HERBICIDE TOLERANCE PROTEIN, ENCODING GENE THEREOF AND USE THEREOF
20210324404 · 2021-10-21
Inventors
- Jian He (Nanjing, Jiangsu Province, CN)
- Bin Liu (Nanjing, Jiangsu Province, CN)
- Qian Peng (Nanjing, Jiangsu Province, CN)
- Qing TAO (Beijing, CN)
- Xiang Xiao (Beijing, CN)
- Xiaoming BAO (Beijing, CN)
Cpc classification
C12N15/8202
CHEMISTRY; METALLURGY
A01N47/36
HUMAN NECESSITIES
International classification
C12N15/82
CHEMISTRY; METALLURGY
A01N47/36
HUMAN NECESSITIES
Abstract
The present invention relates to an herbicide tolerance protein, an encoding gene thereof and use thereof, the herbicide tolerance protein comprising: a protein (a) having an amino acid sequence as shown in SEQ ID NO: 1, and having an alanine substitution at least at position 176 and/or having a valine substitution at position 178 of SEQ ID NO: 1; or (b) having an amino acid sequence as shown in SEQ ID NO: 3; or (c) having an amino acid sequence as shown in SEQ ID NO: 5; or (d) having an amino acid sequence as shown in SEQ ID NO: 7; or (e) being derived from (a) by means of the amino acid sequence of (a) undergoing substitution and/or deletion and/or by added one or several amino acids, and having the activity of thifensulfuron hydrolase. The herbicide tolerance protein of the present invention has a broad application prospects in plants.
Claims
1.-15. (canceled)
16. An herbicide tolerance protein, comprising: a genetically modified protein characterized by increased enzymatic activity to degrade sulfonylurea herbicides compared to genetically unmodified ALT01 of SEQ ID NO:1.
17. The herbicide tolerance protein according to claim 16, comprising: (a) a protein consisting of an amino acid sequence as shown in SEQ ID NO: 1, and at least having an alanine substitution at position 176 and/or a valine substitution at position 178 of SEQ ID NO: 1; or (b) a protein consisting of an amino acid sequence as shown in SEQ ID NO: 19, and at least having an alanine substitution at position 140 and/or a valine substitution at position 142 of SEQ ID NO: 19; or (c) a protein consisting of an amino acid sequence as shown in SEQ ID NO: 35, and at least having an alanine substitution at position 140 and/or a valine substitution at position 142 of SEQ ID NO: 35; or (d) a protein consisting of an amino acid sequence as shown in SEQ ID NO: 51, and at least having an alanine substitution at position 131 and/or a valine substitution at position 133 of SEQ ID NO: 51; or (e) a protein which is derived from (a) to (d) by substituting and/or deleting and/or adding one or more amino acids in the amino acid sequences of (a) to (d), and has thifensulfuron hydrolase activity.
18. The herbicide tolerance protein according to claim 17, wherein the herbicide tolerance protein comprises: (f) an amino acid sequence of (a), wherein the amino acid sequence of (a) has an arginine substitution at position 80 and/or an alanine substitution at position 81 and/or an arginine substitution at position 182 of SEQ ID NO: 1; or (g) an amino acid sequence of (b), wherein the amino acid sequence of (b) has an arginine substitution at position 44 and/or an alanine substitution at position 45 and/or an arginine substitution at position 146 of SEQ ID NO: 19; or (h) an amino acid sequence of (c), wherein the amino acid sequence of (c) has an arginine substitution at position 44 and/or an alanine substitution at position 45 and/or an arginine substitution at position 146 of SEQ ID NO: 35; or (i) an amino acid sequence of (d), wherein the amino acid sequence of (d) has an arginine substitution at position 35 and/or an alanine substitution at position 36 and/or a valine substitution at position 137 of SEQ ID NO: 51; or (j) a protein which is derived from (a) to (d) by substituting and/or deleting and/or adding one or more amino acids in the amino acid sequences of (f) to (i), and has thifensulfuron hydrolase activity.
19. The herbicide tolerance protein according to claim 17, wherein the herbicide tolerance protein comprises: (k) a protein consisting of an amino acid sequence as shown in SEQ ID NO: 7, SEQ ID NO: 11 or SEQ ID NO: 15; or (l) a protein consisting of an amino acid sequence as shown in SEQ ID NO: 23, SEQ ID NO: 27 or SEQ ID NO: 31; or (m) a protein consisting of an amino acid sequence as shown in SEQ ID NO: 39, SEQ ID NO: 43 or SEQ ID NO: 47; or (n) a protein consisting of an amino acid sequence as shown in SEQ ID NO: 55, SEQ ID NO: 59 or SEQ ID NO: 63.
20. A herbicide tolerance gene, comprising: (p) a nucleotide sequence encoding the herbicide tolerance protein according to claim 17; or (q) a nucleotide sequence as shown in SEQ ID NO: 8, 9, 10, 12, 13, 14, 16, 17 or 18; or (r) a nucleotide sequence as shown in SEQ ID NO: 24, 25, 26, 28, 29, 30, 32, 33 or 34; or (s) a nucleotide sequence as shown in SEQ ID NO: 40, 41, 42, 44, 45, 46, 48, 49 or 50.
21. An expression cassette or a recombinant vector, comprising the herbicide tolerance gene of claim 20 under the regulation of an effectively linked regulatory sequence.
22. A method for increasing the range of herbicides which can be tolerated, comprising: co-expressing the herbicide tolerance protein of claim 17 in a plant together with at least one second protein which is different from the herbicide tolerance protein of claim 17.
23. A method for increasing the range of herbicides which can be tolerated, comprising: co-expressing the herbicide tolerance protein of claim 18 in a plant together with at least one second protein which is different from the herbicide tolerance protein of claim 18.
24. A method for increasing the range of herbicides which can be tolerated, comprising: co-expressing the herbicide tolerance protein of claim 19 in a plant together with at least one second protein which is different from the herbicide tolerance protein of claim 19.
25. A method for selecting transformed plant cells, comprising: transforming a plurality of plant cells with the herbicide tolerance gene of claim 20 or an expression cassette comprising the herbicide tolerance gene, and cultivating the cells under a concentration of herbicide allowing the growth of the transformed cells expressing the herbicide tolerance gene or the expression cassette, while killing the untransformed cells or inhibiting the growth of the untransformed cells, wherein the herbicide is a sulfonylurea herbicide.
26. A method for controlling weeds, comprising: applying an effective dose of a sulfonylurea herbicide to a field planting with a target plant, wherein the plant contains the herbicide tolerance gene of claim 20 or an expression cassette comprising the herbicide tolerance gene.
27. A method for controlling glyphosate resistant weeds in a field planting with a glyphosate tolerant plant, comprising: applying an effective dose of a sulfonylurea herbicide to a field planting with a glyphosate tolerant plant, the glyphosate tolerant plant containing the herbicide tolerance gene of claim 20 or an expression cassette comprising the herbicide tolerance gene.
28. A method for protecting a plant from damage caused by sulfonylurea herbicides, comprising: introducing the herbicide tolerance gene of claim 20 or an expression cassette comprising the herbicide tolerance gene or a recombinant vector comprising the herbicide tolerance gene into a plant to make the resultant plant produce a sufficient amount of herbicide tolerance proteins for protecting the plant from damage caused by sulfonylurea herbicides.
29. A method for imparting sulfonylurea herbicide tolerance to a plant or for producing a plant which is tolerant to a sulfonylurea herbicide, comprising: introducing the herbicide tolerance gene of claim 20 or an expression cassette comprising the herbicide tolerance gene or a recombinant vector comprising the herbicide tolerance gene into the genome of the plant.
30. A method for cultivating a plant which is tolerant to a sulfonylurea herbicide, comprising: planting at least one plant propagule, whose genome contains the herbicide tolerance gene of claim 20 or an expression cassette comprising the herbicide tolerance gene; allowing the plant propagule to grow into a plant; and applying an effective dose of a sulfonylurea herbicide to a plant growth environment comprising at least the plant, and harvesting the plant having a reduced plant damage and/or an increased plant yield compared to other plants without the herbicide tolerance gene of claim 20.
31. A planting system for controlling weed growth, comprising: a sulfonylurea herbicide and a plant growth environment in which at least one target plant exists, wherein the plant contains the herbicide tolerance gene of claim 20 or an expression cassette comprising the herbicide tolerance gene.
32. A planting system for controlling glyphosate resistant weeds growth in a field planting with a glyphosate tolerant plant, comprising a sulfonylurea herbicide, a glyphosate herbicide and a field planting with at least one glyphosate tolerant plant, wherein the glyphosate tolerant plant contains the herbicide tolerance gene of claim 20 or an expression cassette comprising the herbicide tolerance gene.
33. The method according to claim 22, wherein the second protein is 5-enolpyruvylshikimate-3-phosphate synthase, glyphosate oxidoreductase, glyphosate-N-acetyltransferase, glyphosate decarboxylase, glufosinate acetyltransferase, α-ketoglutarate-dependent dioxygenase, dicamba monooxygenase, 4-hydroxyphenylpyruvate dioxygenase, acetolactate synthase, cytochrome-like proteins and/or protoporphyrinogen oxidase.
34. The method according to claim 25, wherein the sulfonylurea herbicide is tribenuron-methyl, sulfometuron-methyl, halosulfuron-methyl, pyrazosulfuron-ethyl, thifensulfuron methyl, bensulfuron-methyl, metsulfuron-methyl, ethametsulfuron-methyl or chlorimuron-ethyl.
35. The method according to claim 26, wherein the plant is a monocotyledonous plant or a dicotyledonous plant.
36. The method according to claim 35, wherein the plant is maize, soybean, Arabidopsis thaliana, cotton, rape, rice, sorghum, wheat, barley, millet, sugar cane or oats.
Description
DESCRIPTION OF THE FIGURES
[0132]
[0133]
[0134]
[0135]
[0136]
[0137]
[0138]
[0139]
PARTICULAR EMBODIMENTS
[0140] The technical solutions of the herbicide tolerant protein, the coding gene thereof and use thereof in the present invention are further described through specific examples below.
Example 1. Mutation and Screening of ALT Gene
[0141] 1. Synthesis of ALT Gene
[0142] The nucleotide sequence (1197 nucleotides) of the ALT01 gene as shown in SEQ ID NO: 2 in the sequence listing was synthesized, which encodes the ALT01 protein (398 amino acids) as shown in SEQ ID NO: 1 in the sequence listing. The nucleotide sequence (SEQ ID NO: 2) of the synthetic ALT01 gene was ligated with a SpeI restriction enzyme site at the 5′ end and a KasI restriction enzyme site at the 3′ end. The ALT01-01 nucleotide sequence as shown in SEQ ID NO: 3 in the sequence listing encoding the amino acid sequence corresponding to ALT01 was obtained based on soybean codon usage bias, and the ALT01-02 nucleotide sequence as shown in SEQ ID NO: 4 in the sequence listing encoding the amino acid sequence corresponding to the herbicide tolerant protein ALT01 was obtained based on the maize codon usage bias.
[0143] 2. Construction of a Mutant Library of ALT01 Gene
[0144] The above synthetic ALT01 gene was amplified by PCR, and then was cloned into the vector pGEM-T according to the operational procedure in the instructions of product pGEM-T vector (Promega, Madison, USA, CAT: A3600) of Promega Corporation. Then, the above ligated product was introduced into Escherichia coli DH5α as a template to carry out error-prone PCR using primer 1 and primer 2, so that the ALT01 gene was mutated due to random base mismatch. The primers and error-prone PCR reaction system were as follows:
TABLE-US-00001 primer 1: ATGGAAACCGATAAAAAAACCG, as shown in SEQ ID NO: 5 in the sequence listing; primer 2: TCAGCTTTCGTTCTGATCTAAG, as shown in SEQ ID NO: 6 in the sequence listing;
[0145] Error-Prone PCR Reaction System (Total Volume: 50 μL):
TABLE-US-00002 2 × StarMut Random System 25 μL Plasmid DNA template 1 μL Primer 1 1 μL Primer 2 1 μL StarMut Enhancer 0-20 μL Water (ddH.sub.2O) added to 50 μL
[0146] The plasmid DNA template having a concentration of 1-10 ng/μL, the primer 1 having a concentration of 10 μM, and the primer 2 having a concentration of 10 μM, were stored at 4° C. in an amber tube.
[0147] Error-Prone PCR Reaction Conditions:
TABLE-US-00003 Step temperature time 11 95° C. 2 min 12 94° C. 30 s 13 55° C. 1 min 14 72° C. 1.5 min 15 back to step 12, 30 cycles 16 72° C. 10 min
[0148] The above error-prone PCR product was transformed into tribenuron-methyl-sensitive Escherichia coli DH10B ilvG.sup.+ by heat shock at 42° C. to construct a random mutant library of ALT01 gene.
[0149] 3. Screening of a Mutant Library of ALT01 Gene
[0150] The transformed product in the above mutant library was inoculated onto a screening medium (glucose 5 g/L, ampicillin 100 mg/L, valine 200 mg/L, leucine 200 mg/L, (NH.sub.4).sub.2SO.sub.4 2 g/L, MgSO.sub.4.7H.sub.2O 200 mg/L, CaCl.sub.2.2H.sub.2O 10 mg/L, FeSO.sub.4.7H.sub.2O 1 mg/L, Na.sub.2HPO.sub.4.12H.sub.2O 1.5 g/L and KH.sub.2PO.sub.4 1.5 g/L) containing tribenuron-methyl at a concentration of 200 mg/L, and was cultured at a temperature of 37° C. for 24 h.
[0151] In view of the ability of a resistance gene to transform tribenuron-methyl to benzenesulfonic acid which is non-toxic to bacteria, the above mutant library was subjected to high-throughput screening using the principle, and Escherichia coli DH10B ilvG.sup.+, which is still able to grow on the screening medium containing tribenuron-methyl at a concentration of 200 mg/L, was isolated to obtain a resistance gene.
[0152] 4. Acquisition of Mutant Resistance Genes
[0153] The sequencing results showed acquisition of three mutant resistance genes of ALT01, which were named ALT01M1, ALT01M2 and ALT01M3 genes respectively. The nucleotide sequence of ALT01M1 was mutated at position 527 from G to C, resulting in mutation from glycine to alanine at position 176 of the amino acid sequence of ALT01M1; the nucleotide sequence of ALT01M2 was mutated at positions 532 and 533 from TC to GT, resulting in mutation from serine to valine at position 178 of the amino acid sequence of ALT01M2; the nucleotide sequence of ALT01M3 was mutated at positions 239 to 242 from CATA to GAGC, and at positions 527 to 544 from GAAACTCCAGTAAAGAAG to CAAACGTCAGTAAAGAAA, resulting in mutation from proline and tyrosine to arginine and alanine at positions 80 to 81 and mutation from glycine, serine and glycine to alanine, valine and arginine at positions 176, 178 and 182 of the amino acid sequence of ALT01M3.
[0154] The amino acid sequence of the herbicide tolerant protein ALT01M1 is shown in SEQ ID NO: 7 in the sequence listing, and the ALT01M1 nucleotide sequence which encodes the amino acid sequence of the herbicide tolerant protein ALT01M1 is shown in SEQ ID NO: 8 in the sequence listing; the ALT01M1-01 nucleotide sequence as shown in SEQ ID NO: 9 in the sequence listing encoding the amino acid sequence corresponding to the herbicide tolerant protein ALT01M1 was obtained based on the soybean codon usage bias; the ALT01M1-02 nucleotide sequence as shown in SEQ ID NO: 10 in the sequence listing encoding the amino acid sequence corresponding to the herbicide tolerant protein ALT01M1 was obtained based on the maize codon usage bias.
[0155] The amino acid sequence of the herbicide tolerant protein ALT01M2 is shown in SEQ ID NO: 11 in the sequence listing, and the ALT01M2 nucleotide sequence which encodes the amino acid sequence of the herbicide tolerant protein ALT01M2 is shown in SEQ ID NO: 12 in the sequence listing; the ALT01M2-01 nucleotide sequence as shown in SEQ ID NO: 13 in the sequence listing encoding the amino acid sequence corresponding to the herbicide tolerant protein ALT01M2 was obtained based on the soybean codon usage bias; the ALT01M2-02 nucleotide sequence as shown in SEQ ID NO: 14 in the sequence listing encoding the amino acid sequence corresponding to the herbicide tolerant protein ALT01M2 was obtained based on the maize codon usage bias.
[0156] The amino acid sequence of the herbicide tolerant protein ALT01M3 is shown in SEQ ID NO: 15 in the sequence listing, and the ALT01M3 nucleotide sequence which encodes the amino acid sequence of the herbicide tolerant protein ALT01M3 is shown in SEQ ID NO: 16 in the sequence listing; the ALT01M3-01 nucleotide sequence as shown in SEQ ID NO: 17 in the sequence listing encoding the amino acid sequence corresponding to the herbicide tolerant protein ALT01M3 was obtained based on the soybean codon usage bias; the ALT01M3-02 nucleotide sequence as shown in SEQ ID NO: 18 in the sequence listing encoding the amino acid sequence corresponding to the herbicide tolerant protein ALT01M3 was obtained based on the maize codon usage bias.
[0157] Synthesis of the Following Nucleotide Sequences:
[0158] The amino acid sequence (369 amino acids) of ALT02 is shown in SEQ ID NO: 19 in the sequence listing, and the ALT02 nucleotide sequence (1110 nucleotides) which encodes the amino acid sequence of ALT02 is shown in SEQ ID NO: 20 in the sequence listing; the ALT02-01 nucleotide sequence as shown in SEQ ID NO: 21 in the sequence listing encoding the amino acid sequence corresponding to the ALT02 was obtained based on the soybean codon usage bias; the ALT02-02 nucleotide sequence as shown in SEQ ID NO: 22 in the sequence listing encoding the amino acid sequence corresponding to the herbicide tolerant protein ALT02 was obtained based on the maize codon usage bias.
[0159] The herbicide tolerant protein ALT02M1 includes a mutation from glycine to alanine at position 140 of the amino acid sequence of the ALT02. The amino acid sequence of ALT02M1 is shown in SEQ ID NO: 23 in the sequence listing, and the ALT02M1 nucleotide sequence which encodes the amino acid sequence of the herbicide tolerant protein ALT02M1 is shown in SEQ ID NO: 24 in the sequence listing; the ALT02M1-01 nucleotide sequence as shown in SEQ ID NO: 25 in the sequence listing encoding the amino acid sequence corresponding to the herbicide tolerant protein ALT02M1 was obtained based on the soybean codon usage bias; the ALT02M1-02 nucleotide sequence as shown in SEQ ID NO: 26 in the sequence listing encoding the amino acid sequence corresponding to the herbicide tolerant protein ALT02M1 was obtained based on the maize codon usage bias.
[0160] The herbicide tolerant protein ALT02M2 includes a mutation from serine to valine at position 142 of the amino acid sequence of the ALT02. The amino acid sequence of the ALT02M2 is shown in SEQ ID NO: 27 in the sequence listing, and the ALT02M2 nucleotide sequence which encodes the amino acid sequence of the herbicide tolerant protein ALT02M2 is shown in SEQ ID NO: 28; the ALT02M2-01 nucleotide sequence as shown in SEQ ID NO: 29 in the sequence listing encoding the amino acid sequence corresponding to the herbicide tolerant protein ALT02M2 was obtained based on the soybean codon usage bias; the ALT02M2-02 nucleotide sequence as shown in SEQ ID NO: 30 in the sequence listing encoding the amino acid sequence corresponding to the herbicide tolerant protein ALT02M2 was obtained based on the maize codon usage bias.
[0161] The herbicide tolerant protein ALT02M3 includes mutations from proline and tyrosine to arginine and alanine at positions 44 to 45 and mutations from glycine, serine and glycine to alanine, valine and arginine at positions 140, 142 and 146 of the amino acid sequence of the ALT02. The amino acid sequence of the ALT02M3 is shown in SEQ ID NO: 31 in the sequence listing, and the ALT02M3 nucleotide sequence which encodes the amino acid sequence of the herbicide tolerant protein ALT02M3 is shown in SEQ ID NO: 32 in the sequence listing; the ALT02M3-01 nucleotide sequence as shown in SEQ ID NO: 33 in the sequence listing encoding the amino acid sequence corresponding to the herbicide tolerant protein ALT02M3 was obtained based on the soybean codon usage bias; the ALT02M3-02 nucleotide sequence as shown in SEQ ID NO: 34 in the sequence listing encoding the amino acid sequence corresponding to the herbicide tolerant protein ALT02M3 was obtained based on the maize codon usage bias.
[0162] The amino acid sequence (362 amino acids) of ALT03 is shown in SEQ ID NO: 35 in the sequence listing, and the ALT03 nucleotide sequence (1089 nucleotides) which encodes the amino acid sequence of the ALT03 is shown in SEQ ID NO: 36 in the sequence listing; the ALT03-01 nucleotide sequence as shown in SEQ ID NO: 37 in the sequence listing encoding the amino acid sequence corresponding to the ALT03 was obtained based on the soybean codon usage bias; the ALT03-02 nucleotide sequence as shown in SEQ ID NO: 38 in the sequence listing encoding the amino acid sequence corresponding to the herbicide tolerant protein ALT03 was obtained based on the maize codon usage bias.
[0163] The herbicide tolerant protein ALT03M1 includes a mutation from glycine to alanine at position 140 of the amino acid sequence of the ALT03. The amino acid sequence of the ALT03M1 is shown in SEQ ID NO: 39 in the sequence listing, and the ALT03M1 nucleotide sequence which encodes the amino acid sequence of the herbicide tolerant protein ALT03M1 is shown in SEQ ID NO: 40 in the sequence listing; the ALT03M1-01 nucleotide sequence as shown in SEQ ID NO: 41 in the sequence listing encoding the amino acid sequence corresponding to the herbicide tolerant protein ALT03M1 was obtained based on the soybean codon usage bias; the ALT03M1-02 nucleotide sequence as shown in SEQ ID NO: 42 in the sequence listing encoding the amino acid sequence corresponding to the herbicide tolerant protein ALT03M1 was obtained based on the maize codon usage bias.
[0164] The herbicide tolerant protein ALT03M2 includes a mutation from serine to valine at position 142 of the amino acid sequence of the ALT03. The amino acid sequence of the ALT03M2 is shown in SEQ ID NO: 43 in the sequence listing, and the ALT03M2 nucleotide sequence which encodes the amino acid sequence of the herbicide tolerant protein ALT03M2 is shown in SEQ ID NO: 44 in the sequence listing; the ALT03M2-01 nucleotide sequence as shown in SEQ ID NO: 45 in the sequence listing encoding the amino acid sequence corresponding to the herbicide tolerant protein ALT03M2 was obtained based on the soybean codon usage bias; the ALT03M2-02 nucleotide sequence as shown in SEQ ID NO: 46 in the sequence listing encoding the amino acid sequence corresponding to the herbicide tolerant protein ALT03M2 was obtained based on the maize codon usage bias.
[0165] The herbicide tolerant protein ALT03M3 includes mutations from proline and tyrosine to arginine and alanine at positions 44 to 45 and mutations from glycine, serine and glycine to alanine, valine and arginine at positions 140, 142 and 146 of the amino acid sequence of the ALT03. The amino acid sequence of the ALT03M3 is shown in SEQ ID NO: 47 in the sequence listing, and the ALT03M3 nucleotide sequence which encodes the amino acid sequence of the herbicide tolerant protein ALT03M3 is shown in SEQ ID NO: 48 in the sequence listing; the ALT03M3-01 nucleotide sequence as shown in SEQ ID NO: 49 in the sequence listing encoding the amino acid sequence corresponding to the herbicide tolerant protein ALT03M3 was obtained based on the soybean codon usage bias; the ALT03M3-02 nucleotide sequence as shown in SEQ ID NO: 50 in the sequence listing encoding the amino acid sequence corresponding to the herbicide tolerant protein ALT03M3 was obtained based on the maize codon usage bias.
[0166] The amino acid sequence (350 amino acids) of ALT04 is shown in SEQ ID NO: 51 in the sequence listing, and the ALT04 nucleotide sequence (1053 nucleotides) which encodes the amino acid sequence of the ALT04 is shown in SEQ ID NO: 52 in the sequence listing; the ALT04-01 nucleotide sequence as shown in SEQ ID NO: 53 in the sequence listing encoding the amino acid sequence corresponding to the ALT04 was obtained based on the soybean codon usage bias; the ALT04-02 nucleotide sequence as shown in SEQ ID NO: 54 in the sequence listing encoding the amino acid sequence corresponding to the herbicide tolerant protein ALT04 was obtained based on the maize codon usage bias.
[0167] The herbicide tolerant protein ALT04M1 includes a mutation from glycine to alanine at position 131 of the amino acid sequence of the ALT04. The amino acid sequence of the ALT04M1 is shown in SEQ ID NO: 55 in the sequence listing, and the ALT04M1 nucleotide sequence which encodes the amino acid sequence of the herbicide tolerant protein ALT04M1 is shown in SEQ ID NO: 56 in the sequence listing; the ALT04M1-01 nucleotide sequence as shown in SEQ ID NO: 57 in the sequence listing encoding the amino acid sequence corresponding to the herbicide tolerant protein ALT04M1 was obtained based on the soybean codon usage bias; the ALT04M1-02 nucleotide sequence as shown in SEQ ID NO: 58 in the sequence listing encoding the amino acid sequence corresponding to the herbicide tolerant protein ALT04M1 was obtained based on the maize codon usage bias.
[0168] The herbicide tolerant protein ALT04M2 includes a mutation from serine to valine at position 133 of the amino acid sequence of the ALT04. The amino acid sequence of the ALT04M2 is shown in SEQ ID NO: 59 in the sequence listing, and the ALT04M2 nucleotide sequence which encodes the amino acid sequence of the herbicide tolerant protein ALT04M2 is shown in SEQ ID NO: 60 in the sequence listing; the ALT04M2-01 nucleotide sequence as shown in SEQ ID NO: 61 in the sequence listing encoding the amino acid sequence corresponding to the herbicide tolerant protein ALT04M2 was obtained based on the soybean codon usage bias; the ALT04M2-02 nucleotide sequence as shown in SEQ ID NO: 62 in the sequence listing encoding the amino acid sequence corresponding to the herbicide tolerant protein ALT04M2 was obtained based on the maize codon usage bias.
[0169] The herbicide tolerant protein ALT04M3 includes mutations from proline and tyrosine to arginine and alanine at positions 35 to 36 and mutations from glycine, serine and glycine to alanine, valine and arginine at positions 131, 133 and 137 of the amino acid sequence of the ALT04. The amino acid sequence of the ALT04M3 is shown in SEQ ID NO: 63 in the sequence listing, and the ALT04M3 nucleotide sequence which encodes the amino acid sequence of the herbicide tolerant protein ALT04M3 is shown in SEQ ID NO: 64 in the sequence listing; the ALT04M3-01 nucleotide sequence as shown in SEQ ID NO: 65 in the sequence listing encoding the amino acid sequence corresponding to the herbicide tolerant protein ALT04M3 was obtained based on the soybean codon usage bias; the ALT04M3-02 nucleotide sequence as shown in SEQ ID NO: 66 in the sequence listing encoding the amino acid sequence corresponding to the herbicide tolerant protein ALT04M3 was obtained based on the maize codon usage bias.
Example 2. Expression and Purification of Protein
[0170] 1. PCR Amplification of Genes
[0171] A pair of primers were designed:
TABLE-US-00004 primer 3: TGCAGACATATGGAAACCGATAAAAAAAC (the portion underlined being Nde I restriction enzyme site), as shown in SEQ ID NO: 67 in the sequence listing; primer 4: CCCAAGCTTCTAGCTTTCGTTCTGATCTAAGCCGTGC (the portion underlined being Hind III restriction enzyme site), as shown in SEQ ID NO: 68 in the sequence listing;
[0172] The ALT01M1 gene (terminal containing Nde I and Hind III restriction enzyme sites) was amplified using the following PCR amplification system:
TABLE-US-00005 Taq DNA polymerase (5 U/μL) 0.5 μL 5 × PrimeSTARBuffer (Mg.sup.2+ Plus) 25 μL dNTP mixture (each 2.5 mM) 5 μL Template DNA (M1 gene) 10 ng Primer 3 (25 μM) 1 μL Primer 4 (25 μM) 1 μL Water (ddH.sub.2O) added to 50 μL
[0173] PCR reaction conditions: denaturation at 98° C. for 1 min; then entering the following cycle: denaturation at 98° C. for 15 s, annealing at 55° C. for 15 s, extension at 72° C. for 1 min, totally including 29 cycles; finally extension at 72° C. for 10 min, and cooling to room temperature.
[0174] According to the above PCR amplification method, the ALT01M2 nucleotide sequence, the ALT01M3 nucleotide sequence, the ALT01 nucleotide sequence, the ALT03M1 nucleotide sequence, the ALT03M2 nucleotide sequence, the ALT03M3 nucleotide sequence, ALT03 nucleotide sequence, ALT04M1 nucleotide sequence, ALT04M2 nucleotide sequence, ALT04M3 nucleotide sequence and ALT04 nucleotide sequence, which contain the Nde I and Hind III restriction enzyme sites at terminals, were amplified. ALT02M1 nucleotide sequence, ALT02M2 nucleotide sequence, ALT02M3 nucleotide sequence, and ALT02 nucleotide sequence (terminals of which contain Nde I and Hind III restriction enzyme sites, respectively) were synthesized.
[0175] 2. Construction of a Bacterial Expression Vector and Acquisition of Recombinant Microorganisms
[0176] The above PCR amplification product (the ALT01M1 nucleotide sequence, the ALT01M2 nucleotide sequence, the ALT01M3 nucleotide sequence, the ALT01 nucleotide sequence, the ALT02M1 nucleotide sequence, the ALT02M2 nucleotide sequence, the ALT02M3 nucleotide sequence, the ALT02 nucleotide sequence, the ALT03M1 nucleotide sequence, the ALT03M2 nucleotide sequence, the ALT03M3 nucleotide sequence, the ALT03 nucleotide sequence, the ALT04M1 nucleotide sequence, the ALT04M2 nucleotide sequence, the ALT04M3 nucleotide sequence and the ALT04 nucleotide sequence, which contain the Nde I and Hind III restriction enzyme sites at terminals) and a bacterial expression vector pET-30a (+) were digested respectively with restriction enzymes Nde I and Hind III, the excised gene fragments mentioned above were enzymatically linked respectively with the bacterial expression vector pET-30a (+) after enzyme digestion, and the enzymatically linked products were transformed respectively to the expression host strain BL21 (DE3) to obtain the recombinant microorganisms BL21 (ALT01M1), BL21 (ALT01M2), BL21 (ALT01M3), BL21 (ALT01), BL21 (ALT02M1), BL21 (ALT02M2), BL21 (ALT02M3), BL21 (ALT02), BL21 (ALT03M1), BL21 (ALT03M2), BL21 (ALT03M3), BL21 (ALT03), BL21 (ALT04M1), BL21 (ALT04M2), BL21 (ALT04M3), and BL21 (ALT04).
[0177] 3. Expression and Purification of Herbicide Tolerant Protein in Escherichia coli
[0178] The recombinant microorganisms BL21 (ALT01M1), BL21 (ALT01M2), BL21 (ALT01M3), BL21 (ALT01), BL21 (ALT02M1), BL21 (ALT02M2), BL21 (ALT02M3), BL21 (ALT02), BL21 (ALT03M1), BL21 (ALT03M2), BL21 (ALT03M3), BL21 (ALT03), BL21 (ALT04M1), BL21 (ALT04M2), BL21 (ALT04M3), and BL21 (ALT04) were cultured in 100 mL of LB medium (10 g/L of tryptone, 5 g/L of yeast extract, 10 g/L of NaCl and 100 mg/L of ampicillin, adjusted to pH 7.5 with NaOH) to a concentration of OD.sub.600nm=0.6-0.8, and induced with isopropyl thiogalactoside (IPTG) added at a concentration of 0.4 mM at a temperature of 16° C. for 20 hours. Bacterial cells were collected by centrifugation and resuspended in 20 ml of Tris-HCl buffer (100 mM, pH 8.0), followed by performing ultrasonication (X0-900D ultrasonic processor ultrasonic processor, 30% intensity) for 10 min, then centrifuging, collecting the supernatant, purifying the acquired herbicide tolerant proteins mentioned above with nickel ion affinity chromatography column, and detecting the purification result using SDS-PAGE protein electrophoresis with the band size being consistent with theoretically predicted band size.
Example 3. Determination of Enzymatic Activity of Herbicide Tolerant Protein
[0179] Enzymatic reaction system (1 mL) contains 0.2 μg of reactive enzyme (the herbicide tolerant proteins ALT01M1, ALT01M2, ALT01M3, ALT01, ALT02M1, ALT02M2, ALT02M3, ALT02, ALT03M1, ALT03M2, ALT03M3, ALT03, ALT04M1, ALT04M2, ALT04M3 and ALT04 obtained from the above purification), 0.2 mM of thifensulfuron-methyl (metsulfuron-methyl, chlorimuron-ethyl, bensulfuron-methyl, sulfometuron-methyl or tribenuron-methyl), and a buffer system of phosphate buffer at a concentration of 50 mM (pH 7.0), which were reacted in a water bath at a temperature of 30° C. for 20 min. Each reaction was timed beginning with the addition of reactive enzyme, and was terminated with 1 mL of dichloromethane. The organic phase after delamination was dehydrated with anhydrous sodium sulfate.
[0180] The above dehydrated reaction solution was blown dry with nitrogen and filtered by adding 1 mL of methanol, and 20 μL of the filtrate was subjected to liquid chromatography-mass spectrometry (LC-MS). High performance liquid chromatography (HPLC) conditions were as follows: mobile phase being methanol:water (80:20, V/V), Zorbax XDB-C18 chromatographic column (3.5 μm, 2.1×50 mm, Agilent, USA), column temperature being room temperature, UV detector, with a detection wavelength of 255 nm, a sample injection volume of 20 μL, and a flow rate of 0.25 mL/min. The primary ion mass spectrometry conditions were as follows: ion detection mode being multi-reactive ion detection; ion polarity being negative ion; ionization mode being electrospray ionization; a capillary voltage of 4000 volts; a dry gas temperature of 330° C., a flow rate of 10 L/min, an atomizing gas pressure of 35 psi, a collision voltage of 135 volts; and a mass scan range of 300-500 m/z. The secondary ion mass spectrometry conditions were as follows: a collision voltage of 90 volts; a mass scanning range of 30-400 m/z, and other conditions being the same as those of the primary ion mass spectrometry. It was identified by LC-MS that the metabolite of thifensulfuron-methyl was thiophene sulfonic acid, and the metabolite of metsulfuron-methyl, chlorimuron-ethyl, bensulfuron-methyl, sulfometuron-methyl or tribenuron-methyl was its corresponding sulfonic acid. The amount of the generated thiophene sulfonic acid (metabolite) was detected using high performance liquid chromatography (HPLC). An enzyme activity unit was defined as the amount of enzyme required for catalyzing the degradation of thifensulfuron-methyl (metsulfuron-methyl, chlorimuron-ethyl, bensulfuron-methyl, sulfometuron-methyl or tribenuron-methyl) at pH 7.0, at a temperature of 30° C. within 1 min to decrease 1 μmol of thifensulfuron-methyl (metsulfuron-methyl, chlorimuron-ethyl, bensulfuron-methyl, sulfometuron-methyl or tribenuron-methyl), which is expressed as U. Experimental results were shown in Table 1.
TABLE-US-00006 TABLE 1 Experimental results of degradation of sulfonylurea herbicides by herbicide tolerant proteins specific enzyme activity tribenuron- bensulfuron- thifensulfuron- metsulfuron- chlorimuron- sulfometuron- (μmol/min/mg) methyl methyl methyl methyl ethyl methyl ALT01 1.8 1.7 27.4 2.0 2.7 1.9 ALT01M1 3.1 3.9 89.9 2.2 10.4 5.4 ALT01M2 10.8 2.4 106.0 1.2 9.0 3.5 ALT01M3 3.3 0.68 17.8 4.2 38.4 1.1 ALT02 1.9 1.8 28.8 2.1 2.8 2.0 ALT02M1 3.3 4.1 94.4 2.3 10.9 5.7 ALT02M2 11.3 2.5 111.3 1.3 9.5 3.7 ALT02M3 3.5 0.7 18.7 4.4 40.3 1.2 ALT03 1.7 1.6 26.0 1.9 2.6 1.8 ALT03M1 2.9 3.7 85.4 2.1 9.9 5.1 ALT03M2 10.3 2.3 100.7 1.1 8.6 3.3 ALT03M3 3.1 0.6 16.9 4.0 36.5 1.0 ALT04 1.6 1.5 24.7 1.8 2.4 1.7 ALT04M1 2.8 3.5 80.9 2.0 9.4 4.9 ALT04M2 9.7 2.2 95.4 1.1 8.1 3.2 ALT04M3 3.0 0.6 16.0 3.8 34.6 1.0
[0181] The above experimental results indicate that compared with the herbicide tolerant protein ALT01, the purified herbicide tolerant protein ALT01M1 degrades tribenuron-methyl, bensulfuron-methyl and thifensulfuron-methyl at efficiencies that are 1.7, 2.3 and 3.3-fold of those of ALT01 respectively; the purified herbicide tolerant protein ALT01M2 degrades tribenuron-methyl, bensulfuron-methyl and thifensulfuron-methyl at efficiencies that are 6.0, 1.4 and 3.9-fold of those of ALT01 respectively; the purified herbicide tolerant protein ALT01M3 degrades tribenuron-methyl, metsulfuron-methyl and chlorimuron-ethyl at efficiencies that are 1.9, 2.1 and 14.2-fold of those of ALT01 respectively.
[0182] Compared with the herbicide tolerant protein ALT02, the purified herbicide tolerant protein ALT02M1 degrades tribenuron-methyl, bensulfuron-methyl and thifensulfuron-methyl at efficiencies that are 1.7, 2.3 and 3.3-fold of those of ALT02 respectively; the purified herbicide tolerant protein ALT02M2 degrades tribenuron-methyl, bensulfuron-methyl and thifensulfuron-methyl at efficiencies that are 5.9, 1.4 and 3.9-fold of those of ALT02 respectively; the purified herbicide tolerant protein ALT02M3 degrades tribenuron-methyl, metsulfuron-methyl and chlorimuron-ethyl at efficiencies that are 1.8, 2.1 and 14.2-fold of those of ALT02 respectively.
[0183] Compared with the herbicide tolerant protein ALT03, the purified herbicide tolerant protein ALT03M1 degrades tribenuron-methyl, bensulfuron-methyl and thifensulfuron-methyl at efficiencies that are 1.5, 2.1 and 3.0-fold of those of ALT03 respectively; the purified herbicide tolerant protein ALT03M2 degrades tribenuron-methyl, bensulfuron-methyl and thifensulfuron-methyl at efficiencies that are 5.4, 1.3 and 3.5-fold of those of ALT03 respectively; the purified herbicide tolerant protein ALT03M3 degrades tribenuron-methyl, metsulfuron-methyl and chlorimuron-ethyl at efficiencies that are 1.6, 1.9 and 13.0-fold of those of ALT03 respectively.
[0184] Compared with the herbicide tolerant protein ALT04, the purified herbicide tolerant protein ALT04M1 degrades tribenuron-methyl, bensulfuron-methyl and thifensulfuron-methyl at efficiencies that are 1.5, 1.9 and 2.8-fold of those of ALT04 respectively; the purified herbicide tolerant protein ALT04M2 degrades tribenuron-methyl, bensulfuron-methyl and thifensulfuron-methyl at efficiencies that are 5.1, 1.2 and 3.3-fold of those of ALT04 respectively; the purified herbicide tolerant protein ALT03M3 degrades tribenuron-methyl, metsulfuron-methyl and chlorimuron-ethyl at efficiencies that are 1.6, 1.8 and 12.4-fold of those of ALT04 respectively.
[0185] It thus can be seen that, in the amino acid sequence of the herbicide tolerant protein ALT01, mutation at position 176 from glycine to alanine and/or mutation at position 178 position from serine to valine both can enhance the ability of mutant genes (such as the ALT01M1, ALT01M2 or ALT01M3 gene) to degrade sulfonylurea herbicides, especially tribenuron-methyl. In the amino acid sequence of the herbicide tolerant protein ALT02 (or ALT03), mutation at position 140 from glycine to alanine and/or mutation at position 142 from serine to valine both can enhance the ability of mutant genes (such as the ALT02M1, ALT02M2, ALT02M3, ALT03M1, ALT03M2 or ALT03M3 gene) to degrade sulfonylurea herbicides, especially tribenuron-methyl. In the amino acid sequence of the herbicide tolerant protein ALT04, mutation at position 131 from glycine to alanine and/or mutation at position 133 from serine to valine both can enhance the ability of mutant genes (such as the ALT04M1, ALT04M2 or ALT04M3 gene) to degrade sulfonylurea herbicides, especially tribenuron-methyl.
Example 4. Construction of Recombinant Expression Vectors for Soybean
[0186] 1. Construction of Recombinant Cloning Vectors Containing ALT02M1-01 Nucleotide Sequence for Soybean
[0187] The ALT02M1-01 nucleotide sequence was ligated into cloning vector pGEM-T (Promega, Madison, USA, CAT: A3600) according to the operational procedure in the instructions of product pGEM-T vector of Promega Corporation, thereby obtaining a recombinant cloning vector DBN01-T, the construction process of which was as shown in
[0188] Then, Escherichia coli T1 competent cells (Transgen, Beijing, China, CAT: CD501) were transformed with the recombinant cloning vector DBN01-T using the heat shock method under the following heat shock conditions: maintaining 50 μL of Escherichia coli T1 competent cells and 10 μL of plasmid DNA (recombinant cloning vector DBN01-T) in water bath at 42° C. for 30 seconds; shake culturing at 37° C. for 1 hour (using a shaker at a rotation speed of 100 rpm for shaking); and growing on an LB plate (10 g/L of tryptone, 5 g/L of yeast extract, 10 g/L of NaCl, and 15 g/L of agar, with a pH adjusted to 7.5 with NaOH) of ampicillin (100 mg/L) having its surface coated with IPTG (isopropylthio-β-D-galactoside) and X-gal (5-bromo-4-chloro-3-indole-β-D-galactoside) overnight. White colonies were picked out and cultured in an LB liquid culture medium (10 g/L of tryptone, 5 g/L of yeast extract, 10 g/L of NaCl, and 100 mg/L of ampicillin, with a pH adjusted to 7.5 with NaOH) at a temperature of 37° C. overnight. The plasmids in the cells were extracted through an alkaline method: centrifuging the bacteria solution at a rotation speed of 12000 rpm for 1 min, removing the supernatant, and suspending the precipitated thalli with 100 μL of ice pre-cooled solution I (25 mM Tris-HCl, 10 mM EDTA (ethylenediaminetetraacetic acid), and 50 mM glucose, with a pH of 8.0); adding 200 μL of newly formulated solution II (0.2M NaOH, 1% SDS (sodium dodecyl sulfate)), inverting the tube 4 times, and mixing and placing on ice for 3-5 min; adding 150 μL of ice-cold solution III (3 M potassium acetate, 5 M acetic acid), mixing uniformly immediately and placing on ice for 5-10 min; centrifuging under the conditions of a temperature of 4° C. and a rotation speed of 12000 rpm for 5 min, adding 2-fold volumes of anhydrous ethanol to the supernatant and placing at room temperature for 5 min after mixing uniformly; centrifuging under the conditions of a temperature of 4° C. and a rotation speed of 12000 rpm for 5 min, discarding the supernatant, and air drying the precipitate after washing with ethanol at a concentration of 70% (V/V); adding 30 μL of TE (10 mM Tris-HCl, and 1 mM EDTA, with a pH of 8.0) containing RNase (20 μg/mL) to dissolve the precipitate; water bathing at a temperature of 37° C. for 30 min to digest the RNA; and storing at a temperature of −20° C. for use.
[0189] After identifying the extracted plasmid by SpeI and KasI digestion, positive clones were verified by sequencing. The results showed that the inserted ALT02M1-01 nucleotide sequence in the recombinant cloning vector DBN01-T was the nucleotide sequence as shown in SEQ ID NO: 25 in the sequence listing, that is, the ALT02M1-01 nucleotide sequence was inserted correctly.
[0190] 2. Construction of Recombinant Expression Vectors Containing ALT02M1-01 Nucleotide Sequence for Soybean
[0191] The recombinant cloning vector DBN01-T and an expression vector DBNBC-01 (vector backbone: pCAMBIA2301 (which can be provided by the CAMBIA institution)) were both digested with restriction enzymes SpeI and KasI respectively; the excised ALT02M1-01 nucleotide sequence fragment was inserted between the SpeI and KasI sites in the expression vector DBNBC-01; and it is well known to a person skilled in the art to construct a vector using conventional enzyme digestion methods, wherein a recombinant expression vector DBN100825 was constructed, the construction process of which was as shown in
[0192] Escherichia coli T1 competent cells were transformed with the recombinant expression vector DBN100825 by a heat shock method under the following heat shock conditions: maintaining 50 μL of Escherichia coli T1 competent cells and 10 μL of plasmid DNA (recombinant expression vector DBN100825) in water bath at 42° C. for 30 seconds; shake culturing at 37° C. for 1 hour (using a shaker at a rotation speed of 100 rpm for shaking); then culturing under the condition of a temperature of 37° C. on an LB solid plate containing 50 mg/L of spectinomycin (10 g/L of tryptone, 5 g/L of yeast extract, 10 g/L of NaCl, and 15 g/L of agar, with a pH adjusted to 7.5 with NaOH) for 12 hours, picking white colonies, and culturing under the condition of a temperature of 37° C. overnight in an LB liquid culture medium (10 g/L of tryptone, 5 g/L of yeast extract, 10 g/L of NaCl, and 50 mg/L of spectinomycin, with a pH adjusted to 7.5 with NaOH). The plasmids in the cells were extracted through the alkaline method. The extracted plasmid was identified after digesting with restriction enzymes SpeI and KasI, and positive clones were identified by sequencing. The results showed that the nucleotide sequence between the SpeI and KasI sites in the recombinant expression vector DBN100825 was the nucleotide sequence as shown in SEQ ID NO: 25 in the sequence listing, i.e., the ALT02M1-01 nucleotide sequence.
[0193] The recombinant expression vector DBN100826 containing ALT02M2-01 nucleotide sequence, the recombinant expression vector DBN100827 containing ALT02M3-01 nucleotide sequence, and the recombinant expression vector DBN100828 containing ALT02-01 nucleotide sequence were constructed according to the method for constructing the recombinant expression vector DBN100825 containing ALT02M1-01 nucleotide sequence as described above. Positive clones were verified by sequencing, with the results showing that ALT02M2-01 nucleotide sequence, ALT02M3-01 nucleotide sequence and ALT02-01 nucleotide sequence inserted into the recombinant expression vectors DBN100825, DBN100826, DBN100827 and DBN100828 were the nucleotide sequences as shown in SEQ ID NO: 29, SEQ ID NO: 33 and SEQ ID NO: 21 in the sequence listing respectively, namely ALT02M2-01 nucleotide sequence, ALT02M3-01 nucleotide sequence and ALT02-01 nucleotide sequence were inserted correctly.
[0194] According to the method for constructing the recombinant expression vector DBN100825 containing ALT02M1-01 nucleotide sequence as described above, a control recombinant expression vector DBN100828N was constructed, the structure of which is as shown in
[0195] 3. Transformation of Agrobacterium with the Recombinant Expression Vectors
[0196] Agrobacterium LBA4404 (Invitrogen, Chicago, USA, CAT: 18313-015) was transformed with the recombinant expression vectors DBN100825, DBN100826, DBN100827, DBN100828, and DBN100828N which had been constructed correctly using a liquid nitrogen method, under the following transformation conditions: placing 100 μL of Agrobacterium LBA4404 and 3 μL of plasmid DNA (recombinant expression vector) in liquid nitrogen for 10 minutes, and warm water bathing at 37° C. for 10 minutes; inoculating the transformed Agrobacterium LBA4404 into an LB tube, culturing under the conditions of a temperature of 28° C. and a rotation speed of 200 rpm for 2 hours, spreading on an LB plate containing 50 mg/L of rifampicin and 50 mg/L of spectinomycin until positive single clones were grown, picking out single clones for culturing and extracting the plasmids thereof, and performing enzyme digestion verification using restriction enzymes. The results showed that the structures of the recombinant expression vectors DBN100825, DBN100826, DBN100827, DBN100828, and DBN100828N were completely correct.
Example 5. Acquisition and Verification of Transgenic Soybean Plants
[0197] 1. Acquisition of Transgenic Soybean Plants
[0198] According to the Agrobacterium infection method conventionally used, the cotyledonary node tissue of sterilely cultured soybean variety Zhonghuang13 was co-cultured with the Agrobacterium in part 3 of Example 4, so as to introduce the T-DNA (including the Arabidopsis thaliana Ubiquitin10 gene promoter sequence, the ALT02M1-01 nucleotide sequence, the ALT02M2-01 nucleotide sequence, the ALT02M3-01 nucleotide sequence, the ALT02-01 nucleotide sequence, the tNos terminator, the rape eukaryotic elongation factor gene 1α promoter, the Arabidopsis thaliana chloroplast transit peptide, a 5-enolpyruvylshikimate-3 phosphate synthase gene, and the pea RbcS gene terminator) in the recombinant expression vectors DBN100825, DBN100826, DBN100827, DBN100828, and DBN100828N constructed in Part 2 of Example 4 into the soybean chromosome sets, thereby obtaining soybean plants into which the ALT02M1-01 nucleotide sequence was introduced, soybean plants into which the ALT02M2-01 nucleotide sequence was introduced, soybean plants into which the ALT02M3-01 nucleotide sequence was introduced, and soybean plants into which the ALT02-01 nucleotide sequence was introduced; meanwhile, control soybean plants into which T-DNA in a control recombinant expression vector DBN100828N was introduced and wild-type soybean plants were used as the control.
[0199] As regards the Agrobacterium-mediated soybean transformation, briefly, mature soybean seeds were germinated in a soybean germination culture medium (3.1 g/L of B5 salt, B5 vitamin, 20 g/L of sucrose, and 8 g/L of agar, with a pH of 5.6), and the seeds were inoculated on a germination culture medium and cultured under the conditions of a temperature of 25±1° C.; and a photoperiod (light/dark) of 16 h/8 h. After 4-6 days of germination, soybean sterile seedlings swelling at bright green cotyledonary nodes were taken, hypocotyledonary axes were cut off 3-4 mm below the cotyledonary nodes, the cotyledons were cut longitudinally, and apical buds, lateral buds and seminal roots were removed. A wound was made at a cotyledonary node using the knife back of a scalpel, and the wounded cotyledonary node tissues were contacted with an Agrobacterium suspension, wherein the Agrobacterium can transfer the ALT02M1-01 nucleotide sequence (ALT02M2-01 nucleotide sequence, ALT02M3-01 nucleotide sequence or ALT02-01 nucleotide sequence) to the wounded cotyledonary node tissues (step 1: the infection step). In this step, the cotyledonary node tissues were preferably immersed in the Agrobacterium suspension (OD.sub.660=0.5-0.8, an infection culture medium (2.15 g/L of MS salt, B5 vitamin, 20 g/L of sucrose, 10 g/L of glucose, 40 mg/L of acetosyringone (AS), 4 g/L of 2-morpholine ethanesulfonic acid (MES), and 2 mg/L of zeatin (ZT), with a pH of 5.3)) to initiate the inoculation. The cotyledonary node tissues were co-cultured with Agrobacterium for a period of time (3 days) (step 2: the co-culturing step). Preferably, the cotyledonary node tissues were cultured in a solid culture medium (4.3 g/L of MS salt, B5 vitamin, 20 g/L of sucrose, 10 g/L of glucose, 4 g/L of MES, 2 mg/L of ZT, and 8 g/L of agar, with a pH of 5.6) after the infection step. After this co-culturing stage, there can be an optional “recovery” step. In the “recovery” step, there may be at least one antibiotic (cephalosporin) known to inhibit the growth of Agrobacterium in a recovery culture medium (3.1 g/L of B5 salt, B5 vitamin, 1 g/L of MES, 30 g/L of sucrose, 2 mg/L of ZT, 8 g/L of agar, 150 mg/L of cephalosporin, 100 mg/L of glutamic acid, and 100 mg/L of aspartic acid, with a pH of 5.6), without the addition of a selective agent for a plant transformant (step 3: the recovery step). Preferably, tissue blocks regenerated from the cotyledonary nodes were cultured in a solid culture medium with an antibiotic, but without a selective agent, to eliminate Agrobacterium and provide a recovery stage for the infected cells. Subsequently, the tissue blocks regenerated from the cotyledonary nodes were cultured in a culture medium containing a selective agent (glyphosate), and growing transformed calli were selected (step 4: the selection step). Preferably, the tissue blocks regenerated from the cotyledonary nodes were cultured in a screening solid culture medium (3.1 g/L of B5 salt, B5 vitamin, 1 g/L of MES, 30 g/L of sucrose, 1 mg/L of 6-benzyladenine (6-BAP), 8 g/L of agar, 150 mg/L of cephalosporin, 100 mg/L of glutamic acid, 100 mg/L of aspartic acid, and 0.25 mol/L of N-(phosphonomethyl)glycine, with a pH of 5.6) containing a selective agent, thus resulting in selective growth of the transformed cells. Then, plants were regenerated from the transformed cells (step 5: the regeneration step). Preferably, the tissue blocks regenerated from the cotyledonary nodes grown in a culture medium containing a selective agent were cultured in solid culture media (a B5 differentiation culture medium and B5 rooting culture medium) to regenerate plants.
[0200] The resistant tissue blocks obtained from screening were transferred onto the B5 differentiation culture medium (3.1 g/L of B5 salt, B5 vitamin, 1 g/L of MES, 30 g/L of sucrose, 1 mg/L of ZT, 8 g/L of agar, 150 mg/L of cephalosporin, 50 mg/L of glutamic acid, 50 mg/L of aspartic acid, 1 mg/L of gibberellin, 1 mg/L of auxin, and 0.25 mol/L of N-(phosphonomethyl)glycine, with a pH of 5.6), and cultured at 25° C. for differentiation. The differentiated seedlings were transferred onto the B5 rooting culture medium (3.1 g/L of B5 salt, B5 vitamin, 1 g/L of MES, 30 g/L of sucrose, 8 g/L of agar, 150 mg/L of cephalosporin, and 1 mg/L of indole-3-butyric acid (IBA)), cultured in the rooting culture medium until reaching a height of about 10 cm at 25° C., and transferred to a greenhouse for culturing until fruiting. In the greenhouse, the plants were cultured at 26° C. for 16 hours, and then cultured at 20° C. for 8 hours every day.
[0201] 2. Verification of the Transgenic Soybean Plants Using TaqMan
[0202] About 100 mg of leaves from the soybean plants into which the ALT02M1-01 nucleotide sequence was introduced, the soybean plants into which the ALT02M2-01 nucleotide sequence was introduced, the soybean plants into which the ALT02M3-01 nucleotide sequence was introduced, the soybean plants into which the ALT02-01 nucleotide sequence was introduced and control soybean plants respectively were taken as samples, and the genomic DNA thereof was extracted with a DNeasy Plant Maxi Kit of Qiagen, and copy numbers of an EPSPS gene were detected by the Taqman probe fluorescence quantitative PCR method so as to determine the copy numbers of the genes of interest. At the same time, wild-type soybean plants were used as controls, and detected and analyzed according to the above-mentioned method. Triple repeats were set for the experiments, and were averaged.
[0203] The specific method for detecting the copy number of the EPSPS gene was as follows:
[0204] Step 21. 100 mg of leaves from the soybean plants into which the ALT02M1-01 nucleotide sequence was introduced, soybean plants into which the ALT02M2-01 nucleotide sequence was introduced, soybean plants into which the ALT02M3-01 nucleotide sequence was introduced and soybean plants into which the ALT02-01 nucleotide sequence was introduced, control soybean plants and wild-type soybean plants respectively were taken, and ground into a homogenate using liquid nitrogen in a mortar respectively, and triple repeats were taken for each sample;
[0205] Step 22. The genomic DNA of the above-mentioned samples was extracted using a DNeasy Plant Mini Kit of Qiagen (for the particular method, refer to the product instructions thereof);
[0206] Step 23. The concentrations of the genomic DNA of the above-mentioned samples were detected using NanoDrop 2000 (Thermo Scientific);
[0207] Step 24. The concentrations of the genomic DNA of the above-mentioned samples were adjusted to a consistent concentration value which ranges from 80 to 100 ng/μL;
[0208] Step 25. The copy numbers of the samples were identified using the Taqman probe fluorescence quantitative PCR method, wherein samples for which the copy numbers had been identified and known were taken as standards, the samples of the wild-type soybean plants were taken as the control, and triple repeats were taken for each sample, and were averaged; the sequences of fluorescence quantitative PCR primers and a probe were as follows:
[0209] The following primers and probe were used to detect the EPSPS gene sequence:
TABLE-US-00007 primer 5: CTGGAAGGCGAGGACGTCATCAATA as shown in SEQ ID NO: 75 in the sequence listing; primer 6: TGGCGGCATTGCCGAAATCGAG as shown in SEQ ID NO: 76 in the sequence listing; probe 1: ATGCAGGCGATGGGCGCCCGCATCCGTA as shown in SEQ ID NO: 77 in the sequence listing;
[0210] PCR Reaction System:
TABLE-US-00008 JumpStart ™ Taq ReadyMix ™ (Sigma) 10 μL 50 × primer/probe mixture 1 μL genomic DNA 3 μL water (ddH.sub.2O) 6 μL
[0211] The 50×primer/probe mixture comprises 45 μL of each primer at a concentration of 1 mM, 50 μL of the probe at a concentration of 100 μM, and 860 μL of 1×TE buffer, and was stored at 4° C. in an amber tube.
[0212] PCR Reaction Conditions:
TABLE-US-00009 Step temperature time 31 95° C. 5 min 32 95° C. 30 s 33 60° C. 1 min 34 back to step 32, repeated 40 times
[0213] Data was analyzed using software SDS2.3 (Applied Biosystems).
[0214] It was further demonstrated, by analyzing the experimental results of the copy number of the EPSPS gene, that the ALT02M1-01 nucleotide sequence, the ALT02M2-01 nucleotide sequence, the ALT02M3-01 nucleotide sequence and the ALT02-01 nucleotide sequence had all been integrated into the chromosome set of the detected soybean plants, and all of the soybean plants into which the ALT02M1-01 nucleotide sequence was introduced, soybean plants into which the ALT02M2-01 nucleotide sequence was introduced, soybean plants into which the ALT02M3-01 nucleotide sequence was introduced and soybean plants into which the ALT02-01 nucleotide sequence was introduced and control soybean plants resulted in single-copy transgenic soybean plants.
Example 6. Detection of Herbicide Tolerance Effects of the Transgenic Soybean Plants
[0215] The effect of herbicide tolerance to tribenuron-methyl was detected on the soybean plants into which the ALT02M1-01 nucleotide sequence was introduced, the soybean plants into which the ALT02M2-01 nucleotide sequence was introduced, the soybean plants into which the ALT02M3-01 nucleotide sequence was introduced, the soybean plants into which the ALT02-01 nucleotide sequence was introduced, control soybean plants and wild-type soybean plants (at seedling stage V3-V4), respectively.
[0216] The soybean plants into which the ALT02M1-01 nucleotide sequence was introduced, the soybean plants into which the ALT02M2-01 nucleotide sequence was introduced, the soybean plants into which the ALT02M3-01 nucleotide sequence was introduced, the soybean plants into which the ALT02-01 nucleotide sequence was introduced, control soybean plants and wild-type soybean plants were taken and sprayed with tribenuron-methyl (144 g ai/ha, eight-fold field concentration) or a blank solvent (water), respectively. The degree of damage caused by the herbicide was measured for each plant according to the leaf curl degree and the growth point damage degree 3 days after spraying (3 DAT), 7 days after spraying (7 DAT), 14 days after spraying (14 DAT) and 21 days after spraying (21 DAT): the case where the leaves are flat as untreated plants and the growth points are intact is defined as having a damage degree of 0%; the case where veins are locally browned, new leaves are malformed and plant growth is slow is defined as having a damage degree of 50%; and the case where veins are purple, until the whole plant is dead and the growth points are browned and dry is defined as having a damage degree of 100%. The soybean plants into which the ALT02M1-01 nucleotide sequence was introduced were of three strains in total (S1, S2 and S3), the soybean plants into which the ALT02M2-01 nucleotide sequence was introduced were of three strains in total (S4, S5 and S6), the soybean plants into which the ALT02M3-01 nucleotide sequence was introduced were of three strains in total (S7, S8 and S9), the soybean plants into which the ALT02-01 nucleotide sequence was introduced were of three strains in total (S10, S11 and S12), the control soybean plants were of two strains in total (S13 and S14), and the wild-type soybean plants were of one strain in total (CK1); and 10-15 plants were selected from each strain and tested. The results were as shown in Table 2 and
TABLE-US-00010 TABLE 2 Experimental results of the herbicide tolerance of transgenic soybean T.sub.1 plants Average Average Average Average Soybean damage % damage % damage % damage % Treatment genotypes 3DAT 7DAT 14DAT 21DAT Blank S1 0 0 0 0 solvent S2 0 0 0 0 (water) S3 0 0 0 0 S4 0 0 0 0 S5 0 0 0 0 S6 0 0 0 0 S7 0 0 0 0 S8 0 0 0 0 S9 0 0 0 0 S10 0 0 0 0 S11 0 0 0 0 S12 0 0 0 0 S13 0 0 0 0 S14 0 0 0 0 CK1 0 0 0 0 144 g ai/ha S1 15 8 0 0 tribenuron- S2 16 9 0 0 methyl S3 10 3 0 0 (8x Tri.) S4 0 0 0 0 S5 0 0 0 0 S6 0 0 0 0 S7 12 3 0 0 S8 11 2 0 0 S9 10 1 0 0 S10 25 15 5 0 S11 24 14 3 0 S12 30 17 4 0 S13 63 91 100 100 S14 58 95 100 100 CK1 76 87 100 100
[0217] For soybeans, eight-fold field concentration of tribenuron-methyl is an effective dose for high pressure treatment. The results in Table 2 and
Example 7. Construction of Recombinant Expression Vectors for Maize
[0218] 1. Construction of Recombinant Cloning Vectors Containing ALT02M1-02 Nucleotide Sequence for Maize
[0219] The ALT02M1-02 nucleotide sequence was ligated into cloning vector pGEM-T (Promega, Madison, USA, CAT: A3600) according to the operational procedure in the instructions of product pGEM-T vector of Promega Corporation, thereby obtaining a recombinant cloning vector DBN02-T, the construction process of which is as shown in
[0220] According to the method in Part 1 of Example 4, Escherichia coli T.sub.1 competent cells were transformed with the recombinant cloning vector DBN01-T using the heat shock method, and the plasmids in the cells were extracted through the alkaline method. The extracted plasmid was identified after digesting with restriction enzymes SpeI and KasI, and positive clones were identified by sequencing. The results showed that the nucleotide sequence between the SpeI and KasI sites in the recombinant cloning vector DBN02-T was the nucleotide sequence as shown in SEQ ID NO: 26 in the sequence listing, i.e., the ALT02M1-02 nucleotide sequence.
[0221] 2. Construction of Recombinant Expression Vectors Containing ALT02M1-02 Nucleotide Sequence for Maize
[0222] The recombinant cloning vector DBN02-T and an expression vector DBNBC-02 (vector backbone: pCAMBIA2301 (which can be provided by the CAMBIA institution)) were both digested with restriction enzymes SpeI and KasI; the excised ALT02M1-02 nucleotide sequence fragment was inserted between the SpeI and KasI sites in the expression vector DBNBC-02; and it is well known to a person skilled in the art to construct a vector using conventional enzyme digestion methods, wherein a recombinant expression vector DBN100833 was constructed, the construction process of which was as shown in
[0223] According to the method in Part 2 of Example 4, Escherichia coli T.sub.1 competent cells were transformed with the recombinant expression vector DBN100833 using the heat shock method, and the plasmids in the cells were extracted through the alkaline method. The extracted plasmid was identified after digesting with restriction enzymes SpeI and KasI, and positive clones were identified by sequencing. The results showed that the nucleotide sequence between the SpeI and KasI sites in the recombinant expression vector DBN100833 was the nucleotide sequence as shown in SEQ ID NO: 26 in the sequence listing, i.e., the ALT02M1-02 nucleotide sequence.
[0224] The recombinant expression vector DBN100832 containing ALT02M2-02 nucleotide sequence, the recombinant expression vector DBN100831 containing ALT02M3-02 nucleotide sequence, and the recombinant expression vector DBN100830 containing ALT02-02 nucleotide sequence were constructed according to the method for constructing the recombinant expression vector DBN100833 containing ALT02M1-02 nucleotide sequence as described above. Positive clones were verified by sequencing, with the results showing that ALT02M2-02 nucleotide sequence, ALT02M3-02 nucleotide sequence and ALT02-02 nucleotide sequence inserted into the DBN100832, DBN100831 and DBN100830 were the nucleotide sequences as shown in SEQ ID NO: 30, SEQ ID NO: 34 and SEQ ID NO: 22 in the sequence listing respectively, namely ALT02M2-02 nucleotide sequence, ALT02M3-02 nucleotide sequence and ALT02-02 nucleotide sequence were inserted correctly.
[0225] According to the method for constructing the recombinant expression vector DBN100833 containing ALT02M1-02 nucleotide sequence as described above, a control recombinant expression vector DBN100830N was constructed, the structure of which is as shown in
[0226] 3. Transformation of Agrobacterium with the Recombinant Expression Vectors for Maize
[0227] Agrobacterium LBA4404 (Invitrogen, Chicago, USA, CAT: 18313-015) was transformed with the recombinant expression vectors DBN100833, DBN100832, DBN100831, DBN100830, and DBN100830N which had been constructed correctly using a liquid nitrogen method, under the following transformation conditions: placing 100 μL of Agrobacterium LBA4404, and 3 μL of plasmid DNA (recombinant expression vector) in liquid nitrogen for 10 minutes, and warm water bathing at 37° C. for 10 minutes; inoculating the transformed Agrobacterium LBA4404 into an LB tube, culturing under the conditions of a temperature of 28° C. and a rotation speed of 200 rpm for 2 hours, spreading on an LB plate containing 50 mg/L of rifampicin and 50 mg/L of spectinomycin until positive single clones were grown, picking out single clones for culturing and extracting the plasmids thereof, and performing enzyme digestion verification using restriction enzymes. The results showed that the structures of the recombinant expression vectors DBN100833, DBN100832, DBN100831, DBN100830, and DBN100830N were completely correct.
Example 8. Acquisition and Verification of Transgenic Maize Plants
[0228] 1. Acquisition of Transgenic Maize Plants
[0229] According to the conventionally used Agrobacterium infection method, young embryos of sterilely cultured maize variety Zong31 (Z31) were co-cultured with the Agrobacterium in Part 3 of Example 7, so as to introduce T-DNA (including the maize Ubiquitin1 gene promoter sequence, ALT02M1-02 nucleotide sequence, ALT02M2-02 nucleotide sequence, ALT02M3-02 nucleotide sequence and ALT02-02 nucleotide sequence, the PMI gene and the tNos terminator sequence) in the recombinant expression vectors DBN100833, DBN100832, DBN100831, DBN100830, and DBN100830N constructed in Part 2 of Example 7 into the maize chromosome set, thereby obtaining maize plants into which ALT02M1-02 nucleotide sequence was introduced, maize plants into which ALT02M2-02 nucleotide sequence was introduced, maize plants into which ALT02M3-02 nucleotide sequence was introduced and maize plants into which ALT02-02 nucleotide sequence was introduced; meanwhile, the control maize plants into which T-DNA in the control recombinant expression vector DBN100830N was introduced and wild type maize plants were used as the control.
[0230] As regards the Agrobacterium-mediated maize transformation, briefly, immature young embryos were separated from maize, and contacted with an Agrobacterium suspension, wherein the Agrobacterium can transfer the ALT02M1-02 nucleotide sequence (ALT02M2-02 nucleotide sequence, ALT02M3-02 nucleotide sequence or ALT02-02 nucleotide sequence) to at least one cell of one of the young embryos (step 1: the infection step). In this step, the young embryos were preferably immersed in an Agrobacterium suspension (OD.sub.660=0.4-0.6, an infection culture medium (4.3 g/L of MS salt, MS vitamin, 300 mg/L of casein, 68.5 g/L of sucrose, 36 g/L of glucose, 40 mg/L of acetosyringone (AS), and 1 mg/L of 2,4-dichlorphenoxyacetic acid (2,4-D), with a pH of 5.3)) to initiate the inoculation. The young embryos were co-cultured with Agrobacterium for a period of time (3 days) (step 2: the co-culturing step). Preferably, the young embryos were cultured in a solid culture medium (4.3 g/L of MS salt, MS vitamin, 300 mg/L of casein, 20 g/L of sucrose, 10 g/L of glucose, 100 mg/L of acetosyringone (AS), 1 mg/L of 2,4-dichlorphenoxyacetic acid (2,4-D), and 8 g/L of agar, with a pH of 5.8) after the infection step. After this co-culturing stage, there can be an optional “recovery” step. In the “recovery” step, there may be at least one antibiotic (cephalosporin) known to inhibit the growth of Agrobacterium in a recovery culture medium (4.3 g/L of MS salt, MS vitamin, 300 mg/L of casein, 30 g/L of sucrose, 1 mg/L of 2,4-D, and 3 g/L of phytagel, with a pH of 5.8), without the addition of a selective agent for a plant transformant (step 3: the recovery step). Preferably, the young embryos were cultured in a solid culture medium with an antibiotic, but without a selective agent, in order to eliminate Agrobacterium and provide a recovery stage for the infected cells. Subsequently, the inoculated young embryos were cultured in a culture medium containing a selective agent (mannose), and growing transformed calli were selected (step 4: the selection step). Preferably, the young embryos were cultured in a screening solid culture medium (4.3 g/L of MS salt, MS vitamin, 300 mg/L of casein, 30 g/L of sucrose, 12.5 g/L of mannose, 1 mg/L of 2,4-D, and 3 g/L of phytagel, with a pH of 5.8) with a selective agent, resulting in the selective growth of transformed cells. Then, plants were regenerated from the calli (step 5: the regeneration step). Preferably, the calli grown in a culture medium containing a selective agent were cultured in solid culture media (an MS differentiation culture medium and MS rooting culture medium) to regenerate plants.
[0231] Resistant calli obtained from screening were transferred onto the MS differentiation culture medium (4.3 g/L of MS salt, MS vitamin, 300 mg/L of casein, 30 g/L of sucrose, 2 mg/L of 6-benzyladenine, 5 g/L of mannose, and 3 g/L of phytagel, with a pH of 5.8), and cultured at 25° C. for differentiation. The differentiated seedlings were transferred onto the MS rooting culture medium (2.15 g/L of MS salt, MS vitamin, 300 mg/L of casein, 30 g/L of sucrose, 1 mg/L of indole-3-acetic acid, and 3 g/L of phytagel, with a pH of 5.8), cultured at 25° C. to a height of about 10 cm, and transferred to a greenhouse for culturing until fruiting. In the greenhouse, the plants were cultured at 28° C. for 16 hours, and then cultured at 20° C. for 8 hours every day.
[0232] 2. Verification of the Transgenic Maize Plants Using TaqMan
[0233] The maize plant into which the ALT02M1-02 nucleotide sequence was introduced, the maize plant into which the ALT02M2-02 was introduced, the maize plant into which the ALT02M3-02 was introduced, the maize plant into which the ALT02-02 was introduced and the control maize plant were detected and analyzed according to the method for verifying transgenic soybean plants with TaqMan as described in part 2 of Example 5. The copy number of the PMI gene was detected by the Taqman probe fluorescence quantitative PCR method so as to determine the copy number of the target gene. Meanwhile, wild-type maize plants were used as the control, and detected and analyzed according to the above-mentioned method. Triple repeats were set for the experiments, and were averaged.
[0234] The following primers and probe were used to detect the PMI gene sequence:
TABLE-US-00011 primer 7: GCTGTAAGAGCTTACTGAAAAAATTAACA as shown in SEQ ID NO: 80 in the sequence listing; primer 8: CGATCTGCAGGTCGACGG as shown in SEQ ID NO: 81 in the sequence listing; probe 2: TCTCTTGCTAAGCTGGGAGCTCGATCC as shown as SEQ ID NO: 82
in the sequence listing.
[0235] It was further demonstrated, by analyzing the experimental results of the copy number of PMI gene, that the ALT02M1-02 nucleotide sequence, the ALT02M2-02 nucleotide sequence, the ALT02M3-02 nucleotide sequence and the ALT02-02 nucleotide sequence had all been integrated into the chromosome set of the detected maize plants, and all of the maize plants into which the ALT02M1-02 nucleotide sequence was introduced, the maize plants into which the ALT02M2-02 nucleotide sequence was introduced, the maize plants into which the ALT02M3-02 nucleotide sequence was introduced, the maize plants into which the ALT02-02 nucleotide sequence was introduced and control maize plants resulted in single-copy transgenic maize plants.
Example 9. Detection of Herbicide Tolerance Effects of the Transgenic Maize Plants
[0236] The effect of herbicide tolerance to tribenuron-methyl was detected on the maize plants into which the ALT02M1-02 nucleotide sequence was introduced, maize plants into which the ALT02M2-02 nucleotide sequence was introduced, maize plants into which the ALT02M3-02 nucleotide sequence was introduced, maize plants into which the ALT02-02 nucleotide sequence was introduced, control maize plants and wild-type maize plants (at V3-V4 stages) respectively.
[0237] The maize plants into which the ALT02M1-02 nucleotide sequence was introduced, the maize plants into which the ALT02M2-02 nucleotide sequence was introduced, the maize plants into which the ALT02M3-02 nucleotide sequence was introduced, the maize plants into which the ALT02-02 nucleotide sequence was introduced, control maize plants and wild-type maize plants were taken and sprayed with tribenuron-methyl (144 g ai/ha, eight-fold field concentration) or a blank solvent (water), respectively. The degree of damage caused by the herbicide was measured for each plant according to the plant growth status 3 days after spraying (3 DAT), 7 days after spraying (7 DAT), 14 days after spraying (14 DAT) and 21 days after spraying (21 DAT): a growth status equivalent to that of the untreated plants is defined as having a damage degree of 0%; the case where leaves are locally chlorotic and yellow but the normal plant growth is substantially not affected is defined as having a damage degree of 50%; and the case where the whole plant is purple and dying is defined as having a damage degree of 100%. The maize plants into which the ALT02M1-02 nucleotide sequence was introduced were of three strains in total (S15, S16 and S17), the maize plants into which the ALT02M2-02 nucleotide sequence was introduced were of three strains in total (S18, S19 and S20), the maize plants into which the ALT02M3-02 nucleotide sequence was introduced were of three strains in total (S21, S22 and S23), the maize plants into which the ALT02-02 nucleotide sequence was introduced were of three strains in total (S24, S25 and S26), the control maize plants were of two strains in total (S27 and S28), and the wild-type maize plants were of one strain in total (CK2); and 10-15 plants were selected from each strain and tested. The results were as shown in Table 3 and
TABLE-US-00012 TABLE 3 Experimental results of the herbicide tolerance of transgenic maize T.sub.1 plants Average Average Average Average Maize damage % damage % damage % damage % Treatment genotypes 3DAT 7DAT 14DAT 21DAT Blank S15 0 0 0 0 solvent S16 0 0 0 0 (water) S17 0 0 0 0 S18 0 0 0 0 S19 0 0 0 0 S20 0 0 0 0 S21 0 0 0 0 S22 0 0 0 0 S23 0 0 0 0 S24 0 0 0 0 S25 0 0 0 0 S26 0 0 0 0 S27 0 0 0 0 S28 0 0 0 0 CK2 0 0 0 0 144 g ai/ha S15 5 0 0 0 tribenuron- S16 6 0 0 0 methyl S17 3 0 0 0 (8x Tri.) S18 0 0 0 0 S19 0 0 0 0 S20 0 0 0 0 S21 3 0 0 0 S22 2 0 0 0 S23 0 0 0 0 S24 14 5 0 0 S25 15 4 0 0 S26 20 7 0 0 S27 61 82 100 100 S28 53 78 100 100 CK2 46 86 100 100
[0238] For the maize, eight-fold field concentration of tribenuron-methyl is an effective dose for high pressure treatment. The results in Table 3 and
[0239] In conclusion, the herbicide tolerant protein ALT01 of the present invention can exhibit a higher tolerance to sulfonylurea herbicides, particularly tribenuron-methyl when its amino acid sequence is mutated at position 176 from glycine to alanine and/or at position 178 from serine to valine (such as the herbicide tolerant proteins ALT01M1, ALT01M2 or ALT01M3); the herbicide tolerant protein ALT02 (or ALT03) can exhibit a higher tolerance to sulfonylurea herbicides, particularly tribenuron-methyl when its amino acid sequence is mutated at position 140 from glycine to alanine and/or at position 142 from serine to valine (such as the herbicide tolerant proteins ALT02M1, ALT02M2, ALT02M3, ALT03M1, ALT03M2 or ALT03M3); the herbicide tolerant protein ALT04 can exhibit a higher tolerance to sulfonylurea herbicides, particularly tribenuron-methyl when its amino acid sequence is mutated at position 131 from glycine to alanine and/or at position 133 from serine to valine (such as the herbicide tolerant proteins ALT04M1, ALT04M2 or ALT04M3). Moreover, the coding genes of the above-mentioned herbicide tolerant proteins are particularly suitable for expression in plants due to the use of the preferred codons of plants. The soybean and maize plants into which the above-mentioned herbicide tolerant proteins are introduced have a strong tolerance to sulfonylurea herbicides, and can tolerate tribenuron-methyl of an eight-fold field concentration particularly. Therefore, the above-mentioned herbicide tolerant proteins have a broad application prospect in plants.
[0240] Finally, it should be stated that the above examples are merely used for illustrating, rather than limiting, the technical solution of the present invention; and although the present invention has been described in detail with reference to the preferred examples, a person skilled in the art should understand that modifications or equivalent substitutions may be made to the technical solution of the present invention without departing from the spirit and scope of the technical solution of the present invention.