Transgenic cloned piglet expressing human proinsulin and method of producing the same

11149284 · 2021-10-19

Assignee

Inventors

Cpc classification

International classification

Abstract

A transgenic cloned piglet expressing human proinsulin and a method of preparing the same, and more particularly, to a recombinant vector for human proinsulin expression, a genetically modified cell line into which the recombinant vector is introduced, a transgenic cloned piglet expressing human proinsulin, and a method of producing the same.

Claims

1. A method of producing a transgenic, cloned piglet expressing human proinsulin, the method comprising: genetically modifying a porcine nuclear donor cell by: introducing into the cell a first recombinant vector encoding a sgRNA and Cas9 wherein said first recombinant vector results in knockout of the porcine insulin gene in the genome of the cell, thereby forming a first genetically modified porcine donor cell, transferring the nucleus from the first genetically modified porcine donor cell into a first denucleated porcine oocyte by electrofusing and activating a cell couplet comprising the first genetically modified donor cell and first denucleated porcine oocyte to form a first porcine embryo, transplanting the first porcine embryo to the fallopian tube of a porcine surrogate mother to produce a first transgenic, cloned piglet that fails to express porcine proinsulin, isolating a somatic cell from the first transgenic cloned piglet and introducing into said cell from the first transgenic piglet a second recombinant vector encoding human proinsulin operably linked to the rat insulin II gene promoter and mouse PDX-1 enhancer, thereby forming a second genetically modified porcine donor cell, transferring the nucleus from the second genetically modified porcine donor cell into a second denucleated porcine oocyte by electrofusing and activating a cell couplet comprising the second genetically modified porcine donor cell and second denucleated porcine oocyte to form a second porcine embryo, transplanting the second porcine embryo to the fallopian tube of a porcine surrogate mother to produce a transgenic cloned piglet that fails to express porcine proinsulin and that expresses human proinsulin.

2. The method of claim 1, wherein the second recombinant vector encoding human proinsulin is set forth by SEQ ID NO: 3.

3. The method of claim 1, wherein the sgRNA is encoded by the nucleotide sequence set forth in SEQ ID NO: 5 or 6.

4. The method of claim 1, wherein the first recombinant vector comprises the sequence set forth by SEQ ID NO: 7.

5. The method of claim 1, wherein the somatic cell is a fibroblast.

6. The method of claim 1, wherein the second genetically modified porcine donor cell is deposited as Accession No. KCLRF-BP-00408.

7. A transgenic cloned piglet expressing human proinsulin, the transgenic cloned piglet being produced by the method of claim 1.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 is a schematic diagram of a human proinsulin nucleotide fragment according to the present disclosure;

(2) FIG. 2 illustrates a vector map of a recombinant vector for human proinsulin expression according to the present disclosure;

(3) FIG. 3 is a diagram illustrating sequences of an INS gene targeted by an INS (insulin) gene knockout recombinant vector;

(4) FIG. 4 illustrates a vector map of an INS gene knockout recombinant vector;

(5) FIG. 5A illustrates the results of analysis of T7 endonuclease I of transgenic cloned piglets expressing human proinsulin according to the present disclosure;

(6) FIG. 5B illustrates the results of sequencing of T7 endonuclease I of transgenic cloned piglets expressing human proinsulin according to the present disclosure;

(7) FIG. 6 illustrates the results of confirming insertion of a human proinsulin coding sequence into a transgenic cloned piglet expressing human proinsulin according to the present disclosure;

(8) FIG. 7 illustrates the results of measuring insulin level in serum of a transgenic cloned piglet expressing human proinsulin according to the present disclosure;

(9) FIG. 8 illustrates the results of immunohistochemically analyzing pancreatic β-cells of a transgenic cloned piglet expressing human proinsulin according to the present disclosure;

(10) FIG. 9 illustrates the results of measuring blood glucose level of a transgenic cloned piglet expressing human proinsulin according to the present disclosure; and

(11) FIG. 10 illustrates the results of separating pancreatic protein lysates from a transgenic cloned piglet expressing the human proinsulin according to the present disclosure to analyze peptides thereof.

(12) FIG. 11 illustrates a vector map of a recombinant vector of the present invention.

DETAILED DESCRIPTION

(13) In the following detailed description, reference is made to the accompanying drawing, which forms a part hereof. The illustrative embodiments described in the detailed description, drawing, and claims are not meant to be limiting. Other embodiments may be utilized, and other changes may be made, without departing from the spirit or scope of the subject matter presented here.

(14) Hereinafter, the present disclosure is described in detail.

(15) According to an aspect of the present disclosure, the present disclosure provides the recombinant vector for human proinsulin expression, which includes a human proinsulin gene represented by the nucleotide sequence of SEQ ID NO: 1, an enhancer and a promoter.

(16) In the present disclosure, “proinsulin” refers to a precursor of insulin produced in pancreatic β-cells of the islet of Langerhans in the pancreas, which consists of A and B chains and the C-peptide linking them. Further, the proinsulin is synthesized in rough endoplasmic reticulum of cells and is cleaved at the Golgi body to divide into C-peptide and insulin including A and B chains.

(17) In the present disclosure, the sequence encoding human proinsulin is preferably represented by the nucleotide sequence of SEQ ID NO: 1. Further, the recombinant vector for human proinsulin expression may include functional equivalents of the human proinsulin represented by the nucleotide sequence of SEQ ID NO: 1. The term “functional equivalent” refers to one having sequence homology of at least 70%, preferably at least 80%, more preferably at least 90%, further more preferably at least 95% compared with the nucleotide sequence of SEQ ID NO: 1, which is caused by the results of base deletion, substitution, and insertion and thus means a polynucleotide having substantially the same physiological activity as a polynucleotide represented by the nucleotide sequence of SEQ ID NO: 1. “% of sequence homology” to polynucleotides is confirmed by comparing the comparison region and two optimally aligned sequences, and a portion of the polynucleotide sequence in the comparison region may include the addition or deletion (that is, gap) compared to the reference sequence (without addition or deletion) for the optimal alignment of the two sequences.

(18) In the present disclosure, the term “vector” refers to a gene product including a nucleotide sequence operably linked to a suitable regulatory sequence so that the target gene can be expressed in a suitable host, and the regulatory sequence may include a promoter being capable of initiating transcription, any operator sequences for modulating such transcription and sequences regulating the termination of translation and transcription. The vector of the present disclosure is not particularly limited as long as it is capable of being cloned in cells and may include any vector known in the art. For example, it may be a plasmid, a cosmid, a phage particle or a viral vector.

(19) In the present disclosure, the term “recombinant vector” may be used as a vector that can express the target polypeptide at a high efficiency in a suitable host cell when the coding gene of the target polypeptide to be expressed is operatively linked, which can be expressed in host cells. The host cell may preferably be a eukaryotic cell. An expression regulatory sequence such as a promoter, a terminator and an enhancer, a sequence for membrane targeting or secretion can be suitably selected depending on the type of the host cell and can be variously combined according to the purpose.

(20) In the present disclosure, the term “promoter” refers to a DNA sequence site to which transcriptional regulatory factors bind, which is intended to induce overexpression of the target gene. Examples of the promoter include Pribnow box, TATA box, and the like.

(21) In one embodiment of the present disclosure, the promoter of a rat insulin II gene is used as a promoter.

(22) In the present disclosure, the term “enhancer” is a site that induces structural changes in a DNA template to make the transcription more active. The enhancer is represented by a unique nucleotide sequence to each gene and promotes transcription at any site in the gene.

(23) In one embodiment of the present disclosure, an enhancer of a mouse PDX-1 gene is used as an enhancer.

(24) In the present disclosure, it is preferable that the recombinant vector is represented by the nucleotide sequence of SEQ ID NO: 3, which is an illustrative example only and the present disclosure is not limited thereto.

(25) In the present disclosure, the recombinant vector has a vector map as exhibited in FIG. 11. As long as the recombinant vector has the constitution of a vector capable of expressing the human proinsulin of the present disclosure, the present disclosure is not limited thereto.

(26) According to another aspect of the present disclosure, the present disclosure provides a transformed cell line prepared by introducing the recombinant vector for human proinsulin expression into somatic cells.

(27) The transformed cell line is preferably further transformed by an INS (insulin) gene knockout recombinant vector. More specifically, the INS gene knockout recombinant vector is introduced into the somatic cells for primary transformation. The recombinant vector for expressing human proinsulin is introduced into the primary transformed somatic cell for secondary transformation. Thus, the secondary transformed cell line can be produced. Further, the two vectors may be sequentially introduced into somatic cells as described above or may be simultaneously introduced into somatic cells to result in the transformation. However, the present invention is not limited thereto. The INS gene knockout recombinant vector is intended to remove porcine proinsulin, which includes Cas9 gene and a nucleotide sequence encoding sgRNA represented by SEQ ID NO.: 5 or 6, preferably represented by SEQ ID NO.: 7, but the present disclosure is not limited thereto.

(28) In the present disclosure, the term “cell line” refers to each individual of the cell system when the cells are separated, cultured and sub-cultured in which the cell line can be distinguished from other cell lines by genetic traits, and the original genetic trait is maintained during the sub-culture.

(29) In the present disclosure, the cell line may be an oocyte cell line, a fibroblast cell line or a renal cell line, preferably a fibroblast cell line. More specifically, a fetal-derived cell line is used as a cell line. A primary cell line may be used at one time. Thus, a primary renal cell line or a primary fibroblast line is more preferably used as the cell line of the present disclosure. The primary fibroblast cell line is most preferably used.

(30) In the present disclosure, the term “transformation” refers to the change in the genetic properties of a living organism caused by DNA given from outside, which is also referred to as transfection, transfiguration, or conversion. In other words, “transformation” means introducing a gene into a host cell so that the gene may be expressed in the host cell.

(31) In the method for introducing the recombinant vector for human proinsulin expression of the present disclosure into cell lines to result in the transformation, it may be transformed by introducing the same into eukaryotic cells using conventional methods such as nucleofection, transient transfection, microinjection, transduction, cell fusion, calcium phosphate precipitation, liposome-mediated transfection, DEAE dextran-mediated transfection, polybrene-mediated transfection, and electroporation.

(32) In one embodiment of the present disclosure, after the primary transformation, the recombinant vector for human proinsulin expression is introduced into the primary transformed cell line by the nucleofection to prepare the secondary transformed cell line.

(33) In the present disclosure, the transformed cell line was deposited at the Korean Cell Line Bank on Sep. 6, 2017, and accession number KCLRF-BP-00408 was received.

(34) According to still another aspect of the present disclosure, the present disclosure provides a method of producing a transgenic cloned piglet expressing human proinsulin, which includes nuclear-transferring the transformed cell line into a denucleated oocyte to prepare a reconstituted oocyte and transplanting the reconstituted oocyte into a fallopian tube of a surrogate.

(35) In the present disclosure, the method of producing the transgenic cloned piglet may further include, before nuclear-transferring, preparing a vector for human proinsulin expression, introducing the proinsulin expression vector into somatic cells to prepare a transformed cell line, and denucleating an oocyte.

(36) In the present disclosure, the term “denucleated oocyte” refers to an oocyte from which the nucleus has been removed.

(37) In the present disclosure, the term “nuclear-transfer” refers to a genetic engineering technique in which cells without nucleus are artificially combined with nuclei of other cells to have the same traits and is preferably performed by methods known in the art.

(38) According to yet another aspect of the present disclosure, a transgenic cloned piglet prepared according to the method of producing a transgenic cloned piglet expressing human proinsulin is provided. The transgenic cloned piglet has 4 and 36 bases deleted in the porcine proinsulin gene locus and has a genotype in which the human proinsulin coding sequence is inserted into in the porcine genome.

(39) Therefore, the transgenic cloned piglet expressing the human proinsulin gene according to the present disclosure may be used not only in the field of xenotransplantation but also in the field of prevention and treatment of diabetes and its complications through human proinsulin production.

(40) Hereinafter, the present disclosure will be described in more detail with reference to examples. It is apparent to those skilled in the art that these examples are merely illustrative of the present disclosure and that the scope of the present disclosure is not to be construed as limited by these examples.

Example 1. Construction of Recombinant Vector Expressing Human Proinsulin

(41) For the human proinsulin expression, a human proinsulin nucleotide fragment including an enhancer and a promoter was synthesized and inserted into a plasmid vector to construct a recombinant vector for human proinsulin expression.

(42) 1-1. Synthesis of Human Proinsulin Nucleotide Fragment

(43) The human proinsulin nucleotide fragment was synthesized using the human proinsulin coding sequence (CDS) represented by the nucleotide sequence of SEQ ID NO: 1, the mouse PDX-1 gene enhancer, and the rat insulin II promoter. Specifically, the human proinsulin nucleotide fragment was designed in which the rat insulin II promoter was linked to the 3′ terminal of the PDX-1 enhancer, and the human proinsulin coding sequence was linked to the 3′ terminal of the rat insulin II promoter, which was synthesized by the method known in the art. The human proinsulin nucleotide fragment is represented by SEQ ID NO: 2, and a schematic diagram thereof is illustrated in FIG. 1.

(44) 1-2. Construction of Recombinant Vector for Human Proinsulin Expression

(45) The human proinsulin nucleotide fragment prepared in Example 1-1 was inserted into pCAG 1.1 vector using restriction enzymes BglII and XhoI (New England Biolabs, MA, USA).

(46) The recombinant vector for human proinsulin expression constructed by the process as described above is represented by the nucleotide sequence of SEQ ID NO: 3, and its vector map and the position of each gene are illustrated in FIG. 2.

Example 2. Production of Proinsulin Knockout Piglet

(47) For the production of proinsulin knockout piglet, INS (insulin) gene knockout recombinant vector including sgRNA (small guide RNA) and Cas9 gene represented by the nucleotide sequence of SEQ ID NO: 5 or 6 was prepared using CRISPR/Cas 9 system. The prepared INS gene recombinant vector targets the sequence in the porcine INS gene, and each sgRNA-targeting sequence is illustrated in FIG. 3. The INS gene knockout recombinant vector is represented by the nucleotide sequence of SEQ ID NO: 7, and its vector map is illustrated in FIG. 4.

(48) The INS gene knockout recombinant vector was introduced into a fibroblast using Nucleofector™ (LONZA, Basel, Switzerland) for primary genetic modification. The fibroblast was isolated from PWG micropig and maintained in DMEM (Biowest, Nuaille, France) medium including 20% fetal bovine serum and 1% penicillin-streptomycin (Gibco, CA, USA) under a condition of 5% carbon dioxide and 37° C. After 48 hours of transfection, cell sorting was performed using a cell sorter. The sorted cell was seeded and cultured using a limiting dilution method to prepare single cell-derived transformed cell line. The INS gene knockout cell line was used as a donor cell for somatic cell nuclear transfer (SCNT).

(49) In order to transplant the nuclei into somatic cells, a denucleated oocyte was prepared. The INS gene knockout cell line was inserted into the prepared denucleated oocyte, and an electric pulse was applied to prepare a reconstructed oocyte. The denucleated oocyte was transplanted into the fallopian tube of a surrogate, and about 114 days later, the proinsulin knockout piglet was taken out of the surrogate by a C-section.

(50) The produced proinsulin knockout piglet is characterized in which all or part of the DNA strand encoding the INS gene is modified so that the porcine insulin is not expressed.

Example 3. Preparation of Secondary Genetically Modified Cell Expressing Human Proinsulin

(51) The porcine primary fibroblast was isolated from the proinsulin knockout piglet produced in Example 2 as described above. The porcine primary fibroblast was cultured in DMEM (Biowest, Nuaille, France) medium including 20% fetal bovine serum and 1% penicillin-streptomycin (Gibco, CA, USA) under a condition of 5% carbon dioxide and 37° C.

(52) For the secondary genetic modification of the INS gene knockout porcine primary fibroblast, the recombinant vector for human proinsulin expression constructed in Example 1 was introduced into the porcine primary fibroblast using Nucleofector™ (LONZA, Basel, Switzerland) for the secondary genetic modification. After 42 hours from the introduction of the recombinant vector into the porcine primary fibroblast, the transgenic cells were cultured for 2 weeks in the presence of neomycin (G418) to select a genetically modified cell line having antibiotic resistance. The secondary genetically modified cell line was used as a donor cell for somatic cell nuclear transfer (SCNT).

(53) The donor cell line produced by the process as described above has the properties of knocking out the porcine proinsulin (primary genetic modification) and expressing human proinsulin (secondary genetic modification), and it was deposited at the Korean Cell Line Bank on Sep. 6, 2017, and accession number KCLRF-BP-00408 was received.

Example 4. Production of Transgenic Cloned Piglet Expressing Human Proinsulin Gene

(54) 4-1. Used Pig

(55) The pigs used as surrogate mothers were raised in Mgenplus Co., Ltd., Korea. All animal experiments were approved by Institutional Animal Care and Use Committee (IACUC) of Mgenplus Co., Ltd., and the following all experimental procedures using pigs were conducted according to the guidelines of the Commission. The surgical procedure was performed under general anesthesia and proceeded to reduce the pain of the animal as far as possible. The pigs were reared under normal livestock conditions.

(56) 4-2. Production of Oocytes for Somatic Cell Nuclear Transfer

(57) To prepare the denucleated oocyte, porcine oocytes collected from the local slaughterhouse were transferred to the laboratory with a condition of the temperature of 25° C. to 30° C. and sodium chloride (NaCl) of 0.9% (w/v). The oocytes were obtained from an antral follicle (3 mm to 6 mm in diameter) and cultured in the mature medium at 5% carbon dioxide and 39° C. After 44 hours of incubation, the matured oocytes were placed in the manipulation medium supplemented with cytochalasin B (5 mg/ml stock, 1.5 μm per 10 ml manipulation medium), and the first polar body and adjacent cytoplasm were removed to result in denucleation using a thin glass pipette (diameter 20 μm). The denucleated oocytes were used as nuclear donor cells on somatic cell nuclear transfer (SCNT).

(58) 4-3. Somatic Cell Nuclear Transfer

(59) One donor cell including the human proinsulin gene of Example 3 was injected into the perivitelline space of the denucleated oocyte prepared in Example 4-2. In the Example, the cell membrane of the donor cell was in contact with the cytoplasmic membrane of the denucleated oocyte. The donor cell-injected oocyte was placed between two platinum electrodes, and an electrical pulse (BTX, two 1.1 kV/cm DC pulses for 60 microseconds) was applied to the two platinum electrodes. As a result, the cytoplasmic membrane of the donor cell and the cytoplasmic membrane of the denucleated oocyte were fused. The reconstituted embryo due to electrical pulses was cultured in PZM3 medium with 0.5 μM Scriptaid, a histone deacetylase inhibitor, at 39° C. and 5% carbon dioxide for 14 hours to 16 hours.

(60) 4-4. Production of Transgenic Cloned Piglet

(61) The reconstructed embryos (average 310) prepared in Example 4-3 were transplanted into each of 5 surrogate mothers, and 4 surrogate mothers among them were pregnant. About 114 days after pregnancy, C-section was performed to take out 17 transgenic cloned piglets (including 6 stillborn babies) from the surrogate mothers.

Example 5. Analysis of Genotype of Transgenic Cloned Piglet

(62) For the genotype analysis of the transgenic cloned piglets produced in Example 4, a tail biopsy was performed on each transgenic cloned piglet on the day of birth to obtain a genomic DNA extraction sample thereof. The genomic DNA was extracted from the genomic DNA extraction sample using a genomic DNA extraction kit (iNtRon Biotechnology, Seongnam, Korea) according to the manufacturer's manual. In order to confirm genetic modification of porcine proinsulin gene, PCR on the porcine proinsulin gene locus was performed using Pfu plus 5× master mix (ELPIS biotech, Daejeon, Korea). The primers illustrated in Table 1 as described below were used for the PCR.

(63) TABLE-US-00001 TABLE 1 Nucleotide  Predicted Product sequence (5′.fwdarw.3′) Size (bp) 1st PCR forward CTCCTCTCTCGGAGCCCTT 865 (SEQ ID NO: 8) 1st PCR reverse TTATTGGGTTTTGGGGTGC 865 (SEQ ID NO: 9) 2nd PCR (Nested PCR) GTCCCCCAGGTCCTCACC 558 forward (SEQ ID NO: 10) 2nd PCR (Nested PCR) CCCACCCTGGAGTGGAAG 558 reverse (SEQ ID NO: 11) hINS CDS forward ATGGCCCTGTGGATGCGCCTCCT Human: 333 (SEQ ID NO: 12) Piglet: 718 hINS CDS reverse CTAGTTGCAGTAGTTCTCCAGCT Human: 333 (SEQ ID NO: 13) Piglet: 718

(64) T7 endonuclease I (T7E I) assay and sequencing of the PCR products were carried out, and the results thereof are illustrated in FIG. 5. Further, the addition of the human proinsulin coding sequence (CDS) of the transgenic cloned piglet genome was confirmed using the PCR product, and the results thereof are illustrated in FIG. 6. Wild-type pigs and INS gene targeted pigs (pINS KO) were used as control groups.

(65) As illustrated in FIG. 5A, the transgenic cloned piglet according to the present disclosure exhibited a change in the porcine proinsulin gene locus and exhibited the same cleavage pattern as the genomic DNA of the INS gene knockout pig and donor cells. Further, the results of the sequencing illustrated in FIG. 5B indicates that the transgenic cloned piglet according to the present disclosure exhibited deletion of the same base in the porcine proinsulin gene locus thereas, and 4 bases and 36 bases, respectively, were deleted in alleles.

(66) As illustrated in FIG. 6, bands of human proinsulin and porcine proinsulin were confirmed in the transgenic cloned piglet according to the present disclosure, which appears to be due to the similarity of sequences of human and pig primers. The results indicate that the human proinsulin coding sequence has a length of about 0.3 kb without an intron and the porcine proinsulin has a length of about 0.7 kb with an intron. Further, it was confirmed that #1-L4, #1-L5, #2-L1, and #2-L2 of the transgenic cloned piglets exhibited human proinsulin coding sequences and genomic DNA of porcine proinsulin.

(67) Therefore, it was confirmed that the genotypes of #1-L4, #1-L5, #2-L1, and #2-L2 of the transgenic cloned piglets are such that 4 and 36 bases were deleted in the porcine proinsulin gene locus, and the human proinsulin coding sequence was inserted into the porcine genome.

Example 6. Phenotypic Analysis of Transgenic Cloned Piglet

(68) 6-1. Measurement of Insulin Concentration in Serum

(69) The blood of the transgenic cloned piglet was collected to measure the concentration of insulin included in the serum of the transgenic cloned piglet prepared in Example 4. The collected blood was centrifuged to separate the serum. The human insulin concentration of the serum was measured using an insulin ELISA kit (Mercodia, Uppsala, Sweden). The result of measuring the insulin concentration of the serum is illustrated in FIG. 7. Wild-type pigs and INS gene targeted pigs (pINS KO) were used as control groups.

(70) As illustrated in FIG. 7, insulin was detected in the serum of the transgenic cloned piglets #1-L2, #1-L3, #1-L4, #1-L5, #2-L1, #3-L1, #3-L2, and #3-L3. In particular, the insulin concentration of #1-L4 was the highest. Further, insulin was not detected in the INS gene targeted pig (pINS KO), which was the control group.

(71) 6-2. Immunohistochemical (IHC) Analysis

(72) Immunohistochemical analysis was performed on the pancreatic β-cells of the transgenic cloned piglet in order to confirm the insulin of the transgenic cloned piglet prepared in Example 3. First, the pancreas was isolated from the transgenic cloned piglet and fixed in 10% neutral buffered formalin. The fixed tissue was placed in paraffin to produce a paraffin block, and the paraffin block was divided into two pieces. One of the divided paraffin blocks was H&E stained with a conventional H&E staining kit, and mouse anti-swine insulin (AbD Serotec, Kidlington, UK) was added to the other paraffin block. These were observed with a microscope, and the results are illustrated in FIG. 8. Wild-type pig was used as a control group.

(73) As illustrated in FIG. 8, it was confirmed that insulin was highly expressed in pancreatic β-cells of the transgenic cloned piglets #1-L4 and #1-L5.

(74) 6-3. Measurement of Blood Glucose Level

(75) Non-fasting blood glucose level of insulin of the transgenic cloned piglet produced in Example 3 was measured using ACCU-CHEK® blood glucose meter (Roche, Ind., USA). For the measurement of non-blood glucose level, the transgenic cloned piglet was fed, and the blood thereof was collected every 3 hours. The result of blood glucose measurement of the transgenic cloned piglet is illustrated in FIG. 9. Wild-type pigs and INS gene targeted pigs (pINS KO) were used as control groups.

(76) As illustrated in FIG. 9, blood glucose levels of the transgenic cloned piglets #1-L4, #1-L5 and #2-L2 with high insulin level in the serum, were measured to be similar to that of the wild-type pig.

(77) 6-4. Peptide Analysis of Protein Lysate from Pancreas

(78) Peptide analysis of the protein lysate collected from the pancreas of the transgenic cloned piglet produced in Example 4 was performed. Specifically, SDS-PAGE of the protein lysate collected from the transgenic cloned piglet was conducted, and the target size gel (about 10 kDa) was separated. The separated gel was analyzed using LC-MS/MS, and then the sequence of human proinsulin peptide was confirmed. The results of peptide analysis of the pancreatic protein lysate are illustrated in FIG. 10.

(79) As illustrated in FIG. 10, the peptide with the highest concentration included in the pancreatic protein lysate of the transgenic cloned piglet was detected 25 minutes after the start of the analysis. The result of sequence analysis of the detected peptide indicates that the peptide was a human proinsulin C-peptide represented by the amino acid sequence of SEQ ID NO: 4.

(80) In conclusion, the results as described above indicate that the transgenic cloned piglet expressing human proinsulin according to the present disclosure has 4 and 36 bases deleted in the porcine proinsulin gene locus, the human proinsulin coding sequence has the genotype inserted into the porcine genome, and the human proinsulin is expressed in the body of such transgenic cloned piglet. These indicate that the transgenic cloned piglet can be used as a source animal for the xeno-islet transplantation. The transgenic cloned piglet expressing the human proinsulin gene of the present disclosure can be used in various fields such as xenotransplantation, human proinsulin production, prevention or treatment of diabetes and complications.

(81) From the foregoing, specific portions of the present disclosure have been described in detail. However, it will be apparent by those of ordinary skill in the art that this specific description is merely for preferred embodiments and that the scope of the present disclosure is not limited thereby. Therefore, the substantive scope of the present disclosure is to be defined by the appended claims and their equivalents.

(82) [Access Number]

(83) Name of depositor: Korean Cell Line Bank

(84) Accession number: KCLRF-BP-00408

(85) Date of accession: Sep. 6, 2017

(86) The ASCII text file “Sequence.txt” created on Jul. 9, 2018, having the size of 24 KB, is incorporated by reference into the specification.