METHOD FOR PRODUCING ISOPRENE

Abstract

A method for producing isoprene includes culturing E. coli, which has isoprene productivity and in which a gene encoding a recA protein is attenuated or deleted, in a medium containing a carbon source. Therefore, a great amount of isoprene may be produced within a short period of time, and thereby considerably decreasing isoprene production unit costs.

Claims

1: A method for producing isoprene, comprising: culturing E. coli, which has isoprene productivity and in which a gene encoding a recA protein is attenuated or deleted, in a medium containing a carbon source.

2: The method according to claim 1, wherein the E. coli is DH5α, MG1655, BL21(DE), S17-1, XL1-Blue, BW25113 or a combination thereof.

3: The method according to claim 1, wherein the E. coli is MG1655.

4: The method according to claim 1, wherein the gene encoding a recA protein has a nucleotide sequence of SEQ ID NO: 76.

5: The method according to claim 1, wherein the E. coli expresses isoprene synthase and an enzyme of Enterococcus genus or Streptococcus genus mevalonate pathway.

6: The method according to claim 1, wherein the E. coli has a gene encoding isoprene synthase derived from Populus trichocarpa of SEQ ID NO: 1 intrinsically or by introduction therein.

7: The method according to claim 6, wherein the gene is introduced into a plasmid having a translation initiation rate value of 3,000 au or more in a ribosomal binding site sequence corresponding thereto.

8: The method according to claim 1, wherein the E. coli includes: a gene of SEQ ID NO: 2 encoding an enzyme with functions of acetyacetyl-CoA synthase derived from Enterococcus faecalis and HMG-CoA reductase, simultaneously; a gene of SEQ ID NO: 3 encoding HMG-CoA synthase derived from Enterococcus faecalis; a gene of SEQ ID NO: 4 encoding mevalonate kinase derived from Streptococcus pneumoniae; a gene SEQ ID NO: 5 encoding mevalonate diphosphate carboxylase derived from Streptococcus pneumoniae; a gene of SEQ ID NO: 6 encoding phosphomevalonate kinase derived from Streptococcus pneumoniae; and a gene SEQ ID NO: 7 encoding isoprenyl pyrophosphate isomerase derived from Escherichia coli MG 1655, which are contained intrinsically or by introduction therein.

9: The method according to claim 8, wherein the E. coli further includes a gene selected from a gene of SEQ ID NO: 8 encoding isoprenyl pyrophosphate isomerase derived from Synechocystis sp. PCC6803; a gene of SEQ ID NO: 9 encoding isoprenyl pyrophosphate isomerase derived from Streptococcus pneumoniae; and a gene of SEQ ID NO: 10 encoding isoprenyl pyrophosphate isomerase derived from Haematococcus plavialis, which is included intrinsically or by introduction therein.

10: The method according to claim 1, wherein the E. coli includes: a gene of SEQ ID NO: 11 encoding a fusion protein of isoprene synthase derived from Populus trichocarpa and isoprenyl pyrophosphate isomerase derived from E. coli MG1655; a gene of SEQ ID NO: 12 encoding a fusion protein of isoprenyl pyrophosphate isomerase derived from E. coli MG1655 and isoprene synthase derived from Populus trichocarpa; a gene of SEQ ID NO: 13 encoding a fusion protein of isoprene synthase derived from Populus trichocarpa and Synechocystis isoprenyl pyrophosphate isomerase; or a gene of SEQ ID NO: 14 encoding a fusion protein of Synechocystis isoprenyl pyrophosphate isomerase and isoprene synthase derived from Populus trichocarpa.

11: The method according to claim 1, wherein the E. coli is characterized in that at least one gene selected from the group consisting of dld, atoD, atoA and pps is attenuated or deleted.

12: The method according to claim 1, wherein the E. coli is characterized in that at least one gene selected from the group consisting of ackA-pta, poxB, adhE and ldhA is attenuated or deleted.

13: The method according to claim 1, wherein the E. coli is characterized in that a gene encoding NudB protein is attenuated or deleted.

14: The method according to claim 13, wherein the gene has a nucleotide sequence of SEQ ID NO: 77.

15: The method according to claim 1, wherein the E. coli is characterized in that flagella are inactivated or removed.

16: The method according to claim 15, wherein the E. coli is characterized in that at least one gene selected from the group consisting of fliF, fliG, fliH, fliI, fliJ and fliK is deleted or inactivated.

17: The method according to claim 1, wherein the medium contains lactose.

18: The method according to claim 1, wherein the medium contains Mg.sup.2+.

19: E. coli for producing isoprene, characterized by having isoprene productivity, wherein a gene encoding a recA protein is attenuated or deleted.

20: The E. coli according to claim 19, wherein the E. coli is DH5α, MG1655, BL21(DE), S17-1, XL1-Blue, BW25113 or a combination thereof.

21: The E. coli according to claim 19, wherein the E. coli is MG1655.

22: The E. coli according to claim 19, wherein the gene encoding a recA protein has a nucleotide sequence of SEQ ID NO: 76.

23: The E. coli according to claim 19, wherein the E. coli includes: a gene of SEQ ID NO: 1 encoding isoprene synthase derived from Populus trichocarpa; a gene of SEQ ID NO: 2 encoding an enzyme with functions of acetyacetyl-CoA synthase derived from Enterococcus faecalis and HMG-CoA reductase, simultaneously; a gene of SEQ ID NO: 3 encoding HMG-CoA synthase derived from Enterococcus faecalis; a gene of SEQ ID NO: 4 encoding mevalonate kinase derived from Streptococcus pneumoniae; a gene of SEQ ID NO: 5 encoding mevalonate diphosphate carboxylase derived from Streptococcus pneumoniae; a gene of SEQ ID NO: 6 encoding phosphomevalonate kinase derived from Streptococcus pneumoniae; and a gene of SEQ ID NO: 7 encoding isoprenyl pyrophosphate isomerase derived from Escherichia coli MG 1655, which are contained intrinsically or by introduction therein.

24: The E. coli according to claim 19, wherein the E. coli includes: a gene of SEQ ID NO: 11 encoding a fusion protein of isoprene synthase derived from Populus trichocarpa and isoprenyl pyrophosphate isomerase derived from E. coli MG1655; a gene of SEQ ID NO: 12 encoding a fusion protein of isoprenyl pyrophosphate isomerase derived from E. coli MG1655 and isoprene synthase derived from Populus trichocarpa; a gene of SEQ ID NO: 13 encoding a fusion protein of isoprene synthase derived from Populus trichocarpa and Synechocystis isoprenyl pyrophosphate isomerase; or a gene of SEQ ID NO: 14 encoding a fusion protein of Synechocystis isoprenyl pyrophosphate isomerase and isoprene synthase derived from Populus trichocarpa.

25: The E. coli according to claim 19, wherein the E. coli is characterized in that at least one gene selected from the group consisting of dld, atoD, atoA and pps is attenuated or deleted.

26: The E. coli according to claim 19, wherein the E. coli is characterized in that a gene encoding NudB protein is attenuated or deleted.

27: The E. coli according to claim 19, wherein the gene has a nucleotide sequence of SEQ ID NO: 77.

28: The E. coli according to claim 19, wherein the E. coli is characterized in that flagella are inactivated or removed.

29: The E. coli according to claim 19, wherein the E. coli is characterized in that at least one gene selected from the group consisting of fliF, fliG, fliH, fliI, fliJ and fliK is deleted or inactivated

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0089] FIG. 1 illustrates an isoprene biosynthetic pathway including a mevalonate pathway and a MEP pathway.

[0090] FIG. 2 illustrates the cell growth of E. coli strain and the isoprene production amount, wherein a plasmid including artificially synthesized Populus trichocarpa isoprene synthase and a plasmid including a mevalonate pathway are simultaneously introduced into the strain.

[0091] FIG. 3 illustrates isoprene productivity by integrated plasmid having isoprene synthase and a mevalonate pathway, simultaneously.

[0092] FIG. 4 illustrates plasmid stability in E. coli of integrated plasmid having isoprene synthase and a mevalonate pathway, simultaneously.

[0093] FIG. 5 illustrates cell growth, isoprene productivity and plasmid stability of E. coli transformant into which a plasmid with improved stability of integrated plasmid is introduced.

[0094] FIG. 6 illustrates a difference in isoprene productivity between E. coli DH5a and MG1655.

[0095] FIG. 7 illustrates a result of comparing isoprene productivity between recA and relA-deleted strain of MG 1655.

[0096] FIG. 8 illustrates a result of comparing isoprene productivity between MG1655 and nudB-deleted strain of MG1655.

[0097] FIG. 9 illustrates a result of comparing isoprene productivity between nudB-deleted strain, recA-deleted strain, nudB and recA-co-deleted strain of MG1655.

[0098] FIG. 10 illustrates a result of comparing isoprene productivity between MG1655 and fli operon-deleted strains of MG1655.

[0099] FIG. 11 illustrates a process of preparing AcoCo strains in diagram form, to exhibit a gene to be removed for acetyl-CoA and pyruvate metabolic pathway and for preparing AceCo strains.

[0100] FIG. 12 illustrates results of comparing cell growth, isoprene productivity and organic acid productivity between AceCo strain having improved carbon source use efficiency, wild type strain as a control group, and ackA-pta gene-deleted strain as an acetic acid biosynthetic pathway.

[0101] FIG. 13 illustrates a result of identifying improved isoprene productivity by introducing additional idi gene into isoprene producing plasmid.

[0102] FIG. 14 illustrates a result of improving isoprene productivity using a fusion protein of IspS and IDI.

[0103] FIG. 15 illustrates a result of comparing isoprene productivity using IPTG and lactose as an expression-inducing agent for expressing a biosynthetic pathway of isoprene.

[0104] FIG. 16 illustrates a result of comparing isoprene productivity according to whether or not to add Mg.sup.2+ to a culture medium for isoprene production.

DETAILED DESCRIPTION

[0105] Hereinafter, the present invention will be described in detail by means of the following examples.

EXAMPLE

[0106] 1. Change in Increase of Isoprene Productivity According to Gene Arrangement Introduced in E. coli Host

[0107] (1) Preparation of Plasmid for Isoprene Production

[0108] Information on genes related to isoprene biosynthesis is shown in Table 1 below, while primers to amplify corresponding genes are shown in Table 2 below. The information on genes related to production of a precursor for isoprene biosynthesis is shown in Table 1 below, and a gene encoding an enzyme related to precursor biosynthesis used herein is pS-NA plasmid disclosed in Yoon et al. (2007).

TABLE-US-00001 TABLE 1 SEQ ID Gene NO. name Enzyme name 1 ispS Isoprene synthase derived from Populus trichocarpa 2 mvaE Acetyl-CoA acetyl transferase/hydroxymethyl glutaryl (HMG)-CoA reductase derived from Enterococcus faecalis 3 mvaS Hydroxymethyl glutaryl (HMG)-CoA synthase derived from Enterococcus faecalis 4 mvaK1 Mevalonate kinase derived from Streptococcus pneumoniae 5 mvaD Mevalonate diphosphate carboxylase derived from Streptococcus pneumoniae 6 mvaK2 Phosphomevalonate kinase derived from Streptococcus pneumoniae 7 idi Isoprenyl pyrophosphate isomerase derived from Escherichia coli MG1655 8 idi Isoprenyl pyrophosphate isomerase derived from Synechocystis sp. PCC6803 9 idi Isoprenyl pyrophosphate isomerase derived from Streptococcus pneumoniae 10 idi Isoprenyl pyrophosphate isomerase derived from Haematococcus plavialis 11 ispS-L- Fusion gene of isoprene synthase derived Ecidi from Populus trichocarpa (SEQ ID NO: 1) and isoprenyl pyrophosphate isomerase derived from E. coli MG1655 (SEQ ID NO: 7) 12 Ecidi-L- Fusion gene of isoprenyl pyrophosphate ispS isomerase derived from E. coli MG1655 (SEQ ID NO: 7) and isoprene synthase derived from Populus trichocarpa 13 ispS-L- Fusion gene of isoprene synthase derived Syidi from Populus trichocarpa (SEQ ID NO: 1) and isoprenyl pyrophosphate isomerase derived from Streptococcus pneumoniae (SEQ ID NO: 8) 14 Syidi-L- Fusion gene of isoprenyl pyrophosphate ispS isomerase derived from Streptococcus pneumoniae (SEQ ID NO: 8) and isoprene synthase derived from Populus trichocarpa 15 pTrc99SN Vector including strengthened ribosomal binding site sequence of pTrc99A

[0109] For isoprene biosynthesis, the amplified gene or combined gene was introduced into pTrc99A vector (Bacterial expression vector with inducible lad promoter; amp resistance; restriction enzyme cloning) to prepare 4 types of vectors for isoprene production. Populus trichocarpa-derived isoprene synthase (ispS) was artificially synthesized and conformed to a codon of E. coli (SEQ ID NO: 1). Sequences for artificial synthesis were created using a DNA 2.0 program while artificial synthesis of gene was requested to Genescript (USA). The artificially synthesized Populus trichocarpa isoprene synthase was amplified through PCR using primers sPtispS-F and sPtispS-R in Table 2, cleaved by restriction enzymes NcoI and XbaI, and inserted into the same site of pTrc99A vector, thereby preparing pT-sPtispS.

TABLE-US-00002 TABLE 2 SEQ ID NO. Primer Sequence 16 sPtispS- 5′-GCCATGGCTTGCTCTGTATCCAC-3′ F (SEQ ID NO. 16) 17 sPtispS- 5′-CTCTAGATTAGCGTTCGAACGGCAGAATTG-3′ R (SEQ ID NO. 17)

[0110] Next, pTrc99SN was prepared by strengthening a ribosomal binding site in the pTrc99A vector (SEQ ID NO: 15) and amplified through PCR using the primers sPtispS-F and sPtispS-R in Table 2, followed by inserting the artificially synthesized Populus trichocarpa isoprene synthase therein, thereby preparing pTSN-sPtispS. Then, the plasmid pS-NA having the mavalonate pathway introduced therein was entirely amplified (SEQ ID NOS: 2 to 7) and introduced into an Xbal site of the above-prepared pTSN-sPtispS plasmid, thereby preparing pTSN-sPtispS-MVA. Following this, an ampicillin-resistant gene of the above-prepared pTSN-sPtispS-MVA (SEQ ID NO: 18) was removed using the restriction enzymes BglII and BspHI, followed by inserting a kanamycin-resistant gene (SEQ ID NO: 19) in the same site, thereby preparing pTSNK-sPtispS-MVA.

[0111] Transformation was executed by introducing the above-prepared plasmids for isoprene production, that is, pT-sPtispS, pTSN-sPtispS, pTSN-sPtispS-MVA and pTSNK-sPtispS-MVA, as well as pTrc99A vector as a negative control, separately, or together with pS-NA plasmid, into E. coli DH5. In this case, a transformation method used herein was in compliance with the typical method described in Sambrook and Russell (2001).

[0112] (2) Production of Isoprene Using E. coli DH5α Transformant

[0113] The present example describes that E. coli DH5a transformant including the above-prepared recombinant plasmids pT-sPtispS and pTSN-sPtispS, and the mevalonate pathway plasmid pS-NA (gene introduction of SEQ ID NOS: 2 to 7) introduced simultaneously therein is cultured in a medium containing glycerol to produce isoprene.

[0114] In order to investigate a difference in isoprene productivity according to the ribosomal binding strength, pT-sPtispS and pTSN-sPtispS, as well as the mevalonate pathway plasmid pS-NA were introduced into E. coli DH5a, separately and simultaneously.

[0115] 5 ml TB medium including 100 μm/ml of ampicillin and 50 μm/ml of chloramphenicol (24 g yeast extract, 12 g tryptone, 9.4 g K.sub.2HPO.sub.4, 2.2 g KH.sub.2PO.sub.4 per liter) was inoculated with the transformant having isoprene productivity, and subjected to seed culture under conditions of 30° C. and 250 rpm. Thereafter, 50 ml TB medium including 20 g/L glycerol, 100 μm/ml of ampicillin and 50 μm/ml of chloramphenicol was inoculated with the above-seed cultured product and subjected to main culture. In order to increase an expression level of protein, an expression-inducing agent, that is, IPTG (Isopropyl β-D-1-thiogalactopyranoside) at a final concentration of 0.1 mM was added. The main culture was conducted in a 250 ml grooved conical flask under conditions of 30° C. and 150 rpm for 36 hours.

[0116] For quantitative analysis of isoprene, sampling was carried out from 6 hours to 36 hours after the culture at an interval of 2 hours. 700 μl of the cultured solution was mixed with equal amount of dodecane (CH.sub.3(CH.sub.2)10CH.sub.3), followed by reacting the same at 30° C. for 10 minutes. Isoprene produced from the transformant for 10 minutes was entrapped in dodecane and the dodecane layer was isolated from the medium for quantitative analysis. The isoprene quantitative analysis was executed by using gas chromatography. 7890A model gas chromatograph of Agilent Co. (USA) was used. A column for sample separation used herein was 19091N-133 HP-INNOWAX column (length, 30 m; internal diameter, 0.25 mm; film thickness, 250 μm). An oven temperature started at 50° C. and, after 2 minutes, was raised up to 250° C. in a ratio of 30° C. per minute. Nitrogen was used as a carrier gas and a gas input pressure was set to be 15.345 psi. A flame ionization detector (FID) was employed at a temperature set to be 280° C. A time for separation of isoprene was 1.53 minutes and an isoprene standard material for quantification was purchased from Sigma Co. (USA).

[0117] Culture results are shown in FIG. 2. Referring to FIG. 2, it was demonstrated that an isoprene production amount of about 450 mg/L was obtained in the culture without addition of IPTG, the transformant including the simultaneously introduced pTSN-sPtispS and pS-NA, which are plasmids having a strong ribosomal binding site. This value is about 1.6 times higher than the transformant including the simultaneously introduced pT-sPtispS and pS-NA that has produced about 280 mg/L of isoprene. The highest difference in the isoprene production amount per hour between the above two strains was about 10 mg/L/hr. There was little difference in the cell growth rate, and a final optical density (OD) was about 25.

[0118] For the culture having PTG added thereto, both strains exhibited inhibition of initial cell growth, however, exhibited final cell growth substantially not different from that in the culture without addition of IPTG. Further, due to the inhibition of initial cell growth, initial isoprene production amount was relatively lower than the culture without addition of IPTG. However, from 18 hours after the culture, the isoprene production amount was also increased along with the cell growth. As a result, 420 mg/L of isoprene was produced in the transformant including the simultaneously introduced pTSN-sPtispS and pS-NA, which is 1.6 times higher than the transformant including the simultaneously introduced pT-sPtispS and pS-NA (260 mg/L).

[0119] Consequently, the transformant including the plasmids having a strong ribosomal binding site, that is, pTSN-sPtispS and pS-NA, simultaneously introduced therein, demonstrated excellent isoprene productivity, as compared to the transformant including pT-sPtispS and pS-NA. This is considered as a result of increasing the expression level of isoprene synthase due to the strong ribosomal binding site.

[0120] In the culture having IPTG added thereto for increasing the protein expression level, causes of inhibiting initial cell growth are as follows. An expression level of the isoprene synthase cloned in a vector including a strong promoter and having a high plasmid copy number is far higher than the mevalonate pathway cloned in a vector that include relatively weak promoter and has a low plasmid copy number. Thereby, it is considered that DMAPP as a precursor is excessively consumed and causes a lack of DMAPP required for cell growth, resulting in inhibition of initial cell growth.

[0121] (3) Improved Isoprene Productivity According to Increase of Expression Level of Precursor Production Pathway

[0122] The present example describes that, in order to solve the problem of cell growth inhibition due to lack of DMAPP described in Example 1-(2), a plasmid with increased expression level of mevalonate pathway is utilized to improve the isoprene productivity. The plasmid with increased expression level of mevalonate pathway, that is, pTSN-sPtispS-MVA integrated plasmid was prepared. In order to improve stability of this plasmid, pTSNK-sPtispS-MVA was prepared by replacing the ampicillin-resistant gene with a kanamycin-resistant gene.

[0123] The method of preparing these two plasmids was already described in Example 1-(1).

[0124] First, E. coli DH5α transformant introduced with pTSN-sPtispS-MVA having an increased expression level of mevalonate pathway was prepared. Further, a transformant simultaneously introduced with pTSN-sPtispS and pS-NA was used as a control group. Then, these were cultured to investigate whether isoprene productivity is improved or not.

[0125] The culture medium, culture conditions and isoprene quantitation were the same as those described in the method according to Example 1-(2), except that IPTG was not added.

[0126] Culture results are shown in FIG. 3. Referring to FIG. 3, it was demonstrated that an isoprene production amount of 1.25 g/L was obtained in the strain introduced with the integrated plasmid having an increased expression level of mevalonate pathway, which is about 3 times higher than that of the control group. Further, an isoprene production amount per time (maximum about 90 mg/L/hr) and an isoprene production amount per unit cell (maximum about 5.5 mg/L/hr/OD 600 nm) in the strain were also far higher than those of the control group. However, inhibition of cell growth was not observed.

[0127] The improvement of isoprene productivity is considered as a result of solving the problem entailed in lack of DMAPP indicated in Example 1-(2) by increasing the expression of mevalonate pathway which is a pathway for production of precursor. Further, it is also considered that the above result may be obtained by improving the isoprene productivity due to the balanced expression of IspS and MVA pathway.

[0128] (4) Improved Isoprene Productivity by Improvement of Plasmid Stability

[0129] The present example describes that, in order to solve a problem of losing the integrated plasmid during culture in Example 1-(3), bla (SEQ ID NO: 18) encoding an ampicillin-resistant gene in the integrated plasmid is replaced with nptII (SEQ ID NO: 19) encoding a kanamycin-resistant gene to produce another plasmid, which is utilized to improve isoprene productivity.

[0130] During culture of E. coli including the integrated plasmid, it was investigated whether the plasmid was lost or not. In order to identify stability of plasmid, a culture solution under culturing was diluted with the medium and then spread on a solid medium without antibiotics and another solid medium containing antibiotics, respectively, with the same amount, followed by performing measurement in every 6 hours. In order to determine the plasmid stability, the number of colonies in the medium containing antibiotics was denoted by % to 100% of the number of colonies in the medium without antibiotics.

[0131] Identified results of plasmid stability are shown in FIG. 4. Referring to FIG. 4, as a result of identifying the plasmid stability, it was found that the number of E. coli containing plasmid at the end of culture, that is, after 36 hours, was 50% or less, while a loss rate of plasmid in the culture with the addition of IDTG was far higher than the culture without addition thereof.

[0132] In order to solve the problem of low plasmid stability, bla encoding ampicillin-resistant gene in the integrated plasmid was replaced with nptII encoding kanamycin-resistant gene thus to prepare a new pTSNK-sPtispS-MVA plasmid. In order to investigate a variation in the isoprene productivity according to the improved plasmid stability, the strains were cultured.

[0133] The culture medium, culture conditions and isoprene quantitation were the same as those described in the method according to Example 1-(2), except that IPTG was not added.

[0134] Culture results are shown in FIG. 5. Referring to FIG. 5, it was found that about 1.6 g/L of isoprene was produced in the strain introduced with plasmid having the improved stability, which is about 1.3 times higher than the control group. Plasmid stability was also far superior, compared to the control group. Further, it was found that about 90% or more plasmid was remaining at the end point of culture, that is, 36 hours after the culture. From 14 hours after the culture, in the strain introduced with plasmid having the kanamycin-resistant gene, it could be seen that the isoprene production amount per hour and the isoprene production amount per unit cell were increased. It is considered that such an improvement is a result of the improved stability of the plasmid.

[0135] 2. Improved Isoprene Productivity by Improvement of E. Coli Host Strain

[0136] (1) Change in Isoprene Productivity According to E. Coli Strain

[0137] The E. coli strain used in Example 1, that is, DH5α is a thiamine biosynthetic gene-deleted strain and cannot produce thiamine by itself. For this reason, thiamine should be added to the medium, thus bearing burden of expenses. Further, the above strain has a disadvantage of lower growth rate than E. coli MG1655 strain which is mostly used in industrial applications.

[0138] The present example compares isoprene production abilities between the host E. coli mentioned in Example 1, that is, DH5α and MG1655 strains, investigates gene factors influencing on isoprene productivity in these two host strains and describes utility of MG1655 more applicable in the industry as a host strain for isoprene production.

[0139] First, pTSNK-sPtispS-MVA was introduced into DH5α and MG1655 strains, respectively, to prepare E. coli transformants, followed by performing comparison of isoprene productivity.

[0140] The culture medium, culture conditions and isoprene quantitation were the same as those described in the method according to Example 1-(2), except that IPTG was not added.

[0141] Culture results are shown in FIG. 6. Referring to FIG. 6, it can be seen that E. coli DH5α transformant exhibited an isoprene production amount of 3.2 times higher than that of MG1655 transformant. Although MG1655 transformant had faster cell growth, and a final cell growth amount was a little lower with a fast reduction in pH, than E. coli DH5α transformant.

[0142] It is considered that such a difference in the isoprene productivity is a result of genetic features between the E. coli strains. In addition, for MG1655 strain, it quickly consumes a carbon source while generating and accumulating fermentation by-product such as an organic acid. Therefore, it is determined that pH was rapidly decreased to cause a reduction in the isoprene productivity.

[0143] (2) Identification of Factor Showing Difference in Isoprene Productivity Between E. coli Strains

[0144] Based on the results in Example 2-(1), the present example investigates a gene factor to cause a difference in the isoprene productivity between the host E. coli DH5α and the MG1655 strain, and therefore, describes that a result of isoprene productivity similar to or more improved than that of E. coli DH5α strain may be obtained by changing a gene form of the E. coli MG1655 strain.

[0145] MG1655 ΔrecA and MG1655 ΔrelA strains, in which a gene deleted from the E. coli DH5α strain, that is, recA (SEQ ID NO: 76) and relA were deleted from wild type MG1655 strain, respectively, were prepared. Deletion of genes was conducted by means of a gene deletion kit (Quick & Easy E. coli Gene Deletion Kit by Red®/ET® Recombination, Gene Bridges, Germany) and the gene was deleted using the kit according the instruction for use of the kit.

[0146] After simultaneously introducing pTSNK-sPtispS-MVA and pS-NA into each of the gene-deleted E. coli strains to form an E. coli transformant, isoprene productivity of the transformant was compared to that of the control group, that is, the wild type E. coli MG1655 and DH5α transformants.

[0147] The culture medium, culture conditions and isoprene quantitation were the same as those described in the method according to Example 1-(2), except that IPTG was not added.

[0148] Culture results are shown in FIG. 7. Referring to FIG. 7, it was found that the MG1655 recA strain exhibited an isoprene production amount of 4.6 times and 1.3 times higher than those of the wild type MG1655 and the DH5α strains, respectively. However, relA-deleted strain did not have a difference in the isoprene productivity, compared to the wild type MG1655 strain.

[0149] Based on the above study results, it was identified that the gene factor, which shows a difference in the isoprene productivity between DH5α and MG1655 (DE3), is recA.

[0150] (3) Increase of Isoprene Productivity by nudB Deletion

[0151] The present example concretely describes that the isoprene productivity is improved by deleting nudB which is a gene for transforming isoprene precursors, that is, IPP and DMAPP into 3-methyl-3-buten-1-ol and 3-methyl-2-buten-1-ol, respectively, as well as results thereof.

[0152] In order to prevent undesirable consumption of DMAPP as a precursor of isoprene synthase so as to improve the isoprene productivity, a strain with deletion of NudB gene (SEQ ID NO: 77) from the wild type MG1655 strain was prepared.

[0153] PCR primers for gene deletion are shown in Table 3 below. The gene-deleted strain was prepared by the same method according to Example 2-(2), and the above-prepared strain was named MG1655ΔnudB.

[0154] After introducing pTSNK-sPtispS-MVA into MG1655ΔnudB strain to form a E. coli transformant, isoprene productivity of the transformant was compared to that of the control group, that is, the wild type E. coli MG1655 transformant.

[0155] 5 ml TB medium including 50 μm/ml of kanamycin (24 g yeast extract, 12 g tryptone, 9.4 g KH.sub.2PO.sub.4, 2.2 g KH.sub.2PO.sub.4 per liter) was inoculated with the transformant having isoprene productivity, and subjected to seed culture under conditions of 37° C. and 250 rpm. Thereafter, 50 ml TB medium including 20 g/L of glycerol and 50 μm/ml of kanamycin was inoculated with the seed cultured product and subjected to main culture. In order to increase a protein expression level, an expression-inducing agent, that is, lactose at a final concentration of 5 g/l was added. The main culture was conducted in 250 ml grooved conical flask under conditions of 30° C. and 150 rpm for 36 hours. The isoprene quantitation was performed according to the same procedures as described in the method according to Example 1-(2), except that IPTG was not added.

[0156] Culture results are shown in FIG. 8. Referring to FIG. 8, it was found that the MG1655 nudB strain had an isoprene production amount of about 1.35 times higher than that of the wild type MG1655 strain. From the result, it could be confirmed that nudB deletion was helpful for improving the isoprene productivity.

TABLE-US-00003 TABLE 3 SEQ ID NO. Primer Sequence 78 ΔnudB-F ATAACTATGTGAATGGGATGAGCGAAGGCAG TCAACGAAGAGGCAGCGTGCATATTTATTAC CTCCTTGTAGGC (SEQ ID NO. 78) 79 ΔnudB-R TAAAAATATCTCCAGATAGCCCTGCCTGTTC AGGCAGCGTTAATTACAAACATATGAATATC CTCCTTAGTTCC (SEQ ID NO. 79) 80 nudB-CF- CAGGACCGTAACCTTCGTAGATG F1 (SEQ ID NO. 80) 81 nudB-CF- CAAACTCTACCGTGCGCTGAC F2 (SEQ ID NO. 81) 82 nudB-CF-R GACCGTCTGACCATGCTGCTG (SEQ ID NO. 82) 83 Δflagella- TTCCACTTTGCCAATAACGCCGTCCATAATC F AGCCACGAGGTGCGCGATGGGGGATCCGTCG ACCTGCAG (SEQ ID NO. 83) 84 Δflagella- AGACGCGGATTACGGTGCTACCTCTGACGTT R AGGCGAAAATATCAACGCCCATATTTATTAC CTCCTTGTAGGCTGGAGC (SEQ ID NO. 84) 85 FlaCF-F GAGTGAATTTTTCTGCCTGCG (SEQ ID NO. 85) 86 FlaCF-R GCTTGCTTTTCTTGCTTATCGC (SEQ ID NO. 86)

[0157] (4) Increase of Isoprene Productivity by Simultaneous Deletion of nudB and recA

[0158] Based on the results of Examples 2-(2) and 2-(3), the present example describes that the isoprene productivity is improved by simultaneously deleting nudB and recA, as well as results thereof.

[0159] MG1655ΔnudB strain was integrated with MG1655ΔrecA strain through P1 transduction, thereby preparing MG1655ΔnudB and recA strains. Then, after introducing pTSNK-sPtispS-MVA into MG1655ΔnudB and recA strains to prepare an E. coli transformant, isoprene productivity of this transformant was compared to that of the control group, that is, MG1655ΔrecA and MG1655ΔnudB strain transformants.

[0160] The culture medium and culture conditions are the same as those in Example 2-(3), and isoprene quantitation is the same as the method according to Example 1-(2).

[0161] Culture results are shown in FIG. 9. Referring to FIG. 9, it was found that MG1655 nudB and recA strains exhibited an isoprene production amount of 1.4 times and 2.15 times higher than those of MG1655ΔrecA and MG1655ΔnudB strains, respectively. From the result, it could be confirmed that simultaneous deletion of nudB and recA was helpful for improving the isoprene productivity.

[0162] (5) Identification of Isoprene Productivity by Removal of Flagella

[0163] The present example describes that isoprene productivity is improved by deleting operon (SEQ ID NO: 93) which includes genes related to the formation of flagellar (e.g., fliF (SEQ ID NO: 87), fliG (SEQ ID NO: 88), fliH (SEQ ID NO: 89), fliI (SEQ ID NO: 90), fliJ (SEQ ID NO: 91), and fliK (SEQ ID NO: 92), as well as results thereof.

[0164] A great amount of ATP is consumed for activating flagella. However, in a culture circumstance suitable for microorganism growth, which is artificially controlled, instead of the wild condition, movement of flagella is not necessary. Therefore, the isoprene productivity was improved by preventing undesirable consumption of ATP, and flagellum-deleted MG1655 strain was prepared by deleting the operon of genes related to the formation of flagella in the MG1655 strain.

[0165] PCR primers for gene deletion are shown in Table 3. The gene-deleted strain was prepared by the same method according to Example 2-(2), and the above-prepared strain was named MG1655Δfli operon.

[0166] After introducing pTSNK-sPtispS-MVA into the MG1655Δfli operon strain to prepare an E. coli transformant, isoprene productivity of the transformant was compared to that of the control group, that is, the wild type E. coli MG1655 transformant.

[0167] 5 ml 2YT medium including 50 μm/ml of kanamycin (10 g yeast extract, 16 g tryptone, 5 g NaCl per liter) was inoculated with the transformant having isoprene productivity, and subjected to seed culture under conditions of 37° C. and 250 rpm. Thereafter, 50 ml MR medium including 20 g/L of glycerol and 50 μm/ml of kanamycin (KH.sub.2PO.sub.4 22 g, (NH4)2HPO4 3 g, MgSO4.7H2O 0.7 g, Citrate 0.8 g, Trace metal solution (ZnSO4.7H2O 0.55 g, MnSO4.H2O 1.25 g, Na2B4O7.10H2O 0.05 g, FeSO4.7H2O 50 g, CuSO4.5H2O 2.5 g, CaCl2 5 g, (NH4)6Mo7O24.4H2O 0.25 g per liter) 2 ml per liter) was inoculated with the seed cultured product and subjected to main culture. In order to increase a protein expression level, an expression-inducing agent, that is, lactose at a final concentration of 5 g/l was added. The main culture was conducted in 250 ml grooved conical flask under conditions of 30° C. and 150 rpm for 48 hours. The isoprene quantitation was performed according to the same procedures as described in the method according to Example 1-(2), except that IPTG was not added.

[0168] Culture results are shown in FIG. 10. Referring to FIG. 10, it was found that the MG1655fli operon strain exhibited an isoprene production amount of about 1.3 times higher than the wild type MG1655 strain. From the result, it could be confirmed that removal of flagella was helpful for improving the isoprene productivity.

[0169] 3. Increase of Isoprene Productivity According to Improvement of Carbon Source Use Efficiency

[0170] (1) Preparation of Strain with Improved Carbon Source Use Efficiency

[0171] The present example describes preparation of E. coli MG1655 strain with improved carbon source use efficiency.

[0172] In order to prevent undesirable consumption of a mevalonate pathway precursor, that is, acetyl-CoA, and improve isoprene productivity and carbon source use efficiency, a strain with deletion of 9 genes related to biosynthesis of organic acid and alcohol from the wild type MG1655 strain was prepared.

[0173] PCR primers for gene deletion, a list of deletion strains and a deletion process are shown in Table 4 and FIG. 11.

TABLE-US-00004 TABLE 4 SEQ ID Name NO. Sequence Primer ΔackA- 20 TGGCTCCCTGACGTTTTTTTAGCCACGTATCAATTATAGGTACTTCC pta-F ATGAATTAACCCTCACTAAAGGGCG (SEQ ID NO. 20) ΔackA- 21 GCAGCGCAAAGCTGCGGATGATGACGAGATTACTGCTGCTGTGCAG pta-R ACTGTAATACGACTCACTATAGGGCTC (SEQ ID NO. 21) ackA- 22 TGTCATCATGCGCTACGCTC (SEQ ID NO. 22) ptaCF-F ackA- 23 CAGTTAAGCAAGATAATCAG (SEQ ID NO. 23) ptaCF-R ΔpoxB-F 24 GATGAACTAAACTTGTTACCGTTATCACATTCAGGAGATGGAGAAC CATGAATTAACCCTCACTAAAGGGCG (SEQ ID NO. 24) ΔoxB-R 25 CCTTATTATGACGGGAAATGCCACCCTTTTTACCTTAGCCAGTTTGT TTTTAATACGACTCACTATAGGGCTC (SEQ ID NO. 25) poxBCF-F 26 TTACGTACTGGCCTGCTCCTGC (SEQ ID NO. 26) poxBCF-R 27 GTCGGGTAACGGTATCACTGCG (SEQ ID NO. 27) ΔldhA-F 28 ATTTTTAGTAGCTTAAATGTGATTCAACATCACTGGAGAAAGTCTTA TGAAATTAACCCTCACTAAAGGGCG (SEQ ID NO. 28) ΔldhA-R 29 CTCCCCTGGAATGCAGGGGAGCGGCAAGATTAAACCAGTTCGTTCG GGCATAATACGACTCACTATAGGGCTC (SEQ ID NO. 29) ldhACF-F 30 TCATCAGCAGCGTCAACGGC (SEQ ID NO. 30) ldhACF-R 31 CGCTGGTCACGGGCTTACCG (SEQ ID NO. 31) ΔadhE-F 32 CGAGCAGATGATTTACTAAAAAAGTTTAACATTATCAGGAGAGCAT TATGAATTAACCCTCACTAAAGGGCG (SEQ ID NO. 32) ΔadhE-R 33 CCGTTTATGTTGCCAGACAGCGCTACTGATTAAGCGGATTTTTTCGC TTTTAATACGACTCACTATAGGGCTC (SEQ ID NO. 33) adhECF-F 34 CCGCACTGACTATACTCTCG (SEQ ID NO. 34) adhECF-R 35 TGATCGGCATTGCCCAGAAG (SEQ ID NO. 35) ΔatoDA-F 36 CTATTGCCTGACTGTACCCACAACGGTGTATGCAAGAGGGATAAAA AATGAATTAACCCTCACTAAAGGGCG (SEQ ID NO. 36) ΔatoDA-R 37 ACGCGTCATAAAACGCGATATGCGACCAATCATAAATCACCCCGTT GCGTTTAATACGACTCACTATAGGGCTC (SEQ ID NO. 37) atoDACF-F 38 TGGCGAGGTAAAAACAGCCCC (SEQ ID NO. 38) atoDACF-R 39 AAGCGCGATCACGAATGTTAGC (SEQ ID NO. 39) Δdld-F 40 CGCTATTCTAGTTTGTGATATTTTTTCGCCACCACAAGGAGTGGAAA ATGAATTAACCCTCACTAAAGGGCG (SEQ ID NO. 40) Δdld-R 41 GGATGGCGATACTCTGCCATCCGTAATTTTTACTCCACTTCCTGCCA GTTTAATACGACTCACTATAGGGCTC (SEQ ID NO. 41) dldCF-F 42 CAGACTCACCGCGATTCCTACTG (SEQ ID NO. 42) dldCF-R 43 CGGTAAAGTGATGCCTGTGCC (SEQ ID NO. 43) Δpps-F 44 AGAAATGTGTTTCTCAAACCGTTCATTTATCACAAAAGGATTGTTCG ATGAATTAACCCTCACTAAAGGGCG (SEQ ID NO. 44) Δpps-R 45 CGGCGACTAAACGCCGCCGGGGATTTATTTTATTTCTTCAGTTCAGC CAGTTAATACGACTCACTATAGGGCTC (SEQ ID NO. 45) ppsCF-F 46 GCAGATTTGCGCAACGCTGG (SEQ ID NO. 46) ppsCF-R 47 CTGCCGTATGGATGAGGCTG (SEQ ID NO. 47) Strain IS1 E. coli MG1655 ΔackA-pta IS2 E. coli MG1655 ΔpoxB IS3 E. coli MG1655 ΔldhA IS4 E. coli MG1655 Δdld IS5 E. coli MG1655 ΔadhE IS6 E. coli MG1655 Δpps IS7 E. coli MG1655 ΔatoDA IS8 E. coli MG1655 ΔackA-pta, poxB (IS1 + IS2) IS9 E. coli MG1655 ΔackA-pta, poxB, ldhA (IS8 + IS3) IS10 E. coli MG1655 ΔackA-pta, poxB, ldhA, dld (IS9 + IS4) IS11 E. coli MG1655 ΔackA-pta, poxB, ldhA, dld, adhE (IS10 + IS5) IS12 E. coli MG1655 ΔackA-pta, poxB, ldhA, dld, adhE, pps (IS11 + IS6) Aceco E. coli MG1655 ΔackA-pta, poxB, ldhA, dld, adhE, pps, atoDA (IS12 + IS7)

[0174] From the wild type MG1655 strain, ackA-pta (SEQ ID NO: 48) and poxB (SEQ ID NO: 49) related to the generation of acetate, adhE (SEQ ID NO: 50) related to the generation of alcohol, ldhA (SEQ ID NO: 51) and did (SEQ ID NO: 52) related to the generation of lactate, atoDA (SEQ ID NO: 53) related to the generation of acetoacetate, and pps (SEQ ID NO: 54) related to the generation of phosphoenolpyruvate were removed. With regard to preparation of the gene-deleted strain, each gene was deleted from a strain by homologous recombination using λ-Red recombinase. Then, in a case in which a further gene-deleted strain is prepared on the basis of the above-prepared gene-deleted strain, the same promoter, terminator, FRT site, etc. are already present in the strain and thus the above recombination method could not be applied. Instead, a method of combining respective gene deletions through P1 transduction was used. Finally, a strain with deletion of 9 genes related to the generation of fermentation by-product was prepared and named MG1655 AceCo.

[0175] PCR primers used for preparation of AceCo strain and a process of preparing the final AceCo are shown in Table 4 and FIG. 11. For example, a process of preparing ISI strain will be described below. A gene group including a promoter, a marker gene, FRT site and a terminator (SEQ ID NO: 55) was amplified through PCR using ΔackA-pta-F and ΔackA-pta-R, which are primers containing peripheral 50 bp of ackA-pta gene (SEQ ID NO: 48) of E. coli, respectively, and the amplified DNA fragments were introduced into the E. coli to induce homologous recombination through λ-Red recombinase, thereby preparing IS1 strain. Screening of the gene-deleted strains was performed in a solid antibiotic medium corresponding to an antibiotic-resistant gene, which was primarily introduced. Further, with regard to the final strain with gene deletion, gene deletion was identified through PCR using ackA-ptaCF-F and ackA-ptaCF-R primers.

[0176] Referring to Table 4 and FIG. 11, strains with deletion of one gene or operon such as IS1 to IS7 were prepared by homologous recombination, separately. Then, IS1 and IS2 were combined through P1 transduction to prepare IS8 strain. To the above-prepared IS8 strain, IS3 to IS6 were integrated in sequential order through P1 transduction to prepare IS9 to IS12 strains. Lastly, the IS7 strain was integrated into the finally prepared IS12 strain, thereby preparing AceCo strain.

[0177] (2) Identification of Improved Isoprene Productivity and Prevention of Excessive Fermentation by-Product Using Strain Having Improved Carbon Source Use Efficiency

[0178] The present example describes that isoprene productivity is improved and generation of fermentation by-product is prevented by introducing pTSNK-sPtispS-MVA plasmid in Example 1-(4) into the MG1655 AceCo strain prepared in Example 3-(1), as well as identified results thereof.

[0179] As a control group, MG1655 and the strain with deletion of ackA-pta gene, which is an acetic acid biosynthetic pathway gene, from the wild type E. coli MG1655, were used. The strain with deletion of ackA-pta gene from E. coli MG1655 was prepared by homologous recombination using λ-Red recombinase mentioned in Example 3-(1). Primers used in the above preparation are shown in Table 4.

[0180] The culture medium, culture conditions, and isoprene quantitation were the same as those described in the method according to Example 1-(2), except that IPTG was not added. The fermentation by-product was analyzed using a liquid chromatograph (HPLC, LC-20A) manufactured by Shimadzu Corp. A column for separation of a material used herein is an ion-exchange column (AminexR, HPX-87H, 7.8×300 mm) manufactured by BIO-RAD Co., wherein a mobile phase was 5 mM sulfuric acid and was transferred at a rate of 0.6 ml per minute. A temperature of the oven was maintained at 40° C. The residual glycerol in the medium was analyzed by the RID detector. Further, a column for separation of a material used herein was a hydrophobic column (100-5NH2, 250×4.6 mm) manufactured by Chromacyl Co. wherein a mobile phase was 75% acetonitrile and transferred at a rate of 1.5 ml per minute. A standard material for quantitative analysis was a product manufactured by Sigma Co.

[0181] Culture results are shown in FIG. 12. Referring to FIG. 12, in terms of the isoprene production amount, the AceCo strain exhibited an isoprene production amount about 3.5 times and 2.6 times higher than the wild type MG1655 and ackA-pta deleted strains as control groups, respectively. On the other hand, an acetic acid production amount as the fermentation by-product was 1.3 g/L, which is 5.6 times and 5.0 times smaller than those generated by the wild type MG1655 and ackA-pta deleted strains as control groups, respectively. As a measurement criterion for intercellular concentration of acetyl-CoA, a concentration of a precursor, that is, pyruvate in AceCo strain was determined as 3.1 g/L, which is far superior compared to the control groups, that is, the wild type MG1655 and the ackA-pta deleted strains.

[0182] Therefore, it was demonstrated from the study results that isoprene productivity may be remarkably improved if undesirable consumption of acetyl-CoA as the precursor of MVA pathway is prevented by blocking a fermentation by-product biosynthetic pathway, while improving carbon source use efficiency. Further, it was found that, when only ackA and pta genes related to acetic acid biosynthesis were deleted, there is no effect of suppressing the production of acetic acid. Furthermore, there is no advantageous effect of helping to improve isoprene productivity.

[0183] 4. Improvement of Isoprene Productivity by Efficient Conversion of Isoprene Precursor to Isoprene

[0184] (1) Improvement of Isoprene Productivity by Further Introducing Idi Gene Derived from Various Microorganisms

[0185] The present example describes a new plasmid prepared by further introducing idi gene derived from various microorganisms into the plasmid prepared in Example 1, as well as culture results to identify improvement of isoprene productivity using the same.

[0186] Escherichia genus (SEQ ID NO: 7), Haematococcus genus (SEQ ID NO: 10), Synechocystis genus (SEQ ID NO: 8), Streptococcus genus (SEQ ID NO: 9) idi genes were inserted into XbaI restriction enzyme site of pTSN-sPtispS plasmid prepared in Example 1-(1). For example, the preparation of pTSN-sPtispS-Ecidi plasmid will be concretely described below. The gene from genome of E. coli was amplified using primers Ecidi-F and Ecidi-R, and the amplified gene was introduced into an XbaI site of pTSN-sPtispS to finally complete the preparation. As a result of the preparation in the same manner using the above four types of idi genes, pTSN-sPtispS-Ecidi, pTSN-sPtispS-HPidi, pTSN-sPtispS-Syidi and pTSN-sPtispS-Snidi plasmids were prepared. PCR primers used for additional introduction of idi genes are shown in Table 5.

TABLE-US-00005 TABLE 5 SEQ ID NO. Primer Sequence 56 Ecidi- 5′-CGAATTCAGGAGGAGAAATTATGCAAACG F GAACACGTC-3′ (SEQ ID NO. 56) 57 Ecidi- 5′-CCTGCAGGTCGAAATTCTTATTTAAGCTG R GGTAAA-3′ (SEQ ID NO. 57) 58 Hpidi- 5′-GGAATTCAGGAGGTAATAAAATATGCTTC F GTTCGTTGCTCAG-3′ (SEQ ID NO. 58) 59 Hpidi- 5′-CAAGCTTGATCACTAGTTACGCTTCGTTG R ATGTG-3′ (SEQ ID NO. 59) 60 Syidi- 5′-GGAATTCAGGAGGATTCACTGATGGATAG F CACCCCCCAC-3′ (SEQ ID NO. 60) 61 Syidi- 5′-CCTGCAGGTCGACTCTAGTTAAGGTTTAG R TTAACC-3′ (SEQ ID NO. 61) 62 Snidi- 5′-TCTAGAGGAGGATAGGACATGACGACAAA F TCGTAAG-3′ (SEQ ID NO. 62) 63 Snidi- 5′-GTCGACTCTAGTTACGCCTTTTTCATCTG R ATC-3′ (SEQ ID NO. 63)

[0187] These plasmids were introduced along with pS-NA into E. coli MG1655 AceCo ΔrecA strain to form a transformant, and were investigated whether isoprene productivity was improved or not.

[0188] The culture medium, culture conditions and isoprene quantitation were the same as those described in the method according to Example 1-(2), and 0.5 mM IPTG was added to the culture medium.

[0189] Culture results are shown in FIG. 13. Referring to FIG. 13, the strain with additional introduction of Synechocystis genus idi gene showed the highest isoprene production amount. Further, others with additional introduction of the remaining idi genes also exhibited a higher isoprene production amount than the control group.

[0190] From the results, it was demonstrated that additional introduction of idi gene was helpful for improving the isoprene productivity, and Synechocystis genus idi is the most efficient among the genes described above.

[0191] (2) Identification of Improved Isoprene Productivity According to Preparation and Application of Fusion Protein

[0192] Based on the results in Example 4-(1), the present example describes preparation of a fusion protein by combining Synechocystis genus idi, which exhibited the improved isoprene productivity, and E. coli-specific Escherichia genus idi with isoprene synthase in a fusion form, as well as results of improving isoprene productivity using the same.

[0193] After removing a stop codon of isoprene synthase (amplified through PCR using primers FispS-F and FispS-R) and thus cloning the same at NcoI and XbaI sites of pTrc99SN vector, it was designed to insert idi gene having a serine-glycine linker (amplified through PCR using primers REcidi-F and REcidi-R or RSyidi-F and RSyidi-R) at the back of the isoprene synthase using an XbaI site, so that two genes are expressed as a single protein. The prepared plasmids were named pTSN-sPtispS-L-Sydid and pTSN-sPtispS-L-Ecidi, respectively. Further, after cloning idi (amplified through PCR using primers FEcidi-F and FEcidi-R or FSyidi-F and FSyidi-R) at NcoI and XbaI sites of pTrc99SN vector, the isoprene synthase having a serine-glycine linker (amplified through PCR using primers RispS-F and RispS-R) was inserted at the back of idi gene using the XbaI site, so as to prepare pTSN-Syidi-L-sPtispS and pTSN-Ecidi-L-sPtispS, respectively. PCR primers used for the preparation of genes encoding fusion proteins are shown in Table 6.

TABLE-US-00006 TABLE 6 SEQ ID NO. Primer Sequence 64 FispS-F 5′-GAATTCGAGCTCAGGAGGTAATAAATAT GGCTTGCTCTGTATCC-3′ (SEQ ID NO. 64) 65 FispS-R 5′-GGATCCGCCGCCACCCGAGCCACCGCCA CCGCGTTCGAACGGCAGAATTG-3′ (SEQ ID NO. 65) 66 RispS-F 5′-GGATCCATGGCTTGCTCTGTATCCACTG AG-3′ (SEQ ID NO. 66) 67 RispS-R 5′-CTGCAGGTCGACTTAGCGTTCGAACGGC AG-3′ (SEQ ID NO. 67) 68 FEcidi-F 5′-GAATTCGAGCTCAGGAGGTAATAAATAT GCAAACGGAACACGTC-3′ (SEQ ID NO. 68) 69 FEcidi-R 5′-GGATCCGCCGCCACCCGAGCCACCGCCA CCTTTAAGCTGGGTAAATGC-3′ (SEQ ID NO. 69) 70 REcidi-F 5′-GGATCCATGCAAACGGAACACGTCATTT TATTG-3′ (SEQ ID NO. 70) 71 REcidi-R 5′-CTGCAGGTCGACTTATTTAAGCTGGGTA AATG-3′ (SEQ ID NO. 71) 72 FSyidi-F 5′-GAATTCGAGCTCAGGAGGTAATAAATAT GGATAGCACCCCCCACCG-3′ (SEQ ID NO. 72) 73 FSyidi-R 5′-GGATCCGCCGCCACCCGAGCCACCGCCA CCAGGTTTAGTTAACCTTTGTC-3′ (SEQ ID NO. 73) 74 RSyidi-F 5′-GGATCCATGGATAGCACCCCCCACCGTA AG-3′ (SEQ ID NO. 74) 75 RSyidi-R 5′-CTGCAGGTCGACTTAAGGTTTAGTTAAC CTTTG-3′ (SEQ ID NO. 75)

[0194] In order to identify whether isoprene productivity was improved or not, the plasmids which include genes encoding four types of fusion proteins were introduced into pS-NA and E. coli DH5α, simultaneously, and cultured.

[0195] The culture medium, culture conditions and isoprene quantitation were the same as those described in the method according to Example 1-(2), except that IPTG was not added.

[0196] Culture results are shown in FIG. 14. Referring to FIG. 14, as a result of the culture, the fusion protein of IspS and Escherichia genus IDI exhibited a higher isoprene production amount than Synechocystis genus IDI fusion protein. In particular, the fusion form in which Escherichia genus IDI is fused at the front of IspS exhibited the highest isoprene productivity and an isoprene production amount of about 2.4 times higher than the control group.

[0197] Based on the above results, it could be confirmed that the fusion protein of IspS and IDI might more efficiently convert IPP to isoprene.

[0198] 5. Identification of Isoprene Productivity According to Culture Condition

[0199] (1) Identification of Isoprene Productivity According to Types of Inducing Materials

[0200] The present example describes results of identification of isoprene productivity according to types of inducing agents to increase a protein expression level.

[0201] Lactose is degraded into glucose and galactose by (3-galactosidase. Further, glucose and galactose may be synthesized into lactose by a reverse reaction of (3-galactosidase. In this case, allolactose may be generated at a predetermined probability and this allolactose acts as an expression-inducing agent. Based on this fact, it is expected that an expression level of β-galactosidase is increased in proportion to increase in an amount of cells, which in turn proportionally increases an amount of allolactose. In order to properly control the expression of isoprene biosynthesis-related genes, isoprene productivity was investigated by adding lactose.

[0202] After introducing pTSNK-sPtispS-MVA into MG1655ΔrecA strain to form an E. coli transformant, 5 ml TB medium including 50 μm/ml of kanamycin (24 g yeast extract, 12 g tryptone, 9.4 g K.sub.2HPO.sub.4, 2.2 g KH.sub.2PO.sub.4 per liter) was inoculated with the transformant having isoprene productivity and then subjected to seed culture under conditions of 37° C. and 250 rpm. Thereafter, 50 ml TB medium including 20 g/L of glycerol and 50 μm/ml of kanamycin was inoculated with the seed-cultured product and then subjected to main culture. In order to increase a protein expression level, as the expression-inducing agents, IPTG at a final concentration of 0.03 mM and lactose at final concentrations of 5 g/l, 10 g/l and 20 g/l, respectively, were added. In a condition of adding 20 g/l of lactose, glycerol was not added. The main culture was conducted in 250 ml grooved conical flask under conditions of 30° C. and 150 rpm for 36 hours. The isoprene quantitation was performed according to the same procedures as described in the method according to Example 1-(2), except that IPTG was not added.

[0203] Culture results are shown in FIG. 15. Referring to FIG. 15, it was found that, when adding lactose along with glycerol, an isoprene production amount was about 2.3 times higher than the condition of addition of IPTG. Based on this result, it could be confirmed that addition of lactose as an expression-inducing agent was helpful for improving the isoprene productivity.

[0204] (2) Identification of Isoprene Productivity According to Addition of Auxiliary Factor Mg.sup.2+

[0205] The present example describes results of identification of isoprene productivity when further adding an auxiliary factor of isoprene synthase, Mg.sup.2+.

[0206] It was reported that the isoprene synthase had optimum activity in the presence of 20 mM Mg.sup.2+ as an auxiliary factor. Therefore, isoprene productivity was investigated by adding excessive amount of Mg.sup.2+.

[0207] After introducing pTSNK-sPtispS-MVA into MG1655ΔrecA strain to form an E. coli transformant, 5 ml 2YT medium including 50 μm/ml of kanamycin (10 g yeast extract, 16 g tryptone, 5 g NaCl per liter) was inoculated with the transformant having isoprene productivity and then subjected to seed culture under conditions of 37° C. and 250 rpm. Thereafter, 50 ml MR medium including 20 g/L of glycerol and 50 μm/ml of kanamycin (KH.sub.2PO.sub.4 40.6 g, MgSO4.7H2O 0.492 g, Na2HPO4O7.2H2O 2.56 g, NaCl20.1 g, NH4Cl 0.2 g per liter) was inoculated with the seed cultured product and subjected to main culture. In order to increase a protein expression level, an expression-inducing agent, that is, lactose at a final concentration of 5 g/l was added. Further, 30 mM Mg.sup.2+ as an auxiliary factor was added. The main culture was conducted in 250 ml grooved conical flask under conditions of 30° C. and 150 rpm for 60 hours. The isoprene quantitation was performed according to the same procedures as described in the method according to Example 1-(2), except that IPTG was not added.

[0208] Culture results are shown in FIG. 16. Referring to FIG. 16, it was found that, when 30 mM Mg.sup.+2 was further added to MR medium containing a predetermined amount of Mg.sup.2+, isoprene production was about 1.65 times higher than the same medium without further addition of Mg.sup.2+. Based on this result, it could be confirmed that addition of Mg.sup.2+ as an auxiliary factor was helpful for improving the isoprene productivity.