ANTISENSE OLIGONUCLEOTIDE TARGETING ARL4C MOLECULE, AND NUCLEIC ACID DRUG USING ANTISENSE OLIGONUCLEOTIDE
20210317459 · 2021-10-14
Inventors
- Akira Kikuchi (Suita-shi, Osaka, JP)
- Shinji Matsumoto (Suita-shi, Osaka, JP)
- Satoshi OBIKA (Ibaraki-shi, Osaka, JP)
- Yuya KASAHARA (Ibaraki-shi, Osaka, JP)
- Takumi FUKUMOTO (Kobe-shi, Hyogo, JP)
Cpc classification
C12N2310/3231
CHEMISTRY; METALLURGY
A61K31/713
HUMAN NECESSITIES
C12Y207/01137
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The purpose of the present invention is to provide an antisense oligonucleotide that targets an ARL4C molecule and exerts an antitumor effect in vivo, and a nucleic acid drug using the antisense oligonucleotide. An antisense oligonucleotide that has a base sequence consisting of at least 10 consecutive bases contained in the base sequence represented by SEQ ID NO: 1. This antisense oligonucleotide targets an ARL4C molecule and thus can inhibit the expression of ARL4C in a tumor cell in vitro and suppress the migration and proliferation thereof. When systemically administered, moreover, the antisense oligonucleotide can exert an excellent antitumor effect in vivo too.
Claims
1. An antisense oligonucleotide targeting ARL4C, comprising a sequence of 10 or more consecutive bases that are included in the base sequence represented by SEQ ID NO: 1.
2. The antisense oligonucleotide according to claim 1, wherein the number of bases constituting the antisense oligonucleotide is 10 to 50.
3. The antisense oligonucleotide according to claim 1, wherein the sequence includes the base sequence represented by SEQ ID NO: 1.
4. The antisense oligonucleotide according to claim 1, consisting of the base sequence represented by SEQ ID NO: 1 or 2.
5. The antisense oligonucleotide according to claim 1, wherein at least one nucleotide is a 2′,4′-bridged nucleotide.
6. The antisense oligonucleotide according to claim 1, wherein the 2′,4′-bridged nucleotide has a structure shown in General Formula (1) below: ##STR00008## where “Base” represents a purine-9-yl group or a 2-oxo-1,2-dihydropyrimidine-1-yl group which may be substituted with a substituent, and “R” represents a hydrogen atom; an alkyl group having 1 to 7 carbon atoms wherein the alkyl group may be branched or may form a ring; an alkenyl group having 2 to 7 carbon atoms wherein the alkenyl group may be branched or may form a ring; an aryl group having 3 to 12 carbon atoms wherein the aryl group may have a substituent and may include a heteroatom; or an aralkyl group having an aryl moiety having 3 to 12 carbon atoms wherein the aryl moiety may have a substituent and may include a heteroatom.
7. The antisense oligonucleotide according to claim 1, wherein at least one of the internucleoside bonds is a phosphorothioate bond.
8. The antisense oligonucleotide according to claim 1, wherein all of the internucleoside bonds are phosphorothioate bonds, and the 1st to 3rd nucleotides from the 5′-terminal and the 2nd and 3rd nucleotides from the 3′-terminal are 2′,4′-bridged nucleotides.
9. The antisense oligonucleotide according to claim 1, wherein the antisense oligonucleotide is a chemically modified antisense oligonucleotide consisting of Sequence A or Sequence B shown below: Sequence A: G(Y){circumflex over ( )}5(Y){circumflex over ( )}A(Y){circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}c{circumflex over ( )}t{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}T(Y){circumflex over ( )}A(Y){circumflex over ( )}a Sequence B: G(Y){circumflex over ( )}5(Y){circumflex over ( )}A(Y){circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}c{circumflex over ( )}t{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}T(Y){circumflex over ( )}5(Y){circumflex over ( )}a where “G(Y)” represents guanine having a structure of AmNA (2′,4′-bridged nucleotide in which R is a methyl group in General Formula (1) described above), “A(Y)” represents adenine having a structure of AmNA, “T(Y)” represents thymine having a structure of AmNA, “5(Y)” represents 5-methylcytosine having a structure of AmNA, and “{circumflex over ( )}” represents a phosphorothioate bond.
10. A nucleic acid drug comprising the antisense oligonucleotide according to claim 1.
11. (canceled)
12. A method of treating a liver cancer, a colorectal cancer, a lung cancer, or a tongue cancer in a subject comprising administering the nucleic acid drug according to claim 10 to the subject.
13. A method of treating a metastatic liver cancer, or a cancer metastatic from a pancreatic cancer in a subject comprising administering the nucleic acid drug according to claim 10 to the subject.
14. A method of manufacturing an antitumor agent comprising obtaining the antisense oligonucleotide according to claim 1.
15. A method for treating a tumor, comprising administering, to a tumor patient, a therapeutically effective amount of the antisense oligonucleotide according to claim 1.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
EMBODIMENTS OF THE INVENTION
[0060] 1. Definition
[0061] In the present specification, antisense oligonucleotides may be abbreviated as “ASO”.
[0062] The base sequence of the nucleic acid (ASO, etc.) shown in the present specification has a 5′-terminal at the left end and a 3′-terminal at the right end.
[0063] 2. Antisense Oligonucleotide
[0064] The ASO of the present invention is an ASO that targets ARL4C and is characterized by including a sequence of 10 or more consecutive bases that are included in “gcatacctcaggtaa” (SEQ ID NO: 1). Hereinafter, the ASO of the present invention will be described in detail.
[0065] [Target Molecule]
[0066] The ASO of the present invention is an ASO that targets ARL4C (ARL4C ASO), and is a nucleic acid molecule capable of exerting an antitumor effect by suppressing the expression of ARL4C.
[0067] The mRNA of human ARL4C has the base sequence represented by SEQ ID NO: 3, and the base sequence represented by SEQ ID NO: 1 is complementary to the base sequence from the 1316th site to the 1330th site in SEQ ID NO: 3.
[0068] [Base Sequence]
[0069] The ASO of the present invention includes, as a base sequence, a sequence of 10 or more consecutive bases that are included in “gcatacctcaggtaa” (SEQ ID NO: 1). By including such a specific base sequence, the ASO can effectively suppress the expression of ARL4C and effectively exert an antitumor effect in vivo.
[0070] The number of bases of the ASO of the present invention is not particularly limited as long as the ASO includes a sequence of 10 or more consecutive bases that are included in the base sequence represented by SEQ ID NO: 1 and can knock down ARL4C; however, the number of bases of the ASO is preferably 13 or more. More specifically, the number of bases of the ASO is, for example, 10 to 50, preferably 10 to 40, more preferably 12 to 30, still more preferably 15 to 20, still more preferably 15 to 19, particularly preferably 15 to 17, and most preferably 15 (that is, the ASO consists of the base sequence represented by SEQ ID NO: 1).
[0071] When the number of bases of the ASO of the present invention is 10 to 14, the base sequence of the ASO of the present invention may be set to a base sequences having 10 to 14 consecutive bases included in the base sequence represented by SEQ ID NO: 1.
[0072] When the number of bases of the ASO of the present invention is 15, the base sequence of the ASO of the present invention may be set to one consisting of the base sequence represented by SEQ ID NO: 1.
[0073] When the number of bases of the ASO of the present invention is 16 or more, the base sequence of the ASO of the present invention includes the base sequence represented by SEQ ID NO: 1, with one or more bases being linked thereto on the 5′-terminal side and/or the 3′-terminal side. The type of the one or more bases linked to the 5′-terminal side and/or the 3′-terminal side is not particularly limited as long as ARL4C can be knocked down; the type can be set appropriately based on the base sequence of the mRNA of ARL4C as the target molecule.
[0074] One example of the base sequence of ASO of the present invention is a base sequence including “gcatacctcaggtaattca” (SEQ ID NO: 2). The base sequence represented by SEQ ID NO: 2 is the base sequence represented by SEQ ID NO: 1 with four bases of “ttca” linked to the 3′-terminal side thereof.
[0075] From the viewpoint of further improving the antitumor effect exerted in the living body, the ASO of the present invention is, for example, an ASO consisting of the base sequence represented by SEQ ID NO: 1 or 2, and more preferably, an ASO consisting of the base sequence represented by SEQ ID NO: 1.
[0076] [Chemical Modification]
[0077] The ASO of the present invention may be a chemically unmodified ASO (that is, an ASO consisting of natural nucleotides); however, it is desirable that the ASO is chemically modified so that the resistance to a nuclease, the affinity to a target gene, the pharmacokinetics, etc. are increased or improved.
[0078] In chemically modifying the ASO of the present invention, at least one part of the nucleotide among the base moiety, the sugar moiety, and the internucleoside bond may be chemically modified, and it is desirable that all of the nucleotides are chemically modified.
[0079] The nucleotide in which the base moiety is chemically modified is, for example, a nucleotide in which a substituent is introduced into the base moiety. Specific examples of the substituent include a hydroxyl group, a linear alkyl group having 1 to 6 carbon atoms, a linear alkoxy group having 1 to 6 carbon atoms, a mercapto group, a linear alkylthio group having 1 to 6 carbon atoms, an amino group, a linear alkylamino group having 1 to 6 carbon atoms, and a halogen atom. When the base is cytosine (C), preferable examples of chemically modified cytosine include 5-methylcytidine and 2′-O-methylcytidine.
[0080] Examples of the nucleotide in which the sugar moiety is chemically modified include: a 2′,4′-bridged nucleotides (bridged nucleic acid, BNA); and a nucleotide in which the hydroxyl group at the 2′ position of the sugar moiety is substituted with an alkoxy group (for example, an alkoxy group having 1 to 5 carbon atoms such as a methoxy group or an ethoxy group), or with a halogen atom (a fluorine atom, etc.). Among these, a 2′,4′-bridged nucleotide is preferred, for example.
[0081] A preferable example of the 2′,4′-bridged nucleotide is a nucleotide having the structure shown in General Formula (1) below.
##STR00002##
[0082] In General Formula (1), “Base” represents a base corresponding to the base sequence, and specifically, a purine-9-yl group or a 2-oxo-1,2-dihydropyrimidine-1-yl group that may be substituted with a substituent. Specific examples of the substituent include a hydroxyl group, a linear alkyl group having 1 to 6 carbon atoms, a linear alkoxy group having 1 to 6 carbon atoms, a mercapto group, a linear alkylthio group having 1 to 6 carbon atoms, an amino group, a linear alkylamino group having 1 to 6 carbon atoms, and a halogen atom.
[0083] Further, specific examples of the “Base” in General Formula (1) include: 6-aminopurine-9-yl group that may be substituted with a substituent, in a case where the base is adenine (A); 2-amino-6-hydroxypurine-9-yl group that may be substituted with a substituent, in a case where the base is guanine (G); 2-oxo-4-amino-1,2-dihydropyrimidine-1-yl group (e.g., 4-amino-5-methyl-2-oxo-1,2-dihydropyrimidine-1-yl group (including 5-methylcytosine-1-yl group, 2′-O-methylcytosine-1-yl group, and the like) that may be substituted with a substituent, in a case where the base is cytosine (C); 2-oxo-4-hydroxy-5-methyl-1,2-dihydropyrimidine-1-yl group that may be substituted with a substituent, in a case where the base is thymine (T).
[0084] In General Formula (1), “R” represents a hydrogen atom; an alkyl group having 1 to 7 carbon atoms wherein the alkyl group may be branched or may form a ring; an alkenyl group having 2 to 7 carbon atoms wherein the alkenyl group may be branched or may form a ring; an aryl group having 3 to 12 carbon atoms wherein the aryl group may have a substituent and may include a heteroatom; and an aralkyl group having an aryl moiety having 3 to 12 carbon atoms wherein the aryl moiety may have a substituent and may include a heteroatom. Specific examples of the substituent that can be included in the aryl group or the aralkyl group include a hydroxyl group, a linear alkyl group having 1 to 6 carbon atoms, a linear alkoxy group having 1 to 6 carbon atoms, a mercapto group, a linear alkylthio group having 1 to 6 carbon atoms, an amino group, a linear alkylamino group having 1 to 6 carbon atoms, and a halogen atom. “R” is preferably a hydrogen atom, a methyl group, an ethyl group, an n-propyl group, an isopropyl group, a phenyl group, or a benzyl group; it is more preferably a hydrogen atom or a methyl group, and particularly preferably a methyl group. In the present specification, the 2′,4′-bridged nucleotide in which R in General Formula (1) is a methyl group is referred to as “AmNA” in some cases.
[0085] Further, another example of the 2′,4′-bridged nucleotide is a nucleotide having a structure shown in General Formula (2) below. The nucleotide is a known 2′,4′-bridged nucleotide, which is also called a guanidine bridged nucleic acid (WO2014/046212).
##STR00003##
[0086] In General Formula (2), “Base” represents the same one as that represented by “Base” in General Formula (1) described above. In General Formula (2), R.sup.1, R.sup.12, and R.sup.13 each identically or differently represent a hydrogen atom; an alkyl group having 1 to 7 carbon atoms wherein the alkyl group may be branched or may form a ring, and R.sup.14 represents a hydrogen atom.
[0087] Further, another example of the 2′,4′-bridged nucleotide is a nucleotide having a structure shown in General Formula (3) below. The nucleotide is a known 2′,4′-bridged nucleotide, which is also called a spirocyclopropane bridged nucleic acid (WO2015/125783).
##STR00004##
[0088] In General Formula (3), “Base” represents the same one as that represented by “Base” in General Formula (1) described above. Further, in General Formula (3), R.sup.21 and R.sup.22 each identically or differently represent a hydrogen atom; an alkyl group having 1 to 7 carbon atoms that may be substituted with an aryl group having 3 to 12 carbon atoms that may include a heteroatom, and that may be branched or may form a ring; or an aralkyl group having an aryl moiety having 3 to 12 carbon atoms wherein the aryl moiety may include a heteroatom. Alternatively, R.sup.21 and R.sup.22 together form a group of —(CH.sub.2).sub.n- [where n is an integer of 2 to 5].
[0089] Further, another example of the 2′,4′-bridged nucleotide is a nucleotide having a structure shown in General Formula (4) or (4′) below. The nucleotide is a known 2′,4′-bridged nucleotide, which is also called an ethyleneoxy-bridged nucleic acid (WO2016/017422).
##STR00005##
[0090] In General Formulae (4) and (4′), “Base” represents the same one as that represented by “Base” in General Formula (1) described above. Further, in General Formulae (4) and (4′), X.sup.3 represents an oxygen atom or a sulfur atom.
[0091] In General Formulae (4) and (4′), R.sup.31 and R.sup.32 each identically or differently represent a hydrogen atom; an alkyl group having 1 to 7 carbon atoms wherein the alkyl group may be branched or may form a ring; an alkoxy group having 1 to 7 carbon atoms wherein the alkoxy group may be branched or may form a ring; or an amino group. Further, in the case of General Formula (4), R.sup.31 and R.sup.32 together may form —C(R.sup.35)R.sup.36 [where R.sup.35 and R.sup.36 each identically or differently represent a hydrogen atom; a hydroxyl group; a mercapto group; an amino group; a linear or branched alkoxy group having 1 to 6 carbon atoms; a linear or branched alkylthio group having 1 to 6 carbon atoms; a cyanoalkoxy group having 1 to 6 carbon atoms; or a linear or branched alkylamino group having 1 to 6 carbon atoms].
[0092] In General Formulae (4) and (4′), R.sup.33 represents a hydrogen atom; an alkyl group having 1 to 7 carbon atoms wherein the alkyl group may be branched or may form a ring; an alkoxy group having 1 to 7 carbon atoms wherein the alkoxy group may be branched or may form a ring; or a linear or branched alkylthio group having 1 to 6 carbon atoms.
[0093] In General Formula (4), R.sup.34 represents a hydrogen atom; an alkyl group having 1 to 7 carbon atoms wherein the alkyl group may be branched or may form a ring; an alkoxy group having 1 to 7 carbon atoms wherein the alkoxy group may be branched or may form a ring; or a linear or branched alkylthio group having 1 to 6 carbon atoms.
[0094] Furthermore, other examples of 2′,4′-bridged nucleotides include those having the structures shown below. “Base” and “R” in the following structural formulae represent the same ones as those represented by “Base” and “R” in General Formula (1) described above, respectively.
##STR00006## ##STR00007##
[0095] As for the chemical modification of the internucleoside bond, the internucleoside bond is a bond of, for example, phosphorothioate, chiral phosphorothioate, phosphorodithioate, phosphotriester, aminoalkylphosphotriester, 3′-alkylene phosphonate, 5′-alkylene phosphonate, phosphinate, 3′-aminophosphoramidate, aminoalkylphosphoramidate, thionophosphoramidate, thionoalkylphosphonate, thionoalkylphosphotriester, selenophosphate, or boranophosphate. The chemical modification of the internucleoside bond is preferably phosphorothioate, for example.
[0096] In the ASO of the present invention, the chemical modification may be applied to some of the nucleosides and/or the internucleoside bonds, or may be applied to all of the nucleosides and/or the internucleoside bonds.
[0097] Preferable examples of the chemical modification applied to the ASO of the present invention include chemical modification obtained by including at least one, preferably one to ten, more preferably two to eight, still more preferably two to six, or particularly preferably five 2′,4′-bridged nucleotides. In addition, in a case where a 2′,4′-bridged nucleotide is included, for example, it is preferable that the 1st to 3rd nucleotides from the 5′-terminal and the 2nd and 3rd nucleotides from the 3′-terminal are 2′,4′-bridged nucleotides (preferably AmNAs).
[0098] In addition, in a preferable example of the chemical modification applied to the ASO of the present invention, at least one of the internucleoside bonds is a phosphorothioate bond. Further, in a preferable example in a case where a phosphorothioate bond is included, preferably 50% or more, more preferably 80% or more, still more preferably 90% or more, particularly preferably 100% (i.e., all), among the total, i.e., 100%, of the internucleoside bonds, are phosphorothioate bonds.
[0099] A preferable example of the ASO of the present invention is a chemically modified ASO wherein all of the internucleoside bonds are phosphorothioate bonds, and the 1st to 3rd nucleotides from the 5′-terminal side and the 2nd and 3rd nucleotides from the 3′-terminal side are 2′,4′-bridged nucleotides (preferably AmNAs).
[0100] A preferable specific example of the ASO of the present invention is a chemically modified ASO consisting of the following sequence A or B. The chemically modified ASO consisting of the following sequence A or B can suppress the expression of ARL4C remarkably effectively, thereby having a particularly excellent antitumor effect in vivo; thus, it can be used particularly preferably.
[0101] Sequence A: G(Y){circumflex over ( )}5(Y){circumflex over ( )}A(Y){circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}c{circumflex over ( )}t{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}T(Y){circumflex over ( )}A(Y){circumflex over ( )}a
[0102] Sequence B: G(Y){circumflex over ( )}5(Y){circumflex over ( )}A(Y){circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}c{circumflex over ( )}t{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}T(Y){circumflex over ( )}5(Y){circumflex over ( )}a
[0103] In the sequences A and B, “G(Y)” represents guanine having an AmNA structure (2′,4′-bridged nucleotide in which R is a methyl group in General Formula (1) described above), “A(Y)” represents adenine having an AmNA structure, “T(Y)” represents thymine having an AmNA structure, “5(Y)” represents 5-methylcytosine having an AmNA structure, and “A” represents a phosphorothioate bond.
[0104] [Use/Application Method]
[0105] The ASO of the present invention acts on ARL4C as a target molecule, suppresses the expression, migration, and growth of ARL4C in tumor cells, and exerts an excellent antitumor effect. Therefore, it can be used as a nucleic acid drug that is administered as an antitumor agent to tumor patients.
[0106] The ASO of the present invention can exert an excellent antitumor effect on both primary tumors and metastatic tumors. The primary tumor or metastatic tumor to which the ASO of the present invention is applicable is not particularly limited; specific examples of the tumor include solid cancers such as liver cancer, metastatic liver cancer, colorectal cancer, lung cancer, tongue cancer, pancreatic cancer, gastric cancer, colon cancer, rectal cancer, bladder cancer, prostate cancer, cervical cancer, head and neck cancer, bile duct cancer, gallbladder cancer, oral cancer, pharyngeal cancer, laryngeal cancer, brain cancer, glioma, anti-blastoma, polymorphic glioblastoma, sarcoma, malignant melanoma, renal cancer, and thyroid cancer; and hematological cancers such as leukemia and malignant lymphoma.
[0107] Upon co-activation of the Wnt/β-catenin signal and the EGF/Ras-MAPK signal, ARL4C is highly expressed in a tumor cell-specific manner, and by regulating the activities of Rac and Rho, ARL4C exhibits an effect of promoting the motility and the infiltration ability of tumor cells, and tumorigenesis. On the other hand, the ASO of the present invention effectively suppresses the proliferation of tumor cells by inhibiting the expression of ARL4C in a tumor in which ARL4C is highly expressed; therefore, the cancer expressing ARL4C can be regarded as a target to which the present invention is suitably applied. In particular, a liver cancer, a colorectal cancer, a lung cancer, and a tongue cancer have high expression of ARL4C at high frequency, and therefore, the ASO of the present invention is particularly suitably applied to these cancers. In addition, since the liver is an organ in which systemically administered nucleic acid drugs are likely to accumulate, it can be said that a liver cancer is particularly suitable as a target to which the ASO of the present invention is to be applied.
[0108] As for a tumor having high expression of ARL4C, the expression can be confirmed by performing tissue immunization with respect to a tissue collected from the tumor. Specifically, a collected tumor tissue is immunostained with an anti-ARL4C antibody, and when the expression of ARL4C is observed in 20% or more of the tumor area, it is determined that ARL4C is highly expressed.
[0109] As described above, since the liver is an organ in which systemically administered nucleic acid drugs are likely to accumulate, a metastatic liver cancer is a suitable example of a metastatic tumor as a target to be prevented or treated by the ASO of the present invention. Further, another suitable example of a metastatic tumor as a target to be prevented or treated by the ASO of the present invention is a cancer metastatic from a pancreatic cancer.
[0110] The ASO of the present invention is suitably used as a nucleic acid drug for humans.
[0111] The method for administering ASO of the present invention is not particularly limited as long as an antitumor effect can be obtained; examples of the method include systemic administration such as intravenous injection, subcutaneous injection, intramuscular injection, and intraperitoneal injection, as well as local administration such as local injection into the affected area, transpulmonary administration, and suppository administration.
[0112] Regarding the dose of ASO of the present invention, the therapeutically effective amount may be appropriately set according to the type of an active ingredient to be used, the administration form, the type of a tumor to which the ASO is to be applied, the degree of symptom of a patient, and the like. For example, the single dose of ASO of the present invention is usually set to about 100 μg to 100 mg/kg body weight, and may be administered at a frequency of about once every 3 to 7 days.
[0113] In addition, the ASO of the present invention may be used alone, or may be used in combination with one, two, or more other drugs having antitumor activity and/or radiation therapy.
[0114] [Formulation]
[0115] The ASO of the present invention is prepared in a formulation according to the administration form, and is used as a nucleic acid drug. Examples of the formulation of the nucleic acid drug containing ASO of the present invention include liquid-type preparations such as liquid agents, suspension preparations, and liposome preparations.
[0116] In addition, the nucleic acid drug containing ASO of the present invention is formulated according to the formulation form thereof, with a pharmaceutically acceptable carrier or additive being added thereto. For example, in the case of making a liquid-type preparation, it can be prepared using physiological saline, a buffer solution, or the like.
[0117] Further, it is desirable that the nucleic acid drug containing the ASO of the present invention is formulated together with a nucleic acid transfer agent so that the ASO can be easily transferred into tumor cells. Specific examples of the nucleic acid transfer agent include lipofectamine, oligofectamine, RNAiFect, liposome, polyamine, DEAE dextran, calcium phosphate, and dendrimer.
EXAMPLES
[0118] Hereinafter, the present invention will be described in more detail with reference to examples. However, the present invention is not construed as being limited to the following examples.
[0119] 1. Test Material and Test Method
[0120] 1-1. Patients and Cancer Tissues
[0121] This study was conducted on 128 liver cancer patients (Stages Ito IVA) aged 21 to 81 (average 69 years old) who underwent surgical resection between January 2010 and December 2012 at Kobe University Hospital, and 115 colorectal cancer patients aged 28 to 91 (average 66 years old) who underwent surgical resection between February 2007 and February 2017 at Osaka University Hospital. Of the colorectal cancer patients, 102 patients were in Stages 0 to IIIC and 13 patients were in Stages IVA to IVB. Tumors were classified according to the Union for International Cancer Control (UICC) TNM classification. Resected specimens were macroscopically examined so that the location and size of the tumor were determined. Histological specimens were fixed with 10% by volume of formalin and embedded in paraffin. From each specimen, a 4 μm thick section was produced, and stained with hematoxylin and eosin (HE), or immunoperoxidase, for each analysis. The protocol in this study was carried out under the approval of the Medical Ethics Committee of Kobe University Graduate School of Medicine, etc. (No.180048) and the approval of the Osaka University Graduate School of Medicine (No.13032).
[0122] 1-2 Immunohistochemical Test
[0123] The immunohistochemical test was carried out by improving the method reported by Fujii S et al. (Oncogene 2015; 34: 4834-44.). When 20% or more of the total area of the tumor lesion was stained with ARL4C, it was judged to be ARL4C positive.
[0124] 1-3. Materials
[0125] Liver cancer cells (HLE, HLF, HuH-7, and PLC) were purchased from the Cell Resource Center for Biomedical Research, Institute of Development, Aging and Cancer, Tohoku University. HepG2 cells were purchased from the American Type Culture Collection (ATCC). HCT116 cells were supplied by Dr. T. Kobayashi (Hiroshima University). A549 cells were supplied by Dr. Y. Shintani (Osaka University). S2-CP8 cells were supplied by the Cell Resource Center for Biomedical Research, Institute of Development, Aging and Cancer, Tohoku University.
[0126] HLE, HLF, HuH-7, PLC, HCT116, A549, and S2-CP8 cells were grown in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal bovine serum (FBS). HepG2 cells were grown in Eagle's minimal essential medium (E-MEM) containing GlutaMAX™ I (Life Technologies, Darmstadt, Germany, catalog 35050-061), MEM non-essential amino acids (Life Technologies, catalog 11140-050), and 10% FBS.
[0127] HLE cells allowing for the stable expression of GFP (HLE/GFP cells), HLE cells allowing for the stable expression of ARL4c-GFP with GFP fused to the C-terminal side (HLE/ARL4C-GFP cells, i.e., cells in which ARL4C-GFP is transduced and stably expressed), HCT116 cells allowing for the stable expression of luciferase (HCT116/Luc cells), A549 cells allowing for the stable expression of luciferase (A549/Luc cells), and S2-CP8 cells allowing for the stable expression of luciferase (S2-CP8/Luc cells) were produced using lentivirus according to the method reported by Matsumoto S et al. (EMBO J 2014; 33: 702-18.) and Fujii S et al. (Oncogene 2015; 34: 4834-44.). In addition, ARL4C-GFP is ARL4C with GFP fused thereto.
[0128] Anti-ARL4C and anti-PIK3CD antibodies were purchased from Abcam (Cambridge, UK) and Santa Cruz Biotechnology (Santa Cruz, Calif., USA), respectively. Anti-phosphorylated AKT (S473) antibody, anti-AKT antibody, anti-Ki-67 antibody, and anti-YAP/TAZ were purchased from Cell Signaling Technology (Beverly, Mass., USA). PD184161 (MEK1/2 inhibitor) and VivoGlo luciferin were purchased from Sigma-Aldrich (Steinheim, Germany) and Promega (Madison, Wis., USA), respectively.
[0129] 1-4. Preparation of ASO Targeting ARL4C
[0130] 15 mer or 19 mer ASOs in which AmNA monomers were contained and linking was achieved by phosphodiester bonds, and 6-carboxyfluorescein (FAM)-labeled ASOs, were synthesized by Gene Design Co., Ltd. according to the method reported in Yahara A et al. (J Pharmacol Exp Ther 2012; 343: 489-96.) And Zuker M (Nucleic Acids Res 2003; 31: 3406-15.).
[0131] The sequences of the prepared ASOs targeting ARL4C are shown in Table 1.
[0132] In the present specification and drawings, among the ASOs shown in Table 1, “hArl4c-1316-AmNA (15)” is referred to as “ASO-1316”; “hArl4c-1312-AmNA (19)” as “ASO-1312”; “hArl4c-650-AmNA (15)” as “ASO-650”; “hArl4c-793-AmNA (15)” as “ASO-793”; “hArl4c-986-AmNA (15)” as “ASO-986”; “hArl4c-1065-AmNA (15)” as “ASO-1065”; “hArl4c-1454-AmNA (15)” as “ASO-1454”; “hArl4c-3225-AmNA (15)” as “ASO-”; “3225” “hArl4c-1450-AmNA (19)” as “ASO-1450”; and “hArl4c-3223-AmNA (19)” as “ASO-3223” in some cases.
[0133] ASO-1316 consists of the base sequence represented by SEQ ID NO: 1, and ASO-1312 consists of the base sequence represented by SEQ ID NO: 2.
TABLE-US-00001 TABLE 1 Sequence Name (Number of Bases) Sequence (5′.fwdarw.3′) Control ASO T(Y){circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}A(Y){circumflex over ( )}g{circumflex over ( )}a{circumflex over ( )}G(Y){circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}5(Y){circumflex over ( )}c{circumflex over ( )}c{circumflex over ( )}A(Y){circumflex over ( )}t{circumflex over ( )}c hAr14c-1-AmNA(15) G(Y){circumflex over ( )}G(Y){circumflex over ( )}5(Y){circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}c{circumflex over ( )}c{circumflex over ( )}t{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}G(Y){circumflex over ( )}T(Y){circumflex over ( )}c hAr14c-88-AmNA(15) G(Y){circumflex over ( )}5(Y){circumflex over ( )}5(Y){circumflex over ( )}t{circumflex over ( )}c{circumflex over ( )}t{circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}c{circumflex over ( )}c{circumflex over ( )}t{circumflex over ( )}g{circumflex over ( )}G(Y){circumflex over ( )}G(Y){circumflex over ( )}a hAr14c-474-AmNA(15) G(Y){circumflex over ( )}T(Y){circumflex over ( )}T(Y){circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}G(Y){circumflex over ( )}T(Y){circumflex over ( )}t hAr14c-650-AmNA(15) A(Y){circumflex over ( )}A(Y){circumflex over ( )}G(Y){circumflex over ( )}t{circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}c{circumflex over ( )}t{circumflex over ( )}g{circumflex over ( )}A(Y){circumflex over ( )}T(Y){circumflex over ( )}g (ASO-650) hAr14c-793-AmNA(15) A(Y){circumflex over ( )}5(Y){circumflex over ( )}T(Y){circumflex over ( )}t{circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}t{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}c{circumflex over ( )}t{circumflex over ( )}T(Y){circumflex over ( )}G(Y){circumflex over ( )}t (ASO-793) hAr14c-986-AmNA(15) A(Y){circumflex over ( )}T(Y){circumflex over ( )}5(Y){circumflex over ( )}t{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}c{circumflex over ( )}T(Y){circumflex over ( )}T(Y){circumflex over ( )}g (ASO-986) hAr14c-1065-AmNA(15) G(Y){circumflex over ( )}G(Y){circumflex over ( )}T(Y){circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}T(Y){circumflex over ( )}T(Y){circumflex over ( )}c (ASO-1065) hAr14c-1246-AmNA(15) G(Y){circumflex over ( )}G(Y){circumflex over ( )}A(Y){circumflex over ( )}g{circumflex over ( )}t{circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}a{circumflex over ( )}A(Y){circumflex over ( )}A(Y){circumflex over ( )}t hAr14c-1316-AmNA(15) G(Y){circumflex over ( )}5(Y){circumflex over ( )}A(Y){circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}c{circumflex over ( )}t{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}T(Y){circumflex over ( )}A(Y){circumflex over ( )}a (ASO-1316) hAr14c-1454-AmNA(15) A(Y){circumflex over ( )}G(Y){circumflex over ( )}G(Y){circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}g{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}A(Y){circumflex over ( )}T(Y){circumflex over ( )}t (ASO-1454) hAr14c-1710-AmNA(15) T(Y){circumflex over ( )}T(Y){circumflex over ( )}T(Y){circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}T(Y){circumflex over ( )}A(Y){circumflex over ( )}t hAr14c-1819-AmNA(15) 5(Y){circumflex over ( )}5(Y){circumflex over ( )}A(Y){circumflex over ( )}g{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}5(Y){circumflex over ( )}5(Y){circumflex over ( )}a hAr14c-1977-AmNA(15) G(Y){circumflex over ( )}5(Y){circumflex over ( )}A(Y){circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}A(Y){circumflex over ( )}5(Y){circumflex over ( )}a hAr14c-2055-AmNA(15) 5(Y){circumflex over ( )}A(Y){circumflex over ( )}T(Y){circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}g{circumflex over ( )}t{circumflex over ( )}c{circumflex over ( )}t{circumflex over ( )}g{circumflex over ( )}a{circumflex over ( )}A(Y){circumflex over ( )}A(Y){circumflex over ( )}a hAr14c-2082-AmNA(15) T(Y){circumflex over ( )}A(Y){circumflex over ( )}T(Y){circumflex over ( )}t{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}g{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}A(Y){circumflex over ( )}A(Y){circumflex over ( )}a hAr14c-2146-AmNA(15) 5(Y){circumflex over ( )}A(Y){circumflex over ( )}T(Y){circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}T(Y){circumflex over ( )}A(Y){circumflex over ( )}a hAr14c-2220-AmNA(15) T(Y){circumflex over ( )}T(Y){circumflex over ( )}T(Y){circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}g{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}G(Y){circumflex over ( )}A(Y){circumflex over ( )}c hAr14c-2264-AmNA(15) G(Y){circumflex over ( )}T(Y){circumflex over ( )}T(Y){circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}T(Y){circumflex over ( )}G(Y){circumflex over ( )}g hAr14c-2314-AmNA(15) 5(Y){circumflex over ( )}5(Y){circumflex over ( )}T(Y){circumflex over ( )}t{circumflex over ( )}c{circumflex over ( )}t{circumflex over ( )}c{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}A(Y){circumflex over ( )}T(Y){circumflex over ( )}t hAr14c-2448-AmNA(15) 5(Y){circumflex over ( )}T(Y){circumflex over ( )}G(Y){circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}t{circumflex over ( )}G(Y){circumflex over ( )}A(Y){circumflex over ( )}c hAr14c-2555-AmNA(15) A(Y){circumflex over ( )}T(Y){circumflex over ( )}T(Y){circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}T(Y){circumflex over ( )}T(Y){circumflex over ( )}t hAr14c-2715-AmNA(15) T(Y){circumflex over ( )}T(Y){circumflex over ( )}G(Y){circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}G(Y){circumflex over ( )}T(Y){circumflex over ( )}g hAr14c-2773-AmNA(15) A(Y){circumflex over ( )}T(Y){circumflex over ( )}A(Y){circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}g{circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}A(Y){circumflex over ( )}5(Y){circumflex over ( )}t hAr14c-2781-AmNA(15) A(Y){circumflex over ( )}G(Y){circumflex over ( )}G(Y){circumflex over ( )}g{circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}t{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}T(Y){circumflex over ( )}T(Y){circumflex over ( )}t hAr14c-2850-AmNA(15) T(Y){circumflex over ( )}5(Y){circumflex over ( )}A(Y){circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}5(Y){circumflex over ( )}5(Y){circumflex over ( )}a hAr14c-2936-AmNA(15) G(Y){circumflex over ( )}G(Y){circumflex over ( )}G(Y){circumflex over ( )}g{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}A(Y){circumflex over ( )}5(Y){circumflex over ( )}a hAr14c-2970-AmNA(15) T(Y){circumflex over ( )}5(Y){circumflex over ( )}T(Y){circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}t{circumflex over ( )}g{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}(5Y){circumflex over ( )}T(Y){circumflex over ( )}a hAr14c-3071-AmNA(15) 5(Y){circumflex over ( )}T(Y){circumflex over ( )}T(Y){circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}g{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}g{circumflex over ( )}G(Y){circumflex over ( )}G(Y){circumflex over ( )}a hAr14c-3105-AmNA(15) G(Y){circumflex over ( )}A(Y){circumflex over ( )}T(Y){circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}T(Y){circumflex over ( )}T(Y){circumflex over ( )}t hAr14c-3187-AmNA(15) A(Y){circumflex over ( )}T(Y){circumflex over ( )}A(Y){circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}c{circumflex over ( )}t{circumflex over ( )}5(Y){circumflex over ( )}T(Y){circumflex over ( )}c hAr14c-3225-AmNA(15) A(Y){circumflex over ( )}G(Y){circumflex over ( )}G(Y){circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}T(Y){circumflex over ( )}T(Y){circumflex over ( )}g (ASO-3225) hAr14c-3245-AmNA(15) T(Y){circumflex over ( )}A(Y){circumflex over ( )}A(Y){circumflex over ( )}g{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}g{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}T(Y){circumflex over ( )}5(Y){circumflex over ( )}a hAr14c-3332-AmNA(15) G(Y){circumflex over ( )}5(Y){circumflex over ( )}A(Y){circumflex over ( )}c{circumflex over ( )}c{circumflex over ( )}c{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}t{circumflex over ( )}A(Y){circumflex over ( )}T(Y){circumflex over ( )}t hAr14c-3378-AmNA(15) T(Y){circumflex over ( )}A(Y){circumflex over ( )}5(Y){circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}5(Y){circumflex over ( )}T(Y){circumflex over ( )}t hAr14c-3431-AmNA(15) A(Y){circumflex over ( )}T(Y){circumflex over ( )}T(Y){circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}t{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}A(Y){circumflex over ( )}A(Y){circumflex over ( )}c hAr14c-3597-AmNA(15) G(Y){circumflex over ( )}A(Y){circumflex over ( )}G(Y){circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}c{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}5(Y){circumflex over ( )}T(Y){circumflex over ( )}t hAr14c-3649-AmNA(15) G(Y){circumflex over ( )}A(Y){circumflex over ( )}A(Y){circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}t{circumflex over ( )}g{circumflex over ( )}G(Y){circumflex over ( )}5(Y){circumflex over ( )}c hAr14c-3728-AmNA(15) A(Y){circumflex over ( )}5(Y){circumflex over ( )}A(y){circumflex over ( )}g{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}A(Y){circumflex over ( )}G(Y){circumflex over ( )}g hAr14c-3756-AmNA(15) A(Y){circumflex over ( )}A(Y){circumflex over ( )}A(Y){circumflex over ( )}g{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}G(Y){circumflex over ( )}A(Y){circumflex over ( )}t hAr14c-3822-AmNA(15) T(Y){circumflex over ( )}G(Y){circumflex over ( )}A(Y){circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}g{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}T(Y){circumflex over ( )}A(Y){circumflex over ( )}a hAr14c-3223-AmNA(17) A(Y){circumflex over ( )}G(Y)G(Y){circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}G(Y){circumflex over ( )}G(Y){circumflex over ( )}c hAr14c-3221-AmNA(19) A(Y){circumflex over ( )}G(Y){circumflex over ( )}G(Y){circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}5(Y){circumflex over ( )}A(Y){circumflex over ( )}t hAr14c-3223-AmNA(15) G(Y){circumflex over ( )}T(Y){circumflex over ( )}T(Y){circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}G(Y){circumflex over ( )}G(Y){circumflex over ( )}c hAr14c-3221-AmNA(17) G(Y){circumflex over ( )}T(Y){circumflex over ( )}T(Y){circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}5(Y){circumflex over ( )}A(Y){circumflex over ( )}t hAr14c-3219-AmNA(19) G(Y){circumflex over ( )}T(Y){circumflex over ( )}T(Y){circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}T(Y){circumflex over ( )}5(Y){circumflex over ( )}t hAr14c-3221-AmNA(15) T(Y){circumflex over ( )}A(Y){circumflex over ( )}5(Y){circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}5(Y){circumflex over ( )}A(Y){circumflex over ( )}t hAr14c-3219-AmNA(17) T(Y){circumflex over ( )}A(Y){circumflex over ( )}5(Y){circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}T(Y){circumflex over ( )}5(Y){circumflex over ( )}t hAr14c-3217-AmNA(19) T(Y){circumflex over ( )}A(Y){circumflex over ( )}5(Y){circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}c{circumflex over ( )}T(Y){circumflex over ( )}G(Y){circumflex over ( )}c hAr14c-3227-AmNA(15) G(Y){circumflex over ( )}A(Y){circumflex over ( )}A(Y){circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}t{circumflex over ( )}A(Y){circumflex over ( )}T(Y){circumflex over ( )}t hAr14c-3225-AmNA(17) G(Y){circumflex over ( )}A(Y){circumflex over ( )}A(Y){circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}T(Y){circumflex over ( )}T(Y){circumflex over ( )}g hAr14c-3223-AmNA(19) G(Y){circumflex over ( )}A(Y){circumflex over ( )}A(Y){circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}G(Y){circumflex over ( )}G(Y){circumflex over ( )}c (ASO-3223) hAr14c-3229-AmNA(15) G(Y){circumflex over ( )}A(Y){circumflex over ( )}G(Y){circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}G(Y){circumflex over ( )}T(Y){circumflex over ( )}a hAr14c-3227-AmNA(17) G(Y){circumflex over ( )}A(Y){circumflex over ( )}G(Y){circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}t{circumflex over ( )}A(Y){circumflex over ( )}T(Y){circumflex over ( )}t hAr14c-3225-AmNA(19) G(Y){circumflex over ( )}A(Y){circumflex over ( )}G(Y){circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}T(Y){circumflex over ( )}T(Y){circumflex over ( )}g hAr14c-1314-AmNA(17) G(Y){circumflex over ( )}5(Y){circumflex over ( )}A(Y){circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}c{circumflex over ( )}t{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}A(Y){circumflex over ( )}T(Y){circumflex over ( )}t hAr14c-1312-AmNA(19) G(Y){circumflex over ( )}5(Y){circumflex over ( )}A(Y){circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}c{circumflex over ( )}t{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}T(Y){circumflex over ( )}5(Y){circumflex over ( )}a (ASO-1312) hAr14c-1318-AmNA(15) A(Y){circumflex over ( )}T(Y){circumflex over ( )}G(Y){circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}c{circumflex over ( )}t{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}G(Y){circumflex over ( )}G(Y){circumflex over ( )}t hAr14c-1316-AmNA(17) A(Y){circumflex over ( )}T(Y){circumflex over ( )}G(Y){circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}c{circumflex over ( )}t{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}T(Y){circumflex over ( )}A(Y){circumflex over ( )}a hAr14c-1314-AmNA(19) A(Y){circumflex over ( )}T(Y){circumflex over ( )}G(Y){circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}c{circumflex over ( )}t{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}A(Y){circumflex over ( )}T(Y){circumflex over ( )}t hAr14c-1320-AmNA(15) A(Y){circumflex over ( )}A(Y){circumflex over ( )}A(Y){circumflex over ( )}t{circumflex over ( )}g{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}c{circumflex over ( )}t{circumflex over ( )}5(Y){circumflex over ( )}A(Y){circumflex over ( )}g hAr14c-1318-AmNA(17) A(Y){circumflex over ( )}A(Y){circumflex over ( )}A(Y){circumflex over ( )}t{circumflex over ( )}g{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}c{circumflex over ( )}t{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}G(Y){circumflex over ( )}G(Y){circumflex over ( )}t hAr14c-1316-AmNA(19) A(Y){circumflex over ( )}A(Y){circumflex over ( )}A(Y){circumflex over ( )}t{circumflex over ( )}g{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}c{circumflex over ( )}t{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}T(Y){circumflex over ( )}A(Y){circumflex over ( )}a hAr14c-1314-AmNA(15) A(Y){circumflex over ( )}T(Y){circumflex over ( )}A(Y){circumflex over ( )}c{circumflex over ( )}c{circumflex over ( )}t{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}A(Y){circumflex over ( )}T(Y){circumflex over ( )}t hAr14c-1312-AmNA(17) A(Y){circumflex over ( )}T(Y){circumflex over ( )}A(Y){circumflex over ( )}c{circumflex over ( )}c{circumflex over ( )}t{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}T(Y){circumflex over ( )}5(Y){circumflex over ( )}a hAr14c-1310-AmNA(19) A(Y){circumflex over ( )}T(Y){circumflex over ( )}A(Y){circumflex over ( )}c{circumflex over ( )}c{circumflex over ( )}t{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}c{circumflex over ( )}A(Y){circumflex over ( )}5(Y){circumflex over ( )}a hAr14c-1312-AmNA(15) A(Y){circumflex over ( )}5(Y){circumflex over ( )}5(Y){circumflex over ( )}t{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}T(Y){circumflex over ( )}5(Y){circumflex over ( )}a hAr14c-1310-AmNA(17) A(Y){circumflex over ( )}5(Y){circumflex over ( )}5(Y){circumflex over ( )}t{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}c{circumflex over ( )}A(Y){circumflex over ( )}5(Y){circumflex over ( )}a hAr14c-1308-AmNA(19) A(Y){circumflex over ( )}5(Y){circumflex over ( )}5(Y){circumflex over ( )}t{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}t{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}A(Y){circumflex over ( )}G(Y){circumflex over ( )}g hAr14c-1452-AmNA(17) A(Y){circumflex over ( )}G(Y){circumflex over ( )}G(Y){circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}g{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}T(Y){circumflex over ( )}T(Y){circumflex over ( )}c hAr14c-1450-AmNA(19) A(Y){circumflex over ( )}G(Y){circumflex over ( )}G(Y){circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}g{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}5(Y){circumflex over ( )}A(Y){circumflex over ( )}a (ASO-1450) hAr14c-1452-AmNA(15) G(Y){circumflex over ( )}A(Y){circumflex over ( )}5(Y){circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}g{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}T(Y){circumflex over ( )}T(Y){circumflex over ( )}c hAr14c-1450-AmNA(17) G(Y){circumflex over ( )}A(Y){circumflex over ( )}5(Y){circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}g{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}5(Y){circumflex over ( )}A(Y){circumflex over ( )}a hAr14c-1448-AmNA(19) G(Y){circumflex over ( )}A(Y){circumflex over ( )}5(Y){circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}g{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}A(Y){circumflex over ( )}5(Y){circumflex over ( )}a hAr14c-1450-AmNA(15) 5(Y){circumflex over ( )}A(Y){circumflex over ( )}A(Y){circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}g{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}5(Y){circumflex over ( )}A(Y){circumflex over ( )}a hAr14c-1448-AmNA(17) 5(Y){circumflex over ( )}A(Y){circumflex over ( )}A(Y){circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}g{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}A(Y){circumflex over ( )}5(Y){circumflex over ( )}a hAr14c-1446-AmNA(19) 5(Y){circumflex over ( )}A(Y){circumflex over ( )}A(Y){circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}g{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}t{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}A(Y){circumflex over ( )}G(Y){circumflex over ( )}g hAr14c-1456-AmNA(15) G(Y){circumflex over ( )}5(Y){circumflex over ( )}A(Y){circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}g{circumflex over ( )}A(Y){circumflex over ( )}A(Y){circumflex over ( )}a hAr14c-1454-AmNA(17) G(Y){circumflex over ( )}5(Y){circumflex over ( )}A(Y){circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}g{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}A(Y){circumflex over ( )}T(Y){circumflex over ( )}t hAr14c-1452-AmNA(19) G(Y){circumflex over ( )}5(Y){circumflex over ( )}A(Y){circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}g{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}T(Y){circumflex over ( )}T(Y){circumflex over ( )}c hAr14c-1458-AmNA(15) G(Y){circumflex over ( )}A(Y){circumflex over ( )}G(Y){circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}T(Y){circumflex over ( )}G(Y){circumflex over ( )}a hAr14c-1456-AmNA(17) G(Y){circumflex over ( )}A(Y){circumflex over ( )}G(Y){circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}g{circumflex over ( )}A(Y){circumflex over ( )}A(Y){circumflex over ( )}a hAr14c-1454-AmNA(19) G(Y){circumflex over ( )}A(Y){circumflex over ( )}G(Y){circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}g{circumflex over ( )}g{circumflex over ( )}a{circumflex over ( )}c{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}t{circumflex over ( )}g{circumflex over ( )}a{circumflex over ( )}a{circumflex over ( )}A(Y){circumflex over ( )}T(Y){circumflex over ( )}t In Table, “G(Y)” represents guanine having a structure of AmNA (2′,4′-bridged nucleotide in which R is a methyl group in General Formula (1) described above), “A(Y)” represents adenine having a structure of AmNA, “T(Y)” represents thymine having a structure of AmNA, “5(Y)” represents 5-methylcytosine having a structure of AmNA, and “{circumflex over ( )}” represents a phosphorothioate bond.
[0134] HLE cells, HCT116 cells, and A549 cells were transfected with 25 to 50 nM ASO and 10 to 20 nM siRNA using Lipofectamine 3000 (Invitrogen, Carlsbad, Calif., USA) or RNAiMAX (Invitrogen). Transfected cells were used in the experiments 36 to 48 hours after the end of the transfection.
[0135] 1-5. Xenograft Liver Tumor Formation and Treatment with ASO in Vivo
[0136] Pellets of HLE cells (1×10.sup.7 cells) were suspended in 100 μl of Matrigel matrix high concentration (BD Biosciences, San Jose, Calif., USA) and were injected into the livers of 8-week-old male nude mice (BALB/cAJcl-nu/nu, CLEA Japan, Inc.) under anesthesia (day 0). From day 0, ASO (50 μg/body; about 2.5 mg/kg) was subcutaneously administered twice a week. Mice were euthanized 29 days after the HLE cell transplantation, and tumors were recovered and subjected to histological analysis.
[0137] HCT116/Luc cells (2.5×10.sup.5 cells) were suspended in 100 μl of phosphate buffer solution (PBS), and were injected into the spleens of 8-week-old male nude mice (BALB/cAJcl-nu/nu, CLEA Japan, Inc.) under anesthesia. After 19 days had elapsed since the transplantation, ASO (50 μg/body; about 2.5 mg/kg) was subcutaneously administered twice a week. Mice were euthanized 47 days after the HCT116/Luc cell transplantation and were subjected to histological analysis.
[0138] Tumor growth analysis was performed by recording bioluminescence images at a frequency of once a week, in the following manner: VivoGlo luciferin (30 mg/ml) was administered intraperitoneally, and 10 minutes after the administration of VivoGlo luciferin, recording was carried out using an IVIS imaging system (Xenogen Corp., Alameda, Calif., USA).
[0139] 1-6. Clinical Data Analysis Using Open Source
[0140] ARL4C mRNA expression data regarding the livers of liver cancer patients and colorectal cancer patients were obtained from the Gene Expression Profiling Interactive Analysis (GEPIA) online database (http://gepia.cancer-pku.cn/). Tumor samples and normal samples in the GEPIA database were obtained from the Cancer Genome Atlas (TCGA) project and the Genotype-Tissue Expression (GTEx) project. Expression difference analysis was performed by one-way analysis of variance (one-way ANOVA). A p-value of less than 0.05 was determined to be statistically significant. The correlation of the overall survival rate with ARL4C mRNA expression in colorectal cancers in the TCGA dataset was analyzed using OncoLnc (http://www.oncolnc.org), and was visualized by using GraphPad Prism (GraphPad Software, San Diego, Calif.). The ARL4C high expression group and the ARL4C low expression group were designated according to the median value of the ARL4C expression in colorectal cancer patients in the dataset. Co-expression analysis using the TCGA dataset was performed using the R2: Genomics Analysis Platform (http://r2.amc.nl) and visualized using GraphPad Prism. The p-value and the r-value were calculated using GraphPad Prism.
[0141] 1-7. Identification of Potential Off-Target Genes for ARL4C ASOs by In Silico Analysis of Candidate Genes
[0142] Potential off-target genes in ARL4C ASO (hARL4C ASO-1316-AmNA [15-mer] (ARL4C ASO-1316) and hARL4C-3223-AmNA [19-mer] (ARL4C ASO-3223)) were identified by using database “Human Genomic plus Transcript (Human G+T)” (Build 2.7.1) as well as basic local alignment search tools (BLAST+programs) using MegaBlast algorithm.
[0143] 1-8. Formation of Xenograft Orthotopic Transplantation Model Using Lung Cancer Cells and Treatment with ASO in Vivo
[0144] Eight-week-old male nude mice (BALB/cAJcl-nu/nu, CLEA Japan, Inc.) were intraperitoneally injected with medetomidine (0.75 mg/kg), midazolam (4 mg/kg), and butorphanol (5 mg/kg) so as to be anesthetized. The xenograft orthotopic transplantation model was formed by transplanting human lung cancer cells into the left lungs of mice in the following order. A549/Luc cells (approximately 2×10.sup.6 cells) were suspended in 10 μl of PBS (phosphate buffered saline) and 10 μl of Matrigel (BD Biosciences, San Jose, Calif., USA), and a 29G needle attached to a 0.5 ml insulin syringe (BD Biosciences, San Jose, Calif., USA) was used to inject the same through the intercostal space to a depth of 2 mm in the left lung. The incision in the skin was closed with a 5-0 polypropylene suture, and the mice were rested on a warm carpet until they were fully recovered.
[0145] One week after the tumor transplantation, tumor establishment was confirmed using an IVIS imaging system (Xenogen Corp., Alameda, Calif., USA). In the in-vivo imaging, 100 μl of VivoGlo luciferin (30 mg/ml) was administered via the tail vein, and bioluminescence imaging was recorded 5 minutes after the administration. Mice with established tumors were then divided into two groups, a control ASO inhalation group (n=7) and an ARL4C ASO inhalation group (n=9) in such a manner that the groups had identical IVIS signal intensities. When 7, 11 and 15 days elapsed after the tumor transplantation, ASO (200 μg/body, about 10 mg/kg) dissolved in 25 μl was administered transbronchially using a 22G intravenous catheter, according to the procedure reported by Kim MP et al. (Nat Protoc 2009; 4: 1670-80.). When 21 days elapsed after the tumor transplantation, tumor sizes were determined using the IVIS imaging system, and then the mice were euthanized for histological analysis. All protocols in this study were carried out under the approval of the Animal Experiment Committee of Osaka University (No. 26-032-048).
[0146] 1-9. Formation of Xenograft Orthotopic Transplantation Model Using Pancreatic Cancer Cells and Treatment with ASO in Vivo
[0147] Assay based on the xenograft orthotopic transplantation model using pancreatic cancer cells was performed by arranging the method described in the literature (Kim M P. et. al., Nat Protoc 2009; 4: 1670-80.). Specifically, S2-CP8/Luc cells (5×10.sup.5 cells) were suspended in 100 μl of Hanks' Balanced Salt Solution (HBSS) containing 50% matrigel, and were orthotopically transplanted in the central part of the pancreas using a 27G needle. Three days after transplantation, the mice were divided into two groups, a control ASO-administered group (n=6) and an ARL4C ASO-administered group (n=7). After three days had elapsed since the transplantation, ASO (50 μg/body, approximately 2.5 mg/kg) was subcutaneously administered twice a week. Tumors were quantified once a week using the IVIS imaging system (Xenogen Corp.). In the in-vivo imaging, 100 μl of VivoGlo luciferin (30 mg/me was intraperitoneally administered, and bioluminescence images were recorded eight minutes after the administration. The quantification of the tumors was carried out in the following manner: a region of interest (ROI) was selected, and a radiance value of the same was measured using Living Image 4.3.1 Software (Caliper Life Science). The mice were euthanized 28 days after the transplantation, tumor weights and the number of mesenteric lymph nodes (lymph nodes of 1 mm or larger in diameter) were determined, and histological analysis was carried out. All protocols in this study were carried out under the approval of the Animal Experiment Committee of Osaka University (No. 26-032-048).
[0148] 1-10. Statistical Analysis
[0149] Each experiment was performed at least 3 times; the results are expressed as mean±standard deviation (s.d.). The cumulative probability of recurrence-free survival rate was determined using the Kaplan-Meier method. Statistical significance differences were determined using the log rank test. Statistical significance differences in other experiments were determined by the Student's t-test. With a p-value of less than 0.05, it was determined that there was a statistically significant difference.
[0150] 1-11. Other Test Methods and Test Materials
[0151] Cell migration assays and quantitative real-time PCR analyses were performed according to the methods reported by Fujii S et al. (Oncogene 2015; 34: 4834-44.).
[0152] Primers and siRNAs used in the experiments are as shown in Tables 2 and 3.
TABLE-US-00002 TABLE 2 Primer Primer Sequence human ARLAC AGGGGCTGTGAAGCTGAGTA TTCCAGGCTGAAAAGCAGTT human CTNNB1 GAAACGGCTTTCAGTTGAGC CTGGCCATATCCACCAGAGT human PIK3CD TGGAATTCTGGACCAAGGAG AAAGTTGGGGGAGTTCTCGT human NLN GCTGAACTTGGTGCTCTTCC TAGTTTGGCCACCTTGGTTC human FBXL9 AGCTGTGTGCCTCTTGTGTG AGTTGGGGATCTCTGCATTG human GARDH TCCTGCACCACCAACTGCTT TGGCAGTGATGGCATGGAC
TABLE-US-00003 TABLE 3 siRNA Target genes Target Sequences Randomized control CAGTCGCGTTTGCGACTGG human Cmnb1 CCCACTAATGTCCAGCGTT (#1, for open reading frame) GCATAACCTTTCCCATCAT (#2, for open reading frame) human PIK3CD GCGAATACTCTGCCATTAT (#1, for 3′-untranslated region) GCCAACTAACTCTGCAGAT (#2, for 3′-untranslated region) In Table, each siRNA indicates the base sequence of the sense strand.
[0153] The cell proliferation assays were performed using the CyQUANT NF Cell Proliferation Assay Kits (Thermo Fisher Scientific), in the way recommended by the manufacturer.
[0154] Fluorescence was measured using a fluorescence microplate reader (Synergy™ HTX Multi-Mode Microplate Reader, BioTek, Winooski, Vt., USA).
[0155] 2. Test Results
[0156] 2-1. Expression of ARL4C in Primary and Metastatic Cancers
[0157] The expression of ARL4C in primary liver cancers was analyzed immunohistochemically. Tumors with more than 20% of tumor cells stained with an anti-ARL4C antibody were determined to be ARL4C positive. Of the 128 liver cancer cases, 33 (25.8%) were ARL4C positive. An ARL4C-positive primary liver cancer was immunostained with the anti-ARL4C antibody, and the image is shown in (a) of
[0158] The relationship between the expression of ARL4C and clinicopathological factors in liver cancer patients was analyzed, and the results thereof are shown Table 4. Analysis using a dataset (Gene Expression Profiling Interactive Analysis; GEPIA) combining Cancer Genome Atlas (TCGA) and Genotype-Tissue Expression (GTEx) shows that the ARL4C mRNA amount in liver cancers was not statistically significantly higher than that in normal liver cells. However, as shown in
TABLE-US-00004 TABLE 4 Liver Cancer Patient ARL4C negative ARL4C positive (n = 95) (n = 33) P value General Background Age (Year) 68 (21-81) 69 (50-81) 0.15 Sex (Male/Female) 83/12 31/2 0.30 Hepatitis Virus Infection (HB or HC/non-B and non-C).sup.#1 54/41 21/12 0.49 Child-Pugh Score (A/B) 94/1 31/2 0.10 Tumor Factor Number of Tumors (>2/1) 37/58 18/15 0.12 Tumor Size (≥5 cm/<5 cm) 43/52 17/16 0.54 Tissue Type (well or moderate/poor) 74/20 22/11 0.17 Lymph Node Metastasis (negative/positive) 95/0 32/1 0.09 Vascular Infiltration (negative/positive) 65/30 15/18 0.02 Membrane Formation (negative/positive) 16/79 3/30 0.28 Membrane Infiltration (negative/positive) 34/61 7/26 0.12 Stage (I-II/IIIA-IVA) 65/30 18/15 0.15 .sup.#1HB, Hepatitis B; HC, Hepatitis C; non-B and non-C, Non-Hepatitis B and Non-Hepatitis C
[0159] A univariate analysis of the recurrence-free survival rate in liver cancer patients was carried out using the Cox proportional hazard model; the results thereof are shown in Table 5. The results of the univariate analysis show that the gender, the tumor count >2, the poorly differentiated type, the lymph node metastasis, the vascular infiltration, Stages IIIA to IVA, and the ARL4C expression correlated with a decrease in the disease-free survival.
TABLE-US-00005 TABLE 5 Liver Cancer Patient Number Hazard Ratio 95% CI P value Age (≥65 years/<65 years) 87/41 1.31 0.81-2.20 0.27 Sex (Male/Female) 114/14 0.45 0.25-0.91 0.028 Hepatitis Virus Infection (HB or HC/non-B and non-C) 75/53 1.22 0.78-1.95 0.38 Child-Pugh Score (B/A) 3/125 5.10 1.23-14.15 0.029 Number of Tumors (>2/1) 55/73 2.64 1.68-4.17 <0.0001 Tumor Size (≥5 cm/<5 cm) 60/68 1.49 0.96-2.34 0.078 Tissue Type (poor/well or moderate) 31/96 1.96 1.18-3.16 0.010 Lymph Node Metastasis (positive/negative) 1/127 31.35 1.60-211.89 0.030 Vascular Infiltration (positive/negative) 48/80 2.61 1.66-4.09 <0.0001 Membrane Formation (positive/negative) 109/19 0.89 0.52-1.66 0.70 Membrane Infiltration (positive/negative) 87/41 1.19 0.74-1.94 0.48 Stage (IIIA-IVA/I-II) 83/45 2.43 1.54-3.80 0.0002 ARL4C expression (positive/negative) 33/95 1.68 1.02-2.69 0.042
[0160] A multivariate analysis of the recurrence-free survival rate in patients with Stage 0 to IIIC liver cancers was carried out using the Cox proportional hazard model; the results thereof are shown in Table 6. The results of a multivariate analysis reveal that the tumor count >2 was an independent prognostic factor (P=0.0003). Furthermore, the results also reveal that the ARL4C positivity tended to be independently associated with a poor prognosis (P=0.066). In addition, the relationship between the recurrence-free survival rate and the ARL4C expression in liver cancer patients was analyzed; the results thereof are shown in (b) of
TABLE-US-00006 TABLE 6 Liver Cancer Patient Number Hazard Ratio 95% P value Sex (Male/Female) 114/14 0.54 0.28-1.12 0.093 Number of Tumors (>2/1) 55/73 2.37 1.50-3.79 0.0003 Tissue Type (poor/well 31/96 1.57 0.93-2.59 0.09 or moderate) ARL4C expression 33/95 1.62 0.97-2.66 0.066 (positive/negative)
[0161] The relationship between the expression of ARL4C and clinicopathological factors in colorectal cancer patients was analyzed; the results thereof are shown in Table 7. In the 102 patients with Stage 0 to IIIC colorectal cancers, 24.5% of the tumors were confirmed to be ARL4C positive. It was also found that the ARL4C positivity correlated with the tumor infiltration, the vascular infiltration, and Stages HA to IIIC.
TABLE-US-00007 TABLE 7 Colorectal Cancer Patient ARL4C negative ARL4C positive (n = 77) (n =25) P value General Background Age (Year) 69 (39-91) 65 (28-85) 0.06 Sex (Male/Female) 48/29 15/10 0.83 Tumor Factor Tissue Type (well or moderate or mucinous/poor) 74/3 23/2 0.59 Tumor Infiltration (M or SM/MP-SI).sup.#1) 33/44 4/21 0.017 Vascular Infiltration (negative/positive) 57/19 12/13 0.024 Lymph Infiltration (negative/positive) 33/43 8/17 0.36 Lymph Node Metastasis (negative/positive) 51/26 17/8 1.00 Stage (0-I/IIA-IIIC) 42/35 6/19 0.011 .sup.#1)M, Mucous Membrane; SM, Submucosal Layer; MP, Muscularis Propria; SI, invasion of adjacent structures
[0162] A univariate analysis of recurrence-free survival rate in colorectal cancer patients was carried out using the Cox proportional hazard model; the results thereof are shown in Table 8. The results of the univariate analysis reveal that the depth of tumor infiltration beyond the submucosal layer, the vascular infiltration, the lymphatic infiltration, the lymph node metastasis, Stages II to IIIC, and the ARL4C expression were associated with the decrease in the recurrence-free survival rate.
TABLE-US-00008 TABLE 8 Colorectal Cancer Patient Number Hazard Ratio 95% CI P value Age (≥65 years/<65 years) 63/39 1.47 0.65-3.30 0.35 Sex (Male/Female) 63/39 2.00 0.84-5.51 0.12 Tissue Type (poor/well, moderate or mucinous) 5/97 1.9 × 109 1.86 0.15 Tumor Infiltration (MP-SI/M or SM) 65/37 8.6 × 109 8.30 <0.0001 Vascular Infiltration (positive/negative) 32/69 7.72 3.32-20.04 <0.0001 Lymph Infiltration (positive/negative) 60/41 5.60 1.93-23.72 0.0007 Lymph Node Metastasis (positive/negative) 34/68 2.93 1.31-6.69 0.01 Stage (IIA-IIIC/0-I) 64/48 12.87 3.79-80.37 <0.0001 ARL4C expression (positive/negative) 25/77 4.79 2.14-11.12 0.0002
[0163] A multivariate analysis of recurrence-free survival rate in patients with Stage 0 to IIIC colorectal cancers was carried out using the Cox proportional hazard model; the results thereof are shown in Table 9. The results show that the expression of ARL4C was an independent prognostic factor in colorectal cancers. In addition, the relationship between the recurrence-free survival rate and the ARL4C expression in colorectal cancer patients was analyzed; the results thereof are shown in (c) of
TABLE-US-00009 TABLE 9 Colorectal Cancer Patient Colorectal Cancer Patient Number Hazard Ratio 95% CI P value Lymph Infiltration (positive/negative) 60/41 3.29 0.94-15.17 0.063 Lymph Node Metastasis (positive/negative) 34/68 1.93 0.80-4.96 0.14 ARL4C expression (positive/negative) 25/77 4.51 1.98-10.61 0.0004
[0164] In addition, the relationship between ARL4C expression and overall survival rates was analyzed using the Cancer Genome Atlas (TCGA) dataset on colorectal cancer patients; the results are shown in (d) of
[0165] Regarding tumors resulting from metastasis of colorectal cancers to the livers (24 cases), the ARL4C expression was measured immunohistologically; the results are shown in (e) of
[0166] 2-2. Screening of ARL4C ASOs and Influence of ARL4C ASOs on Proliferation and Migration of Liver Cancer Cells and Colorectal Cancer Cells
[0167] First, base sequences of 15-nucleotide ARL4C were selected based on the structure of ARL4C mRNA. From thousands of ARL4C ASO candidates, those that may cause hepatotoxicity were excluded, and 38 types of ARL4C ASOs (those other than ASO-1312, ASO-1450 and ASO-3223 among the ASOs in Table 1) were selected, by high-dimensional structure prediction of ARL4C mRNA. The ASOs used in this test were those in which all of the phosphodiester bonds were substituted with phosphorothioate bonds. Knockdown efficiencies of ARL4C ASOs in A549 cells (lung adenocarcinoma cells) were investigated by screening experiments using real-time PCR. It has been confirmed that the protein abundance of ARL4C in A549 cells is reduced by treatment with ARL4C siRNA. The ARL4C mRNA amounts in A549 cells treated with 38 types of ARL4C ASOs were measured, and the results are shown in (a) of
[0168] The ARL4C mRNA amounts in 5 types of liver cancer cells (HLE, HLF, PLC, HuH-7 cells, and HepG2) were measured, and the results thereof are shown in (b) of
[0169] HLE cells and HCT116 cells were transfected with the above-described seven types of ARL4C ASOs and the control ASO at 25 nM, and the ARL4C mRNA amounts were measured by real-time PCR; the results thereof are shown in (a) of
[0170] HLE cells were transfected with ARL4C ASOs (ASO-1316, ASO-1312, ASO-1454, ASO-1450, ASO-3225, and ASO-3223) at 25 nM each, and the ARL4C mRNA amounts were measured by real-time PCR; the results are shown in (c) of
[0171] Four genes of neurolysin (NLN), sapiens F-box and leucine-rich repeat protein 19 (FBXL19), keratin-associated protein 15-1 (KRTAP15-1), and sialic acid binding Ig-like lectin 6 (SIGLEC6) were identified as candidates for off-target genes of ASO-1316 and ASO-3223 by in silico analysis. HLE cells were transfected with ASO-1316 and ASO-3223 at 25 nM each, and mRNA amounts of NLN and FBXL19 were measured by real-time PCR; the results are shown in (d) of
[0172] HLE/GFP cells that stably express GFP or HLE/ARL4C-GFP cells that stably express ARL4C-GFP were transfected with control ASO, ASO-1316 and ASO-3223 at 25 nM, and a cell migration assay was carried out; the results of the assay are shown in (c) of
[0173] HLE cells were transfected with control ASO, ASO-1316 and ASO-3223 at 25 nM and a proliferation assay was performed; the results of the assay are shown in (e) of
[0174] In addition, HCT116 cells were transfected with control ASO, ASO-1316 and ASO-3223 at 25 nM, and a cell migration assay was carried out; the results are shown in (e) of
[0175] The above-described results clarify that ASO-1316 and ASO-3223 are able to suppress the proliferation and migration of cancer cells expressing ARL4C.
[0176] 2-3. Influences of ARL4C on PIK3CD in Liver Cancer Cells
[0177] It is known that Wnt/β-catenin signaling and EGF/Ras signaling stimulate the expression of ARL4C, which induces the nuclear localization of YAP/TAZ (EMBO J 2014; 33: 702-18, Oncogene 2015; 34: 4834-44).
[0178] HLE cells were treated with 10 μM PD184161 or 10 nM CTNNB1 siRNA (siRNA against CTNNB1), and the ARL4C mRNA amount was measured by real-time PCR; the results are shown in (a) of
[0179] In addition, using the TCGA data set (n=371) using R2: Genomics Analysis and Visualization Platform, the ARL4C mRNA amount (X-axis), as well as the EGR1 mRNA amount, the FOS mRNA amount, the AXIN2 mRNA amount, the LGRS mRNA amount (Y-axis) in liver cancer were plotted, and the result is shown in (b) of
[0180] HLE cells or A549 cells were transfected with control ASO, ASO-1316, and ASO-3223 at 25 nM, and were stained with an anti-YAP/TAZ antibody; the results are shown in (c) of
[0181] The phosphatidylinositol-3-kinase catalytic subunit 6 isoform (PIK3CD gene product) is known to be expressed in many cancers, including liver cancer (Blood 2010; 116: 1460-8., Hepatology). 2012; 55: 1852-62., Mol Cancer Ther 2008; 7: 841-50., Cancer Res 2003; 63: 1667-75.). Therefore, using the TCGA dataset (n=371) using R2: Genomics Analysis and Visualization Platform, the correlation of the ARL4C mRNA amount with the PIK3CD mRNA amount, the PIK3CA mRNA amount, and the PIK3CB mRNA amount, in liver cancer was analyzed. The ARL4C mRNA amount (X-axis) and the PIK3CD mRNA amount (Y-axis) in liver cancer were plotted using the TCGA data set (n=371), and the result is shown in
[0182] HLE cells were treated with 25 μM SecinH3 (inhibitor of Arf nucleotide-binding site opener (ARNO)) or 50 μM NSC23766 (Rac inhibitor), and the amount of PIK3CD mRNA was measured by real-time PCR; the results are shown in (c) of
[0183] In addition, using the TCGA dataset (n=371) using R2: Genomics Analysis and Visualization Platform, the ARL4C mRNA amount (X-axis), and the RAC1 mRNA amount, the ARF6 mRNA amount, as well as the ARF1 mRNA amount (Y-axis) in liver cancer were plotted, and the result is shown in (b) of
[0184] HLE cells were transfected with control siRNA and PIK3CD siRNA (siRNA against PIK3CD) at 20 nM, and a proliferation assay was performed; the results are shown in (e) of
[0185] HLE cells were transfected with control ASO, ASO-1316, and ASO-3223 at 25 nM, and the PIK3CD mRNA amount was measured by real-time PCR; the results are shown in (g) of
[0186] 2-4. Examination of Antitumor Effect of ARL4C ASO in Primary Liver Tumor Model
[0187] In a primary liver tumor model in which HLE cells were directly transplanted into the liver, influences of the subcutaneous administration of ARL4C ASO (ASO-1316 and ASO-3223) on liver tumors was examined.
[0188] In experiments in the primary liver tumor model, Matrigel containing HEL cells at a high concentration was injected into the liver of a mouse (day 0), and control ASO, ASO-1316, and ASO-3223 were subcutaneously administered on and after day 0, at a frequency of twice a week. The tumor formed in the liver was observed when 29 days had elapsed since the transplantation; the result is shown in (a) of
[0189] In addition, 6-FAM-labeled ASO-1316 or buffer (Saline) was subcutaneously administered to normal mice to which HLE cells had not been transplanted, and fluorescence intensities in various organs were measured four hours after that; the results are shown in (a) of
[0190] 6-FAM-labeled ASO-1316 or buffer (Saline) was subcutaneously administered to a mouse primary liver tumor model transplanted with HLE cells, and fluorescence intensities in various organs were measured four hours after that; the results are shown in (d) of
[0191] In addition, since ASO-1312 has a base sequence that overlaps with that of ASO-1316, it can be highly expected that an antitumor effect will be exerted in the primary liver tumor model, as is the case with ASO-1316.
[0192] 2-5. Examination of Antitumor Effect of ARL4C ASO in Metastatic Tumor Model
[0193] In a metastatic tumor model in which HCT116 cells were transplanted into the spleen and the tumor was caused to metastasize to the liver, influences of the subcutaneous administration of ARL4C ASO (ASO-1316 and ASO-3223) on the liver tumor was examined
[0194] In an experiment in the metastatic tumor model, HCT116/Luc cells were injected into the spleens (day 0), luciferase signals were detected in the livers 19 days after the injection; on and after this day, control ASO, ASO-1316, and ASO-3223 were subcutaneously administered at a frequency of twice a week. When 19, 35 and 47 days had elapsed, the fluorescence of luciferase emitted from the liver tumors was observed, and when 47 days had elapsed, fluorescence intensities of luciferase emitted from the liver tumors were quantified with software of IVIS/Kodak; the results are shown in (a) of
[0195] On the other hand, ASO-3223 did not exert an antitumor effect in the metastatic tumor model, as is the case with the result of the primary liver tumor model.
[0196] In addition, since ASO-1312 has a base sequence that overlaps with that of ASO-1316, it can be highly expected that an antitumor effect will be exerted in the metastatic tumor model, as is the case with ASO-1316.
[0197] 2-6. Examination of Antitumor Effect of ARL4C ASO in Lung Cancer Tumor Model
[0198] Influences of ARL4C ASO (ASO-1316) on tumors was examined in a xenograft orthotopic transplantation model in which A549/Luc cells were transplanted into the lung.
[0199] In an experiment in a xenograft orthotopic transplantation model using lung cancer cells, A549/Luc cells were transplanted into the left lung (day 0), and transbronchial administration of control ASO and ARL4C ASO-1316 was carried out when 7, 11 and 15 days had elapsed after the transplantation. Bioluminescent images of the left lung observed 7 and 21 days after the transplantation of A549/Luc cells are shown in the left part of (a) of
[0200] 2-7. Examination of Metastasis Inhibitory Effect and Antitumor Effect of ARL4C ASO in Pancreatic Cancer Tumor Model
[0201] Influences of ARL4C ASO (ASO-1316) on tumorigenesis and mesenteric lymph node (mLN) metastasis were examined in a xenograft orthotopic transplantation model in which S2-CP8/Luc cells were transplanted into the lung.
[0202] In an experiment in a xenograft orthotopic transplantation model using pancreatic cancer cells, S2-CP8/Luc cells were transplanted into the pancreas (day 0), and control ASO and ASO-1316 were intraperitoneally administered on and after 3 days after the transplantation, twice a week. Bioluminescent images of intraperitoneal tumors observed when 7, 14, and 21 days had elapsed after the transplantation of S2-CP8/Luc cells are shown in the left part of (b) of