ARGONAUTE PROTEIN MUTANT AND USE THEREOF

Abstract

The present invention relates to a mutant of Argonaute protein lacking a DNA cleavage activity but having a DNA binding activity, wherein the mutation of the mutant is located in a PIWI domain. The present invention also relates to a use based on the protein mutant, especially in enrichment of a target DNA and construction of sequence libraries. Therefore, the present invention also relates to a method for enrichment of a target DNA, comprising the following steps: (a) designing a guide sequence for a specific sequence in the target DNA; (b) binding the mutant according to the present invention, the guide sequence and the target DNA to obtain a mutant-guide sequence-target DNA ternary complex; (c) capturing the mutant-guide sequence-target DNA ternary complex through a capture medium; and (d) separating the target DNA from the captured mutant-guide sequence-target DNA ternary complex to obtain an enriched target DNA.

Claims

1-39. (canceled)

40. A mutant of Argonaute protein, having a DNA binding activity but lacking a DNA cleavage activity, wherein the mutation of the mutant is located in a PIWI domain.

41. The mutant of claim 40, wherein the Argonaute protein is derived from Marinitoga, Thermotoga, Pyrococcus, Methanocaldococus, Rhodobacter, Aquifex, Archaeoglobus, or Thermus.

42. The mutant of claim 40, wherein the Argonaute protein is derived from Pyrococcus furiosus, Thermus thermophiles, Methanocaldococus jannaschii, Marinitoga piezophila, Rhodobacter sphaeroides, Aquifex aeolicus, Archaeoblobus fulgidus or Thermotoga profunda.

43. The mutant of claim 40, wherein the amino acid sequence of the Argonaute protein is selected from SEQ ID NOs: 1-8.

44. The mutant of claim 43, wherein the mutant comprises one or more mutations selected from the group consisting of: substitution of amino acid residues at positions 558, 596, 628 and 745 of SEQ ID NO: 1, and of amino acid residues at the positions corresponding to the above positions, or deletion of amino acid at positions 628-770 of SEQ ID NO: 1, and of amino acid residues at the positions corresponding to the above positions.

45. The mutant of claim 44, wherein the substitution is alanine or glutamic acid substitution.

46. The mutant of claim 40, wherein the mutant further comprises mutations located in the following domains: N-terminal domain and PAZ domain.

47. A method for enrichment of a target DNA comprising the following steps: (a) designing a guide sequence for a specific sequence in the target DNA; (b) binding the mutant of claim 40, the guide sequence and the target DNA to obtain a mutant-guide sequence-target DNA ternary complex; (c) capturing the mutant-guide sequence-target DNA ternary complex through a capture medium; (d) separating the target DNA from the captured mutant-guide sequence-target DNA ternary complex to obtain an enriched target DNA.

48. The method of claim 47, wherein the step (b) further comprises the following steps: (b1) binding the mutant according to the present invention with a guide sequence to obtain a mutant-guide sequence binary complex; (b2) binding a dAgo-guide sequence binary complex with the target DNA sequence to obtain a mutant-guide sequence-target DNA ternary complex.

49. The method of claim 47, wherein the guide sequence is an RNA or a DNA.

50. The method of claim 47, wherein the guide sequence is a single stranded RNA (ssRNA) or a single stranded DNA (ssDNA).

51. The method of claim 47, wherein the guide sequence comprises nucleotide modifications.

52. The method of claim 51, wherein the modification is 5′ phosphorylation or 5′ hydroxylation.

53. The method of claim 47, wherein the guide sequence has a length of 15-25 nucleotides.

54. The method of claim 47, wherein the guide sequence is substantially complementary to the specific sequence in the target DNA.

55. The method of claim 47, wherein the capture medium is magnetic beads.

56. The method of claim 47, wherein the capture medium carries a capture tag capable of binding to the specific tag carried by the mutant.

57. A kit comprising the mutant of claim 40.

58. The kit of claim 57, further comprising a guide sequence and a capture medium.

59. The kit of claim 58, wherein the guide sequence is an RNA or a DNA.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0073] FIG. 1 is a flow chart illustrating a method of the enrichment of the target DNA according to the present invention.

[0074] FIG. 2 shows an amino acid sequence SEQ ID NO: 1 of Ago protein (PfAgo) of Pyrococcus furiosus, wherein PIWI domain (amino acid residues at positions 473-756) is underlined.

[0075] FIG. 3 shows an amino acid sequence SEQ ID NO: 2 of Ago protein (TtAgo) of Thermus thermophilus, wherein PIWI domain (amino acid residues at positions 507-671) is underlined.

[0076] FIG. 4 shows an amino acid sequence SEQ ID NO: 3 of Ago protein (MjAgo) of Methanocaldococus jannaschii, wherein PIWI domain (amino acid residues at positions 426-699) is underlined.

[0077] FIG. 5 shows an amino acid sequence SEQ ID NO: 4 of Ago protein (MpAgo) of Marinitoga piezophila, wherein PIWI domain (amino acid residues at positions 394-634) is underlined.

[0078] FIG. 6 shows an amino acid sequence SEQ ID NO: 5 of Ago protein (TpAgo) of Thermotoga profunda, wherein PIWI domain (amino acid residues at positions 431-620) is underlined.

[0079] FIG. 7 shows an amino acid sequence SEQ ID NO: 6 of Ago protein (RsAgo) of Rhodobacter sphaeroides, wherein PIWI domain (amino acid residues at positions 445-757) is underlined.

[0080] FIG. 8 shows an amino acid sequence SEQ ID NO: 7 of Ago protein (AaAgo) of Aquifex aeolicus, wherein PIWI domain (amino acid residues at positions 419-694) is underlined.

[0081] FIG. 9 shows an amino acid sequence SEQ ID NO: 8 of Ago protein (AfAgo) of Archaeoblobus fulgidus, wherein PIWI domain (amino acid residues at positions 110-406) is underlined.

[0082] FIG. 10 shows an amino acid sequence alignment of DEDX catalytic regions in PIWI domain of hAGO2 (GenBank Gene ID: 27161), TtAgo, MjAgo, PfAgo, MpAgo, TpAgo, AaAgo, AfAgo and RsAgo. Among them, the DEDX catalytic regions shown are amino acid residues at positions 553-563/591-600/623-631/740-750 of SEQ ID NO: 1, amino acid residues at positions 473-483/511-519/541-549/655-665 of SEQ ID NO: 2, amino acid residues at positions 499-509/540-548/565-573/683-693 of SEQ ID NO: 3, amino acid residues at positions 441-451/481-489/511-521/619-629 of SEQ ID NO: 4, amino acid residues at positions 434-444/474-482/504-514/612-622 of SEQ ID NO: 5, amino acid residues at positions 524-534/695-703/549-559/461-471 of SEQ ID NO: 6, amino acid residues at positions 463-471/497-507/566-576/678-688 of SEQ ID NO: 7, and amino acid residues at positions 169-179/136-144/200-210/121-131 of SEQ ID NO: 8. FIG. 10 discloses SEQ ID NOS: 17-20 and 31-62, respectively, in order of appearance.

[0083] FIG. 11 shows the sequencing results of pPFA-1.1, pPFA-1.2, pPFA-1.3, pPFA-1.4, and pPFA-1.5. FIG. 11 discloses SEQ ID NOS: 21-24, 23, and 25-29, respectively, in order of columns.

[0084] FIG. 12 shows the quality analysis results of the target DNA enriched according to the method of Example 2.

[0085] FIG. 13 shows the representative sequencing results of the sequencing library prepared according to the methods of Example 3 and Example 4.

DETAILED DESCRIPTION OF THE INVENTION

[0086] The present invention is described below in detail with reference to the drawings and the examples. It should be noted that those skilled in the art should understand that the drawings and the examples of the present invention are for the purpose of illustration only and do not constitute any limitation to the present invention.

Example 1: Preparation of Ago Protein Mutant of the Present Invention

Step 1: Constructing an Expression Vector

[0087] A biotin receptor sequence was connected to the N-terminal of the amino acid sequence (SEQ ID NO: 1) of the known Pyrococcus fuliginosus Ago protein (PfAgo), and a codon optimized nucleotide sequence for Escherichia coli (E. coli) was designed and synthesized according to the biotin receptor sequence. The nucleotide sequence, 6× His-Tag (SEQ ID NO: 30), PfAgo-BAS, IRES, and BirA (E. coli biotin ligase) were serially cloned into pET-28a vector with a kanamycin resistance gene in sequence to obtain a vector pPFA-1.0.

[0088] The pPFA-1.0 was subjected to site-directed mutation according to the operation protocol of the manual using Q5® Site-Directed Mutagenesis Kit (NEB, Cat #E05454S). The mutated DNA was transformed into E. Coli DH5α□cells and cultured overnight at 37° C. in LB agarose medium containing kanamycin. For each mutation, 10 colonies were selected and cultured in 4 mL LB liquid medium containing kanamycin under shaking at 37° C. for 12-16 hours. Then, 2 mL of bacterial liquid was taken to extract plasmids using Plasmid Mini Kit (Qiagen®, Cat #27104).

Step 2: Sequencing Verification

[0089] The extracted plasmid was amplified using universal primers on the plasmid (T7 promoter primer 5′-TAATACGACTCACTATAGGG-3′ (SEQ ID NO: 13) and T7 terminator primer 5′-GCTAGTTATTGCTCAGCGG-3′ (SEQ ID NO: 14), synthesized by IDT), and then the amplified products were sequenced (Beijing Ruibo Xingke Biotechnology Co., Ltd.). The sequencing results are shown in FIG. 11.

[0090] The following plasmids confirmed to contain mutations were stored at −20° C. for a long time: [0091] plasmid pPFA-1.1, wherein the amino acid residue at position 558 is substituted by alanine (D558A); [0092] plasmid pPFA-1.2, wherein the amino acid residue at position 596 is substituted by alanine (E596A); [0093] plasmid pPFA-1.3, wherein the amino acid residue at position 628 is substituted by alanine (D628A); [0094] plasmid pPFA-1.4, wherein the amino acid residue at position 745 is substituted by alanine (H745A); and [0095] plasmid pPFA-1.5, wherein the amino acid residues at positions 628-770 are deleted (Δ628-770).

Step 3: Vector Transformation and Expression of PfAgo Protein Mutant

[0096] The five plasmids confirmed to be mutated in above step 2 were transformed into E. coli BL21 (DE3) cells, respectively. The transformed cells were cultured at 37° C. under shaking overnight in LB culture medium containing 50 μg/mL kanamycin. Then, the medium was replaced with fresh LB culture medium, and the culture was continued to expand until OD.sub.600 reached 0.4-0.8. IPTG was added until the final concentration is 500 μM, and the culture continued at 37° C. under shaking for 3-5 hours.

[0097] The culture medium was centrifuged at 6,000 g for 15 minutes to remove the supernatant. The resulting pellet was resuspended in cell lysis buffer I (20 mM Tris pH 8.0, 1 M NaCl, 2 mM MnCl.sub.2) and ultrasonically disrupted. The disrupted solution was centrifuged at 20,000 g for 30 minutes at 4° C., and then the supernatant was collected. The supernatant was purified with nickel column at 4° C., and then the purified product was desalted and concentrated using a protein ultrafiltration column (Pierce™ Protein Concentrator PES, 30K MWCO, Thermo Fisher Scientific) according to the operation protocol of the manual. The concentrated product is the expressed PfAgo protein mutant carrying a biotin tag. The expressed PfAgo protein mutant was added with equal volume of glycerol and stored at −20° C.

Example 2: Enrichment of Target DNA According to the Method of the Present Invention

[0098] The target DNA in this example is exons 18-21 fragment of EGFR gene from free DNAs in plasma sample and genomic DNAs in leukocytes isolated from normal human peripheral blood, respectively.

Step 1: DNA Extraction

[0099] For free DNAs: 4 mL of human plasma was taken, and the free DNAs were extracted using QIAamp Circulating Nucleic Acid Kit (Qiagen®, Cat #55114) according to the kit manual, and then eluted with 45 μL Elution Buffer.

[0100] For genomic DNAs: 200 μL of leukocytes isolated from human peripheral blood were taken, and the genomic DNA was extracted using MagJET™ Whole Blood gDNA Kit (Thermo Scientific™, Cat #K2741) according to the kit manual. Approximately 500 ng (30 μL) of extracted genomic DNA was ultrasonically disrupted (ultrasonic disruptor Bioruptor® Pico from Diagenode SA).

Step 2: Design of Guide DNA (gDNA)

[0101] The gDNA with 5′ phosphorylation modification was designed and synthesized according to EGFR exons 18, 19, 20 and 21 sequences as follows:

TABLE-US-00001 gDNA Name gDNA sequences (5′-3′) EGFR_E18_gD1 CTCCCAACCAAGCTCTCTTG (SEQ ID NO: 9) EGFR_E19_gD1 TAGGGACTCTGGATCCCAGA (SEQ ID NO: 10) EGFR_E20_gD2 TGAGGCAGATGCCCAGCAGG (SEQ ID NO: 11) EGFR_E21_gD1 TCTGTGATCTTGACATGCTG (SEQ ID NO: 12)

[0102] 100 μM of the above-mentioned gDNAs were dissolved in Buffer EB (20 mM Tris pH 8.0), respectively. Then, each of the gDNA solutions were mixed in equal volume and diluted 100 times to obtain 1 μM gDNA mixed solution.

Step 3: Binding of gDNA to PfAgo Protein Mutant to Form a Binary Complex.

[0103] The reaction system was prepared by mixing each PfAgo protein mutant (i.e., D558A, E596A, D628A, H745A and Δ628-770) and gDNA according to the following table:

TABLE-US-00002 Reagent Name Volume Buffer DA1 (2x)  10 uL PfAgo protein mutant (5 uM) 0.5 uL gDNA mixed solution (1 uM)   5 uL ddH.sub.2O 4.5 uL

[0104] The above reaction system was incubated at 95° C. for 10 minutes.

Step 4: Binding of the Binary Complex to the Target DNA to Form a Ternary Complex.

[0105] 45 μL of free DNA or 30 μL of ultrasonically disrupted genomic DNA obtained in the above step 1 was added to the reaction system in the above step 3, mixed evenly, incubated at 87° C. for 15 minutes, and then placed on ice.

Step 5: Capture of the Ternary Complex.

[0106] Dynabeads™ M270 Streptavidin (Thermo Fisher, Cat #65305) pre-balanced with Buffer DA1(1×) were added to the reaction system in the above step 4 and incubated at room temperature for 30 minutes. Then Dynabeads™ were washed with Buffer DA1(1×) 3 times at room temperature for 3 minutes each time. At this time, Dynabeads™ were bound with the enriched target DNA.

Step 6: Separation of Enriched Target DNA

[0107] 50 μL Buffer DA1(1×) and 1 μL protease K (20 μg/μL) were added to Dynabeads™ and incubated at 55° C. for 15 minutes. Then, it was placed on ice, cooled and added with double volume of Agencourt AMPure XP magnetic beads (Beckman Coulter™, Cat #A63880). After incubation for 10 minutes at room temperature, the magnetic beads were adsorbed to remove supernatant, washed twice with 80% alcohol, and finally dissolved in 25 μL Tris solution (20 mM, pH 8.5).

Step 7: Quality Analysis of Enriched Target DNA

[0108] Purified DNA was tested for DNA concentration on Qubit® 3 Fluorometer (Thermo Fisher, Cat #Q33216) with Qubit® dsDNA Hs reagent (Thermo Fisher, Cat #Q3323), and DNA purity was tested by capillary electrophoresis simultaneously (Agilent 2100 Bio Analyzer Instrument, Cat #G2939BA). The representative results are shown in FIG. 12. The enriched target DNA has a length of around 200-1000 bp. The concentration is 61.5 pg/μL. The molar concentration reaches 275.8 pmol/l. The quality is good and complies with the requirements of preparing library for sequencing.

Example 3: Construction of Sequencing Library of Target DNA According to the Method of the Present Invention

Step 1: Extraction of Free DNA

[0109] 4 mL of human plasma was taken, and free DNA was extracted using QIAamp Circulating Nucleic Acid Kit (Qiagen®, Cat #55114) according to the kit manual. The final free DNA was eluted with 45 μL Elution Buffer provided by the kit.

Step 2: Connection of Sequencing Linker

[0110] The free DNA was subjected to terminal filling and A addition, and then connected to TruSeq linker suitable for Illumina® sequencing platform using KAPA HyperPrep Kit (Kapa Biosystems, Cat #KKK8501) according to the manual protocol.

Step 3: Pre-Amplification of the Connection Product

[0111] The reaction system was prepared according to the following table:

TABLE-US-00003 NEBNext® Ultra™ II Q5® Mater Mix 2x 50 uL (NEB, Cat#M0544S) P5/P7 Universal Primer Mixture (each 20 uM)  5 uL (synthesized by IDT, P5: 5′-AATGATACGGCGACCACCGA-3′  (SEQ ID NO: 15) P7: 5′-CAAGCAGAAGACGGCATACGAGAT-3′ (SEQ ID NO: 16)) Connection product 45 uL

[0112] Pre-amplification was carried out on a PCR instrument according to the following conditions:

TABLE-US-00004 Number of Temperature Time cycle 98° C. 60 sec 1 98° C. 15 sec 15 60° C. 30 sec 65° C. 30 sec 65° C. 3 min 1

[0113] After amplification was completed, the pre-amplification product was purified according to the manufacturer's manual with 200 μL of Agencourt AMPure XP magnetic beads (Beckman Coulter™, Cat #A63880). The purified product was dissolved in 30 μL buffer DA1 (1×) (15 mm Tris pH 8.0, 0.5 mm MnCl.sub.2, 250 mm NaCl).

Step 4: Enrichment of Target DNA

[0114] Guide DNA (gDNA) with 5′ phosphorylation modification was designed and synthesized according to exons 18, 19, 20 and 21 sequences of EGFR gene as follows:

TABLE-US-00005 gDNA Name gDNA sequences (5′-3′) EGFR_E18_gD1 CTCCCAACCAAGCTCTCTTG (SEQ ID NO: 9) EGFR_E19_gD1 TAGGGACTCTGGATCCCAGA (SEQ ID NO: 10) EGFR_E20_gD2 TGAGGCAGATGCCCAGCAGG (SEQ ID NO: 11) EGFR_E21_gD1 TCTGTGATCTTGACATGCTG (SEQ ID NO: 12)

[0115] 100 μM of the above-mentioned gDNAs were dissolved in Buffer EB (20 mM Tris pH 8.0), respectively. Then, each of the gDNA solutions were mixed in equal volume and diluted 100 times to obtain 1 μM gDNA mixed solution.

[0116] The reaction system was prepared by mixing PfAgo protein mutant (i.e., D558A, E596A, D628A, H745A and Δ628-770) and gDNA according to the following table:

TABLE-US-00006 Reagent Name Volume Buffer DA1 (2x)*  10 uL PfAgo protein mutant (5 uM) 0.5 uL gDNA mixed solution (1 uM)   5 uL ddH.sub.2O 4.5 uL *Buffer DA1(2x): 30 mM Tris pH 8.0, 1.0 mM MnCl.sub.2, 500 mM NaCl

[0117] The above reaction system was incubated at 95° C. for 10 minutes.

[0118] 30 μL of the purified product obtained in step 3 was added to the above reaction system, mixed evenly, incubated at 87° C. for 15 minutes, and then placed on ice.

[0119] Dynabeads™ M270 Streptavidin (Thermo Fisher, Cat #65305) pre-balanced with Buffer DA1(1×) were added to the above reaction system and incubated at room temperature for 30 minutes. Then, Dynabeads™ were washed with Buffer DA1(1×) 3 times at room temperature for 3 minutes each time. At this time, Dynabeads™ were bound with enriched target DNA.

Step 5: Amplification of the Enriched Target DNA

[0120] The following reagents were added to Dynabeads™ obtained in step 4.

TABLE-US-00007 Reagent Name Volume NEBNext ® Ultra ™ II Q5 ® Mater Mix 2x  25 uL P5/P7 Universal Primer Mixture (each 20 uM) 2.5 uL deionized water 22.5 uL 

[0121] Amplification was performed on a PCR instrument under the following conditions:

TABLE-US-00008 Number of Temperature Time cycle 98° C. 60 sec 1 98° C. 15 sec 15 60° C. 30 sec 65° C. 30 sec 65° C. 3 min 1

Step 6: Purification of the Amplified Target DNA

[0122] To the amplification product obtained in step 5 above, equal volume of Agencourt AMPure XP magnetic beads (Beckman Coulter™, Cat #A63880) were added, incubated at room temperature for 5 minutes, and then washed twice with 200 μl of 80% ethanol. After air drying at room temperature, 30 μl Buffer EB was added and the supernatant was collected after standing for 5 min. The supernatant is the enriched and purified target DNA sequencing library.

Example 4: Construction of Sequencing Library of Target DNA According to the Method of the Present Invention

[0123] The enriched target DNA obtained in step 6 of Example 2 was subjected to terminal filling and A addition using KAPA Hyper Prep kit (Kapa Biosystems, Cat #KK8501) and according to the kit manual (the enriched target DNA combined with Dynabeads™ obtained in step 5 of Example 2 can also be used), and then connected with TruSeq linker suitable for Illumina.sup.− sequencing platform to obtain a connection product.

[0124] The following reagents were added to the above-mentioned connection product:

TABLE-US-00009 Reagent Name Volume NEBNext ® Ultra ™ II Q5 ® Mater Mix 2x  25 uL P5/P7 Universal Primer Mixture (each 20 uM) 2.5 uL deionized water 22.5 uL 

[0125] Amplification was performed on a PCR instrument under the following conditions:

TABLE-US-00010 Number of Temperature Time cycle 98° C. 60 sec 1 98° C. 15 sec 15 60° C. 30 sec 65° C. 30 sec 65° C. 3 min 1

[0126] After completion of amplification, equal volume of Agencourt AMPure XP magnetic beads (Beckman Coulter, Cat #A63880) were added to the amplification product, incubated at room temperature for 5 minutes, and then washed twice with 200 μl of 80% ethanol. After air drying at room temperature, 30 μl buffer EB was added and the supernatant was collected after standing for 5 minutes. The supernatant is the enriched and purified target DNA sequencing library.

Example 5: Computer Sequencing

[0127] The sequencing libraries obtained in Examples 3 and 4 were quantified on a StepOnePlus™ Real-Time PCR System (ThermoFisher, Cat #4376592) fluorescence quantitative PCR instrument using KAPA Library Quantification Kits (KAPA Biosciences, Cat #KK4835) and according to the kit manual. The effective concentration for quantitative detection of the sequencing library was not less than 1 nM.

[0128] According to the concentration of the library, the sequencing library with an appropriate volume was sequenced by double-ended 150 bases (150PE) on Illumina® NextSeq CN500 sequencer. The representative sequencing results are shown in FIG. 13. The target DNA fragment in the genomic DNA and free DNA were enriched for around 500 times by the Ago protein mutant of the present invention. Thus, for the genomic DNA and highly fragmented free DNA, the present invention could rapidly and efficiently enrich the target DNA using Ago protein mutant, thereby constructing the sequencing library meeting the sequencing requirements.

[0129] It should be noted that although some features of the present invention have been illustrated by the above examples, they cannot be used to limit the present invention. Various modifications and changes can be made to the present invention for those skilled in the Art. Reaction reagents, reaction conditions and the like involved in the construction of sequencing library can be adjusted and changed according to specific needs. Therefore, for those skilled in the art, several simple substitutions can be made without departing from the concepts and principles of the present invention, which should be included in the protection scope of the present invention.