PROBIOTIC STRAINS AND USES THEREOF
20210322492 · 2021-10-21
Inventors
Cpc classification
A61K35/742
HUMAN NECESSITIES
A23C9/1234
HUMAN NECESSITIES
A61K39/09
HUMAN NECESSITIES
A61K9/0053
HUMAN NECESSITIES
A61P1/00
HUMAN NECESSITIES
A61K35/744
HUMAN NECESSITIES
C12N15/746
CHEMISTRY; METALLURGY
International classification
A23C9/123
HUMAN NECESSITIES
A23L33/135
HUMAN NECESSITIES
A61K35/742
HUMAN NECESSITIES
Abstract
The present invention pertains to a probiotic comprising a generally recognized as safe (GRAS) microbiological organism, which GRAS microbiological organism comprises a food-grade expression vector, which vector comprises in functional linkage a nucleic acid sequence encoding for a soluble form of Amuc_1100 or a functionally equivalent fragment of said soluble form of Amuc_1100, wherein said GRAS microbiological organism is capable of expressing and secreting said soluble form of Amuc_1100 or said fragment thereof, as further defined in the claims. Methods for treating a disease in a patient, comprising oral administration of the probiotic as defined herein are also described, as well as methods of preparing the probiotic disclosed herein.
Claims
1. A probiotic comprising a GRAS microbiological organism, which GRAS microbiological organism comprises a food-grade expression vector, which vector comprises in functional linkage a nucleic acid sequence encoding for a soluble form of Amuc_1100 or a functionally equivalent fragment of said soluble form of Amuc_1100, wherein said GRAS microbiological organism is capable of expressing and secreting said soluble form of Amuc_1100 or said fragment thereof.
2. The probiotic of claim 1, wherein the GRAS microbiological organism is selected from the group of organisms consisting of a gram-positive bacteria, a gram-negative bacteria, and a yeast.
3. The probiotic of claim 1, wherein the GRAS microbiological organism is selected from the group of organisms consisting of a gram-positive bacteria and a gram-negative bacteria.
4. The probiotic of claim 3, wherein the GRAS microbiological organism is a gram-positive bacteria of the order of lactic acid bacteria.
5. The probiotic of claim 3, wherein the GRAS microbiological organism is not of the genus Lactobacillus or of the genus Akkermansia.
6. The probiotic of claim 1, wherein the GRAS microbiological organism is selected from the group consisting of organisms of the genus Lactobacillus, Bifidobacterium, Brevibacillus, Lactococcus, Enterococcus, Streptococcus, Pediococcus, Leuconostoc, Bacillus, Bacteroides, Prevotella, Parabacteroides, Ruminococcacaeae, Corynebacterium, Neisseria, Planococcaceae, Rothia, Ruminococcus, Veilonella, Coprococcus, Alistsipes, Clostridium, Lachnospiraceae, Faecalibacterium, Rikenellaceae, Comamonas, Dialister, Blautia, Roseburia, Turicibacter, and Saccharomyces.
7. The probiotic of claim 1, wherein the GRAS microbiological organism is selected from the group consisting of organisms of the species Lactobacillus rhamnosus, Lactobacillus acidophilus, Lactobacillus plantarum, Lactobacillus casei, Lactobacillus delbrueckii subsp. bulgaricus, Lactobacillus brevies, Lactobacillus johnsonii, Lactobacillus fermentum, Lactobacillus reuteri, Bifidobacterium infantis, Bifidobacterium animalis subsp. lactis, Bifidobacterium bifidum, Bifidobacterium longum, Bifidobacterium breve, Lactococcus lactis subsp. lactis, Enterococcus durans, Enterocococcus faecium, Streptococcus thermophilus, Pediococcus acidilactici, Leuconostoc mesentoroides, Bacillus coagulans, Bacillus subtilis, Bacillus cereus, Saccharomyces boulardi.
8. The probiotic of claim 1, wherein said soluble form of Amuc_1100 or a fragment of said soluble form of Amuc_1100 does not comprise a purification tag.
9. The probiotic of claim 1, wherein said nucleic acid sequence encodes for a soluble form of Amuc_1100 having an amino acid sequence with at least 80% identity to SEQ ID NO: 2.
10. The probiotic of claim 1, wherein said nucleic acid sequence encodes for a fragment of said soluble form of Amuc_1100, which has a length of at least 100 and up to 286 amino acids.
11. The probiotic of claim 1, wherein said nucleic acid sequence is optimized for expression in the genus selected from the group of Bifidobacterium, Bacillus, Brevibacillus, Lactococcus and Saccharomyces.
12. The probiotic of claim 1, wherein said nucleic acid sequence has at least 70% identity to SEQ ID NO: 1.
13. The probiotic of claim 1, wherein said nucleic acid sequence has a sequence selected from SEQ ID NO: 3 to SEQ ID NO: 7.
14. The probiotic of claim 1, wherein said food-grade expression vector carries the SH71rep replicon.
15. The probiotic of claim 1, wherein said food-grade expression vector carries a food-grade selection marker, which provides prototrophy to the otherwise auxotroph GRAS microbiological organism.
16. The probiotic of claim 15, wherein said food grade selection marker is a marker selected from the group of alanine racemase (alr), thymidylate synthase (thyA), lactose phosphotransferase (lacF), and phospho-β-galactosidase (lacG).
17. The probiotic of claim 16, wherein said food grade selection marker is alanine racemase (alr).
18. The probiotic of claim 1, wherein said food-grade expression vector is p3050alrAmuc1100-sh71 (SEQ ID NO: 9) or p3050Alr_Amuc1100_sh71 with 5′UTR, 3′UTR and terminator (SEQ ID NO: 15).
19. The probiotic of claim 1, wherein the probiotic is in the form of a fermented non-dairy food product, a fermented dairy product, or a probiotic food supplement.
20. A method of treating a disease in a patient, comprising the step of administering orally a probiotic as defined in claim 1.
21. The method of claim 20, wherein the disease is selected from the group consisting of obesity, diabetes, hypercholesterolemia.
22. The method of claim 20, wherein the patient is a human patient.
23. A method of preparing a prebiotic according to claim 1, wherein the method comprises the step of introducing a food-grade expression vector, which vector comprises in functional linkage a nucleic acid sequence encoding for a soluble form of Amuc_1100 or a fragment of said soluble form of Amuc_1100, into a GRAS microbiological organism, such that said GRAS microbiological organism is capable of expressing and secreting said soluble form of Amuc_1100 or said fragment thereof.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0020]
[0021]
[0022]
BRIEF DESCRIPTION OF THE SEQUENCES
[0023]
TABLE-US-00001 Nucleic acid sequence encoding Amuc_1100 without its signal sequence (aa 1-30), (SEQ ID NO: 1): atcgtcaatt ccaaacgcag tgaactggac aaaaaaatca gcatcgccgc caaggaaatc 60 aagtccgcca atgctgcgga aatcactccg agccgatcat ccaacgaaga gctggaaaaa 120 gaactgaacc gctatgccaa ggccgtgggc agcctggaaa cggcctacaa gcccttcctt 180 gcctcctccg cgctggtccc caccacgccc acggcattcc agaatgaact gaaaacattc 240 agggattccc tgatctcctc ctgcaagaaa aagaacattc tcataacgga cacatcctcc 300 tggctcggtt tccaggttta cagcacccag gctccctctg ttcaggcggc ctccacgctg 360 ggttttgaat tgaaagccat caacagcctg gtcaacaaac tggcggaatg cggcctgtcc 420 aaattcatca aggtgtaccg cccccagctc cccattgaaa ccccggcgaa caatccggaa 480 gaatcggacg aagccgacca ggccccatgg actcccatgc ctctggaaat agccttccag 540 ggcgaccggg aaagtgtatt gaaagccatg aacgccataa ccggcatgca ggactatctg 600 ttcacggtca actccatccg tatccgcaac gaacggatga tgccccctcc catcgccaat 660 ccggcagccg ccaaacctgc cgcggcccaa cccgccacgg gtgcggcttc cctgactccg 720 gcggatgagg cggctgcacc tgcagccccg gccatccagc aagtcatcaa gccttacatg 780 ggcaaggagc aggtctttgt ccaggtctcc ctgaatctgg tccacttcaa ccagcccaag 840 gctcaggaac cgtctgaaga ttaa 864 Amino acid sequence of Amuc_1100 without its signal sequence (aa 1-30), (SEQ ID NO: 2): I V N S K R S E L D K K I S I A A K E I K S A N A A E I T P S R S S N E E L E K E L N R Y A K A V G S L E T A Y K P F L A S S A L V P T T P T A F Q N E L K T F R D S L I S S C K K K N I L I T D T S S W L G F Q V Y S T Q A P S V Q A A S T L G F E L K A I N S L V N K L A E C G L S K F I K V Y R P Q L P I E T P A N N P E E S D E A D Q A P W T P M P L E I A F Q G D R E S V L K A M N A I T G M Q D Y L F T V N S I R I R N E R M M P P P I A N P A A A K P A A A Q P A T G A A S L T P A D E A A A P A A P A I Q Q V I K P Y M G K E Q V F V Q V S L N L V H F N Q P K A Q E P S E D Amuc_1100 Δ1-30 sequence optimized for Bifidobacterium (SEQ ID NO: 3): attgtgaact ccaagcgctc cgagctggac aagaagatca gcattgccgc taaggagatc 60 aagtccgcca atgctgccga gatcacgccc tccaggagca gcaacgagga gctggaaaag 120 gagctgaacc ggtatgccaa agcggtgggt agcctggaaa ccgcgtacaa acccttcctt 180 gcgtcctcgg cgctcgttcc gaccaccccg acggccttcc agaacgagct caagacgttc 240 cgcgactccc tcatctcgtc ctgcaagaag aagaacatcc tcatcaccga tacgagctcc 300 tggttgggct tccaggtgta ctccacccag gccccgtcgg tccaagccgc ctcgaccttg 360 ggcttcgaac tgaaggccat caactccctg gtgaacaagc tggccgaatg cgggctgtcc 420 aagttcatca aggtgtatcg tccgcagctc cccatcgaaa ccccggccaa caaccccgag 480 gaatccgacg aggccgatca ggcgccctgg accccgatgc ctctcgagat cgcctttcag 540 ggcgatcgcg agtccgtgct gaaggcgatg aacgccatca ccggcatgca ggactacctt 600 ttcacggtga acagcatccg catccggaac gagcgcatga tgccgccgcc gattgcgaat 660 ccggcggccg cgaaaccggc agctgcccaa ccggccactg gagcagccag cctgacccct 720 gcggacgagg cagccgctcc tgcagctccg gcgatccaac aggtcatcaa gccgtacatg 780 ggcaaggaac aggtgttcgt ccaggtttcc ctgaacctgg tccacttcaa ccagcccaaa 840 gcccaggaac cgtcggagga ctga 864 Amuc_1100 Δ1-30 sequence optimized for Bacillus species (SEQ ID NO: 4): attgtgaact caaaacggtc tgagttggac aagaaaatca gcatagctgc aaaagagatc 60 aaatccgcaa acgcagcaga aattacgccg tcaagaagtt ccaacgaaga gctggagaaa 120 gaactgaatc gctatgccaa agcggttgga tcacttgaaa cggcatacaa gccgtttctt 180 gcgagctctg cccttgtacc gacaacaccg acagcgttcc aaaacgaact gaaaacattt 240 cgtgacagcc ttatatcttc ctgcaagaag aagaacatcc tcatcactga tacaagctct 300 tggttaggct ttcaggtgta tagcacacaa gcaccttcag ttcaagcggc atcaacgtta 360 ggctttgagc tgaaagccat caattcgttg gtgaacaaac ttgcggaatg tggcttatcg 420 aagtttatca aagtctatcg tccgcaatta cccattgaaa ccccagcaaa taaccctgaa 480 gaatcggatg aggcggatca agccccttgg accccaatgc ctttggaaat tgcctttcag 540 ggtgatagag aatctgtttt aaaagccatg aatgcgatta ccggaatgca ggactatctg 600 ttcacggtca atagtattcg cattcgaaat gagaggatga tgccaccgcc gattgctaat 660 cctgcagccg ctaaaccagc tgctgctcaa ccggcaactg gagctgcaag tctgactcct 720 gcggatgaag cggctgctcc agctgcccct gcgattcaac aggtaatcaa accgtacatg 780 gggaaagaac aggtatttgt ccaggtttca ttgaatctcg tgcatttcaa tcagccgaaa 840 gcccaagaac ccagcgaaga ttaa 864 Amuc_1100 AΔ-30 sequence optimized for Brevibacillus species (SEQ ID NO: 5): atcgtcaata gcaaacgcag tgaactggac aagaaaatct ccattgccgc aaaagagatc 60 aaatccgcaa acgctgccga aatcactccc tctcgtagtt ctaacgagga actggagaaa 120 gaactgaatc gctatgctaa agccgtaggc tctctggaaa ccgcgtacaa accgtttctt 180 gcgtcctctg cattggtccc caccacaccg accgcgtttc agaatgagct gaaaaccttc 240 cgcgattctc tgatctcgag ctgcaagaag aagaacatcc tcatcaccga cacatcgtcc 300 tggttgggat tccaagtata ctccacgcaa gctccaagcg tacaagcggc atcgactctt 360 ggctttgagc tgaaagctat caactccctc gttaacaagc tcgcggagtg tggcctttcc 420 aaattcatca aggtgtatcg acctcagctg ccaatcgaaa ctccggctaa caaccctgaa 480 gaatccgatg aagcagatca agccccatgg actccgatgc cactggaaat cgcgtttcaa 540 ggtgaccgtg aatccgtact gaaagccatg aacgcaatca cggggatgca agactacttg 600 ttcacggtga actccattcg cattcgcaat gaacgcatga tgccacctcc aattgcgaat 660 cctgcagctg caaaaccagc tgcggcacaa cccgctacag gtgcggcatc cttgactccg 720 gcagacgaag ctgctgctcc agctgcgcct gcaatccagc aagtgatcaa accctatatg 780 ggcaaagaac aggttttcgt acaggtttcc ctgaatctgg tgcatttcaa ccaaccgaaa 840 gcgcaagaac cttccgaaga ttaa 864 Amuc_1100 Δ1-30 sequence optimized for Lactococcus species (SEQ ID NO: 6): atagttaaca gcaaacgatc agagttagac aagaaaattt caattgcagc aaaggagata 60 aaatctgcca atgctgctga gattactccc tctagaagtt caaacgaaga acttgagaaa 120 gaattgaata gatatgcgaa agcggttggt tcacttgaaa ccgcgtataa accgtttcta 180 gcgagttctg ccttagtacc aactacacca acggcatttc agaatgaact taaaactttt 240 agagacagct taatttcatc atgcaagaag aagaacatac ttattacaga tacctcatca 300 tggttaggat ttcaggttta tagtactcaa gctccttcag ttcaagccgc atcaacgttg 360 ggttttgagt tgaaagcgat taatagctta gtaaacaaac ttgctgaatg tgggttgagt 420 aaatttatca aagtctatag accgcaatta cctattgaaa ctcccgctaa taatccagaa 480 gaaagtgatg aagcagatca agcaccatgg acacctatgc ctttggaaat tgcctttcaa 540 ggagatcgag aaagtgtttt aaaagccatg aatgcaatta caggaatgca agattactta 600 ttcaccgtca attctattcg tatccgtaat gaacgcatga tgcctccacc tattgcaaat 660 cctgcagctg ctaaaccggc tgcagcacaa ccagctacag gtgcagcttc tctaacacca 720 gccgatgaag ctgctgctcc agctgcacca gccatacaac aggtaatcaa accttatatg 780 ggcaaagaac aagtgtttgt tcaagtgtct ttaaatttag ttcatttcaa tcaaccaaaa 840 gctcaagaac catcagaaga ttaa 864 Amuc_1100 Δ1-30 sequence optimized for Saccharomyces (SEQ ID NO: 7): attgttaatt ctaagagatc cgaactggac aagaaaatctcgattgcagc gaaggaaatc 60 aaatcggcta atgcagctga aatcactcct tcaaggtctagtaacgagga attggagaaa 120 gaattgaaca gatatgctaa agcagttggt agcttggaaacagcctataa accgttctta 180 gcatctagcg cattagttcc aaccactcca acagcgtttcagaatgaact gaaaacgttt 240 agagacagct tgattagttc ttgcaagaag aagaacatcttgataacaga caccagttca 300 tggttaggct ttcaagtata ctctactcaa gcaccatcagttcaagctgc atccactttg 360 ggattcgagt taaaggccat aaactcactt gtgaacaaacttgctgaatg tggtctatcc 420 aagttcatca aagtttacag accccagtta ccgattgaaactcccgcaaa taatcctgaa 480 gagtcagatg aagccgatca agctccttgg acacctatgcctctagaaat tgcttttcag 540 ggtgatagag agagtgtatt gaaagcgatg aatgccattacaggtatgca agattaccta 600 tttaccgtaa attccattag gatacgtaac gagagaatgatgccaccacc aattgccaat 660 cctgctgcag ccaaacccgc tgccgctcaa ccagcgactggagcagcatc tcttacgcca 720 gccgatgaag ctgcagctcc agctgctcct gccatacaacaggtgataaa accctatatg 780 gggaaagaac aggtctttgt ccaagtctcg ttgaatttagtgcatttcaa ccaaccaaag 840 gctcaagaac cgtctgagga ttaa 864 Alanine racemase (alr) (SEQ ID NO: 8) atgcaagcgg caactgttgt gattaaccgc cgcgctctgc gacacaacct gcaacgtctt 60 cgtgaactgg cccctgccag taaaatggtt gcggtggtga aagcgaacgc ttatggtcac 120 ggtcttcttg agaccgcgcg aacgctcccc gatgctgacg cctttggcgt agcccgtctc 180 gaagaagctc tgcgactgcg tgcgggggga atcaccaaac ctgtactgtt actcgaaggc 240 ttttttgatg ccagagatct gccgacgatt tctgcgcaac attttcatac cgccgtgcat 300 aacgaagaac agctggctgc gctggaagag gctagcctgg acgagccggt taccgtctgg 360 atgaaactcg ataccggtat gcaccgtctg ggcgtaaggc cggaacaggc tgaggcgttt 420 tatcatcgcc tgacccagtg caaaaacgtt cgtcagccgg tgaatatcgt cagccatttt 480 gcgcgcgcgg atgaaccaaa atgtggcgca accgagaaac aactcgctat ctttaatacc 540 ttttgcgaag gcaaacctgg tcaacgttcc attgccgcgt cgggtggcat tctgctgtgg 600 ccacagtcgc attttgactg ggtgcgcccg ggcatcattc tttatggcgt ctcgccgctg 660 gaagatcgct ccaccggtgc cgattttggc tgtcagccag tgatgtcact aacctccagc 720 ctgattgccg tgcgtgagca taaagccgga gagcctgttg gttatggtgg aacctgggta 780 agcgaacgtg atacccgtct tggcgtagtc gcgatgggct atggcgatgg ttatccgcgc 840 gccgcgccgt ccggtacgcc agtgctggtg aacggtcgcg aagtaccgat tgtcgggcgc 900 gtggcgatgg atatgatctg cgtagactta ggtccacagg cgcaggacaa agccggggat 960 ccggtcattt tatggggcga aggtttgccc gtagaacgta tcgctgaaat gacgaaagta 1020 agcgcttacg aacttattac gcgcctgact tcaagggtcg cgatgaaata cgtggattaa 1080 p3050Alr_Amuc1100_sh71 (SEQ ID NO: 9) atatgaaaaa atttaacttt aaaaccatgt tgctattagt tttggctagt tgtgtcttcg 60 gggtcgtcgt taacgtgact actagtcttg gaccacaaac cgcaatcacc gcccaggcct 120 ccaaggtcga catcgtcaat tccaaacgca gtgaactgga caaaaaaatc agcatcgccg 180 ccaaggaaat caagtccgcc aatgctgcgg aaatcactcc gagccgatca tccaacgaag 240 agctggaaaa agaactgaac cgctatgcca aggccgtggg cagcctggaa acggcctaca 300 agcccttcct tgcctcctcc gcgctggtcc ccaccacgcc cacggcattc cagaatgaac 360 tgaaaacatt cagggattcc ctgatctcct cctgcaagaa aaagaacatt ctcataacgg 420 acacatcctc ctggctcggt ttccaggttt acagcaccca ggctccctct gttcaggcgg 480 cctccacgct gggttttgaa ttgaaagcca tcaacagcct ggtcaacaaa ctggcggaat 540 gcggcctgtc caaattcatc aaggtgtacc gcccccagct ccccattgaa accccggcga 600 acaatccgga agaatcggac gaagccgacc aggccccatg gactcccatg cctctggaaa 660 tagccttcca gggcgaccgg gaaagtgtat tgaaagccat gaacgccata accggcatgc 720 aggactatct gttcacggtc aactccatcc gtatccgcaa cgaacggatg atgccccctc 780 ccatcgccaa tccggcagcc gccaaacctg ccgcggccca acccgccacg ggtgcggctt 840 ccctgactcc ggcggatgag gcggctgcac ctgcagcccc ggccatccag caagtcatca 900 agccttacat gggcaaggag caggtctttg tccaggtctc cctgaatctg gtccacttca 960 accagcccaa ggctcaggaa ccgtctgaag attaaaagct tcaaattaca gcacgtgttg 1020 ctttgattga tagccaaaaa gcagcagttg ataaagcaat tactgatatt gctgaaaaat 1080 tgtaatttat aaataaaaat caccttttag aggtggtttt tttatttata aattattcgt 1140 ttgatttcgc tttcgataga acaatcaaag cgagaataag gaagataaat cccataaggg 1200 cgggagcaga atgtccgaga ctaattcatg gatcgatttt ttattaaaac gtctcaaaat 1260 cgtttctgag acgttttagc gtttatttcg tttagttatc ggcataatcg ttaaaacagg 1320 cgttatcgta gcgtaaaagc ccttgagcgt agcgtgcttt gcagcgaaga tgttgtctgt 1380 tagattatga aagccgatga ctgaatgaaa taataagcgc agcgtccttc tatttcggtt 1440 ggaggaggct caagggagtt tgagggaatg aaattccctc atgggtttga ttttaaaaat 1500 tgcttgcaat tttgccgagc ggtagcgctg gaaaaatttt tgaaaaaaat ttggaatttg 1560 gaaaaaaatg gggggaaagg aagcgaattt tgcttccgta ctacgacccc ccattaagtg 1620 ccgagtgcca atttttgtgc caaaaacgct ctatcccaac tggctcaagg gtttgagggg 1680 tttttcaatc gccaacgaat cgccaacgtt ttcgccaacg ttttttataa atctatattt 1740 aagtagcttt attgttgttt ttatgattac aaagtgatac actaatttta taaaattatt 1800 tgattggagt tttttaaatg gtgatttcag aatcgaaaaa aagagttatg atttctctga 1860 caaaagagca agataaaaaa ttaacagata tggcgaaaca aaaaggtttt tcaaaatctg 1920 cggttgcggc gttagctata gaagaatatg caagaaagga atcagaataa aaaaaataag 1980 cgaaagctcg cgtttttaga aggatacgag ttttcgctac ttgtttttga taaggtaata 2040 tatcatggct attaaatact aaagctagaa attttggatt tttattatat cctgactcaa 2100 ttcctaatga ttggaaagaa aaattagaga gtttgggcgt atctatggct gtcagtcctt 2160 tacacgatat ggacgaaaaa aaagataaag atacatggaa tagtagtgat gttatacgaa 2220 atggaaagca ctataaaaaa ccacactatc acgttatata tattgcacga aatcctgtaa 2280 caatagaaag cgttaggaac aagattaagc gaaaattggg gaatagttca gttgctcatg 2340 ttgagatact tgattatatc aaaggttcat atgaatattt gactcatgaa tcaaaggacg 2400 ctattgctaa gaataaacat atatacgaca aaaaagatat tttgaacatt aatgattttg 2460 atattgaccg ctatataaca cttgatgaaa gccaaaaaag agaattgaag aatttacttt 2520 tagatatagt ggatgactat aatttggtaa atacaaaaga tttaatggct tttattcgcc 2580 ttaggggagc ggagtttgga attttaaata cgaatgatgt aaaagatatt gtttcaacaa 2640 actctagcgc ctttagatta tggtttgagg gcaattatca gtgtggatat agagcaagtt 2700 atgcaaaggt tcttgatgct gaaacggggg aaataaaatg acaaacaaag aaaaagagtt 2760 atttgctgaa aatgaggaat taaaaaaaga aattaaggac ttaaaagagc gtattgaaag 2820 atacagagaa atggaagttg aattaagtac aacaatagat ttattgagag gagggattat 2880 tgaataaata aaagcccccc tgacgaaagt cgaagggggc ttttattttg gtttgatgtt 2940 gcgattaata gcaatacgat tgcaataaac aaaaggatcc atgcaagcgg caactgttgt 3000 gattaaccgc cgcgctctgc gacacaacct gcaacgtctt cgtgaactgg cccctgccag 3060 taaaatggtt gcggtggtga aagcgaacgc ttatggtcac ggtcttcttg agaccgcgcg 3120 aacgctcccc gatgctgacg cctttggcgt agcccgtctc gaagaagctc tgcgactgcg 3180 tgcgggggga atcaccaaac ctgtactgtt actcgaaggc ttttttgatg ccagagatct 3240 gccgacgatt tctgcgcaac attttcatac cgccgtgcat aacgaagaac agctggctgc 3300 gctggaagag gctagcctgg acgagccggt taccgtctgg atgaaactcg ataccggtat 3360 gcaccgtctg ggcgtaaggc cggaacaggc tgaggcgttt tatcatcgcc tgacccagtg 3420 caaaaacgtt cgtcagccgg tgaatatcgt cagccatttt gcgcgcgcgg atgaaccaaa 3480 atgtggcgca accgagaaac aactcgctat ctttaatacc ttttgcgaag gcaaacctgg 3540 tcaacgttcc attgccgcgt cgggtggcat tctgctgtgg ccacagtcgc attttgactg 3600 ggtgcgcccg ggcatcattc tttatggcgt ctcgccgctg gaagatcgct ccaccggtgc 3660 cgattttggc tgtcagccag tgatgtcact aacctccagc ctgattgccg tgcgtgagca 3720 taaagccgga gagcctgttg gttatggtgg aacctgggta agcgaacgtg atacccgtct 3780 tggcgtagtc gcgatgggct atggcgatgg ttatccgcgc gccgcgccgt ccggtacgcc 3840 agtgctggtg aacggtcgcg aagtaccgat tgtcgggcgc gtggcgatgg atatgatctg 3900 cgtagactta ggtccacagg cgcaggacaa agccggggat ccggtcattt tatggggcga 3960 aggtttgccc gtagaacgta tcgctgaaat gacgaaagta agcgcttacg aacttattac 4020 gcgcctgact tcaagggtcg cgatgaaata cgtggattaa acacgttact aaagggaatg 4080 gagaccgggg cccttcaata gagttcttaa cgttaatccg aaaaaaacta acgttaatat 4140 taaaaaataa gatccgcttg tgaattatgt ataatttgat tagactaaag aataggagaa 4200 agtatgatga tatttaaaaa actttctcgt taagataggt tgttggtgag catgttatat 4260 acggatgtat cggtttcctt aatgcaaaat tttgttgcta tcttattaat ttttctatta 4320 tatagatata ttcaaagaaa gataacattt aaacggatca tattagatat tttaatagcg 4380 attatttttt caatattata tctgtttatt tcagatgcgt cattacttgt aatggtatta 4440 atgcgattag ggtggcattt tcatcaacaa aaagaaaata agataaaaac gactgataca 4500 gctaatttaa ttctaattat cgtgatccag ttattgttag ttgcggttgg gactattatt 4560 agtcagttta ccatatcgat tatcaaaagt gatttcagcc aaaatatatt gaacaatagt 4620 gcaacagata taactttatt aggtattttc tttgctgttt tatttgacgg cttgttcttt 4680 atattattga agaataagcg gactgaatta caacatttaa atcaagaaat cattgaattt 4740 tcgttagaaa aacaatattt tatatttata tttattttat ttatagtaat agaaattatt 4800 ttagcagttg ggaatcttca aggagtaaca gccacgatat tattaaccat tatcattatt 4860 ttttgtgtcc ttatcgggat gactttttgg caagtgatgc tttttttgaa ggcttattcg 4920 attcgccaag aagccaatga ccaattggtc cggaatcaac aacttcaaga ttatctagtc 4980 aatatcgaac agcagtacac cgaattacgg cgatttaagc atgattatca aaacatctta 5040 ttatcgttgg agagttttgc cgaaaagggc gatcagcaac agtttaaggc gtattaccaa 5100 gaattattag cacaacggcc aattcaaagt gaaatccaag gggcagtcat tgcacaactc 5160 gactacttga aaaatgatcc tattcgagga ttagtcattc aaaagttttt ggcagccaaa 5220 caggctggtg ttactttaaa attcgaaatg accgaaccaa tcgaattagc aaccgctaat 5280 ctattaacgg ttattcggat tatcggtatt ttattagaca atgcgattga acaagccgtt 5340 caagaaaccg atcaattggt gagttgtgct ttcttacaat ctgatggttt aatcgaaatt 5400 acgattgaaa atacggccag tcaagttaag aatctccaag cattttcaga gttaggctat 5460 tcaacgaaag gcgctggtcg ggggactggt ttagctaatg tgcaggattt gattgccaaa 5520 caaaccaatt tattcttaga aacacagatt gaaaatagaa agttacgaca gacattgatg 5580 attacggagg aaacttaatt tgtatcccgt ttatttatta gaggatgatt tacagcaaca 5640 agcgatttat cagcaaatta tcgcgaatac gattatgatt aacgaatttg caatgacttt 5700 aacatgcgct gccagtgata ctgagacatt gttggcggca attaaggatc agcaacgagg 5760 tttattcttt ttggatatgg aaattgagga taaccgccaa gccggtttag aagtggcaac 5820 taagattcgg cagatgatgc cgtttgcgca aattgtcttc attacaaccc acgaggaact 5880 gacattatta acgttagaac gaaaaatagc gcctttagat tacattctca aggaccaaac 5940 aatggctgaa atcaaaaggc aattgattga tgatctattg ttagctgaga agcaaaacga 6000 ggcggcagcg tatcaccgag aaaatttatt tagttataaa ataggtcctc gctttttctc 6060 attaccatta aaggaagttg tttatttata tactgaaaaa gaaaatccgg gtcatattaa 6120 tttgttagcc gttaccagaa aggttacttt tccaggaaat ttaaatgcgc tggaagccca 6180 atatccaatg ctctttcggt gtgataaaag ttacttagtt aacctatcta atattgccaa 6240 ttatgacagt aaaacacgga gtttaaaatt tgtagatggc agtgaggcaa aagtctcgtt 6300 ccggaaatca cgggaactag tggccaaatt aaaacaaatg atgtagcgcc tgcagcacgc 6360 caaatgatcc cagtaaaaag ccacccgcat ggcgggtggc tttttattag ccctagaagg 6420 gcttcccaca cgcatttcag cgccttagtg ccttagtttg tgaatcatag gtggtatagt 6480 cccgaaatac ccgtctaagg aattgtcaga taggcctaat gactggcttt tataatatga 6540 gataatgccg actgtacttt ttacagtcgg ttttctaatg tcactaacct gccccgttag 6600 ttgaagaagg tttttatatt acagctccag atctaccggt gggcccatat taacgtttaa 6660 ccgataaagt tgaacgttaa tatttttttt gcgcagaaat ggtaaattga agcataatag 6720 tcttgtaagg tatttagctg gctggcgtaa agtatgcttt ataaaataat atataggagt 6780 atgattc 6787 human aldehyde dehydrogenase 1B1 (UNIPROT SEQ: P30837; SEQ ID NO: 10): M L R F L A P R L L S L Q G R T A R Y S S A A A L P S P I L N P D I P Y N Q L F I N N E W Q D A V S K K T F P T V N P T T G E V I G H V A E G D R A D V D R A V K A A R E A F R L G S P W R R M D A S E R G R L L N L L A D L V E R D R V Y L A S L E T L D N G K P F Q E S Y A L D L D E V I K V Y R Y F A G W A D K W H G K T I P M D G Q H F C F T R H E P V G V C G Q I I P W N F P L V M Q G W K L A P A L A T G N T V V M K V A E Q T P L S A L Y L A S L I K E A G F P P G V V N I I T G Y G P T A G A A I A Q H V D V D K V A F T G S T E V G H L I Q K A A G D S N L K R V T L E L G G K S P S I V L A D A D M E H A V E Q C H E A L F F N M G Q C C C A G S R T F V E E S I Y N E F L E R T V E K A K Q R K V G N P F E L D T Q Q G P Q V D K E Q F E R V L G Y I Q L G Q K E G A K L L C G G E R F G E R G F F I K P T V F G G V Q D D M R I A K E E I F G P V Q P L F K F K K I E E V V E R A N N T R Y G L A A A V F T R D L D K A M Y F T Q A L Q A G T V W V N T Y N I V T C H T P F G G F K E S G N G R E L G E D G L K A Y T E V K T V T I K V P Q K N S p3050alarAmuc_1100_alcA-al1b1-sh71 (SEQ ID NO: 11) atatgaaaaa atttaacttt aaaaccatgt tgctattagt tttggctagt tgtgtcttcg 60 gggtcgtcgt taacgtgact actagtcttg gaccacaaac cgcaatcacc gcccaggcct 120 ccaaaggagg tatcgtcaat tccaaacgca gtgaactgga caaaaaaatc agcatcgccg 180 ccaaggaaat caagtccgcc aatgctgcgg aaatcactcc gagccgatca tccaacgaag 240 agctggaaaa agaactgaac cgctatgcca aggccgtggg cagcctggaa acggcctaca 300 agcccttcct tgcctcctcc gcgctggtcc ccaccacgcc cacggcattc cagaatgaac 360 tgaaaacatt cagggattcc ctgatctcct cctgcaagaa aaagaacatt ctcataacgg 420 acacatcctc ctggctcggt ttccaggttt acagcaccca ggctccctct gttcaggcgg 480 cctccacgct gggttttgaa ttgaaagcca tcaacagcct ggtcaacaaa ctggcggaat 540 gcggcctgtc caaattcatc aaggtgtacc gcccccagct ccccattgaa accccggcga 600 acaatccgga agaatcggac gaagccgacc aggccccatg gactcccatg cctctggaaa 660 tagccttcca gggcgaccgg gaaagtgtat tgaaagccat gaacgccata accggcatgc 720 aggactatct gttcacggtc aactccatcc gtatccgcaa cgaacggatg atgccccctc 780 ccatcgccaa tccggcagcc gccaaacctg ccgcggccca acccgccacg ggtgcggctt 840 ccctgactcc ggcggatgag gcggctgcac ctgcagcccc ggccatccag caagtcatca 900 agccttacat gggcaaggag caggtctttg tccaggtctc cctgaatctg gtccacttca 960 accagcccaa ggctcaggaa ccgtctgaag attaatactt gaaaaaaaaa aaccccgccc 1020 ctgacagggc ggggtttttt tttccattgt ggtgatcgtt ccgacatgct tgtctgcatg 1080 ggtttctgcg tgtcgggact caagtgatct ggggcttgat gcatgtggga cagcacgagg 1140 tagaggtgga aactgacata cgactccgtt acatgccccg tttaagcgct atgcgtatcg 1200 tgccgtctaa tcccgtgatg gagcgttatc aggcacagta cggactggat gccctcatgg 1260 cgaaccacaa acctcaggag ctccctacgt actgagctat ccgcgcattg cttcgcctca 1320 tagctaaacg ggcatgacac acaatccgac catactcagg aaaacgcttc cactgtacaa 1380 agaggtccac ttcatctgga gaggccctag gaggtatgct cagattcttg gcgcctcgcc 1440 ttcttagcct ccaaggacgt acagccagat attcaagtgc agcagctctt ccgagcccga 1500 ttctcaatcc ggatattccg tataaccaac tgttcattaa caacgagtgg caagacgcag 1560 taagcaagaa aacgtttccg acagtcaatc caactaccgg agaagtgatc ggccacgttg 1620 cagaaggtga tcgggccgat gtcgatcgtg cagttaaagc tgcgagagag gctttcaggc 1680 ttgggtcccc atggcggagg atggatgctt cggaacgtgg cagactgctc aatctgttag 1740 ctgatcttgt agagcgagat cgggtatatc tggcatctct ggaaacactg gacaatggga 1800 agccatttca ggaatcctat gcccttgatc tggatgaggt gattaaggtg tatcgctatt 1860 ttgctggctg ggcagataag tggcatggga aaacaatacc gatggacggc cagcactttt 1920 gctttaccag acatgaacct gttggagtat gtggtcaaat cataccctgg aactttccgc 1980 tggtaatgca aggctggaaa ttagcacccg cgttagcgac gggtaataca gtggtcatga 2040 aagtagctga gcaaacgccg ctttcagcct tgtatttagc ctctcttatc aaagaagctg 2100 gatttcctcc gggtgttgtt aacatcatta caggatacgg ccctacagct ggcgcggcaa 2160 tcgcgcaaca tgtggacgta gacaaagtcg cctttactgg ctcaaccgaa gtcgggcatc 2220 tgatccagaa agctgctggc gatagcaact tgaaacgcgt tacactggag ttaggaggaa 2280 aatctccgag tattgtctta gcggatgcag atatggaaca tgctgttgaa cagtgccatg 2340 aagccttatt cttcaacatg ggtcagtgct gttgtgcggg atctcgtacc tttgtggaag 2400 agtccattta caatgaattt ctggaacgta ccgttgagaa ggcgaaacaa cgcaaagtcg 2460 gaaatccgtt tgagctggac acgcaacaag gtccacaagt ggacaaagaa cagtttgaaa 2520 gagttttggg ctacattcag ctcggacaga aagaaggagc caagttactt tgcggaggcg 2580 aacgatttgg tgaacggggt ttcttcatca aaccaactgt ctttggtgga gtgcaggatg 2640 acatgaggat tgcgaaagaa gagattttcg gccctgtgca acctctgttc aaatttaaga 2700 aaatcgaaga agttgtggaa agagccaaca atacgcggta tggccttgcg gcggcagtct 2760 ttactcgcga tttagacaag gcgatgtact ttacgcaagc cttgcaggca gggacagttt 2820 gggtgaatac gtataacatt gttacatgtc acacaccttt tggaggcttt aaagagtcag 2880 ggaatggacg agaattgggc gaagatgggt tgaaagcata cactgaggtc aaaacagtca 2940 cgataaaagt accccagaag aattcgtaat acttgaaaaa aaaaaacccc gcccctgaca 3000 gggcggggtt ttttttcatg gatcgatttt ttattaaaac gtctcaaaat cgtttctgag 3060 acgttttagc gtttatttcg tttagttatc ggcataatcg ttaaaacagg cgttatcgta 3120 gcgtaaaagc ccttgagcgt agcgtgcttt gcagcgaaga tgttgtctgt tagattatga 3180 aagccgatga ctgaatgaaa taataagcgc agcgtccttc tatttcggtt ggaggaggct 3240 caagggagtt tgagggaatg aaattccctc atgggtttga ttttaaaaat tgcttgcaat 3300 tttgccgagc ggtagcgctg gaaaaatttt tgaaaaaaat ttggaatttg gaaaaaaatg 3360 gggggaaagg aagcgaattt tgcttccgta ctacgacccc ccattaagtg ccgagtgcca 3420 atttttgtgc caaaaacgct ctatcccaac tggctcaagg gtttgagggg tttttcaatc 3480 gccaacgaat cgccaacgtt ttcgccaacg ttttttataa atctatattt aagtagcttt 3540 attgttgttt ttatgattac aaagtgatac actaatttta taaaattatt tgattggagt 3600 tttttaaatg gtgatttcag aatcgaaaaa aagagttatg atttctctga caaaagagca 3660 agataaaaaa ttaacagata tggcgaaaca aaaaggtttt tcaaaatctg cggttgcggc 3720 gttagctata gaagaatatg caagaaagga atcagaataa aaaaaataag cgaaagctcg 3780 cgtttttaga aggatacgag ttttcgctac ttgtttttga taaggtaata tatcatggct 3840 attaaatact aaagctagaa attttggatt tttattatat cctgactcaa ttcctaatga 3900 ttggaaagaa aaattagaga gtttgggcgt atctatggct gtcagtcctt tacacgatat 3960 ggacgaaaaa aaagataaag atacatggaa tagtagtgat gttatacgaa atggaaagca 4020 ctataaaaaa ccacactatc acgttatata tattgcacga aatcctgtaa caatagaaag 4080 cgttaggaac aagattaagc gaaaattggg gaatagttca gttgctcatg ttgagatact 4140 tgattatatc aaaggttcat atgaatattt gactcatgaa tcaaaggacg ctattgctaa 4200 gaataaacat atatacgaca aaaaagatat tttgaacatt aatgattttg atattgaccg 4260 ctatataaca cttgatgaaa gccaaaaaag agaattgaag aatttacttt tagatatagt 4320 ggatgactat aatttggtaa atacaaaaga tttaatggct tttattcgcc ttaggggagc 4380 ggagtttgga attttaaata cgaatgatgt aaaagatatt gtttcaacaa actctagcgc 4440 ctttagatta tggtttgagg gcaattatca gtgtggatat agagcaagtt atgcaaaggt 4500 tcttgatgct gaaacggggg aaataaaatg acaaacaaag aaaaagagtt atttgctgaa 4560 aatgaggaat taaaaaaaga aattaaggac ttaaaagagc gtattgaaag atacagagaa 4620 atggaagttg aattaagtac aacaatagat ttattgagag gagggattat tgaataaata 4680 aaagcccccc tgacgaaagt cgaagggggc ttttattttg gtttgatgtt gcgattaata 4740 gcaatacgat tgcaataaac aaaaggatcc atgcaagcgg caactgttgt gattaaccgc 4800 cgcgctctgc gacacaacct gcaacgtctt cgtgaactgg cccctgccag taaaatggtt 4860 gcggtggtga aagcgaacgc ttatggtcac ggtcttcttg agaccgcgcg aacgctcccc 4920 gatgctgacg cctttggcgt agcccgtctc gaagaagctc tgcgactgcg tgcgggggga 4980 atcaccaaac ctgtactgtt actcgaaggc ttttttgatg ccagagatct gccgacgatt 5040 tctgcgcaac attttcatac cgccgtgcat aacgaagaac agctggctgc gctggaagag 5100 gctagcctgg acgagccggt taccgtctgg atgaaactcg ataccggtat gcaccgtctg 5160 ggcgtaaggc cggaacaggc tgaggcgttt tatcatcgcc tgacccagtg caaaaacgtt 5220 cgtcagccgg tgaatatcgt cagccatttt gcgcgcgcgg atgaaccaaa atgtggcgca 5280 accgagaaac aactcgctat ctttaatacc ttttgcgaag gcaaacctgg tcaacgttcc 5340 attgccgcgt cgggtggcat tctgctgtgg ccacagtcgc attttgactg ggtgcgcccg 5400 ggcatcattc tttatggcgt ctcgccgctg gaagatcgct ccaccggtgc cgattttggc 5460 tgtcagccag tgatgtcact aacctccagc ctgattgccg tgcgtgagca taaagccgga 5520 gagcctgttg gttatggtgg aacctgggta agcgaacgtg atacccgtct tggcgtagtc 5580 gcgatgggct atggcgatgg ttatccgcgc gccgcgccgt ccggtacgcc agtgctggtg 5640 aacggtcgcg aagtaccgat tgtcgggcgc gtggcgatgg atatgatctg cgtagactta 5700 ggtccacagg cgcaggacaa agccggggat ccggtcattt tatggggcga aggtttgccc 5760 gtagaacgta tcgctgaaat gacgaaagta agcgcttacg aacttattac gcgcctgact 5820 tcaagggtcg cgatgaaata cgtggattaa acacgttact aaagggaatg gagaccgggg 5880 cccttcaata gagttcttaa cgttaatccg aaaaaaacta acgttaatat taaaaaataa 5940 gatccgcttg tgaattatgt ataatttgat tagactaaag aataggagaa agtatgatga 6000 tatttaaaaa actttctcgt taagataggt tgttggtgag catgttatat acggatgtat 6060 cggtttcctt aatgcaaaat tttgttgcta tcttattaat ttttctatta tatagatata 6120 ttcaaagaaa gataacattt aaacggatca tattagatat tttaatagcg attatttttt 6180 caatattata tctgtttatt tcagatgcgt cattacttgt aatggtatta atgcgattag 6240 ggtggcattt tcatcaacaa aaagaaaata agataaaaac gactgataca gctaatttaa 6300 ttctaattat cgtgatccag ttattgttag ttgcggttgg gactattatt agtcagttta 6360 ccatatcgat tatcaaaagt gatttcagcc aaaatatatt gaacaatagt gcaacagata 6420 taactttatt aggtattttc tttgctgttt tatttgacgg cttgttcttt atattattga 6480 agaataagcg gactgaatta caacatttaa atcaagaaat cattgaattt tcgttagaaa 6540 aacaatattt tatatttata tttattttat ttatagtaat agaaattatt ttagcagttg 6600 ggaatcttca aggagtaaca gccacgatat tattaaccat tatcattatt ttttgtgtcc 6660 ttatcgggat gactttttgg caagtgatgc tttttttgaa ggcttattcg attcgccaag 6720 aagccaatga ccaattggtc cggaatcaac aacttcaaga ttatctagtc aatatcgaac 6780 agcagtacac cgaattacgg cgatttaagc atgattatca aaacatctta ttatcgttgg 6840 agagttttgc cgaaaagggc gatcagcaac agtttaaggc gtattaccaa gaattattag 6900 cacaacggcc aattcaaagt gaaatccaag gggcagtcat tgcacaactc gactacttga 6960 aaaatgatcc tattcgagga ttagtcattc aaaagttttt ggcagccaaa caggctggtg 7020 ttactttaaa attcgaaatg accgaaccaa tcgaattagc aaccgctaat ctattaacgg 7080 ttattcggat tatcggtatt ttattagaca atgcgattga acaagccgtt caagaaaccg 7140 atcaattggt gagttgtgct ttcttacaat ctgatggttt aatcgaaatt acgattgaaa 7200 atacggccag tcaagttaag aatctccaag cattttcaga gttaggctat tcaacgaaag 7260 gcgctggtcg ggggactggt ttagctaatg tgcaggattt gattgccaaa caaaccaatt 7320 tattcttaga aacacagatt gaaaatagaa agttacgaca gacattgatg attacggagg 7380 aaacttaatt tgtatcccgt ttatttatta gaggatgatt tacagcaaca agcgatttat 7440 cagcaaatta tcgcgaatac gattatgatt aacgaatttg caatgacttt aacatgcgct 7500 gccagtgata ctgagacatt gttggcggca attaaggatc agcaacgagg tttattcttt 7560 ttggatatgg aaattgagga taaccgccaa gccggtttag aagtggcaac taagattcgg 7620 cagatgatgc cgtttgcgca aattgtcttc attacaaccc acgaggaact gacattatta 7680 acgttagaac gaaaaatagc gcctttagat tacattctca aggaccaaac aatggctgaa 7740 atcaaaaggc aattgattga tgatctattg ttagctgaga agcaaaacga ggcggcagcg 7800 tatcaccgag aaaatttatt tagttataaa ataggtcctc gctttttctc attaccatta 7860 aaggaagttg tttatttata tactgaaaaa gaaaatccgg gtcatattaa tttgttagcc 7920 gttaccagaa aggttacttt tccaggaaat ttaaatgcgc tggaagccca atatccaatg 7980 ctctttcggt gtgataaaag ttacttagtt aacctatcta atattgccaa ttatgacagt 8040 aaaacacgga gtttaaaatt tgtagatggc agtgaggcaa aagtctcgtt ccggaaatca 8100 cgggaactag tggccaaatt aaaacaaatg atgtagcgcc tgcagcacgc caaatgatcc 8160 cagtaaaaag ccacccgcat ggcgggtggc tttttattag ccctagaagg gcttcccaca 8220 cgcatttcag cgccttagtg ccttagtttg tgaatcatag gtggtatagt cccgaaatac 8280 ccgtctaagg aattgtcaga taggcctaat gactggcttt tataatatga gataatgccg 8340 actgtacttt ttacagtcgg ttttctaatg tcactaacct gccccgttag ttgaagaagg 8400 tttttatatt acagctccag atctaccggt gggcccatat taacgtttaa ccgataaagt 8460 tgaacgttaa tatttttttt gcgcagaaat ggtaaattga agcataatag tcttgtaagg 8520 tatttagctg gctggcgtaa agtatgcttt ataaaataat atataggagt atgattc 8577 Terminator iGEM-part BBa_B1006 (SEQ ID NO: 12) aaaaaaaaac cccgcccctg acagggcggg gtttttttt 5′UTR (SEQ ID NO: 13) AGGAGGT 3′UTR (SEQ ID NO: 14) TACTTGAA p3050Alr_Amuc1100_sh71 with 5′UTR, 3′UTR and terminator (SEQ ID NO: 15) atatgaaaaa atttaacttt aaaaccatgt tgctattagt tttggctagt tgtgtcttcg 60 gggtcgtcgt taacgtgact actagtcttg gaccacaaac cgcaatcacc gcccaggcct 120 ccaaaggagg tatcgtcaat tccaaacgca gtgaactgga caaaaaaatc agcatcgccg 180 ccaaggaaat caagtccgcc aatgctgcgg aaatcactcc gagccgatca tccaacgaag 240 agctggaaaa agaactgaac cgctatgcca aggccgtggg cagcctggaa acggcctaca 300 agcccttcct tgcctcctcc gcgctggtcc ccaccacgcc cacggcattc cagaatgaac 360 tgaaaacatt cagggattcc ctgatctcct cctgcaagaa aaagaacatt ctcataacgg 420 acacatcctc ctggctcggt ttccaggttt acagcaccca ggctccctct gttcaggcgg 480 cctccacgct gggttttgaa ttgaaagcca tcaacagcct ggtcaacaaa ctggcggaat 540 gcggcctgtc caaattcatc aaggtgtacc gcccccagct ccccattgaa accccggcga 600 acaatccgga agaatcggac gaagccgacc aggccccatg gactcccatg cctctggaaa 660 tagccttcca gggcgaccgg gaaagtgtat tgaaagccat gaacgccata accggcatgc 720 aggactatct gttcacggtc aactccatcc gtatccgcaa cgaacggatg atgccccctc 780 ccatcgccaa tccggcagcc gccaaacctg ccgcggccca acccgccacg ggtgcggctt 840 ccctgactcc ggcggatgag gcggctgcac ctgcagcccc ggccatccag caagtcatca 900 agccttacat gggcaaggag caggtctttg tccaggtctc cctgaatctg gtccacttca 960 accagcccaa ggctcaggaa ccgtctgaag attaatactt gaaaaaaaaa aaccccgccc 1020 ctgacagggc ggggtttttt ttcatggatc gattttttat taaaacgtct caaaatcgtt 1080 tctgagacgt tttagcgttt atttcgttta gttatcggca taatcgttaa aacaggcgtt 1140 atcgtagcgt aaaagccctt gagcgtagcg tgctttgcag cgaagatgtt gtctgttaga 1200 ttatgaaagc cgatgactga atgaaataat aagcgcagcg tccttctatt tcggttggag 1260 gaggctcaag ggagtttgag ggaatgaaat tccctcatgg gtttgatttt aaaaattgct 1320 tgcaattttg ccgagcggta gcgctggaaa aatttttgaa aaaaatttgg aatttggaaa 1380 aaaatggggg gaaaggaagc gaattttgct tccgtactac gaccccccat taagtgccga 1440 gtgccaattt ttgtgccaaa aacgctctat cccaactggc tcaagggttt gaggggtttt 1500 tcaatcgcca acgaatcgcc aacgttttcg ccaacgtttt ttataaatct atatttaagt 1560 agctttattg ttgtttttat gattacaaag tgatacacta attttataaa attatttgat 1620 tggagttttt taaatggtga tttcagaatc gaaaaaaaga gttatgattt ctctgacaaa 1680 agagcaagat aaaaaattaa cagatatggc gaaacaaaaa ggtttttcaa aatctgcggt 1740 tgcggcgtta gctatagaag aatatgcaag aaaggaatca gaataaaaaa aataagcgaa 1800 agctcgcgtt tttagaagga tacgagtttt cgctacttgt ttttgataag gtaatatatc 1860 atggctatta aatactaaag ctagaaattt tggattttta ttatatcctg actcaattcc 1920 taatgattgg aaagaaaaat tagagagttt gggcgtatct atggctgtca gtcctttaca 1980 cgatatggac gaaaaaaaag ataaagatac atggaatagt agtgatgtta tacgaaatgg 2040 aaagcactat aaaaaaccac actatcacgt tatatatatt gcacgaaatc ctgtaacaat 2100 agaaagcgtt aggaacaaga ttaagcgaaa attggggaat agttcagttg ctcatgttga 2160 gatacttgat tatatcaaag gttcatatga atatttgact catgaatcaa aggacgctat 2220 tgctaagaat aaacatatat acgacaaaaa agatattttg aacattaatg attttgatat 2280 tgaccgctat ataacacttg atgaaagcca aaaaagagaa ttgaagaatt tacttttaga 2340 tatagtggat gactataatt tggtaaatac aaaagattta atggctttta ttcgccttag 2400 gggagcggag tttggaattt taaatacgaa tgatgtaaaa gatattgttt caacaaactc 2460 tagcgccttt agattatggt ttgagggcaa ttatcagtgt ggatatagag caagttatgc 2520 aaaggttctt gatgctgaaa cgggggaaat aaaatgacaa acaaagaaaa agagttattt 2580 gctgaaaatg aggaattaaa aaaagaaatt aaggacttaa aagagcgtat tgaaagatac 2640 agagaaatgg aagttgaatt aagtacaaca atagatttat tgagaggagg gattattgaa 2700 taaataaaag cccccctgac gaaagtcgaa gggggctttt attttggttt gatgttgcga 2760 ttaatagcaa tacgattgca ataaacaaaa ggatccatgc aagcggcaac tgttgtgatt 2820 aaccgccgcg ctctgcgaca caacctgcaa cgtcttcgtg aactggcccc tgccagtaaa 2880 atggttgcgg tggtgaaagc gaacgcttat ggtcacggtc ttcttgagac cgcgcgaacg 2940 ctccccgatg ctgacgcctt tggcgtagcc cgtctcgaag aagctctgcg actgcgtgcg 3000 gggggaatca ccaaacctgt actgttactc gaaggctttt ttgatgccag agatctgccg 3060 acgatttctg cgcaacattt tcataccgcc gtgcataacg aagaacagct ggctgcgctg 3120 gaagaggcta gcctggacga gccggttacc gtctggatga aactcgatac cggtatgcac 3180 cgtctgggcg taaggccgga acaggctgag gcgttttatc atcgcctgac ccagtgcaaa 3240 aacgttcgtc agccggtgaa tatcgtcagc cattttgcgc gcgcggatga accaaaatgt 3300 ggcgcaaccg agaaacaact cgctatcttt aatacctttt gcgaaggcaa acctggtcaa 3360 cgttccattg ccgcgtcggg tggcattctg ctgtggccac agtcgcattt tgactgggtg 3420 cgcccgggca tcattcttta tggcgtctcg ccgctggaag atcgctccac cggtgccgat 3480 tttggctgtc agccagtgat gtcactaacc tccagcctga ttgccgtgcg tgagcataaa 3540 gccggagagc ctgttggtta tggtggaacc tgggtaagcg aacgtgatac ccgtcttggc 3600 gtagtcgcga tgggctatgg cgatggttat ccgcgcgccg cgccgtccgg tacgccagtg 3660 ctggtgaacg gtcgcgaagt accgattgtc gggcgcgtgg cgatggatat gatctgcgta 3720 gacttaggtc cacaggcgca ggacaaagcc ggggatccgg tcattttatg gggcgaaggt 3780 ttgcccgtag aacgtatcgc tgaaatgacg aaagtaagcg cttacgaact tattacgcgc 3840 ctgacttcaa gggtcgcgat gaaatacgtg gattaaacac gttactaaag ggaatggaga 3900 ccggggccct tcaatagagt tcttaacgtt aatccgaaaa aaactaacgt taatattaaa 3960 aaataagatc cgcttgtgaa ttatgtataa tttgattaga ctaaagaata ggagaaagta 4020 tgatgatatt taaaaaactt tctcgttaag ataggttgtt ggtgagcatg ttatatacgg 4080 atgtatcggt ttccttaatg caaaattttg ttgctatctt attaattttt ctattatata 4140 gatatattca aagaaagata acatttaaac ggatcatatt agatatttta atagcgatta 4200 ttttttcaat attatatctg tttatttcag atgcgtcatt acttgtaatg gtattaatgc 4260 gattagggtg gcattttcat caacaaaaag aaaataagat aaaaacgact gatacagcta 4320 atttaattct aattatcgtg atccagttat tgttagttgc ggttgggact attattagtc 4380 agtttaccat atcgattatc aaaagtgatt tcagccaaaa tatattgaac aatagtgcaa 4440 cagatataac tttattaggt attttctttg ctgttttatt tgacggcttg ttctttatat 4500 tattgaagaa taagcggact gaattacaac atttaaatca agaaatcatt gaattttcgt 4560 tagaaaaaca atattttata tttatattta ttttatttat agtaatagaa attattttag 4620 cagttgggaa tcttcaagga gtaacagcca cgatattatt aaccattatc attatttttt 4680 gtgtccttat cgggatgact ttttggcaag tgatgctttt tttgaaggct tattcgattc 4740 gccaagaagc caatgaccaa ttggtccgga atcaacaact tcaagattat ctagtcaata 4800 tcgaacagca gtacaccgaa ttacggcgat ttaagcatga ttatcaaaac atcttattat 4860 cgttggagag ttttgccgaa aagggcgatc agcaacagtt taaggcgtat taccaagaat 4920 tattagcaca acggccaatt caaagtgaaa tccaaggggc agtcattgca caactcgact 4980 acttgaaaaa tgatcctatt cgaggattag tcattcaaaa gtttttggca gccaaacagg 5040 ctggtgttac tttaaaattc gaaatgaccg aaccaatcga attagcaacc gctaatctat 5100 taacggttat tcggattatc ggtattttat tagacaatgc gattgaacaa gccgttcaag 5160 aaaccgatca attggtgagt tgtgctttct tacaatctga tggtttaatc gaaattacga 5220 ttgaaaatac ggccagtcaa gttaagaatc tccaagcatt ttcagagtta ggctattcaa 5280 cgaaaggcgc tggtcggggg actggtttag ctaatgtgca ggatttgatt gccaaacaaa 5340 ccaatttatt cttagaaaca cagattgaaa atagaaagtt acgacagaca ttgatgatta 5400 cggaggaaac ttaatttgta tcccgtttat ttattagagg atgatttaca gcaacaagcg 5460 atttatcagc aaattatcgc gaatacgatt atgattaacg aatttgcaat gactttaaca 5520 tgcgctgcca gtgatactga gacattgttg gcggcaatta aggatcagca acgaggttta 5580 ttctttttgg atatggaaat tgaggataac cgccaagccg gtttagaagt ggcaactaag 5640 attcggcaga tgatgccgtt tgcgcaaatt gtcttcatta caacccacga ggaactgaca 5700 ttattaacgt tagaacgaaa aatagcgcct ttagattaca ttctcaagga ccaaacaatg 5760 gctgaaatca aaaggcaatt gattgatgat ctattgttag ctgagaagca aaacgaggcg 5820 gcagcgtatc accgagaaaa tttatttagt tataaaatag gtcctcgctt tttctcatta 5880 ccattaaagg aagttgttta tttatatact gaaaaagaaa atccgggtca tattaatttg 5940 ttagccgtta ccagaaaggt tacttttcca ggaaatttaa atgcgctgga agcccaatat 6000 ccaatgctct ttcggtgtga taaaagttac ttagttaacc tatctaatat tgccaattat 6060 gacagtaaaa cacggagttt aaaatttgta gatggcagtg aggcaaaagt ctcgttccgg 6120 aaatcacggg aactagtggc caaattaaaa caaatgatgt agcgcctgca gcacgccaaa 6180 tgatcccagt aaaaagccac ccgcatggcg ggtggctttt tattagccct agaagggctt 6240 cccacacgca tttcagcgcc ttagtgcctt agtttgtgaa tcataggtgg tatagtcccg 6300 aaatacccgt ctaaggaatt gtcagatagg cctaatgact ggcttttata atatgagata 6360 atgccgactg tactttttac agtcggtttt ctaatgtcac taacctgccc cgttagttga 6420 agaaggtttt tatattacag ctccagatct accggtgggc ccatattaac gtttaaccga 6480 taaagttgaa cgttaatatt ttttttgcgc agaaatggta aattgaagca taatagtctt 6540 gtaaggtatt tagctggctg gcgtaaagta tgctttataa aataatatat aggagtatga 6600 ttc 6603
DETAILED DESCRIPTION OF THE INVENTION
[0024] The present invention provides a probiotic comprising a GRAS microbiological organism, which GRAS microbiological organism comprises a food-grade expression vector, which vector comprises in functional linkage a nucleic acid sequence encoding for a soluble form of Amuc_1100 or a functionally equivalent fragment of said soluble form of Amuc_1100, wherein said GRAS microbiological organism is capable of expressing and secreting said soluble form of Amuc_1100 or said fragment thereof.
[0025] The term “probiotic” as used herein in the context of the present invention is defined as live microorganism, which when administered in adequate amounts, confers health benefit on the host. The probiotic may be in the form of a fermented dairy food product, a fermented non-dairy product, or a probiotic food supplement. Examples of a fermented dairy food product comprise yoghurt, yoghurt drinks, kefir, buttermilk, sour cream, viili, fil, and creme fraiche. Often dairy products are fermented are with lactic acid bacteria such as Lactococcus, Lactobacillus and Leuconostoc. However, in particular cheese may comprise bacteria and molds from other genera. Examples of fermented non-dairy products comprise pickled vegetables, sauerkraut, kimchi, pao cai, soy products including miso, tempeh, and soy sauce. Probiotic food supplements may be in the form of capsules, microcapsules, tablets, powders, and sachets, and may optionally be formulated to deliver the probiotic bacteria through the acidic environment of the stomach.
[0026] Generally recognized as safe (GRAS) is a designation of the United States Food and Drug Administration (FDA) designating that a chemical or substance added to food is considered safe by experts, and so is exempted from the usual Federal Food, Drug, and Cosmetic Act (FFDCA) food additive tolerance requirements. The term “GRAS microbiological organism” as used herein in the context of the present invention is intended to mean that the microorganism is known or is found to be suitable for consumption by a host, in particular a human, without causing a state of disease. Indeed, any organism causing a state of disease, i.e. a deterioration in health, would also not be considered as a probiotic. For example, Escherichia coli is not a GRAS microbiological organism. Thus, the terms “GRAS microbiological organism” and “probiotic” are intended to complement each other.
[0027] Microorganisms which are intended to fulfill both requirements of a “probiotic” and a “GRAS microbiological organism” are exemplified in the review article of Fijan, “Microorganisms with Claimed Probiotic Properties: An Overview of Recent Literature” Int. J. Environ. Res. Public Health 2014, 11, 4745-4765, the content of which is incorporated herein by reference. In embodiments, the GRAS microbiological organism may be selected from the group of organisms consisting of a gram-positive bacteria, a gram-negative bacteria, and a yeast. In embodiments, the GRAS microbiological organism is selected from the group consisting of organisms of the genus Lactobacillus, Bifidobacterium, Brevibacillus, Lactococcus, Enterococcus, Streptococcus, Pediococcus, Leuconostoc, Bacillus, Bacteroides, Prevotella, Parabacteroides, Ruminococcacaeae, Corynebacterium, Neisseria, Planococcaceae, Rothia, Ruminococcus, Veilonella, Coprococcus, Alistsipes, Clostridium, Lachnospiraceae, Faecalibacterium, Rikenellaceae, Comamonas, Dialister, Blautia, Roseburia, Turicibacter, and Saccharomyces. In embodiments, the GRAS microbiological organism is selected from the group consisting of organisms of the species Lactobacillus rhamnosus, Lactobacillus acidophilus, Lactobacillus plantarum, Lactobacillus casei, Lactobacillus delbrueckii subsp. bulgaricus, Lactobacillus brevies, Lactobacillus johnsonii, Lactobacillus fermentum, Lactobacillus reuteri, Bifidobacterium infantis, Bifidobacterium animalis subsp. lactis, Bifidobacterium bifidum, Bifidobacterium longum, Bifidobacterium breve, Lactococcus lactis subsp. lactis, Enterococcus durans, Enterocococcus faecium, Streptococcus thermophilus, Pediococcus acidilactici, Leuconostoc mesentoroides, Bacillus coagulans, Bacillus subtilis, Bacillus cereus, Saccharomyces boulardi. Preferably, the GRAS microbiological organism is not of the genus Akkermansia, in particular not Akkermansia muciniphila.
[0028] The invention is particularly advantageous for embodiments, wherein the GRAS microbiological organism is selected from the group of organisms consisting of a gram-positive bacteria and a gram-negative bacteria. This is because it is expected that the beneficial effects reported for Amuc_1100, in particular its Toll-like receptor 2 (TLR-2) agonistic activity, will further improve the beneficial health effects which are ascribed to the induction of TLR-2 by PAMPs found in the membrane of these microorganisms. A particular high expression of Amuc_1100 has been found in embodiments, wherein the GRAS microbiological organism is a gram-positive bacteria belonging to the order of lactic acid bacteria.
[0029] As noted above, said GRAS microbiological organism comprises a food-grade expression vector. Several food-grade expression vectors are described in the art. Food-grade expression vectors are characterized by containing only the DNA from homologous hosts or generally considered as safe organisms, and by not being dependent antibiotic markers. Consequently, said food-grade expression vector may carry a food-grade selection marker, which provides prototrophy to an otherwise auxotroph GRAS microbiological organism. Suitable vectors for lactic acid bacteria are reviewed by Landete, Critical Review in Biotechnology, 2017, 37(3): 296-308, the content of which is incorporated herein by reference. These vectors can also be used for identifying building blocks, which can be combined.
[0030] The various components of the food-grade expression vector are comprised in the vector in functional linkage. The expression “in functional linkage” as used herein, is intended to mean that the respective component of the food-grade expression vector is arranged within said vector, such that they can bring about their intended function. A marker gene is in functional linkage in case the gene is expressed such that its gene product provides the selection advantage. A replicon is in functional linkage in case the vector or plasmid is reproduced and maintained in the host cell due to the effect of said replicon. In the context of the nucleic acid encoding Amuc_1100, or a fragment thereof, said nucleic acid encoding Amuc_1100 or a fragment thereof is in functional linkage in case its gene product is expressed, such that its translated gene product is secreted into the host cells supernatant.
[0031] The food grade selection marker may be, for example, a marker selected from the group of alanine racemase (alr), thymidylate snynthase (thyA), lactose phosphotransferase (lacF), and phospho-β-galactosidase (lacG). In one particular embodiment, the marker is alanine racemase (alr), such as the alanine racemase (alr) marker encoded by SEQ ID NO: 8. The alr marker, and a food-grade expression vector using same is described in further detail in Nguyen et al., J. Agric. Food Chem. 2011, 59: 5617-5624; and Bron et al. Appl. Environ. Microbiol. 2002, 68(11): 5663-5670; each the content of which is incorporated herein by reference. In embodiments, the food-grade expression vector carries the SH71rep replicon, which has a broad functionality. The SH71rep replicon is further described by Karlskas et al., PLOS One 2014, 9(3): e91125, the content of which is incorporated herein by reference. Other suitable replicons may be employed as well. An additional 5′UTR ‘AGGAGGT’ (SEQ ID NO: 13) sequence may be optionally inserted directly upstream of the Amuc-protein sequence and 3′UTR sequence ‘TACTTGAA’ (SEQ ID NO: 14) directly downstream of the Amuc-protein sequence followed by a terminator, for example iGEM-part BBa_B1006 (SEQ ID NO: 12).
[0032] Signal sequences steering the gene of interest to the secretion pathway are known to the skilled person. For example, Dieye et al. J. Bacteriol. 2001, 183(14): 4157, the content of which is incorporated herein by reference, disclose the M6 preprotein and the Usp45 preprotein signal peptide sequence, which provides secretion when fused to the gene product of interest. Whether a gene product of interest has been expressed and secreted into the supernatant of the host cell can be tested for by assays generally known in the art, including SDS-PAGE followed by Coomassie Blue Staining, or any immunological method including dot blots, ouchterlony assays, western blots, or ELISA techniques.
[0033] In any case, the food-grade expression vector comprises in functional linkage a nucleic acid sequence encoding for a soluble form of Amuc_1100 or a fragment of said soluble form of Amuc_1100. In embodiments, the nucleic acid sequence in said food-grade expression vector encodes a soluble form of Amuc_1100 having an amino acid sequence with at least 80% identity to SEQ ID NO: 2 (Amuc_1100), such as with at least 82% identity to SEQ ID NO: 2, such as with at least 84% identity to SEQ ID NO: 2, such as with at least 86% identity to SEQ ID NO: 2, such as with at least 88% identity to SEQ ID NO: 2, such as with at least 90% identity to SEQ ID NO: 2, such as with at least 92% identity to SEQ ID NO: 2, such as with at least 94% identity to SEQ ID NO: 2, such as with at least 96% identity to SEQ ID NO: 2, such as with at least 98% identity to SEQ ID NO: 2, for example with at least 99% identity to SEQ ID NO: 2. For example, the Amuc_1100 encoded by the nucleic acid sequence comprised in functional linkage in said food-grade expression vector may comprise one or more conservative or semi-conservative substitutions, as generally known in the art, or it may be a homolog or an allelic variant to Amuc_1100 of SEQ DI NO: 2.
[0034] In one embodiment, the nucleic acid sequence in said food-grade expression vector encodes a soluble form of Amuc_1100 having an amino acid sequence as set out in SEQ ID NO: 2. A protein sequence comparison can be conducted using a sequence comparison and alignment tool, such as the publicly available program BLASTp, wherein sequence identity is intended to mean the identity of two amino acids at the same position, when both sequences are aligned, and over the total length of SEQ ID NO: 2 (287 amino acids).
[0035] In embodiments, said nucleic acid sequence may also encodes for a fragment of said soluble form of Amuc_1100, which has a length of at least 100 and up to 286 amino acids. These fragments may, for example, be N- or C-terminally truncated fragments. Alternatively, these fragments may arise from internal deletion(s). For example, said fragment may have a length of up to 285 amino acids, up to 284 amino acids, up to 283 amino acids, up to 282 amino acids, up to 281 amino acids, up to 280 amino acids, up to 275 amino acids, up to 270 amino acids, up to 265 amino acids, up to 260 amino acids, up to 255 amino acids, up to 250 amino acids, up to 240 amino acids, up to 230 amino acids, up to 220 amino acids, up to 210 amino acids, up to 200 amino acids; and/or at least 110 amino acids, at least 120 amino acids, at least 130 amino acids, at least 140 amino acids, at least 150 amino acids, at least 160 amino acids, at least 170 amino acids, at least 180 amino acids, at least 190 amino acids, at least 200 amino acids, at least 210 amino acids, at least 220 amino acids, at least 230 amino acids, at least 240 amino acids, at least 250 amino acids, at least 260 amino acids, at least 270 amino acids, or at least 280 amino acids.
[0036] In any case, the soluble Amuc_1100 protein or the fragment thereof must be selected such that it maintains at least in part the functional properties observed for Amuc_1100 of SEQ ID NO: 2. The term “functionally equivalent” or “functional properties” as used herein is intended to mean that the candidate protein maintains at least in part the property to increase the transepithelial electrical resistance (TEER), and/or the TLR-2 agonistic activity, observed for Amuc_1100 of SEQ ID NO: 2.
[0037] TLR-2 agonistic activity of the full length Amuc_1100 of SEQ ID NO: 2. TLR-2 agonistic activity can be determined using methods as described in the prior art, for example as described in Ottman et al. PLOS One 12(3): e0173004. Briefly, HEK-Blue hTLR2 cells (Invivogen, CA, USA) are grown and subcultured up to 70-80% of confluency using DMEM supplemented with 4.5 g/I D-glucose, 50 U/ml penicillin, 50 μg/ml streptomycin, 100 μg/ml Normocin, 2 mM L-glutamine, and 10% (v/v) of heat-inactivated FBS. For the experiment, cells are seeded in 180 μl in flat bottom 96-well plates and stimulated by addition of Amuc_1100 (fragment) protein to a final concentration of 5 μg/ml. Pam3CSK4 (10 ng/ml) are used as positive control, and culture medium is used as negative control. The 96-well plates are incubated for 20-24 hours at 37° C. in a 5% CO2 incubator. Stimulation of the hTLR2 receptor activates NF-κB and AP-1, which induces the production of secreted embryonic alkaline phosphatase (SEAP), the levels of which are measured spectrophotometrically. SEAP secretion is detected by measuring the OD600 at 1 hour after addition of 180 μl of QUANTI-Blue (Invivogen) to 20 μl of induced HEK-Blue hTLR2 supernatant. Experiments are performed in triplicate. The candidate soluble Amuc_1100 or the fragment thereof are considered to have or maintain TLR-2 agonistic activity in case its TLR-2 signalling activity, as determined using the foregoing assay, is at least 50% of the TLR-2 signalling activity of Amuc_1100 of SEQ ID NO: 2, such as at least 60% of the TLR-2 signalling activity of Amuc_1100 of SEQ ID NO: 2, such as at least 70% of the TLR-2 signalling activity of Amuc_1100 of SEQ ID NO: 2, such as at least 75% of the TLR-2 signalling activity of Amuc_1100 of SEQ ID NO: 2, such as at least 80% of the TLR-2 signalling activity of Amuc_1100 of SEQ ID NO: 2, for example at least 85% of the TLR-2 signalling activity of Amuc_1100 of SEQ ID NO: 2 as measured in the above-described assay.
[0038] In addition, or alternatively, the property to increase the development of transepithelial electrical resistance can be tested for using the transepithelial electrical resistance (TEER) assay, as described in Ottman et al. PLOS One 12(3): e0173004. Briefly, 5×10.sup.4 Caco-2 cells/insert are seeded in Millicell culture inserts with a 3 μm pore size (Merck Millipore) and grown for 8 days, whereas the growth conditions are as described in Kainulainen et al. BMC microbiology, 2015, 15(1): 4, incorporated herein by reference. Transepithelial resistance is determined using a Millicell ERS-2 TEER meter (Merck Millipore) from Caco-2 cell cultures at 0 h, and 24 h after addition of 0.5 μg/ml of Amuc_1100 protein. The candidate soluble Amuc_1100 or the fragment thereof are considered to have or maintain the property to increase the development of transepithelial electrical resistance (TEER) in case its increase in TEER compared to medium control, as determined using the foregoing assay, is at least 50% of the increase in TEER observed for Amuc_1100 of SEQ ID NO: 2, such as at least 60% of the increase in TEER observed for Amuc_1100 of SEQ ID NO: 2, such as at least 70% of the increase in TEER observed for Amuc_1100 of SEQ ID NO: 2, such as at least 75% of the increase in TEER observed for Amuc_1100 of SEQ ID NO: 2, such as at least 80% of the increase in TEER observed for Amuc_1100 of SEQ ID NO: 2, for example at least 85% of the increase in TEER observed for Amuc_1100 of SEQ ID NO: 2 as measured in the above-described assay.
[0039] Due to the degeneration of the genetic code, one and the same amino acid sequence can be encoded by different nucleic acid sequences. Indeed, different microorganisms have different preferences for encoding a particular amino acid. Depending on the abundance of the respective tRNAs in said microorganisms, expression of a gene product can be further improved by optimizing the nucleic acid sequence to the codon usage of the respective host. Thus, in embodiments, said nucleic acid sequence encoding for Amuc_1100 or a fragment thereof can be optimized for expression in a genus selected from the group of Bifidobacterium, Bacillus, Brevibacillus, Lactococcus and Saccharomyces. For example, said nucleic acid sequence may have a sequence selected from SEQ ID NO: 3 to SEQ ID NO: 7.
[0040] Within this context, said nucleic acid sequence encoding for Amuc_1100 or a fragment thereof has at least 70% sequence identity to SEQ ID NO: 1 (Amuc_1100), such as at least 72% sequence identity to SEQ ID NO: 1, such as at least 74% sequence identity to SEQ ID NO: 1, such as at least 76% sequence identity to SEQ ID NO: 1, such as at least 78% sequence identity to SEQ ID NO: 1, such as at least 80% sequence identity to SEQ ID NO: 1, such as at least 82% sequence identity to SEQ ID NO: 1, such as at least 84% sequence identity to SEQ ID NO: 1, such as at least 86% sequence identity to SEQ ID NO: 1, such as at least 88% sequence identity to SEQ ID NO: 1, such as at least 90% sequence identity to SEQ ID NO: 1, such as at least 92% sequence identity to SEQ ID NO: 1, such as at least 94% sequence identity to SEQ ID NO: 1, such as at least 96% sequence identity to SEQ ID NO: 1, such as at least 97% sequence identity to SEQ ID NO: 1, such as at least 98% sequence identity to SEQ ID NO: 1, or at least 99% sequence identity to SEQ ID NO: 1. A nucleic acid sequence comparison can be conducted using a sequence comparison and alignment tool, such as the publicly available program BLASTn, wherein sequence identity is intended to mean the identity of two nucleotides at the same position, when both sequences are aligned, and over the total length of SEQ ID NO: 1 (864 nucleotides).
[0041] In embodiments of the present invention, said soluble form of Amuc_1100 or a functionally equivalent fragment of said soluble form of Amuc_1100 does not need to comprise such a purification tag, as it is not required nor intended to purify Amuc_1100.
[0042] Moreover, while food-grade expression systems are disclosed for primary use in organisms of the genus Lactobacillus, in embodiments these expression systems are used in genera other than Lactobacillus, in which these food-grade expression vectors are also functional.
[0043] One useful example of said food-grade expression vector is p3050alrAmuc1100-sh71 (SEQ ID NO: 9) or p3050Alr_Amuc1100-sh71 with 5′UTR, 3′UTR and terminator (SEQ ID NO: 15). Many (shuttle) vectors for gram positive bacteria or for yeasts may be used, this particular vector is however the highest yielding.
[0044] In a further optional embodiment, the food-grade expression vector has an additional ethanol inducible promoter AlcA followed by human aldehyde dehydrogenase 1B1 (UniProt P30837; SEQ ID NO: 10). A corresponding food-grade expression vector is exemplified in SEQ ID NO: 11. Said vector is able to additionally express aldehyde dehydrogenase following the consumption of potable ethanol. Acetaldehyde, a metabolite of ethanol, is carcinogenic and the expression vector enables providing aldehyde dehydrogenase locally to colon, so to turn acetaldehyde into acetic acid. At the same time, it is reported that aldehyde dehydrogenase 1 expression is significantly higher in lean mice than in obese mice (Singh et al., Biochem Biophys Res Commun. 2015; 463(4): 768-773; and Yasmeen et al., Diabetes 2013; 62: 124-136; each of which is incorporated herein by reference).
[0045] Further disclosed is a method of preparing a probiotic as disclosed herein above, wherein the method comprises the step of introducing a food-grade expression vector, which vector comprises in functional linkage a nucleic acid sequence encoding for a soluble form of Amuc_1100 or a fragment of said soluble form of Amuc_1100, into a GRAS microbiological organism, such that said GRAS microbiological organism is capable of expressing and secreting said soluble form of Amuc_1100 or said fragment thereof.
[0046] Methods for introducing the vector into the GRAS microbiological organism are known in the art, and include, for example, electroporation techniques, or heat-shock techniques.
[0047] The link between gut microbiota and health is well-recognized and described, and biotherapeutic strategies evolved in the recent years, including fecal microbiota transplant (FMT), as also reviewed in Hage et al. Frontiers in Microbiology 2017, 8: article 1889, the content of which is incorporated by reference. Moreover, Plovier et al. (Nature Medicine 2016, doi: 10.1038/nm.4236, the content of which is incorporated herein by reference) and Ottman et al. (PLOS One 2017, 12(3): e0173004, the content of which is incorporated herein by reference) demonstrate that Akkermansia muciniphila or the pasteurized bacterium improve metabolism in obese and diabetic mice. It was furthermore shown that these beneficial health effects are due to a membrane protein, Amuc_1100. When added as a His-tagged purified protein in soluble form, the following beneficial health effects were observed: a reduction in body weight gain, a reduction in fat mass gain, a decrease in intestinal energy absorption, normalization of plasma LPS concentration, normalizing/reducing plasma cholesterol (in particular HDL-levels), normalizing/reducing plasma triglyceride levels, and normalizing/reducing plasma glucose levels, and improving the intestinal barrier function (as can be followed, for example, by an increase in the development of transepithelial electrical resistance).
[0048] In addition, it was demonstrated Ottman et al. (PLOS One 2017, 12(3): e0173004, the content of which is incorporated herein by reference) that the soluble, His-tagged Amuc_1100 purified protein has TLR-2 agonistic activity, and is thus considered to be involved with cross-talk with the host. In the intestine, TLR-2 regulates the expression of CYP1A1, an enzyme which is key in detoxication of certain carcinogenic substances. Recently, it was found that TLR-2 is involved in the activation of regulatory T cells (Tregs), that act to suppress immune response, thereby maintaining homeostasis and self-tolerance. It has been shown that Tregs are able to inhibit T cell proliferation and cytokine production and play a critical role in preventing autoimmunity. TLR-2 is also expressed by intestinal epithelial cells and subsets of lamina propria mononuclear cells in the gastrointestinal tract. TLR-2 has been observed downregulated in human papillomavirus-positive neoplastic keratocytres derived from uterine cervical preneoplastic lesions. Thus, TLR-2 is assumed to be associated with tumorigenesis.
[0049] Thus, in a further aspect, the above-described probiotic is for use in medicine for therapeutic purposes. Likewise, disclosed is the use of a probiotic as defined herein above for the manufacture of a medicament. Accordingly, also provided is a method of treatment of a patient, comprising the step of orally administering a probiotic as defined herein above to said patient. The patient may be a mammal, in particular a dog, cat, rat, or mouse. Preferably, the patient is a human patient. Dosages (cfu) will vary based on the formulation, the indication, and the physical state of the patient (for example dependent on the age and/or weight), but are commonly in the range of 10.sup.9 to 10.sup.10 CFU/day. Suitable dosages can be determined by a person skilled in the art.
[0050] More specifically, the probiotic is for use in the treatment of obesity, diabetes, and/or hypercholesterolemia. Hence, the probiotic may be used for the manufacture of a medicament for the treatment of obesity, diabetes, and/or hypercholesterolemia.
[0051] Provided is thus a method for treating obesity, diabetes, and/or hypercholesterolemia in a patient, such as a human patient, comprising the step of orally administering a probiotic as defined herein above to said patient. Similarly, also provided is a method for (i) reducing body weight gain, (ii) reducing fat mass gain, (iii) decreasing intestinal energy absorption, (iv) normalizing plasma LPS concentration, (v) normalizing/reducing plasma cholesterol (in particular HDL-levels), (vi) normalizing/reducing plasma triglyceride levels, and (vii) normalizing/reducing plasma glucose levels, and (viii) improving the intestinal barrier function in a patient, such as a human patient, comprising the step of orally administering a probiotic as defined herein above to said patient.
[0052] As used herein, the term “or” has the meaning of both “and” and “or” (i.e. “and/or”). Furthermore, the meaning of a singular noun includes that of a plural noun and thus a singular term, unless otherwise specified, may also carry the meaning of its plural form. In other words, the term “a” or “an” may mean one or more.
[0053] It is apparent to the skilled reader that, as technology develops, the basic idea of the invention can be accomplished in many different ways. The invention and its embodiments are therefore not confined to the examples described above, but may vary in the framework of patent requirements and the below claims.
Example
[0054] If not otherwise stated, the following example uses routine methods of molecular biology, as also described in reference textbooks in the art, in particular with regard to techniques concerning molecular cloning, polymerase chain reaction, and gel electrophoresis. See, for example, ‘Molecular Cloning: A Laboratory Manual’ by Michael Green and Joseph Sambrook, 4th edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
[0055] In order to construct a food-grade expression and secretion vector comprising a nucleic acid sequence encoding for a soluble form of Amuc_1100, the plasmid p3050sNucA-sh71 was selected as the starting point. The plasmid p3050sNucA-sh71 is based on pSIP411, described in Sørvig et al. Microbiology 2005, 151(7): 2439-2449 (the disclosure of which is incorporated herewith by reference), which is also the source of the sh71 replicon. The plasmid p3050sNucA-sh71 and its construction is described in Mathiesen et al. BMC Genomics 2009, 10: 425; and Karlskas et al. PLoS One, 2014, 9(3): e91125, the respective disclosure of which is hereby incorporated by reference. The plasmid p3050sNucA-sh71 (see FIG. 1 in Karlskås et al.) was first linearized by digestion with 4 restriction enzymes (BamH I, Afl III, Sal I, Hind III) yielding following bands in an agarose gel: 2852 bp (AflIII-SalI), 1962 bp (AflIII-BamHI), 1100 bp (BamHI-AflIII), 307 bp (SalI-HindIII), 178 bp (HindIII-HindIII), 17 bp (HindIII-AflIII), (linear: 2727(AflIII-End), 1962(AflIII-BamHI), 1100(BamHI-AflIII), 307(SalI-HindIII), 178(HindIII-HindIII), 125(Start-SalI), 17(HindIII-AflIII)).
[0056] The bands containing the erythromycin resistance marker gene at 1.1 kb and NucA fragments at 0.3 kb and 0.2 kb were discarded, and the DNA was cleaned.
[0057] The sh71-replicon (2 kb band) was ligated back to the backbone leaving BamHI-AflIII and SalI-HindIII restriction site pairs open to which alanine racemase and Amuc_1100 inserts were then ligated.
[0058] The food-grade alanine racemase (alr) marker gene and its isolation is described in Nguyen et al. J. Agric. Food Chem. 2011, 59, 5617-5624, the content of which is incorporated herein by reference. The following is the sequence of the alr marker gene in 5′ to 3′-direction:
alanine racemase (alr) (SEQ ID NO: 8):
TABLE-US-00002 atgcaagcgg caactgttgt gattaaccgc cgcgctctgc gacacaacct gcaacgtctt 60 cgtgaactgg cccctgccag taaaatggtt gcggtggtga aagcgaacgc ttatggtcac 120 ggtcttcttg agaccgcgcg aacgctcccc gatgctgacg cctttggcgt agcccgtctc 180 gaagaagctc tgcgactgcg tgcgggggga atcaccaaac ctgtactgtt actcgaaggc 240 ttttttgatg ccagagatct gccgacgatt tctgcgcaac attttcatac cgccgtgcat 300 aacgaagaac agctggctgc gctggaagag gctagcctgg acgagccggt taccgtctgg 360 atgaaactcg ataccggtat gcaccgtctg ggcgtaaggc cggaacaggc tgaggcgttt 420 tatcatcgcc tgacccagtg caaaaacgtt cgtcagccgg tgaatatcgt cagccatttt 480 gcgcgcgcgg atgaaccaaa atgtggcgca accgagaaac aactcgctat ctttaatacc 540 ttttgcgaag gcaaacctgg tcaacgttcc attgccgcgt cgggtggcat tctgctgtgg 600 ccacagtcgc attttgactg ggtgcgcccg ggcatcattc tttatggcgt ctcgccgctg 660 gaagatcgct ccaccggtgc cgattttggc tgtcagccag tgatgtcact aacctccagc 720 ctgattgccg tgcgtgagca taaagccgga gagcctgttg gttatggtgg aacctgggta 780 agcgaacgtg atacccgtct tggcgtagtc gcgatgggct atggcgatgg ttatccgcgc 840 gccgcgccgt ccggtacgcc agtgctggtg aacggtcgcg aagtaccgat tgtcgggcgc 900 gtggcgatgg atatgatctg cgtagactta ggtccacagg cgcaggacaa agccggggat 960 ccggtcattt tatggggcga aggtttgccc gtagaacgta tcgctgaaat gacgaaagta 1020 agcgcttacg aacttattac gcgcctgact tcaagggtcg cgatgaaata cgtggattaa 1080
[0059] For introducing same into the backbone vector, the alr selection marker was PCR-amplified with 5′ BamHI and 3′ AflIII restriction sites.
[0060] The complete nucleic acid sequence encoding for Amuc_1100 is publicly available from the KEGG GENOME Database under reference ID T00376. Isolation of Amuc_1100 from Akkermansia muciniphila is also described in Plovier et al. Nature Medicine, doi: 10.1038/nm.4236, the disclosure of which is incorporated herein by reference. The nucleic acid sequence encoding a soluble form of Amuc_1100 (i.e. an Amuc_1100 encoding gene insert lacking it's signal sequence in the N-terminal residues 1-30) was synthesized with 5′ SalI and 3′ HindIII-sites, and cloned into the above-mentioned vector backbone.
[0061] The following is the nucleic acid sequence encoding the soluble form of Amuc_1100, which lacks the first 30 N-terminal residues (in 5′ to 3′ direction): p3050Alr_Amuc1100_sh71 (SEQ ID NO: 9):
TABLE-US-00003 atcgtcaatt ccaaacgcag tgaactggac aaaaaaatca gcatcgccgc caaggaaatc 60 aagtccgcca atgctgcgga aatcactccg agccgatcat ccaacgaaga gctggaaaaa 120 gaactgaacc gctatgccaa ggccgtgggc agcctggaaa cggcctacaa gcccttcctt 180 gcctcctccg cgctggtccc caccacgccc acggcattcc agaatgaact gaaaacattc 240 agggattccc tgatctcctc ctgcaagaaa aagaacattc tcataacgga cacatcctcc 300 tggctcggtt tccaggttta cagcacccag gctccctctg ttcaggcggc ctccacgctg 360 ggttttgaat tgaaagccat caacagcctg gtcaacaaac tggcggaatg cggcctgtcc 420 aaattcatca aggtgtaccg cccccagctc cccattgaaa ccccggcgaa caatccggaa 480 gaatcggacg aagccgacca ggccccatgg actcccatgc ctctggaaat agccttccag 540 ggcgaccggg aaagtgtatt gaaagccatg aacgccataa ccggcatgca ggactatctg 600 ttcacggtca actccatccg tatccgcaac gaacggatga tgccccctcc catcgccaat 660 ccggcagccg ccaaacctgc cgcggcccaa cccgccacgg gtgcggcttc cctgactccg 720 gcggatgagg cggctgcacc tgcagccccg gccatccagc aagtcatcaa gccttacatg 780 ggcaaggagc aggtctttgt ccaggtctcc ctgaatctgg tccacttcaa ccagcccaag 840 gctcaggaac cgtctgaaga ttaa 864
[0062] The construct, p3050Alr_Amuc1100_sh71 (SEQ ID NO: 9), was then verified by DNA-sequencing and electrotransformed into the following competent probiotic strains:
Genus
[0063] ->species
Lactobacillus
[0064] L. rhamnosus [0065] L. acidophilus [0066] L. plantarum [0067] L. casei [0068] L. delbrueckii subsp. bulgaricus [0069] L. brevis [0070] L. johnsonii [0071] L. fermentum [0072] L. reuteri
Bifidobacterium
[0073] B. infantis [0074] B. animalis subsp. lactis [0075] B. bifidum [0076] B. longum [0077] B. breve
Brevibacillus brevis
Lactococcus
[0078] L. lactis subsp. lactis
Enterococcus
[0079] E. durans [0080] E. faecium
Streptococcus
[0081] S. thermophilus
Pediococcus
[0082] P. acidilactici
Leuconostoc
[0083] L. mesentoroides
Bacillus
[0084] B. coagulans [0085] B. subtilis [0086] B. cereus
Saccharomyces
[0087] S. boulardii
[0088] Every recombinant strain secreted the protein Amuc_1100, when running the supernatant on a SDS-PAGE, and stained with Coomassie Blue.