LIVER ORGANOID, USES THEREOF AND CULTURE METHOD FOR OBTAINING THEM

Abstract

The invention relates to a liver organoid, uses thereof and method for obtaining them.

Claims

1.-53. (canceled)

54. A composition comprising an organoid, wherein the organoid comprises a cystic structure comprising a layer of cells and a lumen.

55. The composition of claim 54, wherein the organoid is a liver organoid.

56. The composition of claim 54, wherein the organoid comprises (a) a hepatocyte or a cholangiocyte cell, or (b) a hepatocyte and a cholangiocyte cell.

57. The composition of claim 54, wherein the organoid expresses at least one of the following markers: a hepatocyte marker such as albumin, B-1 integrin, transthyretrin and Glutamine synthetase; and/or at least one cholangiocyte maker such as Keratin 7 and 19.

58. The composition of claim 54, wherein (a) between 25% and 45% of the cells comprised by the organoid express a hepatocyte marker, or (b) 35% of the cells comprised by the organoid express a hepatocyte marker.

59. The composition of claim 58, wherein the hepatocyte marker is albumin, B-1 integrin, transthyretrin or Glutamine synthetase.

60. The composition of claim 54, wherein the organoid (a) comprises a population of between at least 1×10.sup.3 cells and 5×10.sup.4 cells, for example between at least 1×10.sup.3 cells and 5×10.sup.3 cells, (b) has a cell density of >5×10.sup.5 cells/cm.sup.3, (c) has a cell density of >10×10.sup.5 cells/cm.sup.3, (d) has a thickness equivalent to 2-30 layers of cells, and/or (e) has a thickness equivalent to 2-15 layers of cells.

61. The composition of claim 54, wherein the layer of cells comprises at least one bud.

62. The composition of claim 54, wherein the organoid has an elongated shape with two defined domains.

63. The composition of claim 62, wherein the two defined domains comprise a first domain, wherein the first domain comprises a single layered epithelial domain comprising highly polarized cells, and wherein keratin markers are expressed; and a second domain, wherein the second domain comprises the main body of the organoid and is formed by a multilayered epithelia comprising non-polarized cells.

64. The composition of claim 63, wherein albumin expression is detected in the second domain.

65. The composition of claim 54, wherein the organoid (a) secretes albumin, (b) secretes urea, (c) comprises glycogen stores, (d) has inducible cytochrome P450 activity, and/or (e) expresses Lgr5.

66. The composition of claim 65, wherein at least 2%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% of the cells comprised by the organoid express Lgr5.

67. The composition of claim 54, wherein the organoid expresses (a) at least one, preferably all of the following hepatocyte specific genes: TTR, ALB, FAH, TAT, CYP3A7, APOA1, HMGCS1, PPARG, CYP2B6, CYP2C18, CYP2C9, CYP2J2, CYP3A4, CYP3A5, CYP3A7, CYP4F8, CYP4V2 and SCARB1, (b) expresses at least one of, preferably all of the following hepatocyte/cholangiocyte specific genes: HNF1A, HNF1B, HNF4A, HHEX, ONECUT1, ONECUT2, PROX1, CDH1, FOXA2, GATA6, FOXM1, CEBPA, CEBPB, CEBPD, CEBPG, GLUL, KRT7, KRT19 and MET, (c) expresses at least one of, preferably all of the following stem cell signature genes: LGR4, TACSTD1/Epcam, CD44, SOX9, SP5, CD24, PROM1, CDCA7 and ELF3, and/or (d) expresses at least one of, preferably all of the following reprogramming genes: KLF4, MYC, POU5F1 and SOX2.

68. The composition of claim 54, wherein the organoid does not express (a) at least one of the following hepatocyte/cholangiocyte specific genes: NEUROG2, IGF1R and CD34, AFP, GCG and PTF1A, or (b) NEUROG2, IGFIR and CD34.

69. The composition of claim 57, wherein the expression is detected by (a) measuring the expression at the mRNA level and/or (b) using a microarray.

70. The composition of claim 54, wherein the organoid is (a) a mouse organoid or (b) a human organoid.

71. The composition of claim 54, wherein the composition further comprises an extracellular matrix.

72. The composition of claim 71, wherein (a) the extracellular matrix is an exogenous extracellular matrix, and/or (b) the extracellular matrix is a non-mesenchymal extracellular matrix.

73. The composition of claim 71, wherein the organoid is (a) embedded in the extracellular matrix, and/or (b) in contact with the extracellular matrix.

74. The composition of claim 54, wherein the organoid (a) is not a liver fragment, (b) does not comprise a blood vessel, and/or (c) does not comprise a liver lobule or a bile duct.

75. Use of the composition of claim 54 in a drug discovery screen, toxicity assay, research of liver embryology, liver cell lineages, and differentiation pathways, gene expression studies including recombinant gene expression, research of mechanisms involved in liver injury and repair, research of inflammatory and infectious diseases of the liver, studies of pathogenetic mechanisms, or studies of mechanisms of liver cell transformation and aetiology of liver cancer.

76. A pharmaceutical composition comprising the composition of claim 54 for treating a liver disorder, condition or disease or in regenerative medicine.

Description

DESCRIPTION OF FIGURES

[0273] FIGS. 1A-1D: Liver organoids growth factor requirement. (FIG. 1A) DIC images of liver organoids maintained with EGF (E), R-spondin 1 (R), Noggin (N), Wnt3Aconditioned media (W) or the combination of them, supplemented with FGF10, HGF and Nicotinamide. (FIG. 1B) The number of organoids was counted weekly and passaged when required. Results are shown as mean±SEM of 3 independent experiments. (FIG. 1C) gene expression analysis by RTPCR of Lgr5, Keratin 7 (K7) and Albumin (Alb) genes. (FIG. 1D) Isolated bibliary ducts growing into organoids. Differential interference contrast images from the corresponding days after seeding. Magnification 10× (days 0, 1, 3 and 5). Days 15 on magnification 4×. Cultures were passage every 4-7 days by mechanical dissociation. Cultures have been grown at least for 8 months.

[0274] FIGS. 2A-2B: Morphology of liver organoids. (FIG. 2A) Upper panels: paraffin section of a mouse liver showing the different domains (PT=portal triad, CV=central vein). Lower panels: Paraffin section of a liver organoid showing different domains b (single layered epithelia) and h (stratified epithelia) (FIG. 2B) Right pannel: Ecadherin staining in the liver organoids. Two different domains can be identified. Domain b, formed by a single layered epithelia that resembles the bile duct structures in the liver. This bile duct domain is formed by highly polarized cells that shows positive staining for pancytokeratin (PCK) (lower panel). Left panels show the presence of a second domain within the liver organoids. This h domain is formed by a stratified epithelia with non-polarized cells. The cells are organized around a central lumen and express the hepatocyte marker Alb. Magnification 10×.

[0275] FIG. 3: Wnt signalling in the liver cultures. Lac Z expression was detected in cultures derived from Lgr5-LacZ or Axin2 LacZ mice. No positive staining was detected in liver cultures derived from a B16 mice. Magnification 4×, inset 20×.

[0276] FIGS. 4A-4B: Expression of liver differentiating markers. (FIG. 4A) immunohistochemical and immunofluorescence anaylisis of the expression of the cholangiocyte marker keratin 7 (K7) and the hepatocyte markers keratin 8 (K8) and albumin (Alb). (FIG. 4B) analysis of the gene expression of hepatocyte markers: Albumin (Alb), transthyretrin (Ttr), Glutamine synthetase (Glul), glucose 6 phosphatase (G6P) and Cytocrome p450 isoform 3A11 (CYP3A11); and cholangiocyte markers keratin 7 (K7) and Keratin 19 (K19).

[0277] FIGS. 5A-5D: Liver single cell cultures. (FIG. 5A) flow cytometry plot indicating the area of the sorted cells. (FIG. 5B) single cell growing into organoids at the time points indicated. Magnification 40× (day 1-3), 10× (day 16), 4× (day 21-on). (FIGS. 5C-5D) representative image of the colony formation efficiency of a Lgr5GFP single sorted cells. 100 cells were seeded in triplicate and colonies were counted 10 days later.

[0278] FIGS. 6A-6B: Microarray analysis of the liver cultures. Analysis of the gene expression profile of adult liver tissue and liver organoid cultures maintained for 1 month in the ER or ER media supplemented with Noggin (ENR) or with noggin and Wnt (ENRW). The genetic profile was compared between the different samples and the genetic profile of Brow adipose tissue (BAT) white adipose tissue (WAT), muscle and new born liver. (FIG. 6A) hit map analysis showing that the cultures present a similar profile to the adult liver but a different profile to non-liver related tissues as muscle and BAT and WAT, (FIG. 6B) List of hepatocyte markers and cholangyocyte markers in the different conditions.

[0279] FIGS. 7A-7B: Mouse liver organoid culture shows stable karyotyping after long-term culture.

[0280] FIG. 7A—DIC images of liver organoids maintained in EGF (E) and R-spondin 1 (R), supplemented with FGF10, HGF and Nicotinamide (left figure, ER) or maintained in the same combination supplemented with Noggin (N) and Wnt3A conditioned media (W) (right figure, ENRW) for a period of 24 months.

[0281] FIG. 7B—Karyotype analysis of mouse liver organoids after 8 months in culture. Normal chromosomal counts (n=40, left panel figure) and polyploidy, a typical hepatocyte feature, were found (n=80, right panel figure)

[0282] FIGS. 8A-8E: Supplemental factors FGF10, HGF and Nicotinamide; effect on growth and differentiation.

[0283] FIG. 8A—Diagram depicting the genes differentially expressed during the 3 stages of liver development, from hepatoblast to mature hepatocyte.

[0284] FIG. 8B—Scheme showing the protocol used. Cultures were seeded in expansion medium EM2 (ERFHNic: EGF (E) and R-spondin 1 (R), supplemented with FGF10, HGF and Nicotinamide; ERFHNic is indicated as ‘ER’ in FIG. 8B) 2 days prior the experiment. Two days later, culture media was changed to either EGF (E) alone or EGF supplemented with R-spondin 1 (ER) with or without additional supplements chosen from FGF10 (F) or HGF (H) or Nicotinamide (Nic) or a combination of these at the concentrations stated in the text. Five days later cultures were split and replated at 1:4 ratio for each condition. Under these conditions, cultures have been split and replated every 7 days for a total period of 10 weeks

[0285] FIG. 8C—First day after first split in each of the culture conditions tested. Results shows that EGF and R-spondin 1 combined with FGF10 or HGF or Nicotinamide or a combination of these are essential to achieve at least 1 passage.

[0286] FIG. 8D—After long-term culture, the combination of ER supplemented with FNic or ER supplemented with FHNic, both result in high passage numbers. After passage 10, the growth rate is better for the culture condition including the 3 supplemental factors; ERFHNic (FIGS. 15A-15B).

[0287] FIG. 8E—RT-PCR analysis showing the expression of different hepatocyte markers (CYP3A11, Alb, FAH) and cholangiocyte marker (K19) and stem cell marker IGR5 5 days after the withdrawal of certain factors (starting point was ERFHNic). Note that only the condition EF showed expression of all hepatocyte markers tested. HPRT was used as a housekeeping gene to normalize for gene expression.

[0288] FIG. 9: Table showing the quantification of different hepatocyte and cholangiocyte specific transcription factors in cells from three different liver culture conditions and in adult liver tissue. Also shown is the expression of the key components of the Notch and TGF-beta signalling pathways. E=EFHNic, ER=ERFHNic, ENRW=ENRWFHNic.

[0289] FIGS. 10A-10F: Differentiation protocol

[0290] FIG. 10A—Scheme showing the protocol used. Cultures were seeded in expansion medium (ERFHNic: EGF (E) and R-spondin 1 (R), supplemented with FGF10, HGF and Nicotinamide; ERFHNic is indicated as ‘ER’ in FIG. 10A 2 days prior to the experiment. Two days later, culture media was changed to EGF (E) supplemented with either A8301 (A), or DAPT (D), or FGF10 (F) or HGF (H) or Nicotinamide (Nic) or R-spondin 1 (R) or Wnt3A or Noggin (N) or a combination of these at the concentrations shown. RNA was isolated at several time points. Mouse liver tissue was taken as positive control (+) whereas water was taken as negative control (−).

[0291] FIG. 10B—RT-PCR analysis showing the expression of the hepatocyte markers CYP3A11, Alb, FAH, tbx3, TAT and Gck 7 days after differentiation conditions. Note that only the condition EADF showed an expression of all hepatocyte markers tested. HPRT was used as a housekeeping gene to normalize for gene expression.

[0292] FIG. 10C—Time course expression analysis after differentiation conditions. At days 2, 5 and 8 days after differentiation, the expression of the hepatocyte markers CYP3A11, Alb, FAH, and the cholangyocyte marker K19, was analysed by RTPCR. Note that the expression of the liver markers CYP3A11 and FAH starts at day 5 and peaks at day 8 after. HPRT was used as a housekeeping gene to normalize for gene expression. A; A8301, D; DAPT, F; FGF10, H; HGF, De; Dexamethasone

[0293] FIG. 10D—Titration experiment showing the expression of the hepatocyte markers CYP3A11, Alb, FAH, tbx3, TAT, G6P and Gck 7 days after different concentrations of the differentiation compounds A and D. HPRT was used as a housekeeping gene to normalize for gene expression.

[0294] FIG. 10E—Immunofluorescent staining for the liver markers K19, Albumin and hepatocyte surface marker. Hoeschst was use to stain nuclei.

[0295] FIG. 10F—Xgal staining on Albcreert2LacZ mice liver-derived organoids. Albumin positive cells (arrows) were detected after EADF differentiation in tamoxifen induced Albcreert2LacZ derived cultures.

[0296] FIG. 11: Human-derived liver cultures under ERFHNic culture conditions

[0297] FIGS. 12A-12B: Liver response to Wnt signaling stimulation under physiological conditions or during regeneration after injury

[0298] FIG. 12A: Injection of Lgr5 ligand R-spondin1 in Axin2 LacZ mice shows that liver cells are responsive to Wnt stimulation (arrows pointing X-gal positive cells). There was no Lgr5 expression so the inventors hypothesise that Lgr4 was used to initiate the response.

[0299] FIG. 12B: CCL4 injection in Axin2 LAcZ mice shows that during the regeneration response Wnt signalling is activated

[0300] FIGS. 13A-13B: Lgr5 upregulation following liver injury-regeneration model.

[0301] Adult Lgr5-LacZ KI mice were injected with 0.8 ml/kg of the hepatotoxic compound CCL4. The pictures show that in non injected (undamaged) livers the Wnt pathway is active only in cells lining the ducts. After damage by CC14 cells also cells not lining duct have an activated Wnt pathway.

[0302] FIG. 13A—Time course experiment showing upregulation of Lgr5 in CCL4 damaged livers (arrows showing x-gal positive cells). Control CCL4 injected WT mice and placebo-injected Lgr5LacZ Ki mice did not show any staining (right-hand panel).

[0303] FIG. 13B—Lgr5 co-staining with liver markers.

[0304] FIG. 14: Isolated duct staining for K19

[0305] Lgr5LacZ duct isolation. K19 staining confirms that the isolated and seeded structures are indeed intrahepatic ducts.

[0306] FIGS. 15A-15B: Growth factor requirement

[0307] The 3 supplemental factors (FGF10, HGF and Nicotinamide) are essential for long term self-maintenance of liver cultures. After long-term culture, the combination of ER including FNic ($) or ERFHNic ($$), both result in high passage numbers. After passage 10, the growth rate is better for the culture condition including the 3 supplemental factors; ERFHNic (see FIG. 16B).

[0308] FIGS. 16A-16C: Gene expression profile of mouse liver organoids under differentiation conditions resemble the adult and newborn liver profile

[0309] FIG. 16A—Gene clusters showing the genes similarly expressed (a) or similarly shut down (b) between the differentiation condition EADF and adult or newborn liver.

[0310] FIG. 16B—Gene clusters showing the genes differentially expressed between the liver organoids and adult or newborn liver (a) and the genes similarly expressed between EADF and newborn liver (b).

[0311] FIG. 16C—Raw signal data from a microarray analysis, comparing the expression levels of selected ductal markers, transcription factors necessary for Ngn3 expression and endocrine markers in adult liver, adult pancreas, pancreas organoids and liver organoids in expansion media.

[0312] FIGS. 17A-17D: Transplantation of the cells into mouse model of liver disease

[0313] Organoids were transplanted into the mouse model: adult FGR mice (FAH-/-RAG-/-IL2R-/-). Hepatocytes were transplanted into the mice as a control.

[0314] FIG. 17A—K19 positive cells (left top panel) and Fah positive cells (middle panel) derived from the liver organoids transplanted into FAH knock out mice. Hepatocyte transplanted control (top right panel). Lower flow Cytometry plots show that the % of hepatocyte positive cells was higher in the group that resulted in positive FAH engrafted hepatocytes.

[0315] FIGS. 17B-17C—Flow Cytometry analyses of cells transplanted. (FIG. 17B) Clone 1, obtained from Lgr5-GFP mouse, and (FIG. 17C) clone 2, obtained from Lgr5-lacZ mouse. The hepatocyte surface marker shows a positive subpopulation that comprises large cells and highly granular cells, i.e. cells that represent the phenotype of mature hepatocytes.

[0316] FIG. 17D—Transplantation schedule.

[0317] FIG. 18: Mouse liver signature genes

[0318] Table showing a) markers expressed in mouse liver stem cells; b) markers not expressed in mouse liver stem cells; c) hepatocyte and cholangiocyte markers expressed in mouse liver stem cell signature for mouse liver organoids in expansion media; d) hepatocyte and cholangiocyte markers not expressed in mouse liver stem cell signature for mouse liver organoids in expansion media; e) reprogramming genes expressed in mouse liver organoids; f) reprogramming genes not expressed in mouse liver organoids. The results were obtained using a liver microarray using the Universal Mouse Reference RNA (Strategene, Catalog #740100) as a reference RNA. If the absolute figures detected were less than 100, the gene was consider as undetected.

[0319] FIGS. 19A-19E: Human liver signature genes

[0320] Table showing results of liver mircroarray of human organoids. From left to right, the results are shown for a) expansion medium EM1, b) expansion medium EM2, c) differentiation medium, d) adult liver.

[0321] The numbers (log 2) in the left four columns are the result of a comparison between the sample and a reference (commercial) RNA sample which is used for all arrays. The relative expression of mRNA in each sample compared to the RNA present in the reference sample is shown. The reference RNA used was Universal Human Reference RNA (Stratagene, Catalog #740000). Thus, negative numbers in these columns do not relate to real expression levels it just means there is less of that RNA then in the Reference sample. The 4 columns on the right are absolute figures. If they are below 100, they are considered as undetected.

EXAMPLES

Example 1—an Expansion Medium for Liver Organoid Growth and Expansion

[0322] After isolation, biliary ducts (see FIGS. 1A-D) were suspended in MATRIGEL™ and cultured in different growth factor conditions. The combination of EGF (50 ng/ml) and R-spondin 1 (1 ug/ml) supplemented with FGF10 (100 ng/ml), HGF (25-50 ng/ml) and Nicotinamide (1-10 mM), (ERFHNic) were essential for the long term maintenance of the cultures, indicating that Wnt signalling and EGF signalling are strictly required to maintain adult liver progenitor proliferation in vitro. The addition of Noggin (100 ng/ml) and Wnt conditioned media (50%) also showed long term maintenance of the cultures (see FIGS. 1A and 1B). Under these conditions that supported long-term maintenance, Lgr5 expression as well as hepatocyte markers (Albumin) and cholangiocyte markers (K7) were detected by RT-PCR (see FIG. 1C). Under these conditions liver organoids have been weekly passaged by mechanical or enzymatic dissociation, at 1:8 dilution, and have been grown for many months (FIG. 1D).

[0323] We analysed the expression of the Wnt target genes Axin2 and Lgr5 in the cultures. Cultures of both Axin2LacZ and Lgr5-LacZ livers revealed the presence of Axin2- and Lgr5-positive cells in the liver organoids 1 month after seeding, thus confirming that the Wnt signalling is active and required for culture growth (FIG. 3). The liver cultures also express hepatocyte markers (e.g. albumin, transthyretrin, Glutamine synthetase) and cholangiocyte makers (Keratin 7 and 19) (see FIGS. 4A-B).

[0324] When single Lgr5 cells from a Lgr5LacZ or Lgr5GFP mouse were sorted, single colonies grew into organoids. These cultures also express markers of cholangiocyte and hepatocyte lineages and have been maintained and regularly split into 1:6-1:8 for more than 4 months (see FIGS. 5A-B). Interestingly, only the cultures derived from Lgr5 positive cells grew into organoids (FIGS. 5C-D). These data indicate that Lgr5 cells are progenitor cells of these cultures and able to propagate progeny of the 2 different liver lineages.

[0325] Having established that the liver organoids are derived from Lgr5+ve cells we set out to determine their individual gene signature as compared to the adult liver signature. RNA was isolated from adult liver and from liver organoids grown in ER or ENRW media supplemented with FGF10, Nicotinamide and Hepatocyte Growth Factor. The genetic signature of the adult liver and the 2 liver culture conditions was subsequently derived via comparative gene expression profiling in respect to the expression of a Universal RNA reference. The use of the same reference RNA for the hybridization to all the samples allowed us to compare the 3 independent samples among them (adult liver, ER and ENRW). The heat map analysis revealed that the expression profile of both culture conditions highly resemble the adult liver tissue expression profile, whereas they do not share the same profile when compared to muscle or adipose tissue profile (see FIGS. 6A-B). Among the similar gene expression profile between the adult liver and the liver cultures, liver specific genes as HNF1a, HNF1b, HNF4, Alb, Glu1, Met, G6P, Fand1, Fand2a, CYP4B1, K7 and K19 are detected. The heat map analysis reveals that both culture conditions present similar expression pattern among each other and when compared to the adult liver sample. However, when analyzing the data in detail, we can observe that the condition without Wnt and without noggin shows a more differentiated pattern that the condition including both growth factors. This is in agreement with the data shown in FIG. 1 C where hepatocyte differentiation (by means of albumin expression) is almost absent in the presence of Wnt. This result would indicate that Wnt is favouring the self-renewal of the culture in detriment of the differentiation.

[0326] Also, in both culture conditions as well as in the adult liver, non-specific adult liver genes as AFP, and non-liver transcription factors as Pdx1 or NeuroD can be detected.

[0327] It is remarkable that, in both culture conditions but not in the adult liver, the stem cell marker Lgr5 was one of the most highly enriched genes in the liver culture signature. Also, cell markers of progenitor populations in small intestine and stomach as Cd44 and Sox9 (Barker & Huch et al Cell stem cell 2010) were highly expressed in both culture conditions but not in adult liver, indicating again the self-renewal capacity of the liver cultures as well as the quiescent status of the normal adult liver.

[0328] Additionally, apart from Lgr5, multiple Wnt target genes were also highly upregulated in the liver cultures compared to the adult liver including MMP7, Sp5 and Tnfrs19, among others, providing strong evidence of the requirement of an active and robust canonical Wnt signaling activity to maintain the self renewing capacity of the cultures.

Example 2—an Improved Differentiation Medium

[0329] Under ER or ENRW conditions the liver cultures self-renew, and can be maintained and expanded in a weekly basis, for up to 1 year (FIG. 7A). The karyotypic analysis after 1 year shows no evidence of chromosomal aberrations. More than 66% of the cells analysed presented normal chromosomal counts and 13% of them also showed polyploidy, a characteristic trait of hepatocytes (FIG. 7B).

[0330] The combination of EGF (50 ng/ml) and R-spondin 1 (1 ug/ml) supplemented with FGF10 (100 ng/ml), HGF (25-50 ng/ml) and Nicotinamide (1-10 mM), were preferable for the long term maintenance of the cultures. Under these conditions, we obtained long-lived cell cultures that express biliary duct and some hepatoblast or immature-hepatocyte markers (Glul, Albumine). However, the number of cells positive for these hepatocyte markers was very low. Under these culture conditions, no mature hepatocyte markers (e.g. p450 Cytochromes) were detected. These results suggest that the culture conditions described here facilitate the expansion of liver progenitors able to generate hepatocyte-like cells, albeit at lower numbers, but not fully mature hepatocytes (FIG. 8A).

[0331] To enhance the hepatocytic nature of the cultures and obtain mature hepatocytes in vitro, we first determined whether the three supplemental factors (FGF10, HGF and Nicotinamide) added to EGF and R-spondin1 were exerting either a positive or negative effect on the hepatocyte expression, as well as on the self-renewal of the culture. We generated liver organoid cultures and cultured them either with EGF or EGF and R-spondin1 plus FGF10 or HGF or Nicotinamide or the combination of these, and we split the cultures once a week for a total period of 10 weeks. At each time-point we also analysed the expression of several mature hepatocyte markers (FAH, CYP3A11) and hepatoblast markers (albumin) (FIG. 8B).

[0332] In agreement with the data in FIGS. 1A-D (see example 1), we observed that R-spondin1 and Nicotinamide combined with FGF10 are essential for the growth and self-renewal of the liver cultures (FIGS. 8C-D). R-spondin1 and Nicotinamide both inhibit the expression of the mature marker CYP3A11 and yet promote the expression of the hepatoblast marker albumin. The addition of either FGF10 or HGF to media containing only EGF (without R-spondin1 and without nicotinamide), facilitated the expression of the mature marker CYP3A11, albeit at very low levels (FIG. 8E). To identify additional compounds that might facilitate hepatocyte differentiation, we used two different approaches, both based upon base conditions of: EGF+HGF and/or FGF10.

[0333] The first approach involved testing a series of compounds in addition to the EGF+FGF10 or HGF condition. A complete list of the compounds analysed is shown in table 2.

TABLE-US-00002 TABLE 2 Result Compounds Signal Concentration Alb CYP3AII Exendin4 Glucagon like Sigma 0.1-1 uM peptide 2 analog E7144 Retinoic Acid RAR-RXR Sigma 25 nM receptor ligand Retinoic Acid + Exendin 4 Sonic Hedgehog Invitrogen 500-100 ng/ml C25II BMP4 BMP signaling Peprotech 20 ng/ml 120-05 DAPT Gamma-secretase Sigma 10 nM inhibitor D5942 A8301 Alk5/4/7 inhibitor Tocris 50 nM Bioscience 2939 DAPT + A8301 +++ +++ FGF4 FGFR1, 2 ligand Peprotech 50 ng/ml FGF1 FGFR1, 2, 3, 4 Peprotech 100 ng/ml ligand 450-33A Dexamethasone Sigma  10 μM-1 mM D4902 25MG Oncostatin M R&D 10-1000 ng/ml (OSM) systems 495- MO-025 FGF4 + OSM + Dexa IGF peprotech 100 ng/ml Valproic acid histone deacetylase Stemgent 250 μM inhibitor and 04-0007 regulator of ERK, PKC Wnt/β- catenin pathways Sodium Butyrate histone deacetylase Stemgent 04- 250 μM inhibitor 0005 BIX01294 G9a HMTase Stemgent 04- 1 μM inhibitor 0002 RG 108 DNA Stemgent 04- 1 μM methyltransferase 0001 inhibitor TSA 100 nM + − Hydrocortisone glucocorticoid Sigma 5 nM H6909 Oncostatin M R&D 10-1000 ng/ml (OSM) systems 495- MO-025 ARA Sigma A 500 nM 0937 R 59022 Diacylglycerol Sigma D 500 nM-50 nM + + kinase inhibitor 5919 Arterenol bitrartre: andrenoreceptor sigma 500 nM-50 nM-5 nM — agonist A 0937 LIF 10.sup.3 PD 035901 MEK1 inhibitor Axon 500 nM Medchem cat n 1386 CHIR99021 GSK3 inhibitor Axon 3 uM Medchem cat n 1408 DMSO 1% L-Ascobic acid Sigma 1 mM 077K13021 VEGF Peprotech MATRIGEL ™ 50% MATRIGEL ™ 20% VEGF + DEXA

[0334] The second approach took into account knowledge from published developmental studies regarding the expression of the transcription factors essential to achieve biliary and hepatocyte differentiation in vivo. A comparative analysis of the expression of transcription factors in the organoids under E or ER or ENRW conditions supplemented with FGF10, HGF and Nicotinamide is shown in FIGS. 8A-E. All the transcription factors required for Hepatocyte specification were present, besides tbx3 and prox1. However, we also noticed that the expression of specific biliary transcription factors was highly upregulated in the cultures containing R-spondin1 (R), indicating that the culture gene expression was unbalanced towards a more biliary cell fate.

[0335] Notch and TGF-beta signaling pathways have been implicated in biliary cell fate in vivo. In fact, deletion of Rbpj (essential to achieve active Notch signalling) results in abnormal tubulogenesis (Zong Y. Development 2009) and the addition of TGF-beta to liver explants facilitates the biliary differentiation in vitro (Clotman F. Genes and Development 2005). Since both Notch and TGF-beta signalling pathways were highly upregulated in the liver cultures (FIG. 9) we reasoned that inhibition of biliary duct cell-fate might trigger the differentiation of the cells towards a more hepatocytic phenotype. A8301 was selected as an inhibitor of TGF-beta receptor ALK5, 4, and 7 and DAPT as inhibitor of the gamma-secretase, the active protease essential to activate the Notch pathway. We first cultured the cells for 2 days in the expansion conditions (ER media) and at day 2 (FIG. 10A) we started the differentiation conditions by adding the combination of the different compounds. Media was changed every other day, and the expression of differentiated markers was analysed 8-9 days later. The ER and ENRW conditions were used as negative control.

[0336] The combination of EGF+FGF10 with DAPT and A8301 resulted in surprisingly large enhancement of expression of the hepatocyte markers analysed (CYP3A11, TAT, Albumin) (FIG. 10B). The effect was already detectable by day 5 and peaked at days 8-9 (FIG. 10C). The maximal concentration efficiency was achieved at 10 uM (DAPT) and 50 nM (A8301) (FIG. 10D) respectively. The addition of dexamethasone (a known hepatocyte differentiation molecule) did not result in any improvement in gene expression. The combination of EGF, FGF10, A8301 and DAPT not only enhances the expression but also increases the number of hepatocyte-like cells, as assessed by immunofluorescent against the hepatocyte markers albumin and 2F8, and Xgal staining on AlbCreLacZ derived organoids (FIGS. 10E-F). Therefore, we can conclude that the aforementioned differentiation protocol facilitates the generation of hepatocyte-like cells in vitro from liver stem cell cultures.

Example 3—Human Liver Organoids

[0337] Using these expansion conditions (ERFHNic and ENRWFHNic) we have also been able to expand human biliary-derived cultures (FIG. 11) with the addition of 500 uM TGF beta inhibitor (A83-01) to the expansion medium.

Material and Methods (for Examples 1-3)

Liver Culture-Biliary Duct Isolation

[0338] Isolated adult liver tissue was washed in cold Advanced-DMEM/F12 (Invitrogen) and then, the tissue was chopped into pieces of around 5 mm animals and further washed with cold dissociation buffer (collagenase, dispase, FBS in DMEM media). The tissue fragments were incubated with the dissociation buffer for 2 h at 37° C. Then, the tissue fragments were vigorously suspended in 10 ml of cold isolation buffer with a 10 ml pipette. The first supernatant containing death cells was discarded and the sediment was suspended with 10-15 ml of dissociation buffer. After further vigorous suspension of the tissue fragments the supernatant is enriched in biliary ducts. This procedure is repeated until enough biliary ducts are obtained.

[0339] Isolated biliary ducts are pelleted and mixed with 500 of MATRIGEL™ (BD Bioscience), seeded on 24-well tissue culture plates and incubated for 5-10 min at 37° C. until complete polymerization of the MATRIGEL™. After polymerization, 500 μl of tissue culture media are overloaded.

[0340] Media composition: Advanced-DMEM/F12 supplemented with B27, N2, 200 ng/ml N-Acetylcysteine, 50 ng/ml EGF, 1 μg/ml R-spondin1, gastrin: 10 nM, FGF10 100 ng/ml, Nicotinamide 10 mM and HGF: 50 ng/ml and 50% Wnt conditioned media.

[0341] The entire medium was changed every 2 days. After 1 week, Wnt conditioned media is withdrawal and the formed organoids removed from the MATRIGEL™ using a 1000 μl pipette and were dissociated mechanically into small fragments and transferred to fresh MATRIGEL™. Passage was performed in 1:4 split ratio once or twice per week. Under these conditions cultures have been maintained for at least 6 month.

[0342] Reagents

[0343] Human Hepatocyte Growth Factor (HGF) was purchased from Peprotech, EGF invitrogen, R-Spondin Nuvelo, Noggin peprotech, FGF10 Peprotech, gastrin Sigma Aldrich, nicotinamide Sigma.

[0344] Microarray

[0345] For the expression analysis of Lgr5-derived liver cultures, RNA was isolated using a Qiagen RNAase kit, from adult liver or from liver cultures cultured in media without Wntcm and Noggin (ER) or with Wntcm and Noggin (ENRW). 150 ng of total RNA was labelled with low RNA Input Linear Amp kit (Agilent Technologies, Palo Alto, Calif.). Universal mouse Reference RNA (Agilent) was differentially labelled and hybridized to either adult liver tissue or ER or ENRW treated cultures. A 4X44K Agilent Whole Mouse Genome dual colour Microarrays (G4122F) was used. Labelling, hybridization, and washing were performed according to Agilent guidelines.

Example 4—Lgr5 Expression is Upregulated Following Liver Injury

[0346] In the liver, Wnt signalling is active in central vein areas. We have recently observed that Wnt signaling plays a key role in liver metabolism (Boj et al. personal communication). In the liver duct cells, Wnt signalling is activated following liver injury (Hu et al 2007, Gastroenterology, 133(5): 1579-91). Similarly, using the Axin2-LacZ allele, which represents a faithful, general reporter for Wnt signalling, we also have observed upregulation of Wnt signaling in the whole liver parenquima after injection of the Wnt agonist Rspo1 (see FIG. 12A) or following liver injury by the hepatotoxic compound carbon tetrachloride (CC14) (see FIG. 12B).

[0347] The Wnt target gene Lgr5 marks stem cells in several actively self-renewing tissues, but has not previously been reported to be expressed upon injury. Our previously described Lgr5-LacZ knockin mice (Barker et al, 2007, Nature 449 (7165): 1003-7) show that Lgr5 is essentially undetectable in healthy liver although a residual mRNA expression is detected by qPCR. Following injection of CC14 on Lgr5-LacZ knockin mice (see Barker et al, 2007, supra for LacZ mice and Furuyama K et al., Nat Genetics, 43, 34-41, 2001 for description of CC14 method), we observed a clear expression of the reporter in newly formed bud structures in the liver (see FIG. 13A), peaking at day 6.5 after injury and being maintained up to day 9 to show a clear decay once the liver is completely regenerated at day 13 after injury (see FIG. 13A, top right panel). No expression of the reporter was detected in wild-type littermates undergoing similar injury protocol (see FIG. 13A, bottom right panel).

[0348] The appearance of Lgr5 expression at sites of active regeneration, suggested that Lgr5 might herald de novo activation by Wnt of regenerative stem cells/progenitors upon injury. Indeed, we found that the novo appearing Lgr5 cells do not express markers of mature liver cells (K19 or FAH) or stellate cells (SMA) but instead, they are positive for the recently described liver progenitor marker Sox9 (FIG. 13B). This means that Lgr5+ cells, which are the starting point for obtaining in vitro organoids, can be obtained from liver fragments by inducing liver injury or by stimulating Wnt signalling with R-spondin. The induction of Lgr5 expression in liver cells by injury or by R-spondin may be carried out in vivo before the cells are obtained, ex vivo in an isolated liver, or in vitro in a liver fragment or population of liver cells.

Example 5—Long-Term Expansion of Liver Organoid Cultures

[0349] In example 1, it was found that the combination of EGF (50 ng/ml) and R-spondin 1 (1 ug/ml) supplemented with FGF10 (100 ng/ml), HGF (25-50 ng/ml) and Nicotinamide (1-10 mM), were preferable for the long term maintenance of the cultures. We now also have evidence that the three supplemental factors (FGF10, HGF and Nicotinamide) added to EGF and R-spondin1 are all necessary for the expansion of the cultures for longer than 3 months. To assess that, we isolated biliary ducts from the liver parenquima, as shown in FIG. 14 (K19 staining was used to confirm the identity of the isolated structures), and generated liver organoid cultures by culturing them with: i) EGF; or ii) EGF and R-spondin1 plus FGF10 or HGF or Nicotinamide; or iii) EGF and R-spondin1 plus FGF10 and HGF and Nicotinamide (ERFHNic). We have split the cultures once a week for a total period of 14 weeks. Results confirmed, as reported in examples 1 and 2, that EGF, R-spondin1 and Nicotinamide combined with FGF10 are essential for the growth and self-renewal of the liver cultures. After 10 passages, the cultures lacking HGF showed a growth disadvantage compared to the cultures supplemented with HGF. Although still viable, the proliferation ratio decreased to 1:2-1:4 compared to the 1:6-1:8 of the cultures supplemented with the complete combination (FGF10, HGF, and Nicotinamide). After 15 passages, the cultures with ERFNic not supplemented with HGF were no longer viable. Therefore, these results suggest that HGF is essential for maintaining a good proliferating rate after long-term maintenance (FIGS. 15A-B).

Example 6—Markers Expressed in Liver Organoids Under Differentiation Conditions

[0350] Using the differentiation protocol described in example 2, we were able to detect a hepatoblast marker (albumin) and a hepatocyte surface marker in the liver organoids. To quantify the number of these hepatocyte-like cells, we performed flow cytometry analysis of the cultures using a hepatocyte surface marker. We observed that, whereas in the expansion culture condition almost no hepatocyte surface marker-positive cells were detected, after differentiation, up to 35% of the cells were positive for this hepatocyte surface marker (see FIGS. 17B-C).

[0351] We then analysed the gene expression profile of the mouse liver organoids under these differentiation conditions (FIGS. 16A-C and FIGS. 1A-D, we see strong upregulation of eg Alb, FAH, and TAT and the Cyp3 genes). We found that the gene expression of the mouse liver organoids after differentiation resemble that of mature mouse hepatocytes and/or mouse liver.

Example 7—Transplantation of Liver Organoids into Mice

[0352] Cells were taken from the organoids that had been grown using ERFHNic expansion conditions and EAFD differentiation conditions and were transplanted into immunodeficient strain of mice deficient in the tyrosine catabolic enzyme fumarylacetoacetate hydrolase (FAH), a mouse model for Tyrosinemia type I human disease (Azuma et al. 2007, Nature Biotech, 25(8), 903-910). The transplantation schedule is shown in FIG. 17D. Preliminary results show that scattered FAH positive cells can be found in the liver parenquima of the FAH deficient mice, indicating that liver cells derived from the organoid cultures have engrafted into the recipient livers (see FIG. 17A, right-hand side). Furthermore, significantly increased numbers of K19 positive cells were also detected in the livers of the recipient mice. This suggests that the organoid-derived transplanted cells are able to generate both lineages in vivo: hepatocytes (as demonstrated by the FAH marker) and cholangyocytes (as demonstrated by the K19 marker) (see FIG. 17A, left top panel). This was further supported by flow cytometry analysis of transplanted cells that had come from two separate clones from two separate cultures (FIGS. 17B and 17C respectively). The Lgr5+ cells were transduced with a virus containing GFP and flow cytometry analysis was carried out after differentiation. Cells that were positive for the hepatocyte surface marker show a larger scatter indicating larger cells, which represent granularity and maturity i.e. mature hepatocyte cells. The cells that were negative for the hepatocyte surface marker resulted in less scattering indicating smaller cells i.e. less mature progenitors. Therefore, all cell types are present (mature and immature cells) in a differentiating culture. The rest of the differentiated cells, so the cells not used for FACS analysis were used for the transplantation experiments.

Example 8

[0353] Organoids from mouse liver cultured in accordance with a method of the invention were analysed using microarray analysis to determine which genes are expressed and which genes are not expressed.

Example 9

[0354] Organoids from human liver cultured using the EM1, EM2 and DM media of the invention and human liver were analysed using oligonucleotide microarray analysis to determine which genes are expressed and which genes are not expressed. A significantly different gene expression profile was noticeable between the genes expressed in expansion media, the genes expressed in differentiation medium and the genes expressed in adult liver. The trend for hepatocyte gene expression is roughly the same as for in the mouse but the differentiation of the organoids was less than in the mouse liver organoids. This may be due to use of the human cell used.

[0355] As often happens in an analysis using an oligonucleotide microarray, Lgr5 and Tnfrsf19 were not detected. However, they were found to be present in organoids cultured in the expansion medium.

Materials & Methods (for Examples 4 to 7)

Animal Treatment

[0356] Two-Eight month old Lgr5LacZ or Axin2-LacZ or WT littermates BL6/Balbc F1mice received an intraperitoneal injection of 0.8 ml/kg of CCL4 dissolved in corn oil (n=) or corn oil alone (n=). Mice were sacrificed 2 or 5 or 9 or 13 days later and the liver was isolated and further processed for RNA or bgalactosidase staining.

β-Galactosidase (lacZ) Staining

[0357] Liver tissues were isolated and immediately incubated for 2 hours in a 20-fold volume of ice-cold fixative (1% Formaldehyde; 0.2% Gluteraldehyde; 0.02% NP40 in PBS0) at 4° C. on a rolling platform. The fixative was removed and the tissues washed twice in washing buffer (PBS0; 2 mM MgCl.sub.2; 0.02% NP40; 0.1% NaDeoxycholate) for 20 minutes at room temperature on a rolling platform. The β-galactosidase substrate (5 mM K.sub.3FE(CN).sub.6; 5 mM K.sub.4Fe(CN).sub.6.3H.sub.2O; 2 mM MgCl.sub.2; 0.02% NP40; 0.1% NaDeoxycholate; 1 mg/ml X-gal in PBS0) was then added and the tissues incubated in the dark at 37° C. for 2 h and overnight at room temperature. The substrate was removed and the tissues washed twice PBS0 for 20 minutes at room temperature on a rolling platform. The tissues were then fixed overnight in a 20-fold volume of 4% Paraformaldehyde (PFA) in PBS0 at 4° C. in the dark on a rolling platform. The PFA was removed and the tissues washed twice in PBS0 for 20 minutes at room temperature on a rolling platform.

[0358] The stained tissues were transferred to tissue cassettes and paraffin blocks prepared using standard methods. Tissue sections (4 μM) were prepared and counterstained with neutral red.

R-Spondin1 Treatment

[0359] Axin2-lacZ mice aged 6-8 weeks were injected IP with 100 μg of purified human R-spondin1 and sacrificed 48 hours later for LacZ expression analysis in the liver.

RT-PCR

[0360] RNA was extracted from gastric cell cultures or freshly isolated tissue using the RNeasy Mini RNA Extraction Kit (Qiagen) and reverse-transcribed using Moloney Murine Leukemia Virus reverse transcriptase (Promega). cDNA was amplified in a thermal cycler (GeneAmp PCR System 9700; Applied Biosystems, London, UK) as previously described (Huch et al., 2009). Primers used are shown in Table 3 below.

TABLE-US-00003 TABLE 3 Primers for RT-PCR PCR Gene product Gene name Symbol Sequence (bp) cytochrome P450, family 3, CYP3A11 fw TGGTCAAACGCCTCTCCTTGCTG 100 subfamily a, polypeptide 11 rv ACTGGGCCAAAATCCCGCCG Glucose-6-phoshatase G6P fw GAATTACCAAGACTCCAGG 581 rv TGAGACAATACTTCCGGAGG Keratin 19 Krt19 fw GTCCTACAGATTGACAATGC 549 rv CACGCTCTGGATCTGTGACA Albumin Alb fw GCGCAGATGACAGGGCGGAA 358 rv GTGCCGTAGCATGCGGGAGG t-box 3 Tbx3 fw AGCGATCACGCAACGTGGCA 441 rv GGCTTCGCTGGGACACAGATCTTT Prospero-related-homeobox Prox1 fw TTCAACAGATGCATTACC 270 protein 1 rv TCTTTGCCCGCGATGATG Fumarylacetoacetate- Fah fw ACGACTGGAGCGCACGAGAC 183 hydrolase rv AGGGCTGGCTGTGGCAGAGA Tyrosine aminotransferase Tat fw TTTGGCAGTGGCTGAAAGGCA 258 rv GGGCCCAGGATCCGCTGACT Tryptophan2,3-dioxygenase Tdo2 fw ACTCCCCGTAGAAGGCAGCGA 583 rv TCTTTCCAGCCATGCCTCCACT Leucine-rich repeat- Lgr5 fw GGAAATGCTTTGACACACATTC 413 containing G-protein rv GGAAGTCATCAAGGTTATTATAA coupled receptor 5 Transthyretin TTR fw ATGGTCAAAGTCCTGGATGC 220 rv AATTCATGGAACGGGGAAAT Glucokinase Gck fw AAGATCATTGGCGGAAAG 193 rv GAGTGCTCAGGATGTTAAG hypoxanthine Hprt fw AAGCTTGCTGGTGAAAAGGA 186 phosphoribosyltransferase rv TTGCGCTCATCTTAGGCTTT

Immunohistochemistry

[0361] Immunostaining procedure used here was previously described in Huch et al. 2009. Briefly, five-micrometer sections were deparaffinized, rehydrated, and tissue sections were permeabilized using PBS-T (PBS; Tween20 0.1%). When required, sections were treated with 10 mM citrate buffer (pH 6.0) for antigen retrieval, blocked using Universal blocking buffer (BioGenex)) and incubated with the primary antibody. Then, sections were washed twice with PBS and incubated with peroxidase conjugated secondary antibodies. DAB+ (DAKO) was used as a chromogen substrate. Sections were counterstained with Mayer's hematoxylin and visualized on a Leica DMR microscope. The primary antibodies used were rabbit anti-Sox9 (1:600; 1 h at RT, Millipore), mouse anti-SMA (1:1000, overnight at 4° C., Sigma), rabbit anti-FAH (1:5000; overnight 37° C., gift from M. Grompe), rabbit anti-K19 (1:500; overnight 4° C., gift from M. Grompe). The peroxidase conjugated secondary antibodies used were Mouse or Rabbit Brightvision (Immunologic).

Immunofluorescence

[0362] For whole mount staining, organoids or isolated biliary ducts were fixed with acetone (organoids) or PFA4% (biliary ducts) for 30 min, washed once with PBS, permeabilized with PBS 0.3% Triton-X100 for 5 min, blocked using Universal blocking solution (Power block HK085-5KE BioGenex) and incubated overnight with the primary antibodies diluted in PBS1% FBS. Following several washes in PBS, samples were incubated with the secondary antibody. Nuclei were stained with Hoescht33342. Images were acquired using confocal microscopy (Leica, SP5). Three-dimensional reconstruction was performed using Volocity Software (Improvision). The primary antibodies used were rabbit anti-K19 (1:500; gift from M. Grompe), rat anti-hepatocyte surface marker (1:50, gift M. Grompe), goat anti-albumin (1:50, santa Cruz). The secondary antibodies used were all raised in donkey and conjugated to different Alexa fluorofores (donkey anti-goat 568, donkey anti rat-488, donkey anti rabbit-647, Molecular probes).

Flow Cytometry

[0363] Dissociated cells were resuspended at 1×10.sup.4 cells per milliliter in 1 ml of DMEM+2% FBS prior to the addition of MIC1-1C3 hybridoma supernatant at a 1:20 dilution or OC2-2F8 hybridoma supernatant at a 1:50 dilution, and incubated for 30 min at 4° C. After a wash with cold Dulbecco's Phosphate Buffered Saline (DPBS), cells were resuspended in DMEM+2% FBS containing a 1:200 dilution of APC-conjugated goat anti-rat secondary antibody adsorbed against mouse serum proteins (Jackson Immunoresearch). Propidium iodide staining was used to label dead cells for exclusion. Cells were analyzed and sorted with a Cytopeia inFluxV-GS (Becton-Dickenson).

Transplantation Assay

[0364] The injection of sorted cell populations to the spleen and the withdrawal of NTBC to induce hepatocyte selection were performed as described previously (Overturf et al. 1996). Drug withdrawal was done in periods of 3 wk, followed by readministration until normal weight was restored in the recipient animals.