Method For The Determination Of The Fingerprint In Varieties Of Cannabis

20210325411 · 2021-10-21

Assignee

Inventors

Cpc classification

International classification

Abstract

Method of obtaining a fingerprint from Cannabis samples comprising the following steps: determination of the genetic profile by analysis of at least one STR marker, obtaining the chemical profile by NMR, and differentiation of cannabis varieties from each other by comparing the results obtained in steps (a) and (b) on each sample with each other and/or with previously obtained fingerprint databases.

Claims

1. Method of obtaining a fingerprint of cannabis samples that comprises the following steps: a) determination of the genetic profile by the analysis of at least one STR marker, b) obtaining the chemical profile by means of NMR; and c) differentiation of cannabis varieties from each other by comparing the results obtained in steps (a) and (b) for each sample with each other and/or with databases of previously obtained fingerprints.

2. Method according to claim 1, wherein the STR marker is selected from: D02, C11, H09, B01, E07, 305, 308, B05, H06, 501, CS1, 302, 301, B02, H11 and combinations thereof.

3. Method according to claim 1, that further comprises the following stages: extraction and quantification of DNA from the plant sample, and amplification of the selected STR by individual PCRs or multiplexed PCRs and analysis of the PCR results.

4. Method according to claim 3, wherein the results of: individual PCRs are analyzed by agarose gels, and multiplexed PCR is analyzed by capillary electrophoresis.

5. Method according to claim 1, that further comprises the detection of the presence of the Rubisco gene in cannabis samples prior to the determination of the genetic profile by STR marker analysis to confirm that the sample is a plant sample.

6. Method according to claim 1, wherein step b) comprises obtaining the 1H and 13C spectra of the cannabis sample.

7. Method according to claim 1, wherein obtaining the NMR chemical profile comprises the following steps: extraction, dissolution in deuterated solvent, obtaining and analyzing the 1H and 13C spectra.

8. Method according to claim 7, wherein the sample extraction is performed with a solvent selected from among: an alcohol from 1 to 6 carbons, one alkane from 1 to 6 carbons and an alkane halide derivative, for a period of time of 8 to 24 hours and a temperature between 15 and 30° C.

9. Method according to claim 7, wherein the deuterated solvent is selected from the deuterated variants of: chloroform, acetone, methanol, benzene, heavy water, dimethyl sulfoxide, dichloromethane, trifluoroacetic acid, acetonitrile, pyridine, N,N-dimethylformamide and tetrahydrofuran.

10. Method according to claim 7, wherein the 13C-NMR spectrum analysis comprises at least 40 frequencies (ppm) of peaks associated with metabolites present in the sample.

11. Method according to claim 1, wherein the cannabis sample is selected from Cannabis sativa L., sativa and indica subspecies, sativa variety, Vavilov spontaneous variety; indica (Lam.) variety, kafiristanica (Vavilov) variety and combinations thereof.

12. Method according to claim 1, wherein the cannabis sample of the plant is selected from leaves, stem, bulb, seeds and flowers.

13. Method according to claim 1, wherein the sample amount used to obtain the fingerprint is from 0.1 to 10 g.

14. Database that comprises the fingerprints of cannabis samples obtained by the method described in claim 1.

Description

BRIEF DESCRIPTION OF THE FIGURES

[0083] FIG. 1: Agarose gel showing the amplified Rubisco gene fragment from sample No 680 in triplicate, “M” being a molecular weight marker, “607” a positive control and “C-” a negative control.

[0084] FIG. 2: Screenshot of the Rubisco gene nucleotide sequence comparison results obtained from the cannabis sample No 680 with the NCBI (National Center for Biotechnology Information) database. At the bottom it is noted that the results obtained are from the Cannabis genome.

[0085] FIG. 3: Electropherogram of the STR D02 marker alleles in the 5 cannabis samples analyzed. FIG. 3A: Sample No 680; FIG. 3B: Sample No 681; FIG. 3C: Sample No 682; FIG. 3D: Sample No 683; FIG. 3E: Sample No 684.

[0086] FIG. 4: Electropherogram of the STR C11 marker alleles in the 5 cannabis samples analyzed. FIG. 4A: Sample No 680; FIG. 4B: Sample No 681; FIG. 4C: Sample No 682; FIG. 4D: Sample No 683; FIG. 4E: Sample No 684.

[0087] FIG. 5: Electropherogram of the STR H09 marker alleles in the 5 cannabis samples analyzed. FIG. 5A: Sample No 680; FIG. 5B: Sample No 681; FIG. 5C: Sample No 682; FIG. 5D: Sample No 683; FIG. 5E: Sample No 684.

[0088] FIG. 6: Electropherogram of the STR B01 marker alleles in the 5 cannabis samples analyzed. FIG. 6A: Sample No 680; FIG. 6B: Sample No 681; FIG. 6C: Sample No 682; FIG. 6D: Sample No 683; FIG. 6E: Sample No 684.

[0089] FIG. 7: Electropherogram of the STR E07 marker alleles in the 5 cannabis samples analyzed. FIG. 7A: Sample No 680; FIG. 7B: Sample No 681; FIG. 7C: Sample No 682; FIG. 7D: Sample No 683; FIG. 7E: Sample No 684.

[0090] FIG. 8: Electropherogram of the STR 305 marker alleles in the 5 cannabis samples analyzed. FIG. 8A: Sample No 680; FIG. 8B: Sample No 681; FIG. 8C: Sample No 682; FIG. 8D: Sample No 683; FIG. 8E: Sample No 684.

[0091] FIG. 9: Electropherogram of the STR 308 marker alleles in the 5 cannabis samples analyzed. FIG. 9A: Sample No 680; FIG. 9B: Sample No 681; FIG. 9C: Sample No 682; FIG. 9D: Sample No 683; FIG. 9E: Sample No 684.

[0092] FIG. 10: Electropherogram of the STR B05 marker alleles in the 5 cannabis samples analyzed. FIG. 10A: Sample No 680; FIG. 10B: Sample No 681; FIG. 10C: Sample No 682; FIG. 10D: Sample No 683; FIG. 10E: Sample No 684.

[0093] FIG. 11: Electropherogram of the STR H06 marker alleles in the 5 cannabis samples analyzed. FIG. 11A: Sample No 680; FIG. 11B: Sample No 681; FIG. 11C: Sample No 682; FIG. 11D: Sample No 683; FIG. 11E: Sample No 684.

[0094] FIG. 12: Electropherogram of the STR 501 marker alleles in the 5 cannabis samples analyzed. FIG. 12A: Sample No 680; FIG. 12B: Sample No 681; FIG. 12C: Sample No 682; FIG. 12D: Sample No 683; FIG. 12E: Sample No 684.

[0095] FIG. 13: Electropherogram of the STR CS1 marker alleles in the 5 cannabis samples analyzed. FIG. 13A: Sample No 680; FIG. 13B: Sample No 681; FIG. 13C: Sample No 682; FIG. 13D: Sample No 683; FIG. 13E: Sample No 684.

[0096] FIG. 14: Electropherogram of the STR 302 marker alleles in the 5 cannabis samples analyzed. FIG. 14A: Sample No 680; FIG. 14B: Sample No 681; FIG. 14C: Sample No 682; FIG. 14D: Sample No 683; FIG. 14E: Sample No 684.

[0097] FIG. 15: Electropherogram of the STR 301 marker alleles in the 5 cannabis samples analyzed. FIG. 15A: Sample No 680; FIG. 15B: Sample No 681; FIG. 15C: Sample No 682; FIG. 15D: Sample No 683; FIG. 15E: Sample No 684.

[0098] FIG. 16: .sup.1H NMR spectrum of cannabis sample No 680.

[0099] FIG. 17: .sup.13C NMR spectrum of cannabis sample No 680 (top image), magnification of a region of the spectrum (lower image).

[0100] FIG. 18: .sup.1H NMR spectrum of cannabis sample No 681.

[0101] FIG. 19: .sup.13C NMR spectrum of cannabis sample No 681 (top part), magnification of a region of the spectrum (bottom part).

[0102] FIG. 20: .sup.1H NMR spectrum of cannabis sample No 682.

[0103] FIG. 21: .sup.13C NMR spectrum of cannabis sample No 682.

[0104] FIG. 22: .sup.1H NMR spectrum of cannabis sample No 683.

[0105] FIG. 23: .sup.13C NMR spectrum of cannabis sample No 683.

[0106] FIG. 24: .sup.1H NMR spectrum of cannabis sample No 684.

[0107] FIG. 25: .sup.13C NMR spectrum of cannabis sample No 681 (top part), magnification of a region of the spectrum (bottom part).

EXAMPLES

[0108] The analyses carried out have been made with leaf samples from 5 Cannabis sativa L varieties as shown in Table 2.

TABLE-US-00002 TABLE 2 Samples used in the experiments SAMPLE NUMBER AMOUNT/UNIT 680 1.6 g × 4 Units 681 1.4 g × 3 Units 682 1.7 g × 3 Units 683 .sup. 7 g × 1 Units 684 1.5 g × 3 Units

[0109] Molecular Analysis of DNA Markers

[0110] DNA Extraction

[0111] For the genetic sequencing analysis, the samples were kept frozen at a temperature of −20° C. from reception until the analysis. The sample is then cut into small portions using sterile blades and homogenized with liquid nitrogen. DNA extraction has been carried out using the method of cethylmethylammonium bromide (CTAB) in water on the samples, following a manual and standard forensic extraction method.sup.18. The main steps are described below:

[0112] The sample is ground with liquid nitrogen in a mortar to obtain a fine powder. Then, 300 μl of extraction buffer (0.1 mM EDTA, 10 mM Tris-HCl pH 7.5) with 0.2% beta-mercaptoethanol are added. The resulting product is mixed and incubated for 1 hour at 60° C. in a shaker. Then, 300 μl of isoamyl alcohol chloroform (24:1) are added and mixed by inversion. Centrifugation for 10 minutes at 14500 rpm is carried out and transfer of the aqueous phase into a clean tube, to which 1 volume (about 200 μl) of isopropanol is added, mixed by inversion and the samples are incubated for 10 minutes at room temperature. Then centrifugation of the tubes for 10 minutes at 10000 rpm is carried out, discarding the supernatant, washing the pellet obtained with 300 μl 70% ethanol and centrifugation of the tubes for 5 minutes at 10000 rpm, discarding the supernatant again and allowing the pellet to dry. Finally, the sample is redissolved in 50 μl of double-distilled, nuclease free water and the purified DNA is quantified.

[0113] DNA quantification and quality analysis (A280/230 and A230/A260) were obtained by a spectrophotometric method, using the NanoVue spectrophotometer. Each sample was analyzed in triplicate.

[0114] Sequencing the Rubisco Gene

[0115] The genetic confirmation of the species (Barcoding) was obtained by PCR amplification and Sanger sequencing of the Rubisco gene fragment. The sequence obtained was searched in the international GenBank database.

[0116] The amplified Rubisco gene fragment is the one delimited by the design of the primers published in the scientific article by Kress et al..sup.21 The size of the amplification fragment generated with these primers is about 700 base pairs.

[0117] The PCR conditions were as follows: 98° C.-30 seconds, 40 cycles (98° C.-10 seconds; 52° C.-30 seconds; 72° C.-30 seconds), 72° C.-2 minutes.

[0118] The reagents, reaction volume and controls are as follows

[0119] Reagents kit used: New England Biolab (NEB) Q5 High-fidelity DNA polymerase M0491S. [0120] Control samples. External control: DNA extracted from oleander leaf, Nerium Oleander. Negative control: distilled water. [0121] The reaction volumes are shown in Table 3:

TABLE-US-00003 TABLE 3 Reaction volumen per sample Reagents (μl) Water 11.3 PCR buffer 5 Q5 GC (Kit specific) 5 dNTPs 10 mM 0.5 primers 10 μM (each) 1 Q5 High-fidelity Taq 0.2 Total mixed volume per 24 μl reaction Total DNA in the reaction 1-100 ng

[0122] The amplified gene fragment was analyzed in a 2% agarose gel.

[0123] For the analysis of the PCR results an agarose gel (2%) was prepared: Agarose D1 LE (Low EEOO) Cat. No E5000 INtRON biotechonology: 0.7 g. TBE 1× buffer: 35 ml. Sybr safe DNA gel stain. Invitrogen Ref S33102: 3,5 μl. The molecular weight marker used was the Omega M01-02 100 bp DNA ladder. Promega blue/Orange loading buffer 6× Ref: G190A was added to the samples before loading them into the gel. A volume of 3-5 μl of loaded PCR/marker product was loaded into each well. The electrophoresis conditions were 90 Watt for a period of 30-45 min.

[0124] FIG. 1 shows the result obtained from sample 680. The above protocol was repeated for the remaining samples (681-684) with identical results.

[0125] A Sanger sequencing of the samples was additionally performed using the same primers.sup.19. The nucleotide sequences obtained were searched into the NCBI open access database, confirming that the amplified fragment corresponds to the Rubisco gene, FIG. 2.

[0126] Analysis of STR Molecular Markers

[0127] A total of 13 pairs of previously published primers were used.sup.20, 21 for the amplification of the microsatellites detailed in table 4. For capillary electrophoresis, the Forward primer of each pair was marked with a fluorophore for subsequent separation and analysis.sup.21:

TABLE-US-00004 TABLE 4 Primers pairs used in the molecular analysis of DNA markers in cannabis samples STR primer FORWARD (5′-3′) primer REVERSE (5′-3′) fluorophore.sup.21 D02 GGTTGGGATGTTGTTGTTGTG AGAAATCCAAGGTCCTGATGG 6-FAM™ (SEQ ID NO: 1) (SEQ ID NO: 2) C11 GTGGTGGTGATGATGATAATGG TGAATTGGTTACGATGGCG 6-FAM™ (SEQ ID NO: 3) (SEQ ID NO: 4) H09 CGTACAGTGATCGTAGTTGAG ACACATACAGAGAGAGCCC 6-FAM™ (SEQ ID NO: 5) (SEQ ID NO: 6) B01 TGGAGTCAAATGAAAGGGAAC CCATAGCATTATCCCACTCAAG 6-FAM™ (SEQ ID NO: 7) (SEQ ID NO: 8) E07 CAAATGCCACACCACCTTC GTGGTAGCCAGGTATAGGTAG VIC® (SEQ ID NO: 9) (SEQ ID NO: 10) 305 AAAGTTGGTCTGAGAAGCAAT CCTAGGAACTTTCGACAACA VIC® (SEQ ID NO: 11) (SEQ ID NO: 12) 308 AGATGGTGTTGGGTATCTTT TGGTGCAGGTTTATACAATTT VIC® (SEQ ID NO: 13) (SEQ ID NO: 14) B05 TTGATGGTGGTGAAACGGC CCCCAATCTCAATCTCAACCC VIC® (SEQ ID NO: 15) (SEQ ID NO: 16) H06 TGGTTTCAGTGGTCCTCTC ACGTGAGTGATGACACGAG VIC® (SEQ ID NO: 17) (SEQ ID NO: 18) 501 AGCAATAATGGAGTGAGTGAAC AGAGATCAAGAAATTGAGATTCC NED™ (SEQ ID NO: 19) (SEQ ID NO: 20) CS1 AAGCAACTCCAATTCCAGCC TAATGATGAGACGAGTGAGAACG NED™ (SEQ ID NO: 21) (SEQ ID NO: 22) 302 AACATAAACACCAACAACTGC ATGGTTGATGTTTTGATGGT PET™ (SEQ ID NO: 23) (SEQ ID NO: 24) 301 ATATGGTTGAAATCCATTGC TAACAAAGTTTCGTGAGGGT PET™ (SEQ ID NO: 25) (SEQ ID NO: 26) D02 GGTTGGGATGTTGTTGTTGTG AGAAATCCAAGGTCCTGATGG 6-FAM™ (SEQ ID NO: 1) (SEQ ID NO: 2) C11 GTGGTGGTGATGATGATAATGG TGAATTGGTTACGATGGCG 6-FAM™ (SEQ ID NO: 3) (SEQ ID NO: 4) H09 CGTACAGTGATCGTAGTTGAG ACACATACAGAGAGAGCCC 6-FAM™ (SEQ ID NO: 5) (SEQ ID NO: 6) B01 TGGAGTCAAATGAAAGGGAAC CCATAGCATTATCCCACTCAAG 6-FAM™ (SEQ ID NO: 7) (SEQ ID NO: 8) E07 CAAATGCCACACCACCTTC GTGGTAGCCAGGTATAGGTAG VIC® (SEQ ID NO: 9) (SEQ ID NO: 10) 305 AAAGTTGGTCTGAGAAGCAAT CCTAGGAACTTTCGACAACA VIC® (SEQ ID NO: 11) (SEQ ID NO: 12) 308 AGATGGTGTTGGGTATCTTT TGGTGCAGGTTTATACAATTT VIC® (SEQ ID NO: 13) (SEQ ID NO: 14) B05 TTGATGGTGGTGAAACGGC CCCCAATCTCAATCTCAACCC VIC® (SEQ ID NO: 15) (SEQ ID NO: 16) H06 TGGTTTCAGTGGTCCTCTC ACGTGAGTGATGACACGAG VIC® (SEQ ID NO: 17) (SEQ ID NO: 18) 501 AGCAATAATGGAGTGAGTGAAC AGAGATCAAGAAATTGAGATTCC NED™ (SEQ ID NO: 19) (SEQ ID NO: 20) CS1 AAGCAACTCCAATTCCAGCC TAATGATGAGACGAGTGAGAACG NED™ (SEQ ID NO: 21) (SEQ ID NO: 22) 302 AACATAAACACCAACAACTGC ATGGTTGATGTTTTGATGGT PET™ (SEQ ID NO: 23) (SEQ ID NO: 24) 301 ATATGGTTGAAATCCATTGC TAACAAAGTTTCGTGAGGGT PET™ (SEQ ID NO: 25) (SEQ ID NO: 26)
and for the analyses a PCR thermocycler, a gel documenter and a genetic analyser have been used. The genetic method has been developed by amplification of STRs microsatellite markers through multiplexed PCR, using the techniques previously indicated.

[0128] Multiplexed PCR (13 Markers):

[0129] PCR program: 98° C. 30 s; 7 cycles (98° C. 10 s; 61° C. 30 s, 72° C. 30 s); 5 cycles for each temperature (98° C. 10 s; touchdown* ° C., 30 s, 72° C. 30 s); 7 cycles (98° C. 10 s; 51° C. 30 s, 72° C. 30 s); 72° C. 2 min. Touchdown*: 60, 59, 57, 54, 52° C.

[0130] The concentration of primers in each reaction is shown in Table 5:

TABLE-US-00005 TABLE 5 Concentration of primers used in each reaction Marker μM D02 0.08 C11 0.08 H09 0.16 B01 0.09 E07 0.16 305 0.12 308 0.26 B05 0.03 H06 0.07 501 0.1 CS1 0.14 302 0.16 301 0.4

[0131] The reagents, reaction volume and controls are [0132] Reagent kit used: New England Biolab (NEB) Q5 High-fidelity DNA polymerase M0491S. [0133] Negative control sample: distilled water. [0134] The reaction volume is shown in Table 6:

TABLE-US-00006 TABLE 6 Reaction volume Per sample Reagents (μl) Water 10.30 PCR Buffer 5 Q5 GC (Kit specific) 5 dNTPs 10 mM 0.5 primers (mix) 3 Q5 High-fidelity Taq 0.2 Total mixed volume per reaction 24 μl Total DNA in the reaction 25 ng aprox.

[0135] Capillary Electrophoresis and Fragment Analysis

[0136] Fragment separation and detection of PCR products was performed in Genetic Analyzer 3130 (Applied Biosystems).

[0137] 1-2 μL of each PCR product were loaded to a 10 μL mixture (9.5 μl of “Hi-Di Formamide®” and 0.5 μl of the LIZ® 500 molecular weight marker. The samples were denatured 5 minutes at 94° C. before being loaded into the Genetic Analyzer 3130, and run under the following conditions: Oven at 60° C.; prerun 15 kV; injection 1.2 kV, 16 s; run 15 kV, 1200 s; capillary length 36 cm; polymer: POP-7; Dye Set G5 probe set.

[0138] Simultaneously to the analysis of the fragments by capillary electrophoresis, a 2% agarose gel can be made according to the protocol indicated above, and part of the multiplex PCR product can be run therein to determine that the amplification occurred correctly.

[0139] The analysis of results was performed with GeneMapper® v5.0 Software (Applied Biosystems). They can be seen in FIGS. 3-15. The grey colored area in the figures represents a different allele, the software allows to “write down” this allele, memorizing the detection of this allele in subsequent analyses of different samples. The grey areas represent the size of the alleles detected either in the sample being analyzed, or in other samples that were analyzed previously.

[0140] Table 7 shows the results obtained for the STR marker alleles (columns) in the samples tested (rows).

TABLE-US-00007 TABLE 7 Results obtained for the 13 genetic markers analyzed and their respective alleles D02 C11 H09 B01 E07 305 308 680 110 113 154 154 214 219 324 324 108 111 156 156 185 185 681 110 110 154 158 217 217 324 324 108 108 143 156 185 185 682 110 113 154 158 215 217 321 324 108 111 143 156 185 185 683 110 113 154 158  217*  217* 324 324 108 111 143 143 185 185 684 110 110 154 158 219 219 324 324 108 111 143 156 185 185 B05 H06 501 CS1 301 302 680 239 245 266 269 89 100 254 282 155 155 229 229 681 239 242 269 269 89 100 214 231 142 142 229 229 682 242 242 269 272 89 89 214 272 158 158 223 229 683 242 242 ? ? 89 100 196 196 158 158 229 229 684 239 242 ? ? 89 100 282 282 142 142 223 229 *The result for the alleles in H09 marker for sample 683 and 684 is inconclusive.

[0141] Repeated values have been found in the patterns of the markers and each of the markers can be assigned to the samples analyzed. Table 8 shows the number of identical STR markers in each comparison and table 9 shows the % similarity between the samples.

TABLE-US-00008 TABLE 8 Number of identical STR markers between cannabis samples 680 681 682 683 684 680 4 (13) 3 (13) 6 (12) 4 (12) 681 3 (13) 6 (12) 8 (12) 682 5 (12) 5 (12) 683 5 (12) 684

TABLE-US-00009 TABLE 9 Percentage of similarity between cannabis samples 680 681 682 683 684 680 30.77 23.08 50.00 33.33 681 23.08 50.00 66.67 682 41.67 41.67 683 41.67 684

[0142] Although all samples have a different marker pattern, the degree of similarity between the 681 and 684 samples (8 identical markers, 66.67%) is so high that it cannot be said with sufficient certainty that these samples do not have the same origin. This is why the determination of phenotypic characteristics by means of the .sup.1H and .sup.13C spectra provides key information to obtain the fingerprint of each cannabis sample in order to determine its traceability.

[0143] Nuclear Magnetic Resonance

[0144] Optimization of the Extraction Step

[0145] In order to obtain the corresponding NMR spectra it is necessary to extract the metabolites present in the plant, a process that required previous optimization. For this purpose, a Soxhlet extraction equipment and different solvents (ethanol, isopropanol, dichloromethane, chloroform or hexane) were used for the extraction and at laboratory scale.

[0146] However, it was found that the extraction processes using a Soxhlet equipment, which in practice take place under heat and at temperatures close to the boiling point of the extraction solvent, lead to decarboxylation of cannabinoids into acidic forms. For this reason, it was decided to carry out the extraction at room temperature, thus preserving the acidic derivatives of cannabinoids. In this “cold” extraction (which includes values between 10 and 25° C.), the samples were previously lyophilized and, after being powdered, they were subjected to extraction with different solvents (ethanol, isopropanol, dichloromethane, chloroform, acetonitrile, tetrahydrofuran or hexane) during different times (8, 12, 24 hours). This study made it possible to establish the optimum conditions for the extraction by weight of the extract and the analysis of the cannabinoid content by means of a gas chromatography (GC) or liquid chromatography (HPLC) technique. The results are summarised in Table 10:

TABLE-US-00010 TABLE 10 Optimisation of cannabinoids extraction Cycles/ Test Solvent time Conditions Yield.sup.1 Composition.sup.2 1 Ethanol 1 Reflux 32.2% 20.1% (Soxhlet) 2 Ethanol 2 Reflux 32.5% 20.4% (Soxhlet) 3 Ethanol 3 Reflux 32.7% 20.2% (Soxhlet) 4 Isopropanol 2-3 Reflux 18-21%  18.7% (Soxhlet) 5 Hexane 2-3 Reflux 10-12%  25.5% (Soxhlet) 6 CH.sub.2Cl.sub.2 2-3 Reflux 21-23%  20.8% (Soxhlet) 7 CHCl.sub.3 2-3 Reflux 19-24%  21.2% (Soxhlet) 8 Ethanol 8 hours 25° C. 27.5% 23.5% 9 Ethanol 12 hours 25° C. 27.8% 23.5% 10 Ethanol 24 hours 25° C. 27.9% 23.5% 11 CH.sub.2Cl.sub.2 24 hours 25° C. .sup. 20% 23.5% 12 Acetonitrile 24 hours 25° C. .sup. 17% 22.4% 13 CHCl.sub.3 24 hours 25° C. .sup. 21% 22.7% 14 THF 24 hours 25° C. .sup. 19% 21.9% 15 Hexane 24 hours 25° C.   9% 23.5% .sup.1percentage of grams of crude oil obtained after extraction from the dry plant .sup.2percentage referred to the main cannabinoid content (THC + CBD) in grams per 100 g of extract measured by GC technique.

[0147] In view of the results obtained in the optimization of the extraction phase, it was found that extraction with ethanol at room temperature (25° C.) for 12 hours was as effective as extraction with heating and that it was the most efficient in terms of cannabinoid extraction performance compared to the use of other solvents for extraction. The establishment and definition of the optimal conditions of the extraction process was followed by a validation phase in which a set of three experiments were performed under such conditions, checking, after analysis of the results, the reproducibility and validity of the process.

[0148] The use of methanol as a solvent was also studied, obtaining values of percentage of extraction, temperature and time similar to ethanol. However, this compound was discarded due to its high toxicity.

[0149] As a conclusion, the best results were obtained with ethanol as an extraction solvent and during a 12-hour extraction period, as described in the experimental process below.

[0150] Analysis of Cannabis Samples by NMR

[0151] For NMR analysis, a sample of Cannabis sativa L. (0.5 g), previously freeze-dried and powdered, is extracted with absolute ethanol (15 mL) at room temperature, with stirring and for 12 hours. After this period, the extract is dried on a chemical drying agent, which is selected from one of the following: anhydrous sodium sulphate or anhydrous magnesium sulphate or anhydrous calcium chloride, filtered through a filter (pore size 0), and concentrated under vacuum drying in a rotary evaporator at 20° C. A sample of this extract (7 mg) is dissolved in deuterated chloroform (3 mL) and analyzed by NMR at room temperature. The analysis is done in duplicate, with a concentration of 15 mg of extract in 3 mL of deuterated chloroform. In all cases the sample is completely dissolved. Under these conditions and for plant samples, the technique has a detection limit of 25 μg/mL, a quantification limit of 75 μg/mL and an absolute error of 4%.sup.13.

[0152] The .sup.1H-NMR-1H and .sup.13C-NMR spectra were acquired in a 400 MHz instrument model ARX400 from Bruker. The residual solvent signal in CDCl3 (δ=7.24 ppm, 400 MHz, for .sup.1H and 8=77.0 ppm, 100 MHz, for .sup.13C) was used.

[0153] The five analyzed samples present a different pattern in the analyzed area, allowing to assign and correlate the signals found with each sample, finding peaks that are differentiating, which are those followed by an asterisk (“*”), obtained from FIGS. 16-25. This analysis is shown in TABLE 11.

TABLE-US-00011 TABLE 11 Correlation of signals in the .sup.13C-NMR spectra of cannabis samples. SAMPLES frequencies 680 682 681 684 683 1 175.87* 2 175.80* 3 175.00* 4 174.46 5 175.44 174.42 6 170.22* 7 169.10* 8 164.32 164.32 164.40 9 163.90* 10 162.91* 11 161.90* 12 161.62* 13 160.86 160.47 14 158.89 159.20 15 156.28* 16 154.76 154.81 17 154.19 154.37 18 148.86 148.90 19 147.35* 20 146.72 146.72 21 143.27 143.28 22 142.98* 23 142.82 142.84 142.76 24 141.2* 25 140.25* 26 140.02* 27 139.70 139.93 28 138.20* 29 135.07 135.10 30 135.09* 31 134.75* 32 134.40 134.19 33 133.67* 34 132.52* 35 132.49* 36 131.98 131.97 37 130.24 130.26 130.24 38 130.04* 39 128.32* 40 128.26 128.26 128.25 128.29 41 128.08* 42 127.92* 43 127.77 127.76 127.77 127.81 44 127.13 127.13 127.13 45 126.77* 46 125.35* 47 124.69 124.70 48 124.59 124.51 49 124.05* 50 123.74 123.88 51 123.80* 52 118.23* 53 114.21 114.34 54 113.82 113.78 55 112.42 112.30 112.28 56 57 111.70 111.62 111.6 58 111.35 111.24 111.3 59 111.07* 60 110.84 110.84 61 110.09* 62 109.93* 63 109.76 109.72 109.79 64 109.07* 65 108.97* 66 108.01* 67 107.53 107.53 107.56 68 105.1* 69 103.50 103.44

[0154] It can be seen that the pattern of chemical composition is very different between the 5 samples analyzed. Table 12 shows the number of signals identified in the .sup.13C spectrum of each sample and how many of them were common to the other samples analyzed.

TABLE-US-00012 TABLE 12 Matching of identified signals among the cannabis samples tested 680 681 682 683 684 Signals 20 23 16 14 37 680 20 2 6 3 12 681 23 2 4 12 682 16 3 7 683 14 6 684 37

[0155] Thus, obtaining fingerprints by NMR analysis combined with the determination of STR genetic markers in cannabis samples allows to increase the degree of certainty in the identification thereof. Particularly in the case of samples whose genetic pattern is coincident (samples 681 and 684), the chemical composition pattern, obtained based on .sup.13C-NMR, is different, confirming the possibility of differentiating samples based on their origin.

[0156] The absolute error considered for ppm allocation in each sample is less than 0.01%. The NMR analysis from the .sup.1H and .sup.13C spectrum of each sample has been performed in triplicate, showing to be reproducible.

REFERENCES

[0157] 1. Meyer, J. S., & Quenzer, L. F. Psychopharmacology: Drugs, the brain, and behavior 3rd ed. (Oxford, Oxford University Press, 2019). [0158] 2. National Academies of Sciences, Engineering, and Medicine. (2017). The health effects of cannabis and cannabinoids: The current state of evidence and recommendations for research. National Academies Press. [0159] 3. WHO Expert Committee on Drug Dependence, Pre-review, “Cannabis plant and cannabis resin: section 1—Chemistry” (Geneva, 2018). [0160] 4. Gaviria, C., Zedillo, E., Cardoso, F. H., Romero, A. M., Mockus, A., Garcia, D., . . . &

[0161] Vargas, M. (2009). Drogas y Democracia: hacia un cambio de paradigma. Rio de Janeiro: Comisión Latinoamericana sobre Drogas y Democracia (pag. 7). [0162] 5. CBOL Working Group. A DNA barcode for land plants. Proc Natl Acad Sci USA 2009; 106(31): 12794-7. [0163] 6. Small E, Cronquist A. A practical and natural taxonomy for Cannabis. Taxon 1976; 25(4):405-35. [0164] 7. Bryant V M, Jones G D (2006) Forensic palynology: current status of a rarely used technique in the United States of America. Forensic Sci Int 163:183-197. [0165] 8. Brenneisen R, eISohly M A (1988) Chromatographic and spectro-scopic profiles of Cannabis of different origins: part I. J Forensic Sci 33:1385-1404. [0166] 9. Shibuya E K, Souza Sarkis J E, Neto O N, Moreira M Z, Victoria R L (2006) Sourcing

[0167] Brazilian marijuana by applying IRMS analysis to seized samples. Forensic Sci Int 160:35-43. [0168] 10. Shibuya E K, Sarkis J E S, Negrini-Neto O, Martinelli L A (2007) Carbon and nitrogen stable isotopes as indicative of geographical origin of marijuana samples seized in the city of Sao Paulo (Brazil). Forensic Sci Int 167:8-15. [0169] 11. Howard C, Gilmore S, Robertson J, Peakall R (2008) Developmental validation of a Cannabis sativa STR multiplex system for forensic analysis. J Forensic Sci 53:1061-1067. [0170] 12. S. Gilmore, R. Peakal, J. Robertson, Short tandem repeat (STR) DNA markers are hypervariable and informative in Cannabis Sativa: implications for forensic investigations, Forensic Sci. Int. 131 (2003) 65-74. [0171] 13. M. Hsieh, R. J. Hou, L. C. Tsai, C. S. Wei, S. W. Liu, L. H. Huang, Y. C. Kuo, A. Linacre, J. C. I. Lee, A highly polymorphic STR locus in Cannabis Sativa, Forensic Sci. Int. 131 (2003) 53-58. [0172] 14. D. Balding, Forensic aplications of micro Satelite markers, in D. B. Goldstein and C. Schlötterer (eds.), Microsatelites Evolution and Aplications, (1999) Oxford University Pres, New York, p. 198-210. [0173] 15. P. S. Keim, K. Zinnamon. DNA fingerprintng for Cannabis sativa using STR markers. US2006/0035236A1. [0174] 16. Xinyi Wang, Peter de B. Harrington, Steven F. BaugH. Comparative Study of NMR Spectral Profiling for the Characterization and Authentication of Cannabis. Journal of AOAC International Vol. 100, no. 5, 2017, 1356. [0175] 17. Wieland Peschel, Matteo Politi. .sup.1H NMR and HPLC/DAD for Cannabis sativa L. chemotype distinction, extract profiling and specification. Talanta 140 (2015) 150-165. [0176] 18. Miller Coyle H, Shutler G, Abrams S, Hanniman J, Neylon S, Ladd C, Palmbach T, Lee H C (2003) A simple DNA extraction method for marijuana samples used in amplified fragment length polymorphism (AFLP) analysis. J Forensic Sci 48:343-347. [0177] 19. W. John Kress, Kenneth J. Wurdack, Elizabeth A. Zimmer, Lee A. Weigt, and Daniel H. Janzen. PNAS Jun. 7, 2005 102 (23) 8369-8374. [0178] 20. Köhnemann, S., Nedele, J., Schwotzer, D., Morzfeld, J., Pfeiffer, H. International Journal of Legal Medicine 126(4), pp. 601-606, 2012. [0179] 21. Houston, R., Birck, M., Hughes-Stamm, S. et al. Evaluation of a 13-loci STR multiplex system for Cannabis sativa genetic identification. Int J Legal Med 130, 635-647 (2016).