Multimerizing Polypeptides Derived From Jelly Roll Fold Domain of Adenovirus Penton Base

20210332088 · 2021-10-28

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to novel polypeptide scaffolds for optimized presentation of oligopeptides, polypeptide sequences, protein domains, proteins and protein complexes made up of two, several or many subunits. These oligopeptides, polypeptide sequences, protein domains and proteins presented by the polypeptide scaffolds of the invention can include antigenic entities that stimulate the immune system to trigger an immune response, for example for vaccination purposes, or for preparing antibodies or other binder molecules in cell culture, or in vitro in a test tube. In a preferred embodiment, the polypeptides of the invention are assembled into Virus Like Particles (VLPs) optimized for presentation of antigens useful in the context of vaccination against infectious agents or tumors.

    Claims

    1. A polypeptide having the structure of formula (I)
    A-L.sub.1-B-L.sub.2-C  (I) wherein A is an N-terminal amino acid stretch of an adenovirus penton base protein; B is an amino acid stretch of an adenovirus penton base protein; C is a C-terminal amino acid stretch of an adenovirus penton base; wherein B is an amino acid stretch located between A and C in the sequence of said adenovirus penton base; wherein A, B and C form the jellyroll fold domain of said adenovirus penton base protein; wherein L.sub.1 and L.sub.2 are independently from one another selected from the group consisting of an oligopeptide, a polypeptide, a protein, and a protein complex; and wherein said oligopeptide, polypeptide, protein and protein complex, respectively, are either essentially non-adenoviral or, if adenoviral, are from an adenovirus having a different serotype compared to the serotype of the adenovirus from which said amino acid stretches A, B and C are derived.

    2. The polypeptide of claim 1, wherein amino acid stretch A comprises beta sheets 1, 2 and 3 of the jellyroll fold domain of said adenovirus.

    3. The polypeptide of claim 1, wherein amino acid stretch B comprises beta sheets 4 and 5 of the jellyroll fold domain of said adenovirus.

    4. The polypeptide according to claim 1, wherein amino acid stretch C comprises beta sheets 6, 7 and 8 of the jellyroll fold domain of adenovirus.

    5. The polypeptide according to claim 1, wherein amino acid stretches A, B, and C have an amino acid sequence each independently selected from the group consisting of penton bases of human adenovirus serotype 2, human adenovirus serotype 3, human adenovirus serotype 4, human adenovirus serotype 5, human adenovirus serotype 7, human adenovirus serotype 11, human adenovirus serotype 12, human adenovirus serotype 17, human adenovirus serotype 25, human adenovirus serotype 35, human adenovirus serotype 37, human adenovirus serotype 41, gorilla adenovirus, chimpanzee adenovirus, simian adenovirus serotype 18, simian adenovirus serotype 20, simian adenovirus serotype 49, rhesus adenovirus serotype 51, rhesus adenovirus serotype 52, and rhesus adenovirus serotype 53.

    6. The polypeptide of claim 5, wherein amino acid stretch A has the following consensus sequence (SEQ ID NO: 21): TABLE-US-00013 (U).sub.1-47PTX.sub.1GRNSIRYSX.sub.2X.sub.3x.sub.4PX.sub.5X.sub.6DTTX.sub.7X.sub.3YLVDNKSADIASL NYQNDHSNFX.sub.5TTVX.sub.9QNNDX.sub.10X.sub.11PX.sub.12EAX.sub.13TQTINX.sub.14DX.sub.15RSR WGX.sub.16X.sub.17LKTIX.sub.18X.sub.19TZ.sub.1Z.sub.2Z.sub.3Z.sub.4Z.sub.5Z.sub.6Z.sub.7Z.sub.8Z.sub.9Z.sub.10Z.sub.11Z.sub.12Z.sub.13 Z.sub.14Z.sub.15 wherein: amino acid stretch A ends on the C-terminal side before Z.sub.1 at residue T or at an amino acid from Z.sub.1 to Z.sub.15 U is any or no amino acid X.sub.1 is E or G X.sub.2 is E or S X.sub.3 is L or V X.sub.4 is A or S X.sub.5 is L or Q X.sub.6 is Y or E X.sub.7 is R or K X.sub.8 is V or L X.sub.9 is V or I X.sub.10 is F or Y X.sub.11 is T or S X.sub.12 is A or T or I or G X.sub.13 is S or G X.sub.14 is F or L X.sub.15 is E or D X.sub.16 is A or G X.sub.17 is D or Q X.sub.18 is L or M X.sub.19 is H or R Z.sub.1, if present, is N Z.sub.2, if present, is M Z.sub.3, if present, is P Z.sub.4, if present, is N Z.sub.5, if present, is V or I Z.sub.6, if present, is N Z.sub.7, if present, is E or D Z.sub.8, if present, is Y or F Z.sub.9, if present, is M Z.sub.10, if present, is F or S or Y Z.sub.11, if present, is T or S Z.sub.12, if present, is S or N Z.sub.13, if present, is K Z.sub.14, if present, is F Z.sub.16, if present, is K

    7. The polypeptide of claim 6, wherein amino acid stretch A is selected from the group consisting of the following sequences: from an amino acid selected from positions 1 to 48, to an amino acid selected from positions 129 to 144 of UniProt Acc. No. Q2Y0H9; from an amino acid selected from positions 1 to 48, to an amino acid selected from positions 129 to 144 of UniProt Acc. No. P03276; from an amino acid selected from positions 1 to 44, to an amino acid selected from positions 125 to 140 of UniProt Acc. No. Q2KSF3; from an amino acid selected from positions 1 to 48, to an amino acid selected from positions 129 to 144 of UniProt Acc. No. P12538; from an amino acid selected from positions 1 to 48, to an amino acid selected from positions 129 to 144 of UniProt Acc. No. Q9JFT6; from an amino acid selected from positions 1 to 48, to an amino acid selected from positions 129 to 144 of UniProt Acc. No. D2DM93; from an amino acid selected from positions 1 to 38, to an amino acid selected from positions 119 to 134 of UniProt Acc. No. P36716; from an amino acid selected from positions 1 to 35, to an amino acid selected from positions 116 to 131 of UniProt Acc. No. F1DT65; from an amino acid selected from positions 1 to 43, to an amino acid selected from positions 124 to 139 of UniProt Acc. No. M0QUK0; from an amino acid selected from positions 1 to 49, to an amino acid selected from positions 130 to 145 of UniProt Acc. No. Q7T941; from an amino acid selected from positions 1 to 35, to an amino acid selected from positions 116 to 131 of UniProt Acc. No. Q912J1; from an amino acid selected from positions 1 to 46, to an amino acid selected from positions 127 to 142 of UniProt Acc. No. F8WQN4; from an amino acid selected from positions 1 to 49, to an amino acid selected from positions 130 to 145 of UniProt Acc. No. E5L3Q9; from an amino acid selected from positions 1 to 44, to an amino acid selected from positions 125 to 140 of UniProt Acc. No. G9G849; from an amino acid selected from positions 1 to 46, to an amino acid selected from positions 127 to 142 of UniProt Acc. No. H8PFZ9; from an amino acid selected from positions 1 to 45, to an amino acid selected from positions 126 to 141 of UniProt Acc. No. F6KSU4; from an amino acid selected from positions 1 to 46, to an amino acid selected from positions 127 to 142 of UniProt Acc. No. F2WTK5; from an amino acid selected from positions 1 to 43, to an amino acid selected from positions 124 to 139 of UniProt Acc. No. A0A0A1EWW1; from an amino acid selected from positions 1 to 43, to an amino acid selected from positions 124 to 139 of UniProt Acc. No. A0A0A1EWX7; and from an amino acid selected from positions 1 to 44, to an amino acid selected from positions 125 to 140 of UniProt Acc. No. A0A0A1EWZ7.

    8. The polypeptide according to claim 5, wherein amino acid stretch B of above general formula (I) has the following sequence (SEQ ID NO: 22): TABLE-US-00014 Z.sub.17Z.sub.18Z.sub.19Z.sub.20Z.sub.21Z.sub.22Z.sub.23Z.sub.24Z.sub.25Z.sub.26Z.sub.27QVYWSLPDX.sub.20MX.sub.21DP VTFRSTX.sub.22QX.sub.23X.sub.24NX.sub.25PVVGX.sub.26ELZ.sub.28Z.sub.29Z.sub.30 wherein: amino acid stretch B begins on the N-terminal side at an amino acid from Z.sub.17 to Z.sub.27 or at amino acid Q after Z.sub.27; amino acid stretch B ends on the C-terminal side before Z.sub.28 at amino acid L or at an amino acid from Z.sub.28 to Z.sub.30, Z.sub.17, if present, is L or S Z.sub.18, if present, is T or P or C Z.sub.19, if present, is T or P Z.sub.20, if present, is P or S or A or R Z.sub.21, if present, is N or D Z.sub.22, if present, is G or V Z.sub.23, if present, is H or T Z.sub.24, if present, is C Z.sub.25, if present, is G Z.sub.26, if present, is A or V or S Z.sub.27, if present, is E or Q X.sub.20 is L or M X.sub.21 is Q or K X.sub.22 is Q or R or S X.sub.23 is V or I X.sub.24 is S or N X.sub.25 is Y or F X.sub.26 is A or V Z.sub.28, if present, is M or L Z.sub.29, if present, is P Z.sub.30, if present, is V or F

    9. The polypeptide of claim 8, wherein amino acid stretch B is selected from the group consisting of the following sequences: from an amino acid selected from positions 398 to 409, to an amino acid selected from positions 440 to 443 of UniProt Acc. No. Q2Y0H9; from an amino acid selected from positions 425 to 436, to an amino acid selected from positions 467 to 470 of UniProt Acc. No. P03276; from an amino acid selected from positions 379 to 390, to an amino acid selected from positions 421 to 444 of UniProt Acc. No. Q2KSF3; from an amino acid selected from positions 425 to 436, to an amino acid selected from positions 467 to 470 of UniProt Acc. No. P12538; from an amino acid selected from positions 398 to 409, to an amino acid selected from positions 440 to 443 of UniProt Acc. No. Q9JFT6; from an amino acid selected from positions 415 to 426, to an amino acid selected from positions 457 to 460 of UniProt Acc. No. D2DM93; from an amino acid selected from positions 351 to 362, to an amino acid selected from positions 393 to 397 of UniProt Acc. No. P36716; from an amino acid selected from positions 370 to 381, to an amino acid selected from positions 413 to 416 of UniProt Acc. No. F1DT65; from an amino acid selected from positions 388 to 399, to an amino acid selected from positions 440 to 443 of UniProt Acc. No. M0QUK0; from an amino acid selected from positions 445 to 456, to an amino acid selected from positions 497 to 500 of UniProt Acc. No. Q7T941; from an amino acid selected from positions 372 to 383, to an amino acid selected from positions 414 to 417 of UniProt Acc. No. Q912J1; from an amino acid selected from positions 362 to 373, to an amino acid selected from positions 404 to 407 of [Please insert UniProt Acc. No. F8WQN4; from an amino acid selected from positions 416 to 427, to an amino acid selected from positions 458 to 461 of UniProt Acc. No. E5L3Q9; from an amino acid selected from positions 372 to 383, to an amino acid selected from positions 420 to 423 of UniProt Acc. No. G9G849; from an amino acid selected from positions 353 to 364, to an amino acid selected from positions 395 to 398 of UniProt Acc. No. H8PFZ9; from an amino acid selected from positions 358 to 369, to an amino acid selected from positions 400 to 403 of UniProt Acc. No. F6KSU4; from an amino acid selected from positions 356 to 367, to an amino acid selected from positions 398 to 401 of UniProt Acc. No. F2WTK5; from an amino acid selected from positions 352 to 363, to an amino acid selected from positions 394 to 397 of UniProt Acc. No. A0A0A1EWW1; from an amino acid selected from positions 350 to 361, to an amino acid selected from positions 392 to 395 of UniProt Acc. No. A0A0A1EWX7; and from an amino acid selected from positions 351 to 362, to an amino acid selected from positions 393 to 396 of UniProt Acc. No. A0A0A1EWZ7.

    10. The polypeptide according to claim 5, wherein amino acid stretch C of above general formula (I) has the following sequence (SEQ ID NO: 23): TABLE-US-00015 Z.sub.32Z.sub.32Z.sub.33ALTDHGTLPLRSSIX.sub.27GVQRVTX.sub.28TDARRRTCPYVYKA LGIVX.sub.30PX.sub.31VLSSRTF wherein: amino acid stretch C begins on the N-terminal side at an amino acid from Z.sub.31 to Z.sub.33 or at amino acid A after Z.sub.33; Z.sub.31, if present, is N Z.sub.32, if present, is V Z.sub.33, if present, is P X.sub.27 is R or S or G X.sub.28 is V or I X.sub.29 is Y or H X.sub.30 is A or S X.sub.31 is R or K

    11. The polypeptide of claim 10, wherein the amino acid stretch C is selected from the group consisting of the following sequences: from an amino acid selected from positions 492 to 495, to the C-terminal amino acid of UniProt Acc. No. Q2Y0H9; from an amino acid selected from positions 519 to 522, to the C-terminal amino acid of UniProt Acc. No. P03276; from an amino acid selected from positions 466 to 469, to the C-terminal amino acid of UniProt Acc. No. Q2KSF3; from an amino acid selected from positions 492 to 495, to the C-terminal amino acid of UniProt Acc. No. P12538; from an amino acid selected from positions 465 to 468, to the C-terminal amino acid of UniProt Acc. No. Q9JFT6; from an amino acid selected from positions 482 to 485, to the C-terminal amino acid of UniProt Acc. No. D2DM93; from an amino acid selected from positions 419 to 422, to the C-terminal amino acid of UniProt Acc. No. P36716; from an amino acid selected from positions 438 to 441, to the C-terminal amino acid of [Please insert UniProt Acc. No. F1DT65; from an amino acid selected from positions 455 to 458, to the C-terminal amino acid of UniProt Acc. No. M0QUK0; from an amino acid selected from positions 522 to 525, to the C-terminal amino acid of UniProt Acc. No. Q7T941; from an amino acid selected from positions 439 to 442, to the C-terminal amino acid of UniProt Acc. No. Q912J1; from an amino acid selected from positions 429 to 432, to the C-terminal amino acid of UniProt Acc. No. F8WQN4; from an amino acid selected from positions 483 to 486, to the C-terminal amino acid of UniProt Acc. No. E5L3Q9; from an amino acid selected from positions 445 to 448, to the C-terminal amino acid of UniProt Acc. No. G9G849; from an amino acid selected from positions 420 to 423, to the C-terminal amino acid of UniProt Acc. No. H8PFZ9; from an amino acid selected from positions 425 to 428, to the C-terminal amino acid of UniProt Acc. No. F6KSU4; from an amino acid selected from positions 423 to 426, to the C-terminal amino acid of UniProt Acc. No. F2WTK5; from an amino acid selected from positions 419 to 422, to the C-terminal amino acid of UniProt Acc. No. A0A0A1EWW1; from an amino acid selected from positions 417 to 420, to the C-terminal amino acid of UniProt Acc. No. A0A0A1EWX7; and from an amino acid selected from positions 418 to 421, to the C-terminal amino acid of UniProt Acc. No. A0A0A1EWZ7.

    12. The polypeptide according to claim 5 wherein amino acid stretch A has the sequence of positions 1 to 132 of UniProt Acc. No. Q2Y0H9, amino acid stretch B has the sequence of positions 407 to 442 of UniProt Acc. No. Q2Y0H9, and amino acid stretch C has the sequence of positions 493 to 544 of UniProt Acc. No. Q2Y0H9.

    13. The polypeptide according to claim 1, wherein L.sub.1 and/or L.sub.2 is an oligopeptide having a sequence of 4 to 40 amino acids being selected from amino acids G and S.

    14. The polypeptide of claim 13 wherein L.sub.1 and/or L.sub.2 is independently selected from the group consisting of GGGS (SEQ ID NO: 24) and GGSGGS (SEQ ID NO: 25).

    15. The polypeptide according to clam 1, wherein L.sub.1 is an adenoviral sequence comprising an RGD loop of an adenovirus penton base having a different serotype compared to the serotype of the adenovirus(es) from which said amino acid stretches A, B and C are derived and/or L.sub.2 is an adenoviral sequence comprising a variable loop of an adenovirus penton base having a different serotype compared to the serotype of the adenovirus from which said amino acid stretches A, B and C are derived.

    16. The polypeptide of claim 15 wherein L.sub.1 is a big fragment of a crown domain of an adenovirus penton base having a different serotype compared to the serotype of the adenovirus(es) from which said amino acid stretches A, B and C are derived and L.sub.2 is a small fragment of a crown domain of an adenovirus penton base having a different serotype compared to the serotype of the adenovirus(es) from which said amino acid stretches A, B and C are derived.

    17. The polypeptide of claim 16 wherein the big and the small fragment are derived from a penton base protein of the same adenovirus.

    18. The polypeptide of claim 16 wherein the big and the small fragment are derived from a penton base protein of different adenoviruses.

    19. The polypeptide according to claim 15 wherein one or more non-adenoviral sequences are inserted into the RGD loop and/or variable loop.

    20. The polypeptide according to claim 1 wherein L.sub.1 and/or L.sub.2 comprise an antigen.

    21. The polypeptide of claim 20 wherein the antigen is selected from the group consisting of an antigen of an infectious agent and a tumour antigen.

    22. The polypeptide according to any claim 1 wherein a nucleic acid, a drug, label and/or binding partner of a biological binding pair is/are coupled to L.sub.1 and/or L.sub.2.

    23. (canceled)

    24. A nucleic acid comprising a sequence having the following general formula (II)
    5′-a-is.sub.1-I.sub.1-is.sub.2-b-is .sub.3-I.sub.2-is.sub.4-c-3′  (II) wherein a is a nucleotide sequence encoding A of general formula (I); b is a nucleotide sequence encoding B of general formula (I); c is a nucleotide sequence encoding C of general formula (I); I.sub.1, I.sub.2 are each a nucleotide sequence; and is.sub.1 to is.sub.4 are each independently a nucleotide sequence comprising at least one insertion site; and wherein general formula (I) is
    A-L.sub.1-B-L.sub.2-C  (I) wherein A is an N-terminal amino acid stretch of an adenovirus penton base protein; B is an amino acid stretch of an adenovirus penton base protein; C is a C-terminal amino acid stretch of an adenovirus penton base; wherein B is an amino acid stretch located between A and C in the sequence of said adenovirus penton base; wherein A, B and C form the jellyroll fold domain of said adenovirus penton base protein; wherein L.sub.1 and L.sub.2 are independently from one another selected from the group consisting of an oligopeptide, a polypeptide, a protein, and a protein complex; and wherein said oligopeptide, polypeptide, protein and protein complex, respectively, are either essentially non-adenoviral or, if adenoviral, are from an adenovirus having a different serotype compared to the serotype of the adenovirus from which said amino acid stretches A, B and C are derived.

    25. The nucleic acid of claim 24 wherein is.sub.1 to is.sub.4 are selected from the group consisting of recognition sequences of restriction enzymes, and recognition sequences of homing endonucleases.

    26. The nucleic acid of claim 25 wherein is.sub.1 comprises an EcoRI site, is.sub.2 comprises a RsrII site, is.sub.3 comprises a SacI site, and is.sub.4 comprises a XbaI site.

    27-36. (canceled)

    37. The polypeptide of claim 1 provided in a pentameric complex or a virus-like particle.

    38. The nucleic acid of claim 24 provided in a vector or a recombinant host cell.

    39. A polypeptide having the structure of formula (I)
    A-L1-B-L2-C  (I) wherein A is an N-terminal amino acid stretch of an adenovirus penton base protein; B is an amino acid stretch of an adenovirus penton base protein; C is a C-terminal amino acid stretch of an adenovirus penton base; wherein amino acid stretch A comprises beta sheets 1, 2 and 3 of the jellyroll fold domain of said adenovirus; wherein amino acid stretch A has the following consensus sequence (SEQ ID NO: 21): TABLE-US-00016 (U)1-47PTX1GRNSIRYSX2X3x4PX5X6DTTX7X3YLVDNKSADIASL NYQNDHSNFX5TTVX9QNNDX10X11PX12EAX13TQTINX14DX15RSR WGX16X17LKTIX18X19TZ1Z2Z3Z4Z5Z6Z7Z8Z9Z10Z11Z12Z13 Z14Z15 and amino acid stretch A ends on the C-terminal side before Z1 at residue T or at an amino acid from Z1 to Z15, and U is any or no amino acid X1 is E or G X2 is E or S X3 is L or V X4 is A or S X5 is L or Q X6 is Y or E X7 is R or K X8 is V or L X9 is V or I X10 is F or Y X11 is T or S X12 is A or T or I or G X13 is S or G X14 is F or L X15 is E or D X16 is A or G X17 is D or Q X18 is L or M X19 is H or R Z1, if present, is N Z2, if present, is M Z3, if present, is P Z4, if present, is N Z5, if present, is V or I Z6, if present, is N Z7, if present, is E or D Z8, if present, is Y or F Z9, if present, is M Z10, if present, is F or S or Y Z11, if present, is T or S Z12, if present, is S or N Z13, if present, is K Z14, if present, is F Z16, if present, is K wherein amino acid stretch B comprises beta sheets 4 and 5 of the jellyroll fold domain of said adenovirus; wherein amino acid stretch B of above general formula (I) has the following sequence (SEQ ID NO: 22): TABLE-US-00017 Z17Z18Z19Z20Z21Z22Z23Z24Z25Z26Z27QVYWSLPDX20MX21DP VTFRSTX22QX23X24NX25PVVGX26ELZ28Z29Z30 and amino acid stretch B begins on the N-terminal side at an amino acid from Z17 to Z27 or at amino acid Q after Z27 and ends on the C-terminal side before Z28 at amino acid L or at an amino acid from Z28 to Z30; and Z17, if present, is L or S Z18, if present, is T or P or C Z19, if present, is T or P Z20, if present, is P or S or A or R Z21, if present, is N or D Z22, if present, is G or V Z23, if present, is H or T Z24, if present, is C Z25, if present, is G Z26, if present, is A or V or S Z27, if present, is E or Q X20 is L or M X21 is Q or K X22 is Q or R or S X23 is V or I X24 is S or N X25 is Y or F X26 is A or V Z28, if present, is M or L Z29, if present, is P Z30, if present, is V or F wherein amino acid stretch C comprises beta sheets 6, 7 and 8 of the jellyroll fold domain of adenovirus; wherein amino acid stretch C of above general formula (I) has the following sequence (SEQ ID NO: 23): TABLE-US-00018 Z31Z32Z33ALTDHGTLPLRSSIX27GVQRVTX28TDARRRTCPYVYKA LGIVX30PX31VLSSRTF and amino acid stretch C begins on the N-terminal side at an amino acid from Z31 to Z33 or at amino acid A after Z33; and Z31, if present, is N Z32, if present, is V Z33, if present, is P X27 is R or S or G X28 is V or I X29 is Y or H X30 is A or S X31 is R or K wherein L1 and L2 are independently from one another selected from the group consisting of an oligopeptide, a polypeptide, a protein, and a protein complex; and wherein said oligopeptide, polypeptide, protein and protein complex, respectively, are either essentially non-adenoviral or, if adenoviral, are from an adenovirus having a different serotype compared to the serotype of the adenovirus from which said amino acid stretches A, B and C are derived.

    40. The polypeptide of claim 39, wherein amino acid stretch A is selected from the group consisting of the following sequences: from an amino acid selected from positions 1 to 48, to an amino acid selected from positions 129 to 144 of UniProt Acc. No. Q2Y0H9; from an amino acid selected from positions 1 to 48, to an amino acid selected from positions 129 to 144 of UniProt Acc. No. P03276; from an amino acid selected from positions 1 to 44, to an amino acid selected from positions 125 to 140 of UniProt Acc. No. Q2KSF3; from an amino acid selected from positions 1 to 48, to an amino acid selected from positions 129 to 144 of UniProt Acc. No. P12538; from an amino acid selected from positions 1 to 48, to an amino acid selected from positions 129 to 144 of UniProt Acc. No. Q9JFT6; from an amino acid selected from positions 1 to 48, to an amino acid selected from positions 129 to 144 of UniProt Acc. No. D2DM93; from an amino acid selected from positions 1 to 38, to an amino acid selected from positions 119 to 134 of UniProt Acc. No. P36716; from an amino acid selected from positions 1 to 35, to an amino acid selected from positions 116 to 131 of UniProt Acc. No. F1DT65; from an amino acid selected from positions 1 to 43, to an amino acid selected from positions 124 to 139 of UniProt Acc. No. M0QUK0; from an amino acid selected from positions 1 to 49, to an amino acid selected from positions 130 to 145 of UniProt Acc. No. Q7T941; from an amino acid selected from positions 1 to 35, to an amino acid selected from positions 116 to 131 of UniProt Acc. No. Q912J1; from an amino acid selected from positions 1 to 46, to an amino acid selected from positions 127 to 142 of UniProt Acc. No. F8WQN4; from an amino acid selected from positions 1 to 49, to an amino acid selected from positions 130 to 145 of UniProt Acc. No. E5L3Q9; from an amino acid selected from positions 1 to 44, to an amino acid selected from positions 125 to 140 of UniProt Acc. No. G9G849; from an amino acid selected from positions 1 to 46, to an amino acid selected from positions 127 to 142 of UniProt Acc. No. H8PFZ9; from an amino acid selected from positions 1 to 45, to an amino acid selected from positions 126 to 141 of UniProt Acc. No. F6KSU4; from an amino acid selected from positions 1 to 46, to an amino acid selected from positions 127 to 142 of UniProt Acc. No. F2WTK5; from an amino acid selected from positions 1 to 43, to an amino acid selected from positions 124 to 139 of UniProt Acc. No. A0A0A1EWW1; from an amino acid selected from positions 1 to 43, to an amino acid selected from positions 124 to 139 of UniProt Acc. No. A0A0A1EWX7; and from an amino acid selected from positions 1 to 44, to an amino acid selected from positions 125 to 140 of UniProt Acc. No. A0A0A1EWZ7.

    41. The polypeptide of claim 39, wherein amino acid stretch B is selected from the group consisting of the following sequences: from an amino acid selected from positions 398 to 409, to an amino acid selected from positions 440 to 443 of UniProt Acc. No. Q2Y0H9; from an amino acid selected from positions 425 to 436, to an amino acid selected from positions 467 to 470 of UniProt Acc. No. P03276; from an amino acid selected from positions 379 to 390, to an amino acid selected from positions 421 to 444 of UniProt Acc. No. Q2KSF3; from an amino acid selected from positions 425 to 436, to an amino acid selected from positions 467 to 470 of UniProt Acc. No. P12538; from an amino acid selected from positions 398 to 409, to an amino acid selected from positions 440 to 443 of UniProt Acc. No. Q9JFT6; from an amino acid selected from positions 415 to 426, to an amino acid selected from positions 457 to 460 of UniProt Acc. No. D2DM93; from an amino acid selected from positions 351 to 362, to an amino acid selected from positions 393 to 397 of UniProt Acc. No. P36716; from an amino acid selected from positions 370 to 381, to an amino acid selected from positions 413 to 416 of UniProt Acc. No. F1DT65; from an amino acid selected from positions 388 to 399, to an amino acid selected from positions 440 to 443 of UniProt Acc. No. M0QUK0; from an amino acid selected from positions 445 to 456, to an amino acid selected from positions 497 to 500 of UniProt Acc. No. Q7T941; from an amino acid selected from positions 372 to 383, to an amino acid selected from positions 414 to 417 of UniProt Acc. No. Q912J1; from an amino acid selected from positions 362 to 373, to an amino acid selected from positions 404 to 407 of [Please insert UniProt Acc. No. F8WQN4; from an amino acid selected from positions 416 to 427, to an amino acid selected from positions 458 to 461 of UniProt Acc. No. E5L3Q9; from an amino acid selected from positions 372 to 383, to an amino acid selected from positions 420 to 423 of UniProt Acc. No. G9G849; from an amino acid selected from positions 353 to 364, to an amino acid selected from positions 395 to 398 of UniProt Acc. No. H8PFZ9; from an amino acid selected from positions 358 to 369, to an amino acid selected from positions 400 to 403 of UniProt Acc. No. F6KSU4; from an amino acid selected from positions 356 to 367, to an amino acid selected from positions 398 to 401 of UniProt Acc. No. F2WTK5; from an amino acid selected from positions 352 to 363, to an amino acid selected from positions 394 to 397 of UniProt Acc. No. A0A0A1EWW1; from an amino acid selected from positions 350 to 361, to an amino acid selected from positions 392 to 395 of UniProt Acc. No. A0A0A1EWX7; and from an amino acid selected from positions 351 to 362, to an amino acid selected from positions 393 to 396 of UniProt Acc. No. A0A0A1EWZ7.

    42. The polypeptide of claim 39, wherein the amino acid stretch C is selected from the group consisting of the following sequences: from an amino acid selected from positions 492 to 495, to the C-terminal amino acid of UniProt Acc. No. Q2Y0H9; from an amino acid selected from positions 519 to 522, to the C-terminal amino acid of UniProt Acc. No. P03276; from an amino acid selected from positions 466 to 469, to the C-terminal amino acid of UniProt Acc. No. Q2KSF3; from an amino acid selected from positions 492 to 495, to the C-terminal amino acid of UniProt Acc. No. P12538; from an amino acid selected from positions 465 to 468, to the C-terminal amino acid of UniProt Acc. No. Q9JFT6; from an amino acid selected from positions 482 to 485, to the C-terminal amino acid of UniProt Acc. No. D2DM93; from an amino acid selected from positions 419 to 422, to the C-terminal amino acid of UniProt Acc. No. P36716; from an amino acid selected from positions 438 to 441, to the C-terminal amino acid of [Please insert UniProt Acc. No. F1DT65; from an amino acid selected from positions 455 to 458, to the C-terminal amino acid of UniProt Acc. No. M0QUK0; from an amino acid selected from positions 522 to 525, to the C-terminal amino acid of UniProt Acc. No. Q7T941; from an amino acid selected from positions 439 to 442, to the C-terminal amino acid of UniProt Acc. No. Q912J1; from an amino acid selected from positions 429 to 432, to the C-terminal amino acid of UniProt Acc. No. F8WQN4; from an amino acid selected from positions 483 to 486, to the C-terminal amino acid of UniProt Acc. No. E5L3Q9; from an amino acid selected from positions 445 to 448, to the C-terminal amino acid of UniProt Acc. No. G9G849; from an amino acid selected from positions 420 to 423, to the C-terminal amino acid of UniProt Acc. No. H8PFZ9; from an amino acid selected from positions 425 to 428, to the C-terminal amino acid of UniProt Acc. No. F6KSU4; from an amino acid selected from positions 423 to 426, to the C-terminal amino acid of UniProt Acc. No. F2WTK5; from an amino acid selected from positions 419 to 422, to the C-terminal amino acid of UniProt Acc. No. A0A0A1EWW1; from an amino acid selected from positions 417 to 420, to the C-terminal amino acid of UniProt Acc. No. A0A0A1EWX7; and from an amino acid selected from positions 418 to 421, to the C-terminal amino acid of UniProt Acc. No. A0A0A1EWZ7.

    43. The polypeptide according to claim 39 wherein amino acid stretch A has the sequence of positions 1 to 132 of UniProt Acc. No. Q2Y0H9, amino acid stretch B has the sequence of positions 407 to 442 of UniProt Acc. No. Q2Y0H9, and amino acid stretch C has the sequence of positions 493 to 544 of UniProt Acc. No. Q2Y0H9.

    44. The polypeptide according to claim 39, wherein L1 and/or L2 is an oligopeptide having a sequence of 4 to 40 amino acids being selected from amino acids G and S.

    45. The polypeptide of claim 44 wherein L1 and/or L2 is independently selected from the group consisting of GGGS (SEQ ID NO: 24) and GGSGGS (SEQ ID NO: 25).

    46. The polypeptide according to claim 39 wherein one or more of L1 and L2 comprise an antigen.

    47. The polypeptide according to any claim 39 wherein one or more of a nucleic acid, a drug, label or a binding partner of a biological binding pair are coupled to one or more of L1 and L2.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0188] FIG. 1A is an image of a dodecahedron formed by 60 copies of base proteins of certain Adenovirus serotypes. FIG. 1B is an image of a adenovirus base protein which can be split into a crown domain and a multimerization domain. Within the multimerization domain, the termini generated by splitting can be reconnected by short oligopeptide linkers yielding contiguous polypeptide chains. Both he N and C-termini of the base protein are contained in the multimerization domain.

    [0189] FIG. 2 is a schematical overview of the jellyroll fold domain of a preferred embodiment of the inventive polypeptide based on the penton base protomer of hAd3.

    [0190] FIG. 3 is a schematic view of an adenovirus base proteinshowing positions of the crown domain and the multimerization domain. The N and C-termini of the base protein are contained in the multimerization domain, which mediates penton and dodecahedron formation. Removal of the crown domain yields an autonomous multimerization domain which, in place of formerly the crown domain, now contains oligopeptides, polypeptides, proteins or protein complexes as shown schematically towards from middle to right. The multimerization domains now give rise to virus-like particles presenting these entities on their surface. Naturally, crown domains and engineered crown domains derived from a range of Adenovirus serotypes can also be fitted on out multimerization domain scaffold, including engineered crown domains containing heterologous peptide and polypeptide sequences.

    [0191] FIG. 4 is a schematic view of an Adenovirus derived dodecahedral display platform (ADDomer). The original particle is shown on the left. The base protein is formed by the multimerization domain and the crown domain. 60 base proteins form a virus-like particle (VLP). ADDomers displaying (instead of the crown domain) multiple copies of oligopeptides, polypeptides and protein domains, proteins or protein complexes are shown on the right.

    [0192] FIG. 5 is a schematic representation of vector pACEBac_VAJB-CHIK.

    DETAILED DESCRIPTION OF THE INVENTION

    [0193] The present invention is further illustrated by the following non-limiting example:

    Example

    [0194] A nucleic acid with the sequence denoted DNAsegVAJB-CHIK (SEQ ID NO: 26; flanked by BamHI site at the 5′ end and by a HindIII site at the 3′ end; see underlined sequence below) was synthesized by a commercial supplier:

    TABLE-US-00010 ggatccatgaggagacgagccgtgctaggcggagcggtggtgtatccgga gggtcctcctccttcttacgagagcgtgatgcagcaacaggcggcgatga tacagcccccactggaggctcccttcgtacccccacggtacctggcgcct acggaagggagaaacagcattcgttactcggagctgtcgcccctgtacga taccaccaagttgtatctggtggacaacaagtcggcggacatcgcctccc tgaactatcagaacgaccacagcaacttcctgaccacggtggtgcagaac aatgactttacccccacggaggctagcacccagaccatcaactttgacga gcggtcgcgatggggcggtcagctgaagaccatcatgcacaccaacatgc ccggaggtgaaaacctgtattttcagagcaccaaagataactttaacgtg tataaagcgacccgcccgtatctggcgcatggaggtgcagagcaggtcta ctggtcgctccctgacatgatgcaagacccagtcaccttccgctccacaa gacaagtcaacaactacccagtggtgggtgcagagcttatgcccggtgga agcggaggtagcgttcctgctctcacagatcacgggaccctgccgttacg cagcagtatccggggagtccagcgcgtgaccgttactgacgccagacgcc gcacctgtccctacgtttacaaggccctgggcatagtcgcgccgcgcgtt ctttcaagccgcactttctgataagctt

    [0195] The construct was cloned into transfer plasmid pACEBac (Geneva Biotech, Geneva, Switzerland) using cleavage sites BamHI and HindIII, giving rise to the construct pACEBac_VAJB-CHIK (SEQ ID NO: 27):

    TABLE-US-00011 accggttgacttgggtcaactgtcagaccaagtttactcatatatacttt agattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatc ctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttcca ctgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctt tttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctacca gcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggt aactggcttcagcagagcgcagataccaaatactgttcttctagtgtagc cgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctc gctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtg tcttaccgggttggactcaagacgatagttaccggataaggcgcagcggt cgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacc tacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgct tcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaa caggagagcgcacgagggagcttccagggggaaacgcctggtatctttat agtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatg ctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttt tacggttcctggccttttgctggccttttgctcacatgttctttcctgcg ttatcccctgattgacttgggtcgctcttcctgtggatgcgcagatgccc tgcgtaagcgggtgtgggcggacaataaagtcttaaactgaacaaaatag atctaaactatgacaataaagtcttaaactagacagaatagttgtaaact gaaatcagtccagttatgctgtgaaaaagcatactggacttttgttatgg ctaaagcaaactcttcattttctgaagtgcaaattgcccgtcgtattaaa gaggggcgtggccaagggcatgtaaagactatattcgcggcgttgtgaca atttaccgaacaactccgcggccgggaagccgatctcggcttgaacgaat tgttaggtggcggtacttgggtcgatatcaaagtgcatcacttcttcccg tatgcccaactttgtatagagagccactgcgggatcgtcaccgtaatctg cttgcacgtagatcacataagcaccaagcgcgttggcctcatgcttgagg agattgatgagcgcggtggcaatgccctgcctccggtgctcgccggagac tgcgagatcatagatatagatctcactacgcggctgctcaaacttgggca gaacgtaagccgcgagagcgccaacaaccgcttcttggtcgaaggcagca agcgcgatgaatgtcttactacggagcaagttcccgaggtaatcggagtc cggctgatgttgggagtaggtggctacgtctccgaactcacgaccgaaaa gatcaagagcagcccgcatggatttgacttggtcagggccgagcctacat gtgcgaatgatgcccatacttgagccacctaactttgttttagggcgact gccctgctgcgtaacatcgttgctgctgcgtaacatcgttgctgctccat aacatcaaacatcgacccacggcgtaacgcgcttgctgcttggatgcccg aggcatagactgtacaaaaaaacagtcataacaagccatgaaaaccgcca ctgcgccgttaccaccgctgcgttcggtcaaggttctggaccagttgcgt gagcgcatacgctacttgcattacagtttacgaaccgaacaggcttatgt caactgggttcgtgccttcatccgtttccacggtgtgcgtcacccggcaa ccttgggcagcagcgaagtcgccataacttcgtatagcatacattatacg aagttatctgtaactataacggtcctaaggtagcgagtttaaacactagt atcgattcgcgacctactccggaatattaatagatcatggagataattaa aatgataaccatctcgcaaataaataagtattttactgttttcgtaacag ttttgtaataaaaaaacctataaatattccggattattcataccgtccca ccatcgggcgcggatccAtgaggagacgagccgtgctaggcggagcggtg gtgtatccggagggtcctcctccttcttacgagagcgtgatgcagcaaca ggcggcgatgatacagcccccactggaggctcccttcgtacccccacggt acctggcgcctacggaagggagaaacagcattcgttactcggagctgtcg cccctgtacgataccaccaagttgtatctggtggacaacaagtcggcgga catcgcctccctgaactatcagaacgaccacagcaacttcctgaccacgg tggtgcagaacaatgactttacccccacggaggctagcacccagaccatc aactttgacgagcggtcgcgatggggcggtcagctgaagaccatcatgca caccaacatgcccGGAGGTgaaaacctgtattttcagagcaccaaagata actttaacgtgtataaagcgacccgcccgTatctggcgcatGGAGGTGca gagcaggtctactggtcgctccctgacatgatgcaagacccagtcacctt ccgctccacaagacaagtcaacaactacccagtggtgggtgcagagctta tgcccGGTGGAagcggAggtagcgttcctgctctcacagatcacgggacc ctgccgttacgcagcagtatccggggagtccagcgcgtgaccgttactga cgccagacgccgcacctgtccctacgtttacaaggccctgggcatagtcg cgccgcgcgttctttcaagccgcactttctgataagcttccatcaacttt gacgagcggtcgcgatggggcggtcagctgaagaccatcatgcacaccaa catgcccaacgtgaacgagtacatgttcagcaacaagttcaaggcgaggg agcttgtcgagaagtactagaggatcataatcagccataccacatttgta gaggttttacttgctttaaaaaacctcccacacctccccctgaacctgaa acataaaatgaatgcaattgttgttgttaacttgtttattgcagcttata atggttacaaataaagcaatagcatcacaaatttcacaaataaagcattt ttttcactgcattctagttgtggtttgtccaaactcatcaatgtatctta tcatgtctggatctgatcactgcttgagcctagaagatccggctgctaac aaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataact atcataacccctagggtatacccatctaattggaaccagataagtgaaat ctagttccaaactattttgtcatttttaattttcgtattagcttacgacg ctacacccagttcccatctattttgtcactcttccctaaataatccttaa aaactccatttccacccctcccagttcccaactattttgtccgcccaca

    [0196] DNA sequencing was used to verify the proper insertion. The open reading frame encodes the protein VAJB-CHIK (SEQ ID NO: 28) which contains the major neutralizing epitope from Chikungunya virus STKDNFNVYKATRPYLAH (SEQ ID NO: 29) in loop L1.

    TABLE-US-00012 VAJB-CHIK (SEQ ID NO: 28): MRRRAVLGGA VVYPEGPPPS YESVMQQQAA MIQPPLEAPF VPPRYLAPTE GRNSIRYSEL SPLYDTTKLY LVDNKSADIA SLNYQNDHSN FLTTVVQNND FTPTEASTQT INFDERSRWG GQLKTIMHTN MPGGENLYFQ STKDNFNVYK ATRPYLAHGG AEQVYWSLPD MMQDPVTFRS TRQVNNYPVV GAELMPGGSG GSVPALTDHG TLPLRSSIRG VQRVIVTDAR RRTCPYVYKA LGIVAPRVLS SRTF

    [0197] pACEBac_VAJB-CHIK was then used to transform DH10EMBacY cells (Geneva Biotech, Geneva, Switzerland) harbouring the baculoviral genome EMBacY as an artificial chromosome (described in Fitzgerald D J et al. Nat Methods. 2006 Dec. 3(12):1021-32 PMID: 17117155). Composite baculovirus with the expression cassette for VAJB1 integrated by Tn7 transposition in the DH10EMBacY cells was then identified by blue/white screening, and recombinant baculovirus generated as described (ibid). Spodoptera frugiperda line 21 (Sf21) insect cell cultures were infected with baculovirus thus generated as described by Fitzgerald et al. (2006) Nat Methods, supra.

    [0198] Large-scale (100 ml-500 ml) expression was carried out in Trichoplusia ni Hi5 cells in shaker flasks and recombinant protein expression followed by measuring yellow fluorescent protein (YFP) fluorescence as described (Fitzgerald D J et Nat Methods. 2006 Dec. 3(12):1021-32 PMID: 17117155). When YFP fluorescence reached a plateau (normally after 72 hours after proliferation arrest in the cell culture, see Fitzgerald et al, Nat Methods 2006), insect cell cultures were harvested and cells pelleted by centrifugation (4000 g, 10 min). Cells were frozen in liquid nitrogen and stored at −80 degrees Celsius.or protein preparation, cells were lysed by freeze-thawing in phosphate buffered saline (PBS) containing whole protease inhibitor cocktail (Roche Ltd). Protein was purified by loading on a sucrose gradient from 15% to 40% w/v sucrose and ultracentrifugation overnight at 100.000 g. The gradient was harvested and protein content identified by means of denaturing polyacrylamide gel electrophoresis (SDS-PAGE) followed by Commassie Brilliant Blue staining. The fractions containing VAJB1 were pooled and dialysed against PBS (or HEPES 10 mM, pH 7.4, 50 mM NaCl). A second purification step was performed on 5 ml HiQ column (BioRAD) using a linear gradient from 50 mM to 500 mM NaCl. Pentamer and Dodecamer formation was verified by negative stain (uranyl acetate) electron microscopy.