MINIATURIZED HAIRPIN RNAi TRIGGERS (mxRNA) AND METHODS OF USES THEREOF
20210332358 · 2021-10-28
Inventors
Cpc classification
C12N15/87
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
A61K9/0019
HUMAN NECESSITIES
C12N15/111
CHEMISTRY; METALLURGY
C12N2310/346
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The present invention relates to novel RNAi triggers that can be chemically synthesized and used to modulate gene expression inside animal cells to study various genes function in laboratories or as an active ingredient for agricultural, veterinary, cosmetic and/or therapeutic applications
Claims
1. A conjugate for modulating, preferably inhibiting, expression of a target gene in a cell, said conjugate comprising a nucleic acid attached to one or more ligands, wherein said nucleic acid is preferably not a substrate for dicer, and comprises: first, second and third nucleic acid portions; wherein said first portion (i) is at least partially complementary to at least a portion of RNA transcribed from said target gene, and (ii) has a 5′ to 3′ directionality thereby defining 5′ and 3′ regions of said first portion; wherein said second portion (i) is at least partially complementary to said first portion, and (ii) has a 5′ to 3′ directionality thereby defining 5′ and 3′ regions of said second portion; wherein said first and second portions dimerise to form an at least partially complementary duplex; wherein the third nucleic acid portion links the 3′ region of said first portion to the 5′ region of said second portion.
2. A conjugate according to claim 1, wherein said third nucleic acid portion is at least partially complementary to at least a portion of RNA transcribed from said target gene.
3. A conjugate according to claim 1, wherein said second nucleic acid portion is at least partially complementary to at least a portion of RNA transcribed from said target gene.
4. A conjugate according to claim 1, wherein said one or more ligands are conjugated to said second nucleic acid portion.
5. A conjugate according to claim 4, wherein said one or more ligands are conjugated at the 3 region of the second nucleic acid portion.
6. A conjugate according to claim 1, wherein said one or more ligands are conjugated at one or more regions intermediate of the 5′ and 3′ regions of the first nucleic acid portion.
7. A conjugate according to claim 1, wherein said one or more ligands are conjugated at one or more regions intermediate of the 5′ and 3′ regions of the secondnucleic acid portion.
8. A conjugate according to claim 1, wherein said one or more ligands are conjugated at one or more regions of the third nucleic acid portion.
9. A conjugate according to claim 1, wherein said one or more ligands are any cell directing moiety, such as lipids, carbohydrates, aptamers, vitamins and/or peptides that bind cellular membrane or a specific target on cellular surface.
10. A conjugate according to claim 9, wherein said one or more ligands comprise one or more carbohydrates.
11. A conjugate according to claim 10, wherein said one or more carbohydrates can be a monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide or polysaccharide.
12. A conjugate according to claim 11, wherein said one or more carbohydrates comprise one or more galactose moieties, one or more lactose moieties, one or more N-Acetyl-Galactosamine moieties, and/or one or more mannose moieties.
13. A conjugate according to claim 12, wherein said one or more carbohydrates comprise one or more N-Acetyl-Galactosamine moieties.
14. A conjugate according to claim 13, which comprises two or three N-Acetyl-Galactosamine moieties.
15. A conjugate according to claim 1, wherein said one or more ligands are attached to said nucleic acid in a linear configuration, or in a branched configuration.
16. A conjugate according to claim 15, wherein said one or more ligands are attached to said nucleic acid as a biantennary or triantennary configuration, or as a configuration based on single ligands at different positions.
17. A conjugate according to claim 1, wherein said nucleic acid is a single strand that dimerises whereby said first and second portions form said at least partially complementary duplex.
18. A conjugate according to claim 1, wherein said nucleic acid is 17 to 40 nucleotides in length.
19. A conjugate according to claim 18, wherein said nucleic acid is at least 20 nucleotides in length, or more preferably is at least 25 nucleotides in length.
20. A conjugate according to claim 1, wherein said first nucleic acid portion is 7 to 20 nucleotides in length, preferably 10 to 18 nucleotides in length, more preferably less than 18 nucleotides in length.
21. A conjugate according to claim 1, wherein said second nucleic acid portion is 7 to 20 nucleotides in length, preferably 10 to 18 nucleotides in length, more preferably less than 18 nucleotides in length.
22. A conjugate according to claim 1, wherein said third nucleic acid portion is 1 to 10 nucleotides in length, such as 4 to 9 nucleotides in length, such as 4, 5, 7 or 9 nucleotides in length.
23. A conjugate according to claim 1, which comprises one or more phosphorothioate or phosphorodithioate internucleotide linkages.
24. A conjugate according to claim 23, which comprises 1 to 15 phosphorothioate or phosphorodithioate internucleotide linkages.
25. A conjugate according to claim 23, which comprises one or more phosphorothioate or phosphorodithioate internucleotide linkages at one or more of the 5′ and/or 3′ regions of the first and/or second nucleic acid portions.
26. A conjugate according to claim 23, which comprises phosphorothioate or phosphorodithioate internucleotide linkages between at least two, preferably at least three, preferably at least four, preferably at least five, preferably at least six, preferably at least seven, preferably at least eight, preferably at least nine, preferably ten, adjacent nucleotides of the third nucleic acid portion, dependent on the number of nucleotides present in the third nucleic acid portion.
27. A conjugate according to claim 23, which comprises a phosphorothioate or phosphorodithioate internucleotide linkage between each adjacent nucleotide that is present in said third nucleic acid portion.
28. A conjugate according to claim 1, which comprises a phosphorothioate or phosphorodithioate internucleotide linkage linking the first nucleic acid portion to the third nucleic acid portion and/or the second nucleic acid portion to the third nucleic acid portion.
29. A conjugate according to claim 23, wherein at least one nucleotide of the first and/or second and/or third nucleic acid portion is modified.
30. A conjugate according to claim 29, wherein one or more of the odd numbered nucleotides starting from the 5′ region of the first nucleic acid portion are modified, and/or wherein one or more of the even numbered nucleotides starting from the 5′ region of the first nucleic acid portion are modified, wherein typically the modification of the even numbered nucleotides is a second modification that is different from the modification of odd numbered nucleotides.
31. A conjugate according to claim 29, wherein one or more of the odd numbered nucleotides starting from the 3′ region of the second nucleic acid portion are modified by a modification that is different from the modification of odd numbered nucleotides of the first nucleic acid portion according to claim 30.
32. A conjugate according to claim 29, wherein one or more of the even numbered nucleotides starting from the 3′ region of the second nucleic acid portion are modified by a modification that is different from the modification of odd numbered nucleotides of the second nucleic acid portion according to claim 31.
33. A conjugate according to claim 29, wherein at least one or more of the modified even numbered nucleotides of the first nucleic acid portion is adjacent to at least one or more of the differently modified odd numbered nucleotides of the first nucleic acid portion.
34. A conjugate according to claim 29, wherein at least one or more of the modified even numbered nucleotides of the second nucleic acid portion is adjacent to at least one or more of the differently modified odd numbered nucleotides of the second nucleic acid portion.
35. A conjugate according to claim 29, wherein a plurality of adjacent nucleotides of the first nucleic acid portion are modified by a common modification.
36. A conjugate according to claim 29, wherein a plurality of adjacent nucleotides of the second nucleic acid portion are modified by a common modification.
37. A conjugate according to claim 35, wherein said plurality of adjacent commonly modified nucleotides are 2 to 4 adjacent nucleotides, preferably 3 or 4 adjacent nucleotides.
38. A conjugate according to claim 37, wherein said plurality of adjacent commonly modified nucleotides are located in the 5′ region of the second nucleic acid portion.
39. A conjugate according to claim 37, wherein said plurality of adjacent commonly modified nucleotides are located in third nucleic acid region.
40. A conjugate according to claim 29, wherein a plurality of odd numbered nucleotides of the first and/or second nucleic acid portions are modified.
41. A conjugate according to claim 29, wherein a plurality of even numbered nucleotides of the first and/or second nucleic acid portions are modified by a second modification.
42. A conjugate according to claim 40, wherein said plurality of odd numbered nucleotides are modified by a common modification.
43. A conjugate according to claim 41, wherein said plurality of even numbered nucleotides are modified by a common second modification.
44. A conjugate according to claim 29, wherein the one or more of the modified nucleotides of the first nucleic acid portion do not have a common modification present in the corresponding nucleotide of the second nucleic acid portion of the duplex.
45. A conjugate according to claim 29, wherein the one or more of the modified nucleotides of the first nucleic acid portion do have a common modification present in the corresponding nucleotide of the second nucleic acid portion of the duplex.
46. A conjugate according to claim 29, wherein the one or more of the modified nucleotides of the first nucleic acid portion are shifted by at least one nucleotide relative to a commonly modified nucleotide of the second nucleic acid portion.
47. A conjugate according to claim 29, wherein the modification and/or modifications are each and individually sugar, backbone or base modifications, and are suitably selected from the group consisting of 3′-terminal deoxy-thymine, 2′-0-methyl, a 2′-deoxy-modification, a 2′-amino-modification, a 2′-alkyl-modification, a morpholino modification, a phosphoramidate modification, phosphorothioate or phosphorodithioate group modification, a 5′ phosphate or 5′ phosphate mimic modification and a cholesteryl derivative or a dodecanoic acid bisdecylamide group modification.
48. A conjugate according to claim 29, wherein the modification is any one of a locked nucleotide, an abasic nucleotide or a non-natural base comprising nucleotide.
49. A conjugate according to claim 29, wherein at least one modification is a 2′-O-methyl modification in a ribose moiety.
50. A conjugate according to claim 29, wherein at least one modification is a 2′-F modification in a ribose moiety.
51. A conjugate according to claim 29, wherein the nucleotides at any of positions 2 and 14 downstream from the first nucleotide of the 5′ region of the first nucleic acid portion do not contain 2′-O-methyl modifications in ribose moieties.
52. A conjugate according to claim 29, wherein the nucleotides of the second nucleic acid portion, that correspond in position to any of the nucleotides of the first nucleic acid portion at any of positions 9 to 11 downstream from the first nucleotide of the 5′ region of the first nucleic acid portion do not contain 2′-O-methyl modifications in ribose moieties.
53. A conjugate according to claim 51, wherein the nucleotides at any of positions 2 and 14 downstream from the first nucleotide of the 5′ region of the first nucleic acid portion contain 2′-F modifications in ribose moieties.
54. A conjugate according to claim 51, wherein the nucleotides of the second nucleic acid portion, that correspond in position to any of the nucleotides of the first nucleic acid portion at any of positions 9 to 11 downstream from the first nucleotide of the 5′ region of the first nucleic acid portion contain 2′-F modifications in ribose moieties.
55. A conjugate according to, claim 1 which comprises one or more unmodified nucleotides.
56. A conjugate according to claim 55, wherein said one or more unmodified nucleotides can replace any modified nucleotide as defined in any of claims 29 to 55.
57. A conjugate according to claim 56, wherein said one or more, preferably one, unmodified nucleotides represent any of the nucleotides at any of positions 17, 18, 19, 20, 21, 22, 23, 24 and/or 25 downstream from the first nucleotide of the 5′ region of the first nucleic acid portion, preferably positions 18, 19, 20 and/or 21.
58. A conjugate according to claim 51, wherein all nucleotides other than the unmodified nucleotides, and/or the nucleotides at any of positions 2 and 14 downstream from the first nucleotide of the 5′ region of the first nucleic acid portion, and/or the nucleotides of the second nucleic acid portion, that correspond in position to any of the nucleotides of the first nucleic acid portion at any of positions 9 to 11 downstream from the first nucleotide of the 5′ region of the first nucleic acid portion, contain 2′-O-methyl modifications in ribose moieties.
59. A conjugate according to claim 1, wherein the nucleic acid comprises at least one vinylphosphonate modification, such as at least one vinylphosphonate modification in the 5′ region of the first nucleic acid portion.
60. A conjugate according to claim 1, wherein one or more nucleotides of at least one of the first nucleic acid portion and the second nucleic acid portion is an inverted nucleotide and is attached to the adjacent nucleotide via the 3′ carbon of the nucleotide and the 3′ carbon of the adjacent nucleotide, and/or one or more nucleotides of at least one of the first nucleic acid portion and the second nucleic acid portion is an inverted nucleotide and is attached to the adjacent nucleotide via the 5′ carbon of the nucleotide and the 5′ carbon of the adjacent nucleotide.
61. A conjugate according to claim 60, wherein one or more nucleotides at the 3′ region of at least one of the first nucleic acid portion and the second nucleic acid portion is an inverted nucleotide and is attached to the adjacent nucleotide via the 3′ carbon of the terminal nucleotide and the 3′ carbon of the adjacent nucleotide, and/or one or more nucleotides at the 5′ region of at least one of the first nucleic acid portion and the second nucleic acid portion is an inverted nucleotide and is attached to the adjacent nucleotide via the 5′ carbon of the terminal nucleotide and the 5′ carbon of the adjacent nucleotide, and/or one or more nucleotides intermediate the 3′ and 5′ regions of at least one of the first nucleic acid portion and the second nucleic acid portion is an inverted nucleotide and is attached to the adjacent nucleotide via the 3′ carbon of the terminal nucleotide and the 3′ carbon of the adjacent nucleotide and/or one or more nucleotides intermediate the 3′ and 5′ regions of at least one of the first nucleic acid portion and the second nucleic acid portion is an inverted nucleotide and is attached to the adjacent nucleotide via the 5′ carbon of the terminal nucleotide and the 5′ carbon of the adjacent nucleotide, and/or one or more nucleotides of at least one of the third nucleic acid portion is an inverted nucleotide and is attached to the adjacent nucleotide via the 3′ carbon of the terminal nucleotide and the 3′ carbon of the adjacent nucleotide and/or one or more nucleotides of at least one of the third nucleic acid portion is an inverted nucleotide and is attached to the adjacent nucleotide via the 5′ carbon of the terminal nucleotide and the 5′ carbon of the adjacent nucleotide.
62. A conjugate according to claim 60, wherein the inverted nucleotide is attached to the adjacent nucleotide via a phosphate group by way of a phosphodiester linkage; or the 3′ and/or 5′ inverted nucleotide of the first and/or second strand is attached to the adjacent nucleotide via a phosphorothioate group; or the 3′ and/or 5′ inverted nucleotide of the first and/or second strand is attached to the adjacent nucleotide via a phosphorodithioate group.
63. A conjugate according to claim 1, which has blunt ended.
64. A conjugate according to claim 1, wherein either the first or second nucleic acid portion has an overhang.
65. A conjugate according to claim 1, which is a homo-dimer RNA molecule comprising two nucleic acid molecules as defined in claim 1, wherein said nucleic acid molecules are bound together through complementary interactions, where the first portion of the first molecule interacts with the second portion of the second molecule and there is a third portion in each molecule that generates a bulge structure intermediate of the first and second portions of the respective nucleic acid molecules.
66. A conjugate according to claim 1, wherein the target RNA is selected from at least one of: mRNA, IncRNA, and/or other RNA molecules.
67. A composition comprising a conjugate according to claim 1, and a physiologically acceptable excipient.
68. A conjugate or molecule according to claim 1, for use in the treatment of a disease or disorder.
69. Use of a conjugate according to claim 1, in the manufacture of a medicament for treating a disease or disorder.
70. A method of treating a disease or disorder comprising administration of a conjugate according to claim 1, to an individual in need of treatment.
71. A method according to claim 70, wherein the conjugate is administered subcutaneously or intravenously to the individual.
72-74. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0081]
[0082] Example 1 of
[0083] Example 2 of
[0084] Example 3 of
[0085]
[0086]
[0087]
[0088]
[0089] mxRNA molecules can be chemically synthesized using conventional and/or advanced approaches, and be used as research tools to study various genes functions in the labs, and/or as active ingredients for agricultural, veterinary, cosmetic and/or therapeutic applications.
[0090] Aspects of the invention are demonstrated by the following non-limiting examples.
EXAMPLES
Example 1: Single Dose Transfection in AML-12 Cells
[0091] Activity tests for mxRNAs versus conventional double stranded siRNA constructs that were directed against MAP4K4 were conducted. Hep3B cells were incubated in 96-well plates at a density of 15,000 cells per each well. The compounds tested with this study were at a final concentration of 50 nM. Reverse transfection was carried out using RNAiMax at 0.3 μL per well. In addition to the test compounds two controls ((TTR PC) TTR-directed siRNA and (INT PC) aha-1 directed siRNA) were also used (Tables 3 & 4). The duration of incubation was 24 hours. Subsequently mRNA was isolated and quantified using a bDNA assay (Quantigene 1.0/2.0). The readouts were normalised to GAPDH transcript, and the mean of quadruplicates was determined. The values from mock treated cells was set at 1.
[0092] A summary of the results obtained from this experiment are presented in Table 1 and
TABLE-US-00001 TABLE 1 Summary of results for Example 1 SEQ ID construct remaining mRNA NO(s). ID mean SD 9 C5 0.31 0.07 10 C6 0.28 0.01 11 C7 0.31 0.01 12 C8 0.28 0.02 13 C9 0.35 0.10 14 C10 0.28 0.00 15 C11 0.32 0.12 16 C12 0.34 0.14 17 C13 0.28 0.04 18 C14 0.31 0.01 23 C19 0.26 0.02 24 C20 0.29 0.03 25 C21 0.31 0.10 26 C22 0.33 0.02 27 C23 0.70 0.06 28 C24 0.24 0.07 29 C25 0.33 0.02 30 C26 0.53 0.07 31 C27 0.39 0.02 32 C28 1.06 0.04 1, 2 C1 0.30 0.03 3, 4 C2 0.33 0.12 5, 6 C3 0.46 0.02 7, 8 C4− 0.92 0.30 1, 19 C15 0.29 0.02 3, 20 C16 0.38 0.03 5, 21 C17 0.41 0.04 7, 22 C18− 0.99 0.07 33, 34 C29− 1.28 0.02 XD-12171− TTR NC− 1.26 0.04 33, 34 C29+ 0.07 0.02 XD-12171+ TTR PC+ 0.05 0.01 XD-00033+ INT PC+ 0.06 0.05 “−” Denotes a negative control and “+” denotes a positive control
Example 2: Single Dose Direct Incubation of GaINAc-Conjugated Compounds in Primary Hepatocytes
[0093] Primary mouse hepatocytes (Lot#MC830; ThermoFisher Scientific) were incubated in a 96-well plate at a density of 60,000 cells per well. The compounds tested with this study were added at a final concentration of 500 nM. In addition to the test compounds two controls ((XD-12171) TTR-directed siRNA and (XD-00033) aha-1 directed siRNA as a negative control) were also used (Tables 3 & 4). A direct incubation transfection (without transfection lipid) method was used. The duration of incubation was 72 hours. Subsequently mRNA was isolated and quantified using a bDNA assay (Quantigene 1.0/2.0). The readouts were normalised to GAPDH, and the mean of quadruplicates was determined. The values from mock treated cells was set at 1.
[0094] A summary of the results obtained from this experiment are presented in Table 2 and
TABLE-US-00002 TABLE 2 Summary of results for Example 2 Description construct SEQ ID remaining mRNA of construct ID NO(s). mean SD w/o phosphorothioate C19 23 0.28 0.02 C20 24 0.39 0.01 C21 25 0.52 0.03 C22 26 0.63 0.01 C23 27 0.99 0.08 with phosphorothioate C24 28 0.15 0.01 C25 29 0.16 0.01 C26 30 0.18 0.06 C27 31 0.32 0.02 C28 32 0.69 0.04 duplex non-stabilized C15 1, 19 0.99 0.03 duplex stable V1 (PC) C16 3, 20 0.67 0.01 duplex stable V2 (PC) C17 5, 21 0.69 0.04 NC1 (flipped central part) C18− 7, 22 0.96 0.05 NC2 (targeting TTR) C29− 33, 34 1.23 0.05 NC3 (no GalNAc) INT NC− XD-00033− 1.01 0.07 PC1 ALNY TTR C29+ 33, 34 0.12 0.01 PC2 AXO TTR INT PC+ XD-12171+ 0.18 0.02 “−” Denotes a negative control and “+” denotes a positive control
Summary of Results from Examples 1 and 2
[0095] The results confirm that the single-oligo miniaturized hairpin structures (mxRNA) can elicit target gene knock-down, if used with transfection reagent and unobstructed with conjugate moieties, as was previously demonstrated in Lapierre et al, 2011.
[0096] We demonstrated that mxRNA molecules conjugated with a bulky chemical moiety (GaINAc in this case) can still elicit target gene knock-down, when used with a transfection reagent. This is a new and non-trivial finding since adding a conjugate to the 3′ end of the active strand could have affected the mxRNAs' ability to be recognized by the RNAi machinery, to enter an RNA-induced silencing complex (RISC) and/or to remain active within the RISC.
[0097] Next, mxRNA-conjugates (conjugated with GaINAc in this case) were demonstrated to enter cells via receptor-mediated uptake and to yield activities higher than those of conventional siRNA targeting exactly the same portion of mRNA (e.g. mxRNA C24, C25, C26 constructs compared with conventional C16, C17 constructs). This is a new finding and without wishing to be bound to a particular theory, such improvement could be due to the smaller size of the mxRNA-conjugate molecules (approximately 32 nucleotides in total), if compared with conventional siRNAs (approximately 42 nucleotides in total).
[0098] Finally the results showed that the use of diverse chemical modification patterns comprising phosphodiester linkage modifications (e.g. phosphorothioate modifications) and/or sugar modifications (e.g. 2′OH positions) can further improved the performance of mxRNAs.
TABLE-US-00003 TABLE 3 Single-stranded mxRNA constructs used in this study con- SEQ Experiment struct ID id NO.(s) Sequence type Target C5 9 puAfgAfcUfuCfcAfcAfgAfaCfuCfuuCfUfGfuGfgAfaGfuCfuAf Transfection mmMAP4K4 C6 10 puAfgAfcUfuCfcAfcAfgAfaCfuCfuCfUfGfuGfgAfaGfuCfuAf Transfection mmMAP4K4 C7 11 puAfgAfcUfuCfcAfcAfgAfaCfuCfUfUfGfuGfgAtaGfuCfuAf Transfection mmMAP4K4 C8 12 puAfgAtcUfuCfcAfcAfgAfaCfuCfUfGfuGfgAfaGfuCfuAf Transfection mmMAP4K4 C9 13 puAfgAfcUfuCfcAfcAfgAfaCfUfCfUfuGfgAfaGfuCfuAf Transfection mmMAP4K4 C10 14 puAfgAfcUfuCfcAfcAfgAfsasCfsusCfsusUCfUfGfuGfgAfaGfuCfuAf Transfection mmMAP4K4 C11 15 puAfgAfcUfuCfcAfcAfgAfsasCfsusCfsUCfUfGfuGfgAfaGfuCfuAf Transfection mmMAP4K4 C12 16 puAfgAfcUfuCfcAfcAfsgsAfsasCfsusCfsUfsUGfuGfgAfaGfuCfuAf Transfection mmMAP4K4 C13 17 puAfgAfcUfuCfcAfcAfgsAfsasCfsusCfsUGfuGfgAfaGfuCfuAf Transfection mmMAP4K4 C14 18 puAfgAfcUfuCfcAfscsAfsgsAfsasCfsUfsCfsUfsUGfgAfaGfuCfuAf Transfection mmMAP4K4 C19 23 puAfgAfcUfuCfcAfcAfgAfaCfuCfuuCfUfGfuGfgAfaGfuCfuAf(NHC6) Transfection & mmMAP4K4 (GalNAc3) incubation C20 24 puAfgAfcUfuCfcAfcAfgAfaCfuCfuCfUfGfuGfgAfaGfuCfuAf(NHC6) Transfection & mmMAP4K4 (GalNAc3) incubation C21 25 puAfgAfcUfuCfcAfcAfgAfaCfuCfUfUfGfuGfgAfaGfuCfuAf(NHC6) Transfection & mmMAP4K4 (GalNAc3) incubation C22 26 puAfgAfcUfuCfcAfcAfgAfaCfuCfUfGfuGfgAfaGfuCfuAf(NHC6) Transfection & mmMAP4K4 (GalNAc3) incubation C23 27 puAfgAfcUfuCfcAfcAfgAfaCfUfCfUfuGfgAfaGfuCfuAf(NHC6)(GalNAc3) Transfection & mmMAP4K4 incubation C24 28 puAfgAtUfuCfcAfcAfgAfsasCfsusCfsusUCfUfGfuGfgAfaGfuCfuAf Transfection & mmMAP4K4 (NHC6)(GalNAc3) incubation C25 29 puAfgAfcUfuCfcAfcAfgAfsasCfsusCfsUCfUfGfuGfgAfaGfuCfuAf(NHC6) Transfection & mmMAP4K4 (GalNAc3) incubation C26 30 puAfgAfcUfuCfcAfcAfsgsAfsasCfsusCfsUfsUGfuGfgAfaGfuCfuAf Transfection & mmMAP4K4 (NHC6)(GalNAc3) incubation C27 31 puAfgAfcUfuCfcAfcAfgsAfsasCfsusCfsUGfuGfgAfaGfuCfuAf(NHC6) Transfection & mmMAP4K4 (GalNAc3) incubation C28 32 puAfgAfcUfuCfcAfscsAfsgsAfsasCfsUfsCfsUfsUGfgAfaGfuCfuAf Transfection & mmMAP4K4 (NHC6)(GalNAc3) incubathon
TABLE-US-00004 TABLE 4 Conventional duplex siRNA constructs used in this study Con- SEQ SEQ struct ID ID ID NO. antisense sequence NO. sense sequence target 1* 1 pUAGACUUCCACAGAACUCUUCAAAG 2 cuuugaagaguuCUGuggaagucua mmMAP4K4 2* 3 pUAGACUUCCACAGAACUCUUCAAAG 4 cuuugaagaguuCUGuggaagucua(NHC6)(GalNAc3) mmMAP4K4 3* 5 puAfgAfcUfuCfcAfcAfgAfaCfuCfu 6 CfuUfuGfaAfgAfgUfuCfUfGfuGfgAfaGfuCfuAf mmMAP4K4 UfcAfaAfg 4*- 7 puAfgAfcUfuCfcAfcAfgAfaCfuCfu 8 CfuUfuGfaAfgAfgUfuCfUfGfuGfgAfaGfuCfuAf mmMAP4K4 UfcAfaAfg (NHC6)(GalNAc3) 15# 1 puAfgAfcUfuCfcAfcAfgAfaCfuCfu 19 AfgAfgUfuCfUfGfuGfgAfaGfuCfuAf mmMAP4K4 16# 3 puAfgAfcUfuCfcAfcAfgAfaCfuCfu 20 AfgAfgUfuCfUfGfuGfgAfaGfuCfuAf(NHC6)(GalNAc3) mmMAP4K4 17# 5 puAfgAfcUfuGfgUfgUfgAfaCfuCfu 21 AfgAfgUfuCfAfCfaCfcAfaGfuCfuAf mmMAP4K4 18#- 7 puAfgAfcUfuGfgUfgUfgAfaCfuCfu 22 AfgAfgUfuCfAfCfaCfcAfaGfuCfuAf(NHC6)(GalNAc3) mmMAP4K4 29#- 33 puUfaUfaGfaGfcAfaGfaAfcAfcUfg 34 AsaCsaGsuGsuUscUsuGscUscUsaUsaAf(NHC6) mmTTR UfusUfsu (GalNAc3) INT PC- 35 usUfsaUfaGfaGfcAfagaAfcAfcUfg 36 AfsasCfaGfuGfuUfCfUfuGfcUfcUfaUfaAf(NHC6) mmTTR Ufususu (GalNAc3) INT PC- Aha1 *denotes that the duplex construct was subjected to transfection only; # denotes that the duplex construct was subjected to transfection and incubation experiments; -denotes that the duplex was used as a control. Table 3 and 4 keys p = phosphate u, a, c, g = 2′-methyl modified Uf, Af, Cf, Gf = 2′-fluoro modified U, A, C, G = unmodified s = phosphorothioate (NHC6) = linker (GalNAc3) = trivalent N-acetylgalactosamine