] The invention provides an optimized ZIKV gene sequence for expression of a soluble and stable envelope protein that is composed of a prM-E contiguous sequence that has been codon optimized, contains an optimized secretion signal for the E protein segment, and has an optimized C-terminus that enhances expression and stability of the expressed E product. The optimized gene sequence is inserted into a Drosophila S2 cell expression vector which drives the expression of high levels of high quality Zika envelope protein in S2 cells that have been stably transformed with the expression vectors carrying the optimized gene sequence. The use of the optimized gene sequence results in an increase in the productivity and quality of the expressed Zika envelope protein. The enhanced expression of the Zika envelope protein provides for an effective immunogen at an improved cost of goods which can bolster the ability to manufacture recombinant proteins suitable for use in vaccines to combat the spread of the Zika virus.

[0045] The term “gene sequence” refers to a sequence of DNA that is transcribed into an RNA molecule that may function directly or be translated into an amino add chain.

[0046] The term “optimized” refers to sequences that were derived from naturally occurring sequences and have been altered to enhance their functions.

[0047] The term “codon optimized” refers to a nucleic acid coding region that has been adapted for expression in the cells of a given host by replacing at least one, or more than one, or a significant number, of codons with one or more codons that are more frequently used in the genes of that host.

[0048] The term “synthetic” refers to sequences that are not found to occur naturally. More specifically, the synthetic elements described herein are not found in the gene sequences of Zika virus or related flaviviruses.

[0049] The term “operably linked” refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner.

[0050] “Expression cassette” means the combination of promoter elements with other transcriptional and translational regulatory control elements which are operably linked to a gene sequence to be expressed. A gene sequence can be inserted into the expression cassette for the purpose of expression of said gene sequence. The expression cassette is capable of directing transcription which results in the production of an mRNA for the desired gene product which is then translated to protein by the host cell translational systems. The expression cassette is integral to the expression vector (plasmid). Such an expression vector directs expression of the protein encoded by the gene sequence once introduced into host cells.

[0051] The term “transformed” refers to the DNA-mediated transformation of cells. This refers to the introduction of plasmid DNA into insect cells in the process of generating stable cell lines following the integration of the introduced DNA into the genome of the cells. This term is used in place of the term “transfection” which is often used in the same context. The term transformation is used for the introduction of plasmid DNA to cultured cells to distinguish from the introduction of viral DNA into cultured cells which was originally referred to as transfection. As there are no viral DNA sequences in the present invention which are introduced into the host that results in the production of virus-like particles or cell lysis the term transformed is preferred.

[0052] “Expression” or “expressed” means the production of proteins using expression vectors and host cells, for instance, Drosophila S2 cells to produce a recombinant protein product that is readily detectable as a cell associated product or as a secreted product in the culture medium.

[0053] “Secretion” means secretion of an expressed recombinant protein from cultured host cells into culture medium. The expressed and secreted protein is the result of a given gene sequence being operably linked to an expression cassette such that the sequence codes for the given protein.

[0054] The term “product” refers to any recombinant protein, full length or subunit thereof, which is expressed by a host cell into which an expression vector carrying the gene sequence encoding the product has been introduced.

[0055] Insect cells are an alternative eukaryotic expression system that provide the ability to express properly folded and post-translationally modified proteins while providing simple and relatively inexpensive growth conditions. The use of stably transformed insect cell expression systems provide benefits over those based on baculovirus infection of the host insect cells. On this basis, S2 cells were selected as the insect host cells of choice. As a result, the efforts to optimize the expression vectors for stably transformed insect cells were based on data derived from the analysis of specific Drosophila genes as well as the complete Drosophila genome.

[0056] In a preferred embodiment of the invention, the E protein secretion signal located at the carboxy end of the prM sequence and immediately preceding the E sequence N-terminus, is a synthetic sequence designed to enhance the processing of these sequences. This synthetic secretion sequence has an increase core hydrophobic region and the −2 and −1 amino acid residues have been optimized to increase the recognition of the signal protease cleavage site at the prM-E junction. The amino acid residues at +1 and +4 of the E sequence have also been optimized to aid in the recognition of the signal protease cleavage site. The amino acid sequence of the synthetic secretion signal including the optimized residues in the E sequence are shown in FIG. 4 and the nucleotide sequence that encodes these elements within the codon optimized prM-80E sequence (Op80E-CoOp) is detailed in SEQ ID NO:2.

[0057] In a preferred embodiment of the invention, the C-terminus of the E protein has been extended beyond the 80E terminus has been extended to stabilize the soluble envelope protein that is expressed. Specifically, the C-terminus of the soluble E protein has been extended from Gly-404 to Ile-436 as shown in FIG. 5. The codon optimized prM-E nucleotide sequence that encodes the extended C-terminal E protein (E-436-CoOp) is detailed in SEQ ID NO:3.

[0058] In a more preferred embodiment of the invention, the combination of the optimized and synthetic elements have been combined into a single gene sequence for the expression of the Zika envelope protein that results in an enhanced efficiency and yield of the product. The product is also enhanced in terms of stability as a soluble product and as an immunogen for use as a vaccine. The prM-E nucleotide sequence containing the assembled optimized Zika virus envelope protein components, codon optimization, synthetic secretion signal, and the E-436 C-terminal extension (OpE-436-CoOp) is presented in SEQ ID NO:4.

[0059] Thus, the present invention provides the combination of multiple optimizations directed at different aspects of the Zika virus prM-E gene sequence in such a manner that an additive benefit is achieved and results in high levels of the envelope protein being expressed. The optimized Zika prM-E sequence when used to express the envelope protein in Drosophila S2 cells results in the economic production of large quantities of high quality proteins. The Examples below show that using the individual optimized elements in the Zika gene sequence results in improved or enhanced expression of the envelope protein. The highest levels of envelope protein expression are achieved in the gene sequence in which all of the identified optimized elements are combined.

[0060] Although the descriptions presented above and the examples that follow are primarily directed at the use of the optimized expression vectors with Drosophila S2 cells, the vectors and methods can be applied to other insect cell lines that result in stable cell lines following transformation of host cells with plasmid DNA.

[0061] The following examples are offered by way of illustration and not by way of limitation.

EXAMPLES

[0062] The following examples describe the development of the optimized ZIKV gene sequences for the expression of the envelope protein in insect cells. The examples demonstrate the ability to effectively express the proteins in Drosophila S2 cells at levels that are commercially suitable for product development.

[0063] The examples demonstrate the ability of the individual regulatory elements to enhance the ability to express proteins in S2 cells and the efforts made to determine what changes contributed to the enhanced function of these elements. The results presented below demonstrate that different elements and modifications of these elements can result in high levels of expression or in very little or no detectable expression. Thus, the selection of functional and effective regulatory elements must be determined thorough experimentation. Hence, the invention described herein is unique in that the expression cassette described is mostly synthetic in composition and directs high levels of protein expression.

Example 1

Expression of Wild Type and Codon Optimized ZIKV 80E Proteins in Drosophila S2 Cells

[0064] In an effort to identify optimized gene sequences for driving high levels of high quality ZIKV envelope protein in S2 cells, the wild type prM-E gene sequence was compared to a codon optimized prM-E gene sequence. Both the WT and codon optimized sequences were produced synthetically (DNA2.0, Menlo Park, Calif.). For codon optimization, the standard Drosophila melanogaster codon table was used (Kazusa DNA Research Institute, http://www.kazusa.or.jp/codon/). As the objective is to improve the efficiency of expression, which is in part controlled by the translation process, a threshold of 10% usage was used in assigning codons (any codon that is used <10% is excluded). Additionally, based on our analysis of highly expressed proteins in Drosophila, we have added the exclusion of the following codons, CGA for Arg, ATA for Ile, and GTA for Val. The synthesized gene sequences included appropriate restriction enzyme sites at the ends and a stop codon was included at the end of the envelope protein coding region.

[0065] For the expression of the ZIKV envelope protein, the genomic sequence representing the ZIKV pre-membrane protein and carboxy-truncated envelope protein (prM-80E) is used. The sequence utilized for expression is based on the 2013 French Polynesia strain H/PF/2013, (GenBank Accession # KJ776791). The WT 2013 French Polynesia strain H/PF/2013 prM-80E sequence along with translation is provided in FIG. 1. The codon optimized sequence is detailed in SEQ ID NO:1 and FIG. 2. While the sequence of the codon optimized sequence is different, it codes for the same protein sequence provided in FIG. 1 for the WT sequence. Viral strains in the Asian lineage such as the 2013 French Polynesia strain H/PF/2013 are responsible for the ongoing outbreak in the Americas (22). The first amino acid codon of the prM sequence is fused in frame with the secretion signal of the expression vector. When the prM-80E sequence is expressed in the S2 cells, the prM-E junction is processed by an S2 encoded signal protease. This results in the secretion of an 80E product with a native N-terminus into the culture medium.

[0066] The synthetic DNA fragments were digested with appropriate restriction enzymes and inserted with in the expression cassette (SEQ ID NO:7) of the pHH202 expression vector that has been digested with Nhe I and Xho I. The pHH202 expression cassette contains the following elements: metallothionein promoter, optimized Kozak sequence, influenza HA secretion signal, and the SV40 early 3′UTR. The hygromycin encoding gene is also incorporated into the pHH202 expression plasmid downstream of the expression cassette. The pHH202 expression plasmid is designed to allow directional cloning of the gene of interest into unique Nhe I and Xho I sites. The junctions and full inserts of all constructs were sequenced to verify that the various components that have been introduced are correct and that the proper reading frame has been maintained.

[0067] For this work standard methods of culturing and transformation of S2 cells were utilized (Van der Straten, Methods in Mol. and Cell Biol. (1989) 1:1-8; Culp et al., Biotechnology (1991) 9:173-177; Kirkpatrick and Shatzman, In Gene Expression Systems: Using Nature for the Art of Expression, Eds. Fernandez and Hoeffler, Academic Press, (1999) 289-330). Drosophila S2 cells (Schneider, J. Embryol. Exp. Morph. (1972) 27:353-365) obtained from ATCC were utilized. The S2 cells have been adapted to growth in Excell 420 medium (SAFC, St Louis, Mo.) and all procedures and culturing described herein were in Excell 420 medium. Cultures are typically seeded at a density of 1×10.sup.6 cells/ml and are passed between days 5 and 7. All cultures were incubated at 26° to 27° C. Expression plasmids into which genes of interest were inserted were transformed into S2 cells using the ExpreS2 TR reagent (Expres2ion Bio, Horsholm, Denmark). Following transformation, cells resistant to hygromycin B, 0.3 mg/ml, were selected. Once stable cell lines were selected, they were evaluated for expression of the appropriate products. For the evaluation of expression, 5 ml cultures of selected cell lines were seeded at 2×10.sup.6 cells/ml and cultured in the presence of 0.2 mM copper sulfate at 26° C. for 7 days. Cultures were evaluated for expression of recombinant proteins in both the cell associated fractions and the culture medium. Proteins were separated by SDS-PAGE and either stained with Coomassie blue or blotted onto nitrocellulose for Western blot analysis. Expression levels ≥1 μg/ml (1 mg/L) are readily detected in S2 cultures by Coomassie staining of SDS-PAGE gels.

[0068] Parental S2 cell lines expressing the ZIKFP 80E-WT and ZIKFP-80E-CoOp have been established using standard methods developed at HBI (23). The expression of the ZIKFP-80E products has been identified using the conformationally sensitive monoclonal antibody (mAb) 4G2 that recognizes most flavivirus envelope proteins (24). The expression data for two parental S2 cell lines expressing codon optimized ZIKFP-80E-CoOp is shown in FIG. 3. West Nile 80E (WN-80E) is included for comparison. The 4G2 mAb is also used for purification utilizing immunoaffinity chromatography (IAC) methods. The 4G2 mAb based IAC purification is analogous to the process that is currently utilized for the WN-80E vaccine program and has been successfully transferred to cGMP manufacturing.

[0069] The use of the codon optimized prM-E gene sequence in transformed S2 resulted in the expression ZIKFP-80E-CoOp at approximately 30 μg/ml. A coomassie stained SDS-PAGE gel is shown in FIG. 3 with both unconcentrated culture media samples with ZIKFP-80E-CoOp (lanes 2-5) and purified ZIKFP-80E-CoOp (lanes 9-10). WN-80E samples are also included on the gel for comparison.

[0070] Another adjuvant which may be utilized in the presently described vaccine formulation is a stable oil based emulsion. In one embodiment the emulsion is a stable oil-in-water emulsion (SE) which may optionally include squalene.

[0071] Another adjuvant which may be utilized in the presently described vaccine formulation is a saponin-based adjuvant, such as QS21. QS21 is a purified plant extract that enhances the ability of the immune system to respond to vaccine antigens. It is derived from the Soap bark tree (Quillaja saponaria) and contains water soluble triterpene glucoside compounds, which are members of a family of plant-based compounds called saponins. In one embodiment, a saponin-based adjuvant is combined with SLA forming a liposome formulation. In one embodiment, SLA is combined with QS21 to form a liposome formulation (SLA-LSQ).

[0072] The vaccine formulation of the present invention may further include one or more additional pharmaceutically acceptable diluents, carriers, solubilizers, emulsifiers, preservatives and/or adjuvants.

Example 2

Design of Synthetic Secetion Signal Sequence for Enhanced Expression in Drosophila S2 Cells

[0073] The secretion signal peptide plays an important role in the expression of proteins that are targeted for secretion from the cell. Therefore, the use of optimal sequences that target the desired recombinant protein for secretion into the culture medium during production is important to the efficiency of processing the protein and potentially increasing the yield of the product. The example of secretion signal optimization presented by Zhang et al. (J. Gene Med. (2005) 7:354-365) clearly demonstrates the benefits of secretion signal optimization. However, this specific example applies to plants and it is not clear that the changes to the secretion signal described apply to other eukaryotic cell types. Furthermore, as Zika envelope expression is achieved through the expression of the prM-E polypeptide, the secretion is directed by the integral sequence of the prM protein that serves as a component of the transmembrane anchor for the prM protein. The second membrane spanning sequence of the prM protein also serves as the secretion signal peptide for the E protein. No clear guidance exists on how to best optimize this transmembrane anchor/secretion signal peptide sequence to improve the secretion and yield of the envelope protein. Therefore, a survey of flavivirus prM-E secretion signals was conducted. The putative secretion signals from prM and the E protein N-terminus were analyzed using the SignalP program described by Petersen et al (Nat. Methods, (2011) 8(10): 785-6), which predicts the strength of the secretion signal based on an established algorithm and also predicts the cleavage site of the sequence analyzed.

[0074] Surprisingly, as shown in FIG. 4, the prediction scores for all of the flaviviruses analyzed were poor. A score of ≥0.500 is defined as a good secretion signal. Therefore, an effort was made to establish the changes required to improve the score of the predicted secretion signal peptide. Such changes are believed to result in an increased expression of the desired protein product into the culture medium of stably transformed S2 cells. The designs of the synthetic secretion signal followed the matrix table first described by von Heijne (Nuc. Acids Res. (1986) 14:4683-4690), and further refined by Bendtsen et al. (J. Mol. Biol. (2004) 340:783-795). The design was to maintain the length of the secretion signal at 17 amino acids, and include a single charged residue in the basic region, improve the hydrophobic region, and improve the −1 and −2 positions. Initially, only the secretion signal was designed (SyntheticZ) leaving the N-terminus of the E protein unaltered. However, the score returned for this sequence was only 0.374 despite the optimization. The +1 through +4 amino acids (in this case the E protein N-terminus) can also impact the efficiency of the cleavage site; therefore, this was also altered at the +1 and +4 positions. The combination of the synthetic secretion sequence and the changes at +1 and +4 (Synthetic+) resulted in a score of 0.649. Thus, the combination of the two changes was required to achieve a score of ≥0.500. To confirm that both changes are required only the +1 and +4 changes were made to the WT Zika sequence (Zika+) and analyzed. This resulted in a slight improvement in the score from 0.231 to 0.310, but still below a score of 0.500. The amino acid sequences of the signal peptides described are listed below along with their Signal P scores.

TABLE-US-00001                −1+1                 | | QKVIYLVMILLIAPAYS IRCIGV “Zika” Score:  0.231 MRTIIALLLLLVSGAHG IRCIGV “SyntheticZ” Score:  0.374 MRTIIALLLLLVSGAHA SRCVGV “Synthetic+” Score:  0.703 QKVIYLVMILLIAPAYS SRCVGV “Zika+” Score:  0.310

[0075] The Synthetic+ secretion signal is operatively linked to the prM-80E codon optimized Zika sequence (SEQ ID NO:1) to create the combination of codon optimization and secretion signal optimization as detailed in SEQ ID NO:2. SEQ ID NO:2 is then inserted into the expression cassette (SEQ ID NO: 7) of the pHH2O2 vector. The expressed and secreted E protein is referred to as ZIKFP-Op80E-CoOp.

Example 3

Alteration of the Carboxy-Terminus of the E Protein Sequence to Enhance Secretion and Stability

[0076] The C-terminus of the flavivirus E ectodomain is typically defined by the Gly residue in the sequence motif W-X-K/R-X-G. In the case of Zika this is Gly.sub.404. While this truncation results in secretion of the ZIKFP-80E product as shown in Example 1, efforts to improve the stability of the expressed E protein, both in terms of expression levels and structural integrity are desirable. An analysis of the Zika virus cyro EM data (Sirohi et al, 2016) suggests that an extension of the E ectodomain from Gly.sub.404 to Gly.sub.436 may provide a stabilizing effect. The extension of the C-terminus to Gly.sub.436 has the potential to provide for interaction between the domain III region and the domain I region and help to stabilize the expressed and secreted ZIKV envelope protein. In the extended E protein, the Phe.sub.431 residue has the potential to interact with a hydrophobic pocket in domain I composed of Val.sub.12, Val.sub.23 and Val.sub.24. An extension of the E protein in this manner could lead to enhancement of proper protein folding (native-like structure) and stability.

[0077] The codon optimized Zika prM-E sequence that extends the E protein to amino acid residue 436 is referred to as prM-E-436 and is detailed in SEQ ID NO:3. SEQ ID NO:3 is then inserted into the expression cassette (SEQ ID NO: 7) of the pHH202 vector. The expressed and secreted E protein is referred to as ZIKFP-E-436-CoOp.

[0078] A fully optimal Zika prM-E sequence that combines the three features, codon optimization, optimized synthetic secretion signal, and the extended E sequence was also generated as detailed in SEQ ID NO:4. SEQ ID NO:4 is then inserted into the expression cassette (SEQ ID NO: 7) of the pHH202 vector. The expressed and secreted E protein is referred to as ZIKFP-OpE-436-CoOp. The expression and secretion of the ZIKFP-80E-WT, ZIKFP-80E-CoOp, and ZIKFP-OpE-436-CoOp from S2 cells was evaluated by SDS-PAGE. A coomassie stained gel is shown in FIG. 8. All samples represent unconcentrated culture media to allow for direct comparison of the expression levels between the different recombinant Zika E proteins. While expression is detected for each of the expressed sequences, ZIKFP-80E-WT, ZIKFP-80E-CoOp, and ZIKFP-OpE-436-CoOp, the ZIKFP-80E-CoOp results in the highest level of expression.

Example 4

Immunogenic Evaluation of Codon Optimized ZIKFP-80E Protein in Mice

[0079] The immunogenicity of the Drosophila S2 expressed ZIKFP-80E-CoOp subunit protein was evaluated in both inbred and outbred mice with several different adjuvants to assess the immunogenic potential. Mice were immunized intra-muscularly with either two doses or 3 doses of ZIKFP-80E separated by 3 week intervals. Two amounts of ZIKFP-80E-CoOp were evaluated, 5.0 μg and 2.5 μg. The adjuvants tested were Alhydrogel, GPI-0100 and GLA-SE. Mice were bled 2 weeks after the 2 or third dose to prepare serum samples for antibody analysis. The design of the immunogenicity study is presented in Table 1.

TABLE-US-00002 TABLE 1 ZIKFP-80E-CoOp Immunogenicity Study Design. Antigen Al GPI- GLA # SW # 129 # Mice # Mice Group Test Article Dose Elem 0100 SE Mice Mice 2 dose 3 dose 1 ZIKFP-80E-CoOp with 5 μg — 100 μg — 10 — 5 5 GPI-0100 Adjuvant in SW 2 ZIKFP-80E-CoOp with Alum 5 μg 120 μg — — 10 — 5 5 Adjuvant in SW 3 ZIKFP-80E-CoOp with GLA- 5 μg — — 5 μg 10 — 5 5 SE Adjuvant in SW 4 ZIKFP-80E-CoOp with GLA- 2.5 μg   — — 5 μg 10 — 5 5 SE Adjuvant in SW 5 No Antigen (Negative Control) — — — 5 μg  5 — 2 3 GLA-SE Adjuvant in SW 6 ZIKFP-80E-CoOp with 5 μg — 100 μg — — 10 5 5 GPI-0100 Adjuvant in 129S6/SvEvTac 7 ZIKFP-80E-CoOp with GLA- 5 μg — — 5 μg — 10 5 5 SE Adjuvant in 129S6/SvEvTac 8 ZIKFP-80E-CoOp with GLA- 2.5 μg   — — 5 μg — 10 5 5 SE Adjuvant in 129S6/SvEvTac 9 No Antigen (Negative Control) — — — 5 μg — 5 2 3 GLA-SE Adjuvant in 129S6/SvEvTac

[0080] Mice were immunized intra-muscularly two or three times at 3 week intervals with the purified subunit protein at a dose of 5.0 μg or 2.5 μg. Five mice were bled two weeks after dose two and 5 mice were bled two weeks after dose three. The sera were then assessed for anti-80E antibody titers by ELISA. The sera were also evaluated for virus neutralizing antibodies using the plaque reduction neutralization test (PRNT).

[0081] The ELISA results for the serum collected following two or three doses of ZIKFP-80E-CoOp formulated with multiple adjuvants is presented in FIG. 6. The results of the ELISA indicate that the ZIKFP-80E-CoOp is immunogenic and the responses in the 129S6/Sv mice is more robust and consistent than in the Swiss Webster mice.

REFERENCES

[0082] The following references are each relied upon and incorporated herein in their entirety.

[0083] Bendtsen J D, Nielsen H, von Heijne G, Brimal S. Improved prediction of signal peptides: SignalP 3.0. J Mol Biol 2004; 340:783-795.

[0084] Bernard A R, Kost T A, Overton L, Cavegn C, Young J, Bertrand M, Yahia-cherif Z, Chabert C and Mills A. Recombinant protein expression in Drosophila cell line: comparison with the baculovirus system. Cytotechnology. 1994; 15:139-144.

[0085] Bin L, Tsing S, Kosaka A H, Nguyen B, Osen E G, Bach C, Chan H and Barnett J. Expression of human dopamine B-hydroxylase in Drosophila Schneider 2 cells. Biochem. J. 1996; 313:57-64.

[0086] Culp J S, Johansen H, Hellmig B. Regulated expression allows high level production and secretion of HIV gp120 envelope glycoprotein in Drosophila Schneider cells. Biotechnology. 1991; 9:173-177.

[0087] Dick G W, Kitchen S F, Haddow A J. Zika virus. I. Isolations and serological specificity. Trans R Soc Trop Med Hyg. 1952;46(5):509-20. Duffy M R, Chen T H, Hancock W T, Powers A M, Kool J L, Lanciotti R S, Pretrick M, Marfel M, Holzbauer S, Dubray C, Guillaumot L, Griggs A, Bel M, Lambert A J, Laven J, Kosoy O, Panella A, Biggerstaff B J, Fischer M, Hayes EB. Zika virus outbreak on Yap Island, Federated States of Micronesia. N Engl J Med. 2009;360(24):2536-43. Gardsvoll H, Werner F, Sondergaard L, Dano K, Ploug M. Characterization of low-glycosylated forms of soluble human urokinase receptor expression in Drosophila Schneider 2 cells after deletion of glycosylation-sites. Protein Expression and Purification. 2004; 34:284-295.

[0088] Farrell P J, Lu M, Prevost J, Brown C, Behie L, Iatrou K. High-level expression of secreted glycoproteins in transformed lepidopteran insect cells using a novel expression vector. Biotechnology and Bioengineering. 1998; 60(6): 656-663.

[0089] Gustafsson C, Govindarajan S, Minshull J. 2004. Codon bias and heterologous protein expression. Trends Biotechnol. July;22(7):346-53.

[0090] Hofmann K J, Schultz L D. Mutations of the a-galactosidase signal peptide which greatly enhance secretion of heterologous proteins by yeast. Gene. 1991; 101:105-111.

[0091] Hughes H R, Crill W D, Chang G J. Manipulation of immunodominant dengue virus E protein epitopes reduces potential antibody-dependent enhancement. Virol J. 2012 Jun. 18;9:115.

[0092] Ikonomou L, Schneider Y-J, Agathos S N. Insect cell culture for industrial production of recombinant proteins. Appl. Microbiol. Biotechnol. 2003; 62:1-20.

[0093] Incardona, J. P. and T. L. Rosenberry. Construction and characterization of secreted and chimeric transmembrane forms of Drosophila acetylcholinesterase: a large truncation of the C-terminal signal peptide does not eliminate glycoinositol phospholipid anchoring. Mol. Biol. of the Cell 1996; 7:595-611.

[0094] Ivey-Hoyle, M. Recombinant gene expression in cultured Drosophila melanogaster cells. Curr. Opin. Biotechnol. 1991; 2:704-707.

[0095] Johansen H A, van der Straten R, Sweet R, Otto E, Maroni G, Rosenberg M. Regulated expression at high copy number allows production of a growth-inhibitory oncogene product in Drosophila Schneider cells. Genes and Development. 1989; 3:882-889.

[0096] Kirkpatrick R B and Shatzman A. Drosophila S2 System for heterologous gene expression. In Gene Expression Systems: Using Nature for the Art of Expression. Joseph M Fernandez and James Hoeffler editors. Academic Press. 1999; Pp. 289-330.

[0097] Le Loir Y, Azevedo V, Oliveira S C, Freitas D A, Miyoshi A, Bermudez-Humaran L G, Nouaille S, Ribeiro L A, Leclercq S, Gabriel J E, Guimaraes V D, Oliveira M N, Charlier C, Gautier M, Langella P. Protein secretion in Lactococcus lactis: and efficient way to increase the overall heterologous protein production. Microb. Cell Fact. 2005; 4:2.

[0098] Mellquist J L, Kasturi L, Spitalnik S L, Shakin-Eshleman S H. The amino acid following an asn-X-Ser/Thr sequon is an important determinant of N-linked core glycosylation efficiency. Biochemistry. 1998 May 12;37(19):6833-7.

[0099] Modis Y, Ogata S, Clements D, Harrison S C. A ligand-binding pocket in the dengue virus envelope glycoprotein. Proc. Natl. Acad. Sci. USA. 2003; 100:6986-6991.

[0100] Modis Y, Ogata S, Clements D, Harrison S C. Structure of the dengue virus envelope protein after membrane fusion. Nature. 2004; 427(6972): 313-319.

[0101] Oehler E, Watrin L, Larre P, Leparc-Goffart I, Lastere S, Valour F, Baudouin L, Mallet H, Musso D, Ghawche F. Zika virus infection complicated by Guillain-Barre syndrome—case report, French Polynesia, December 2013. Euro Surveill. 2014;19(9). Olsen M K, Rockenbach S K, Fischer H D, Hoogerheide J G, Tomich CSC. Stable production of an analog of human tissue plasminogen activator from cultured Drosophila cells. Cytotechnology. 1992; 10: 157-167.

[0102] PAHO. Countries and territories with autochthonous transmission in the Americas reported in 2015-2016 2016 [cited 2016 Feb. 14]. Available from: http://www.paho.org/hq/index.php?option=com_content&view=article&id=11603&Ite mid=41696&lang=en.

[0103] PAHO. Cumulative Zika Virus Cases in the Americas 2016 [cited 2016 Apr. 2]. Available from: http://ais.paho.org/phip/viz/ed_zika_cases.asp.

[0104] Petersen T N, Brunak S, von Heijne G, Nielsen H. SignalP 4.0: discriminating signal peptides from transmembrane regions. Nat Methods. 2011 Sep. 29;8(10):785-6

[0105] Schmetzer O, Moldenhauer G, Riesenberg R, Pires J R, Schlag P, Pezzutto A. 2005. Quality of recombinant protein determines the amount of autoreactivity against the tumor-associated epithelial cell adhesion molecule antigen: low frequency of antibodies against the natural protein. The Journal of Immunology. 2005; 174: 942-952.

[0106] Schmidt F R. Recombinant expression systems in the pharmaceutical industry. Appl Microbiol Biotechnol. 2004; 65:363-372.

[0107] Schneider I J. Cell lines derived from late embryonic stages of Drosophila melanogaster. J. Embryol. Exp. Morph. 1972; 27:353-365.

[0108] Schuler-Faccini L, Ribeiro E M, Feitosa I M, Horovitz D D, Cavalcanti D P, Pessoa A, Doriqui M J, Neri J I, Neto J M, Wanderley H Y, Cernach M, El-Husny A S, Pone M V, Serao C L, Sanseverino M T, Brazilian Medical Genetics Society-Zika Embryopathy Task F. Possible Association Between Zika Virus Infection and Microcephaly-Brazil, 2015. MMWR Morb Mortal Wkly Rep. 2016;65(3):59-62.

[0109] Tognarelli J, Ulloa S, Villagra E, Lagos J, Aguayo C, Fasce R, Parra B, Mora J, Becerra N, Lagos N, Vera L, Olivares B, Vilches M, Fernandez J. A report on the outbreak of Zika virus on Easter Island, South Pacific, 2014. Arch Virol. 2015.

[0110] van der Straten A H, Johansen H, Rosenberg M, Sweet R W. Introduction and constitutive expression of gene products in cultures of Drosophila cells using hygromycin B selection. Methods in Mol And Cell Biol. 1989; 1:1-8.

[0111] von Heijne G. A new method for predicting signal sequence cleavage sites. Nuc Acids Res. 1986; 14:4683-4690.

[0112] WHO. WHO statement on the first meeting of the International Health Regulations (2005) (IHR 2005) Emergency Committee on Zika virus and observed increase in neurological disorders and neonatal malformations: WHO; 2016 [cited 2016 Feb. 12]. Available from: http://www.who.int/mediacentre/news/statements/2016/1st-emergency-committee-zika/en/.

[0113] WHO. Guillain-Barré syndrome—Colombia and Venezuela 2016 [cited 2016 Feb. 14]. Available from: http://www.who.int/csr/don/12-Feb.-2016-gbs-colombia-venezuela/en/.

[0114] WHO. Guillain-Barré syndrome—El Salvador 2016 [cited 2016 Feb. 14]. Available from: http://www.who.int/csr/don/21-Jan.-2016-gbs-el-salvador/en/WHO.

[0115] WHO. Zika Virus, Microcephaly and Guillain-Barre Syndrome Situation Report: WHO; 2016 [cited 2016 Apr. 12]. Available from: http://apps.who.int/iris/bitstream/10665/204718/1/zikasitrep_31Mar.2016_eng.pdf?ua=1

[0116] WHO. Zika Product Landscape 2016 [cited 2016 Apr. 2]. Available from: http://www.who.int/csr/research-and-development/zika-rd-pipeline.pdf.

[0117] Xu T, Logsdon N J, Water M R. Structure of insect-cell-derived IL-22. Acta Crystallogr D Biol Crystallogr. 2005; 61(pt 7): 942-50.

[0118] Zhang L, Leng Q, Mixson A J. Alteration in the IL2 signal peptide affects secretion of proteins in vitro and in vivo. J. Gene Med. 2005; 7:354-365.

TABLE-US-00003 Codon Optimized Zika prM-80E nucleotide sequence (Product = ZIKFP-80E-CoOp) SEQ ID NO: 1 GCAGAAGTGACCCGCCGCGGCAGCGCATACTATATGTACCTCGATCGTAACGACGCGGGC GAAGCTATCTCCTTCCCGACCACGCTGGGCATGAACAAGTGCTATATTCAGATTATGGAC CTGGGCCATATGTGCGACGCGACCATGTCCTACGAATGTCCGATGCTGGACGAAGGAGTT GAGCCTGATGACGTCGATTGCTGGTGCAATACCACTTCCACCTGGGTGGTGTACGGTACT TGCCATCACAAAAAGGGCGAAGCCCGCCGTTCCCGTCGCGCTGTCACTCTGCCAAGCCAC AGCACACGCAAATTGCAGACGAGGAGTCAGACGTGGTTGGAGTCGCGCGAGTACACAAAG CACCTGATTCGGGTGGAAAATTGGATCTTCCGGAATCCGGGCTTTGCTTTGGCGGCAGCC GCTATTGCGTGGCTGCTCGGCAGTAGCACGTCGCAGAAAGTGATTTACCTGGTCATGATC CTCCTCATCGCCCCCGCCTATTCGATCCGTTGCATTGGCGTCAGCAACCGCGATTTCGTG GAGGGCATGAGCGGTGGAACCTGGGTCGACGTTGTGCTGGAACATGGCGGCTGCGTCACA GTGATGGCTCAGGACAAGCCGACCGTGGACATCGAGTTGGTTACCACGACGGTTTCCAAC ATGGCGGAGGTTCGCAGCTACTGCTACGAAGCCAGCATCAGCGATATGGCATCGGACAGC CGGTGCCCGACCCAGGGAGAAGCATATCTCGACAAGCAGTCCGACACGCAATATGTCTGT AAAAGGACGCTCGTTGACCGCGGCTGGGGCAACGGCTGCGGCCTGTTTGGAAAAGGCTCC CTGGTCACATGCGCGAAGTTTGCATGTTCGAAGAAGATGACGGGCAAAAGCATCCAACCA GAGAATCTGGAATACCGGATCATGTTGTCCGTGCACGGCAGCCAGCATAGTGGCATGATT GTGAACGACACCGGTCACGAAACCGACGAGAACCGCGCTAAAGTTGAGATCACCCCGAAC AGTCCCCGGGCCGAGGCCACGCTGGGAGGCTTCGGATCGCTGGGTCTGGATTGCGAACCC CGCACCGGACTGGATTTCTCGGATCTCTACTACCTGACGATGAACAATAAGCACTGGCTG GTGCACAAAGAGTGGTTCCATGATATCCCATTGCCCTGGCATGCCGGTGCCGATACCGGA ACACCCCACTGGAACAATAAGGAGGCCCTGGTCGAGTTTAAGGACGCGCACGCTAAGCGT CAAACGGTGGTGGTGCTGGGATCCCAAGAGGGCGCCGTGCACACGGCCCTGGCCGGCGCG CTGGAGGCCGAGATGGACGGTGCCAAGGGACGCTTGAGCTCCGGACACCTGAAATGCCGC CTCAAGATGGACAAGCTGCGTCTGAAAGGAGTGTCCTACTCCCTCTGCACCGCCGCGTTC ACCTTCACTAAGATTCCCGCCGAGACTTTGCACGGTACAGTGACCGTTGAGGTGCAGTAT GCCGGAACCGATGGCCCTTGCAAAGTCCCGGCCCAAATGGCGGTGGATATGCAGACGCTG ACGCCTGTGGGCCGGCTCATTACCGCAAACCCAGTCATCACGGAGAGTACCGAGAACTCG AAGATGATGCTGGAGTTGGACCCCCCGTTTGGCGACAGTTACATCGTGATCGGAGTGGGC GAAAAGAAGATTACGCACCATTGGCACCGTAGCGGC Codon optimized nucleotide sequence for Zika prM-80E with synthetic E secretion signal (Product = ZIKFP-Op80E-CoOp) SEQ ID NO: 2 GCAGAAGTGACCCGCCGCGGCAGCGCATACTATATGTACCTCGATCGTAACGACGCGGGC GAAGCTATCTCCTTCCCGACCACGCTGGGCATGAACAAGTGCTATATTCAGATTATGGAC CTGGGCCATATGTGCGACGCGACCATGTCCTACGAATGTCCGATGCTGGACGAAGGAGTT GAGCCTGATGACGTCGATTGCTGGTGCAATACCACTTCCACCTGGGTGGTGTACGGTACT TGCCATCACAAAAAGGGCGAAGCCCGCCGTTCCCGTCGCGCTGTCACTCTGCCAAGCCAC AGCACACGCAAATTGCAGACGAGGAGTCAGACGTGGTTGGAGTCGCGCGAGTACACAAAG CACCTGATTCGGGTGGAAAATTGGATCTTCCGGAATCCGGGCTTTGCTTTGGCGGCAGCC GCTATTGCGTGGCTGCTCGGCAGTAGCACGTCGATGCGCACCATCATTGCCCTGCTCTTG CTGCTCGTGAGCGGTGCCCACGCCAGCCGTTGCGTGGGCGTCAGCAACCGCGATTTCGTG GAGGGCATGAGCGGTGGAACCTGGGTCGACGTTGTGCTGGAACATGGCGGCTGCGTCACA GTGATGGCTCAGGACAAGCCGACCGTGGACATCGAGTTGGTTACCACGACGGTTTCCAAC ATGGCGGAGGTTCGCAGCTACTGCTACGAAGCCAGCATCAGCGATATGGCATCGGACAGC CGGTGCCCGACCCAGGGAGAAGCATATCTCGACAAGCAGTCCGACACGCAATATGTCTGT AAAAGGACGCTCGTTGACCGCGGCTGGGGCAACGGCTGCGGCCTGTTTGGAAAAGGCTCC CTGGTCACATGCGCGAAGTTTGCATGTTCGAAGAAGATGACGGGCAAAAGCATCCAACCA GAGAATCTGGAATACCGGATCATGTTGTCCGTGCACGGCAGCCAGCATAGTGGCATGATT GTGAACGACACCGGTCACGAAACCGACGAGAACCGCGCTAAAGTTGAGATCACCCCGAAC AGTCCCCGGGCCGAGGCCACGCTGGGAGGCTTCGGATCGCTGGGTCTGGATTGCGAACCC CGCACCGGACTGGATTTCTCGGATCTCTACTACCTGACGATGAACAATAAGCACTGGCTG GTGCACAAAGAGTGGTTCCATGATATCCCATTGCCCTGGCATGCCGGTGCCGATACCGGA ACACCCCACTGGAACAATAAGGAGGCCCTGGTCGAGTTTAAGGACGCGCACGCTAAGCGT CAAACGGTGGTGGTGCTGGGATCCCAAGAGGGCGCCGTGCACACGGCCCTGGCCGGCGCG CTGGAGGCCGAGATGGACGGTGCCAAGGGACGCTTGAGCTCCGGACACCTGAAATGCCGC CTCAAGATGGACAAGCTGCGTCTGAAAGGAGTGTCCTACTCCCTCTGCACCGCCGCGTTC ACCTTCACTAAGATTCCCGCCGAGACTTTGCACGGTACAGTGACCGTTGAGGTGCAGTAT GCCGGAACCGATGGCCCTTGCAAAGTCCCGGCCCAAATGGCGGTGGATATGCAGACGCTG ACGCCTGTGGGCCGGCTCATTACCGCAAACCCAGTCATCACGGAGAGTACCGAGAACTCG AAGATGATGCTGGAGTTGGACCCCCCGTTTGGCGACAGTTACATCGTGATCGGAGTGGGC GAAAAGAAGATTACGCACCATTGGCACCGTAGCGGC Codon optimized nucleotide sequence for Zika prM-E-436 (Product = ZIKFP-E-436-CoOp) SEQ ID NO: 3 GCAGAAGTGACCCGCCGCGGCAGCGCATACTATATGTACCTCGATCGTAACGACGCGGGC GAAGCTATCTCCTTCCCGACCACGCTGGGCATGAACAAGTGCTATATTCAGATTATGGAC CTGGGCCATATGTGCGACGCGACCATGTCCTACGAATGTCCGATGCTGGACGAAGGAGTT GAGCCTGATGACGTCGATTGCTGGTGCAATACCACTTCCACCTGGGTGGTGTACGGTACT TGCCATCACAAAAAGGGCGAAGCCCGCCGTTCCCGTCGCGCTGTCACTCTGCCAAGCCAC AGCACACGCAAATTGCAGACGAGGAGTCAGACGTGGTTGGAGTCGCGCGAGTACACAAAG CACCTGATTCGGGTGGAAAATTGGATCTTCCGGAATCCGGGCTTTGCTTTGGCGGCAGCC GCTATTGCGTGGCTGCTCGGCAGTAGCACGTCGCAGAAAGTGATTTACCTGGTCATGATC CTCCTCATCGCCCCCGCCTATTCGATCCGTTGCATTGGCGTCAGCAACCGCGATTTCGTG GAGGGCATGAGCGGTGGAACCTGGGTCGACGTTGTGCTGGAACATGGCGGCTGCGTCACA GTGATGGCTCAGGACAAGCCGACCGTGGACATCGAGTTGGTTACCACGACGGTTTCCAAC ATGGCGGAGGTTCGCAGCTACTGCTACGAAGCCAGCATCAGCGATATGGCATCGGACAGC CGGTGCCCGACCCAGGGAGAAGCATATCTCGACAAGCAGTCCGACACGCAATATGTCTGT AAAAGGACGCTCGTTGACCGCGGCTGGGGCAACGGCTGCGGCCTGTTTGGAAAAGGCTCC CTGGTCACATGCGCGAAGTTTGCATGTTCGAAGAAGATGACGGGCAAAAGCATCCAACCA GAGAATCTGGAATACCGGATCATGTTGTCCGTGCACGGCAGCCAGCATAGTGGCATGATT GTGAACGACACCGGTCACGAAACCGACGAGAACCGCGCTAAAGTTGAGATCACCCCGAAC AGTCCCCGGGCCGAGGCCACGCTGGGAGGCTTCGGATCGCTGGGTCTGGATTGCGAACCC CGCACCGGACTGGATTTCTCGGATCTCTACTACCTGACGATGAACAATAAGCACTGGCTG GTGCACAAAGAGTGGTTCCATGATATCCCATTGCCCTGGCATGCCGGTGCCGATACCGGA ACACCCCACTGGAACAATAAGGAGGCCCTGGTCGAGTTTAAGGACGCGCACGCTAAGCGT CAAACGGTGGTGGTGCTGGGATCCCAAGAGGGCGCCGTGCACACGGCCCTGGCCGGCGCG CTGGAGGCCGAGATGGACGGTGCCAAGGGACGCTTGAGCTCCGGACACCTGAAATGCCGC CTCAAGATGGACAAGCTGCGTCTGAAAGGAGTGTCCTACTCCCTCTGCACCGCCGCGTTC ACCTTCACTAAGATTCCCGCCGAGACTTTGCACGGTACAGTGACCGTTGAGGTGCAGTAT GCCGGAACCGATGGCCCTTGCAAAGTCCCGGCCCAAATGGCGGTGGATATGCAGACGCTG ACGCCTGTGGGCCGGCTCATTACCGCAAACCCAGTCATCACGGAGAGTACCGAGAACTCG AAGATGATGCTGGAGTTGGACCCCCCGTTTGGCGACAGTTACATCGTGATCGGAGTGGGC GAAAAGAAGATTACGCACCATTGGCACCGTAGCGGC Codon optimized nucleotide sequence for Zika prM-E-436 with synthetic E secretion signal (Product = ZIKFP-OpE-436-CoOp) SEQ ID NO: 4 GCAGAAGTGACCCGCCGCGGCAGCGCATACTATATGTACCTCGATCGTAACGACGCGGGC GAAGCTATCTCCTTCCCGACCACGCTGGGCATGAACAAGTGCTATATTCAGATTATGGAC CTGGGCCATATGTGCGACGCGACCATGTCCTACGAATGTCCGATGCTGGACGAAGGAGTT GAGCCTGATGACGTCGATTGCTGGTGCAATACCACTTCCACCTGGGTGGTGTACGGTACT TGCCATCACAAAAAGGGCGAAGCCCGCCGTTCCCGTCGCGCTGTCACTCTGCCAAGCCAC AGCACACGCAAATTGCAGACGAGGAGTCAGACGTGGTTGGAGTCGCGCGAGTACACAAAG CACCTGATTCGGGTGGAAAATTGGATCTTCCGGAATCCGGGCTTTGCTTTGGCGGCAGCC GCTATTGCGTGGCTGCTCGGCAGTAGCACGTCGATGCGCACCATCATTGCCCTGCTCTTG CTGCTCGTGAGCGGTGCCCACGCCAGCCGTTGCGTGGGCGTCAGCAACCGCGATTTCGTG GAGGGCATGAGCGGTGGAACCTGGGTCGACGTTGTGCTGGAACATGGCGGCTGCGTCACA GTGATGGCTCAGGACAAGCCGACCGTGGACATCGAGTTGGTTACCACGACGGTTTCCAAC ATGGCGGAGGTTCGCAGCTACTGCTACGAAGCCAGCATCAGCGATATGGCATCGGACAGC CGGTGCCCGACCCAGGGAGAAGCATATCTCGACAAGCAGTCCGACACGCAATATGTCTGT AAAAGGACGCTCGTTGACCGCGGCTGGGGCAACGGCTGCGGCCTGTTTGGAAAAGGCTCC CTGGTCACATGCGCGAAGTTTGCATGTTCGAAGAAGATGACGGGCAAAAGCATCCAACCA GAGAATCTGGAATACCGGATCATGTTGTCCGTGCACGGCAGCCAGCATAGTGGCATGATT GTGAACGACACCGGTCACGAAACCGACGAGAACCGCGCTAAAGTTGAGATCACCCCGAAC AGTCCCCGGGCCGAGGCCACGCTGGGAGGCTTCGGATCGCTGGGTCTGGATTGCGAACCC CGCACCGGACTGGATTTCTCGGATCTCTACTACCTGACGATGAACAATAAGCACTGGCTG GTGCACAAAGAGTGGTTCCATGATATCCCATTGCCCTGGCATGCCGGTGCCGATACCGGA ACACCCCACTGGAACAATAAGGAGGCCCTGGTCGAGTTTAAGGACGCGCACGCTAAGCGT CAAACGGTGGTGGTGCTGGGATCCCAAGAGGGCGCCGTGCACACGGCCCTGGCCGGCGCG CTGGAGGCCGAGATGGACGGTGCCAAGGGACGCTTGAGCTCCGGACACCTGAAATGCCGC CTCAAGATGGACAAGCTGCGTCTGAAAGGAGTGTCCTACTCCCTCTGCACCGCCGCGTTC ACCTTCACTAAGATTCCCGCCGAGACTTTGCACGGTACAGTGACCGTTGAGGTGCAGTAT GCCGGAACCGATGGCCCTTGCAAAGTCCCGGCCCAAATGGCGGTGGATATGCAGACGCTG ACGCCTGTGGGCCGGCTCATTACCGCAAACCCAGTCATCACGGAGAGTACCGAGAACTCG AAGATGATGCTGGAGTTGGACCCCCCGTTTGGCGACAGTTACATCGTGATCGGAGTGGGC GAAAAGAAGATTACGCACCATTGGCACCGTAGCGGC French Polynesia prM-E nucleotide sequence (Product = ZIKFP-80E-WT) SEQ ID NO: 5 GCGGAGGUCACUAGACGUGGGAGUGCAUACUAUAUGUACUUGGACAGAAACGACGCUGGG     60 GAGGCCAUAUCUUUUCCAACCACAUUGGGGAUGAAUAAGUGUUAUAUACAGAUCAUGGAU    120 CUUGGACACAUGUGUGAUGCCACCAUGAGCUAUGAAUGCCCUAUGCUGGAUGAGGGGGUG    180 GAACCAGAUGACGUCGAUUGUUGGUGCAACACGACGUCAACUUGGGUUGUGUACGGAACC    240 UGCCAUCACAAAAAAGGUGAAGCACGGAGAUCUAGAAGAGCUGUGACGCUCCCCUCCCAU    300 UCCACUAGGAAGCUGCAAACGCGGUCGCAAACCUGGUUGGAAUCAAGAGAAUACACAAAG    360 CACUUGAUUAGAGUCGAAAAUUGGAUAUUCAGGAACCCUGGCUUCGCGUUAGCAGCAGCU    420 GCCAUCGCUUGGCUUUUGGGAAGCUCAACGAGCCAAAAAGUCAUAUACUUGGUCAUGAUA    480 CUGCUGAUUGCCCCGGCAUACAGCAUCAGGUGCAUAGGAGUCAGCAAUAGGGACUUUGUG    540 GAAGGUAUGUCAGGUGGGACUUGGGUUGAUGUUGUCUUGGAACAUGGAGGUUGUGUCACC    600 GUAAUGGCACAGGACAAACCGACUGUCGACAUAGAGCUGGUUACAACAACAGUCAGCAAC    660 AUGGCGGAGGUAAGAUCCUACUGCUAUGAGGCAUCAAUAUCGGACAUGGCUUCGGACAGC    720 CGCUGCCCAACACAAGGUGAAGCCUACCUUGACAAGCAAUCAGACACUCAAUAUGUCUGC    780 AAAAGAACGUUAGUGGACAGAGGCUGGGGAAAUGGAUGUGGACUUUUUGGCAAAGGGAGC    840 CUGGUGACAUGCGCUAAGUUUGCAUGCUCCAAGAAAAUGACCGGGAAGAGCAUCCAGCCA    900 GAGAAUCUGGAGUACCGGAUAAUGCUGUCAGUUCAUGGCUCCCAGCACAGUGGGAUGAUC    960 GUUAAUGACACAGGACAUGAAACUGAUGAGAAUAGAGCGAAGGUUGAGAUAACGCCCAAU   1020 UCACCAAGAGCCGAAGCCACCCUGGGGGGUUUUGGAAGCCUAGGACUUGAUUGUGAACCG   1080 AGGACAGGCCUUGACUUUUCAGAUUUGUAUUACUUGACUAUGAAUAACAAGCACUGGUUG   1140 GUUCACAAGGAGUGGUUCCACGACAUUCCAUUACCUUGGCACGCUGGGGCAGACACCGGA   1200 ACUCCACACUGGAACAACAAAGAAGCACUGGUAGAGUUCAAGGACGCACAUGCCAAAAGG   1260 CAAACUGUCGUGGUUCUAGGGAGUCAAGAAGGAGCAGUUCACACGGCCCUUGCUGGAGCU   1320 CUGGAGGCUGAGAUGGAUGGUGCAAAGGGAAGGCUGUCCUCUGGCCACUUGAAAUGUCGC   1380 CUGAAAAUGGAUAAACUUAGAUUGAAGGGCGUGUCAUACUCCUUGUGUACCGCAGCGUUC   1440 ACAUUCACCAAGAUCCCGGCUGAAACACUGCACGGGACAGUCACAGUGGAGGUACAGUAC   1500 GCAGGGACAGAUGGACCUUGCAAGGUUCCAGCUCAGAUGGCGGUGGACAUGCAAACUCUG   1560 ACCCCAGUUGGGAGGUUGAUAACCGCUAACCCCGUAAUCACUGAAAGCACUGAGAACUCU   1620 AAGAUGAUGCUGGAACUUGAUCCACCAUUUGGGGACUCUUACAUUGUCAUAGGAGUCGGG   1680 GAGAAGAAGAUCACCCACCACUGGCACAGGAGUGGCAGCACCAUUGGAAAAGCAUUUGAA   1740 GCCACUGUGAGAGGUGCCAAGAGAAUGGCAGUCUUGGGAGACACAGCCUGGGACUUUGGA   1800 UCAGUUGGAGGCGCUCUCAACUCAUUGGGCAAGGGCAUCCAUCAAAUUUUUGGAGCAGCU   1860 UUCAAAUCAUUGUUUGGAGGAAUGUCCUGGUUCUCACAAAUUCUCAUUGGAACGUUGCUG   1940 AUGUGGUUGGGUCUGAACACAAAGAAUGGAUCUAUUUCCCUUAUGUGCUUGGCCUUAGGG   2000 GGAGUGUUGAUCUUCUUAUCCACAGCUGUCUCUGCUG                          2017 French Polynesia prM-E amino acid sequence SEQ ID NO: 6 A E V T R R G S A Y Y M Y L D R N D A G     20 E A I S F P T T L G M N K C Y I Q I M D     40 L G H M C D A T M S Y E C P M L D E G V     60 E P D D V D C W C N T T S T W V V Y G T     80 C H H K K G E A R R S R R A V T L P S H    100 S T R K L Q T R S Q T W L E S R E Y T K    120 H L I R V E N W I F R N P G F A L A A A    140 A I A W L L G S S T S Q K V I Y L V M I    160 L L I A P A Y S I R C I G V S N R D F V    180 E G M S G G T W V D V V L E H G G C V T    200 V M A Q D K P T V D I E L V T T T V S N    220 M A E V R S Y C Y E A S I S D M A S D S    240 R C P T Q G E A Y L D K Q S D T Q Y V C    260 K R T L V D R G W G N G C G L F G K G S    280 L V T C A K F A C S K K M T G K S I Q P    300 E N L E Y R I M L S V H G S Q H S G M I    320 V N D T G H E T D E N R A K V E I T P N    340 S P R A E A T L G G F G S L G L D C E P    360 R T G L D F S D L Y Y L T M N N K H W L    380 V H K E W F H D I P L P W H A G A D T G    400 T P H W N N K E A L V E F K D A H A K R    420 Q T V V V L G S Q E G A V H T A L A G A    440 L E A E M D G A K G R L S S G H L K C R    460 L K M D K L R L K G V S Y S L C T A A F    480 T F T K I P A E T L H G T V T V E V Q Y    500 A G T D G P C K V P A Q M A V D M Q T L    520 T P V G R L I T A N P V I T E S T E N S    540 K M M L E L D P P F G D S Y I V I G V G    560 E K K I T H H W H R S G S T I G K A F E    580 A T V R G A K R M A V L G D T A W D F G    600 S V G G A L N S L G K G I H Q I F G A A    620 F K S L F G G M S W F S Q I L I G T L L    640 M W L G L N T K N G S I S L M C L A L G    660 G V L I F L S T A V S A                    672 pHH202 expression vector cassette sequence SEQ ID NO: 7 GGTACCGTTGCAGGACAGGATGTGGTGCCCGATGTGACTAGCTCTTTGCTGCAGGCCGTCCTA TCCTCTGGTTCCGATAAGAGACCCAGAACTCCGGCCCCCCACCGCCCACCGCCACCCCCATAC ATATGTGGTACGCAAGTAAGAGTGCCTGCGCATGCCCCATGTGCCCCACCAAGAGTTTTGCAT CCCATACAAGTCCCCAAAGTGGAGAACCGAACCAATTCTTCGCGGGCAGAACAAAAGCTTCTG CACACGTCTCCACTCGAATTTGGAGCCGGCCGGCGTGTGCAAAAGAGGTGAATCGAACGAAAG ACCCGTGTGTAAAGCCGCGTTTCCAAAATGTATAAAACCGAGAGCATCTGGCCAATGTGCATC AGTTGTGGTCAGCAGCAAAATCAAGTGAATCATCTCAGTGCAACTAAAGGGGGaATCTAGAaa caacATGAAGACCATTATCGCCCTGTCGTACATCTTTTGCCTGGTGTTCgctagcTCTAGcta gAggctcgagGCCCTTCGAAggatccAGACATGATAAGATACATTGATGAGTTTGGACAAACC ACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTT GTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAG GTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAG

[0119] Although the present invention has been described in terms of specific exemplary embodiments and examples, it will be appreciated that the embodiments disclosed herein are for illustrative purposes only and various modifications and alterations might be made by those skilled in the art without departing from the spirit and scope of the invention as set forth in the following claims.