COMPOUNDS WITH ANTIMICROBIAL ACTIVITY
20210317076 · 2021-10-14
Inventors
Cpc classification
A61P31/00
HUMAN NECESSITIES
C07C307/06
CHEMISTRY; METALLURGY
C07D207/34
CHEMISTRY; METALLURGY
C07D307/88
CHEMISTRY; METALLURGY
C07C205/59
CHEMISTRY; METALLURGY
C07D231/20
CHEMISTRY; METALLURGY
C07C255/61
CHEMISTRY; METALLURGY
C07C255/58
CHEMISTRY; METALLURGY
C07C205/26
CHEMISTRY; METALLURGY
C07C229/42
CHEMISTRY; METALLURGY
C07C311/44
CHEMISTRY; METALLURGY
C07C251/24
CHEMISTRY; METALLURGY
C07D307/90
CHEMISTRY; METALLURGY
C07C215/50
CHEMISTRY; METALLURGY
C07C255/53
CHEMISTRY; METALLURGY
C07D403/12
CHEMISTRY; METALLURGY
C07C311/39
CHEMISTRY; METALLURGY
C07C251/86
CHEMISTRY; METALLURGY
C07C255/59
CHEMISTRY; METALLURGY
C07C255/42
CHEMISTRY; METALLURGY
C07C217/58
CHEMISTRY; METALLURGY
C07C205/35
CHEMISTRY; METALLURGY
International classification
C07C251/86
CHEMISTRY; METALLURGY
C07C215/50
CHEMISTRY; METALLURGY
C07C217/58
CHEMISTRY; METALLURGY
C07C251/24
CHEMISTRY; METALLURGY
C07C255/53
CHEMISTRY; METALLURGY
C07C255/58
CHEMISTRY; METALLURGY
C07C255/59
CHEMISTRY; METALLURGY
C07C255/61
CHEMISTRY; METALLURGY
C07C311/39
CHEMISTRY; METALLURGY
C07C311/44
CHEMISTRY; METALLURGY
C07D231/20
CHEMISTRY; METALLURGY
C07D307/90
CHEMISTRY; METALLURGY
Abstract
This invention relates to compounds of formula 1, 2 or 3
##STR00001##
a pharmaceutically acceptable salt, or solvate thereof, wherein X.sub.1, Y, R.sub.1, R.sub.2, R.sub.3, R.sub.4, and R.sub.5 are as defined herein. The compounds are antimicrobial agents that may be used to treat various bacterial and protozoal infections and disorders related to such infections. The invention also relates to pharmaceutical compositions containing the compounds and to methods of treating bacterial and protozoal infections by administering the compounds of formula 1, 2 or 3.
Claims
1. A compound of formula 1, ##STR00170## a pharmaceutically acceptable salt, or a solvate thereof, wherein: (1) X.sub.1 is selected from the group consisting of —N═CH—, —CH═N—, —CH═CH—, —NH—CH.sub.2—, —CH.sub.2—NH—, —CH.sub.2—CH.sub.2—, —CH.sub.2—O—, —O—CH.sub.2—, —CH.sub.2—S—, —S—CH.sub.2— —S(═O)—CH.sub.2—, S(═O)—NH—, —CH.sub.2—S(═O)—, —NH—S(═O)—, —S(═O).sub.2—CH.sub.2—, —S(═O).sub.2—NH—, —CH.sub.2—S(═O).sub.2—, —NH—S(═O).sub.2—, —C(═O)—NH—, —NH—C(═O)—, and —C(═O)—; and (2) Each of R.sub.1-R.sub.5 is independently selected from the group consisting of hydrogen, hydroxy, nitro, acetyl, methyl, ethynyl, carboxy, carboxymethyl hydroxymethyl, methoxy, methoxycarbonyl, amninosulfonyl, aminocarbonyl, cyano, tetrazolyl, dimethylaminosulfonylaminocarbonyl, cyanomethyl, acetylaminosulfonyl, methoxyaminocarbonyi, methylsulfonylaminocarbonyl, t-butyl, fluoro, chloro, bromo, phenyl, trifluoromethyl and benzo; or wherein said compound is selected from the group consisting of: ##STR00171## ##STR00172##
2. The compound of claim 1, wherein said compound is selected from the group consisting of: ##STR00173## ##STR00174## ##STR00175## ##STR00176## ##STR00177## ##STR00178## ##STR00179## ##STR00180## ##STR00181## ##STR00182## ##STR00183## ##STR00184## ##STR00185## ##STR00186## ##STR00187## ##STR00188## ##STR00189## ##STR00190## ##STR00191## ##STR00192## ##STR00193## ##STR00194## ##STR00195## ##STR00196##
3. A pharmaceutical composition for treatment or prevention of bacterial or protozoal infections, comprising the compound of claim 1.
4. The pharmaceutical composition of claim 3, wherein said pharmaceutical composition is in the form of tablets, capsules, lozenges, troches, hard candies, powders, sprays, creams, salves, suppositories, jellies, gels, pastes, lotions, ointments, aqueous suspensions, injectable solutions, elixirs, or syrups.
5. The pharmaceutical composition of claim 3, wherein said pharmaceutical composition comprises 5% to 70% by weight of said compound.
6. The pharmaceutical composition of claim 3, wherein said bacterial or protozoal infections are caused by microorganism selected from the group consisting of Enterococcus faecalis, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, Enterobacter cloacae, Escherichia coli, and Streptococcus pneumoniae.
7. A method to inhibit NusB-NusE interaction in a microorganism, comprising the step of contacting the compound of claim 1 with said microorganism.
8. The method of claim 7, wherein said NusB is selected from NusB E81, NusB Y18 and NusB E75, and NusE is selected from NusE H15, NusE D19 and NusE R16.
9. The method of claim 7, wherein said microorganism is selected from the group consisting of Enterococcus faecalis, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, Enterobacter cloacae, Escherichia coli, and Streptococcus pneuroniae.
10. A method of treating or preventing bacterial or protozoal infections in a subject, comprising a step of administering a therapeutically effective amount of the compound of claim 1 to said subject.
11. The method of claim 10, wherein said compound is administered through an oral, parenteral, topical, or rectal route.
12. The method of claim 10, wherein said microorganism is selected from the group consisting of Enterococcus faecalis, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, Enterobacter cloacae, Escherichia coli, and Streptococcus pneumoniae.
13. The method of claim 10, wherein said NusB is selected from NusB E81, NusB Y18 and NusB E75, and NusE is selected from NusE H15 NusE D19 and NusE R16.
14. A compound of formula 2, ##STR00197## a pharmaceutically acceptable salt, or a solvate thereof, wherein: (1) X.sub.1 is selected from the group consisting of —N═CH—, —CH═N—, —CH═CH—, —NH—CH.sub.2—, —CH.sub.2—NH—, —CH.sub.2—CH.sub.2—, —CH.sub.2—O—, —O—CH.sub.2—, —CH.sub.2—S—, —S—CH.sub.2—, —S(═O)—CH.sub.2—, —S(═O)—NH—, —CH.sub.2—S(═O)—, —NH—S(═O)—, —S(═O).sub.2—CH.sub.2—, —S(═O).sub.2—NH—, —CH.sub.2—S(═O).sub.2—, —NH—S(═O).sub.2—, —C(═O)—NH—, —NH—C(═O)—, and —C(═O)—; and (2) Each of R.sub.1-R.sub.5 is independently selected from the group consisting of hydrogen, hydroxy, nitro, acetyl, methyl, ethynyl, carboxy, carboxymethyl hydroxymethyl, methoxy, methoxycarbonyl, aminosulfonyl, aminocarbonyl, cyano, tetrazolyl, dimethylaminosulfonylaminocarbonyl, cyanomethyl, acetylaminosulfonyl, methoxyaminocarbonyl, methylsulfonylaminocarbonyl, t-butyl, fluoro, chloro, bromo, phenyl, trifluoromethyl and benzo.
15. The compound of claim 14 wherein said compound is selected from the group consisting of: ##STR00198##
16. A compound of formula ##STR00199## a pharmaceutically acceptable salt, or a solvate thereof, wherein: (1) each of X.sub.1 and Y is independently selected from the group consisting of —NH—, —CH.sub.2—, —O—, and —S—; and (2) each of R.sub.1-R.sub.5 is independently selected from the group consisting of hydrogen, hydroxy, nitro, acetyl, methyl, ethynyl, carboxy, carboxymethyl hydroxymethyl, methoxy, methoxycarbonyl, aminosulfonyl, aminocarbonyl, cyano, tetrazolyl, dimethylaminosulfonylaminocarbonyl, cyanomethyl, acetylaminosulfonyl, methoxyaminocarbonyl, methylsulfonylaminocarbonyl, t-butyl, fluoro, chloro, bromo, phenyl, trifluoromethyl and benzo.
17. The compound of claim 16, wherein said compound is ##STR00200##
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
DETAILED DESCRIPTION OF THE INVENTION
[0041] The following description of certain embodiment(s) is merely exemplary in nature and is in no way intended to limit the scope of the invention, its applications, or uses.
[0042] The present invention relates to compounds of formula 1, 2 or 3 having anti-bacterial activity. In one embodiment, those compounds of the formula 1, 2 or 3 that are acidic in nature are capable of forming base salts with various pharmacologically acceptable cations. Examples of such salts include the alkali metal or alkaline earth metal salts and particularly, the sodium and potassium salts.
[0043] In one embodiment, certain compounds of formula 1, 2 or 3 may have asymmetric centers and therefore exist in different enantiomeric forms. This invention relates to the use of all optical isomers and stereoisomers of the compounds of formula 1, 2 or 3 and mixtures thereof. In particular, the invention includes both the E and Z isomers of the compound.
[0044] In one embodiment, the invention includes tautomers of the compounds of formula 1, 2 or 3.
[0045] In one embodiment, the present invention also includes isotopically-labelled compounds, and the pharmaceutically acceptable salts thereof, which are identical to those recited in formula 1, 2 or 3, but for the fact that one or more atoms are replaced by an atom having anatomic mass or mass number different from the atomic mass or mass number usually found in nature. Examples of isotopes that can be incorporated into compounds of the invention include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorous, fluorine and chlorine, such as 2H, 3H, 13C, 14C, 15N, 180, 170, 35S, 18F, and 36C, respectively. Compounds of the present invention, prodrugs thereof, and pharmaceutically acceptable salts of said compounds or of said prodrugs which contain the aforementioned isotopes and/or other isotopes of other atoms are within the scope of this invention. Certain isotopically-labelled compounds of the present invention, for example those into which radioactive isotopes such as 3H and 14C are incorporated, are useful in drug and/or substrate tissue distribution assays. Tritiated, i.e, 3H, and carbon-14, i.e., 14C, isotopes are particularly preferred for their ease of preparation and detectability. Further, substitution with heavier isotopes such as deuterium, i.e., 21-1, can afford certain therapeutic advantages resulting from greater metabolic stability, for example increased in vivo half-life or reduced dosage requirements and, hence may be preferred in some circumstances. Isotopically labelled compounds of formula 1, 2 or 3 of this invention and prodrugs thereof can generally be prepared by carrying out the procedures disclosed in the Schemes and/or in the Examples and Preparations below, by substituting a readily available isotopically labelled reagent for a non-isotopically labelled reagent.
[0046] In one embodiment, this invention also encompasses pharmaceutical compositions containing, and methods of treating bacterial infections through administering, prodrugs of compounds of the formula 1, 2 or 3. Compounds of formula 1, 2 or 3 having free amino, amido, hydroxy or carboxylic groups can be converted into prodrugs. Prodrugs include compounds wherein an amino acid residue, or a polypeptide chain of two or more (e.g., two, three or four) amino acid residues is covalently joined through an amide or ester bond to a free amino, hydroxy or carboxylic acid group of compounds of formula 1, 2 or 3. The amino acid residues include but are not limited to the 20 naturally occurring amino acids commonly designated by three letter symbols and also includes 4-hydroxyproline, hydroxylysine, demosine, isodemosine, 3-methylhistidine, norvalin, beta-alanine, gamma-aminobutyric acid, citrulline homocysteine, homoserine, omithine and methionine sulfone. Additional types of prodrugs are also encompassed. For instance, free carboxyl groups can be derivatized as amides or alkyl esters. Free hydroxy groups may be derivatized using groups including but not limited to hemisuccinates, phosphate esters, dimethylaminoacetates, and phosphoryloxymethyloxycarbonyls, as outlined in Advanced Drug Delivery Reviews, 1996, 19, 115. Carbamate prodrugs of hydroxy and amino groups are also included, as are carbonate prodrugs, sulfonate esters and sulfate esters of hydroxy groups. Derivatization of hydroxy groups as (acyloxy)methyl and (acyloxy)ethyl ethers wherein the acyl group may be an alkyl ester, optionally substituted with groups including but not limited to ether, amine and carboxylic acid functionalities, or where the acyl group is an amino acid ester as described above, are also encompassed. Prodrugs of this type are described in J. Med. Chem. 1996, 39, 10. Free amines can also be derivatized as amides, sulfonamides or phosphonamides. All of these prodrug moieties may incorporate groups including but not limited to ether, amine and carboxylic acid functionalities.
[0047] In one embodiment, the compounds of the present invention may have asymmetric carbon atoms. Diastereomeric mixtures can be separated into their individual diastereomers on the basis of their physical chemical differences by methods known to those skilled in the art, for example, by chromatography or fractional crystallization. Enantiomers can be separated by converting the enantiomeric mixtures into a diastereomeric mixture by reaction with an appropriate optically active compound (e.g., alcohol), separating the diastereomers and converting (e.g., hydrolyzing) the individual diastereomers to the corresponding pure enantiomers. All such isomers, including diastereomeric mixtures and pure enantiomers, are considered as part of the invention.
[0048] Any compounds of formula 1, 2 or 3 that are basic in nature are capable of forming a wide variety of salts with various inorganic and organic acids.
[0049] Any compounds of the formula 1, 2 or 3 that are acidic in nature are capable of forming base salts with various pharmacologically acceptable cations. Examples of such salts include the alkali metal or alkaline-earth metal salts and particularly, the sodium and potassium salts. These salts may be prepared by conventional techniques. The chemical bases which are used as reagents to prepare the pharmaceutically acceptable base salts of this invention are those which form non-toxic base salts with any acidic compounds of formula 1, 2 or 3. Such non-toxic base salts include those derived from such pharmacologically acceptable cations as sodium, potassium calcium and magnesium, etc. These salts can be prepared by treating the corresponding acidic compounds with an aqueous solution containing the desired pharmacologically acceptable cations, and then evaporating the resulting solution to dryness, preferably under reduced pressure. Alternatively, they may also be prepared by mixing lower alkanolic solutions of the acidic compounds and the desired alkali metal alkoxide together, and then evaporating the resulting solution to dryness in the same manner as before. In either case, stoichiometric quantities of reagents are preferably employed in order to ensure completeness of reaction and maximum yields of the desired final product.
[0050] In one embodiment, the compounds of formula 1, 2 or 3, and the pharmaceutically acceptable salts and solvates thereof (hereinafter “the active compounds”), may be administered through oral, parenteral, topical, or rectal routes in the treatment or prevention of bacterial or protozoal infections. Variations may nevertheless occur depending upon the species of mammal, fish or bird being treated and its individual response to said medicament, as well as on the type of pharmaceutical formulation chosen and the time period and interval at which such administration is carried out.
[0051] In one embodiment, the active compounds may be administered alone or in combination with pharmaceutically acceptable carriers or diluents by the routes previously indicated, and such administration may be carried out in single or multiple doses. More particularly, the active compounds may be administered in a wide variety of different dosage forms, i.e., they may be combined with various pharmaceutically acceptable inert carriers in the form of tablets, capsules, lozenges, troches, hard candies, powders, sprays, creams, salves, suppositories, jellies, gels, pastes, lotions, ointments, aqueous suspensions, injectable solutions, elixirs, syrups, and the like. Such carriers include solid diluents or fillers, sterile aqueous media and various non-toxic organic solvents, etc. Moreover, oral pharmaceutical compositions can be suitably sweetened and/or flavored. In general, the active compounds are present in such dosage forms at concentration levels ranging from about 5.0% to about 70% by weight.
[0052] In one embodiment, for oral administration, tablets containing various excipients such as microcrystalline cellulose, sodium citrate, calcium carbonate, dicalcium phosphate and glycine may be employed along with various disintegrants such as starch (and preferably corn, potato, or tapioca starch), alginic acid and certain complex silicates, together with granulation binders like polyvinylpyrrolidone, sucrose, gelatin and acacia. Additionally, lubricating agents such as magnesium stearate, sodium lauryl sulfate and talc are often very useful for tabletting purposes Solid compositions of a similar type may also be employed as fillers in gelatin capsules; preferred materials in this connection also include lactose or milk sugar as well as high molecular weight polyethylene glycols. When aqueous suspensions and/or elixirs are desired for oral administration, the active compound may be combined with various sweetening or flavoring agents, coloring matter or dyes, and, if so desired, emulsifying and/or suspending agents as well, together with such diluents as water, ethanol, propylene glycol, glycerin and various like combinations thereof.
[0053] In one embodiment, for parenteral administration, solutions of an active compound in either sesame or peanut oil or in aqueous propylene glycol may be employed. The aqueous solutions should be suitably buffered (preferably pH greater than 8) if necessary and the liquid diluent first rendered isotonic. These aqueous solutions are suitable for intravenous injection purposes. The oily solutions are suitable for intraarticular, intramuscular and subcutaneous injection purposes. The preparation of all these solutions under sterile conditions is readily accomplished by standard pharmaceutical techniques will known to those skilled in the art.
[0054] In another embodiment, it is also possible to administer the active compounds of the present invention topically and this may be done by way of creams, jellies, gels, pastes, patches, ointments and the like, in accordance with standard pharmaceutical practice.
[0055] In one embodiment, for administration to animals other than humans, such as cattle or domestic animals, the active compounds may be administered in the feed of the animals or orally as a drench composition.
[0056] In one embodiment, the active compounds may also be administered in the form of liposome delivery systems, such as small unilamellar vesicles, large unilamellar vesicles and multilamellar vesicles. Liposomes can be formed from a variety of phospholipids, such as cholesterol, stearylamine or phosphatidylcholines.
[0057] In one embodiment, the active compounds may also be coupled with soluble polymers as targetable drug carriers. Such polymers can include polyvinylpyrrolidone, pyran copolymer, polyhydroxypropylmethacrylamide phenyl, polyhydroxyethylaspartamide-phenol, or polyethyleneoxide-polylysine substituted with palmitoyl residues. Furthermore, the active compounds may be coupled to a class of biodegradable polymers useful in achieving controlled release of a drug, for example, polylactic acid, polyglycolic acid, copolymers of polylactic and polyglycolic acid, polyepsilon caprolactone, polyhydroxy butyric acid, polyorthoesters, polyacetals, polydihydropyrans, polycyanoacrylates and cross-linked or amphipathic block copolymers of hydrogels.
[0058] In one embodiment, the present invention provides a compound of formula 1,
##STR00005## [0059] a pharmaceutically acceptable salt, or a solvate thereof wherein: [0060] (1) X.sub.1 is selected from the group consisting of —N═CH—, CH═N—, CH═CH—, —NH—CH.sub.2—, —CH.sub.2—NH—, —CH.sub.2—CH.sub.2—, —CH.sub.2—O—, —O—CH.sub.2—, —CH.sub.2—S—, —S—CH.sub.2—, —S(═O)—CH.sub.2—, —S(═O)—NH—, —CH—S(═O)—, —NH—S(═O)—, S(═O).sub.2—CH.sub.2—, —S(═O).sub.2—NH—, —CH.sub.2—S(═O)—, —NH—S(═O).sub.2—, —C(═O)—NH—, —NH—C(═O)—, and —C(═O)—; and [0061] (2) Each of R.sub.1-R.sub.5 is independently selected from the group consisting of hydrogen, hydroxy, nitro, acetyl, methyl, ethynyl, carboxy, carboxymethyl hydroxymethyl, methoxy, methoxycarbonyl, aminosulfonyl, aminocarbonyl, cyano, tetrazolyl, dimethylaminosulfonylaminocarbonyl, cyanomethyl, acetylaminosulfonyl, methoxyaminocarbonyl, methylsulfonylaminocarbonyl, t-butyl, fluoro, chloro, bromo, phenyl, trifluoromethyl and benzo.
[0062] In one embodiment, the present invention provides a compound including but not limited to:
##STR00006## ##STR00007##
[0063] In one embodiment, the present invention provides a compound including but not limited to:
##STR00008## ##STR00009## ##STR00010## ##STR00011## ##STR00012## ##STR00013## ##STR00014## ##STR00015## ##STR00016## ##STR00017## ##STR00018## ##STR00019## ##STR00020## ##STR00021## ##STR00022## ##STR00023## ##STR00024## ##STR00025## ##STR00026## ##STR00027## ##STR00028## ##STR00029## ##STR00030## ##STR00031##
[0064] In one embodiment the present invention provides a pharmaceutical composition for treatment or prevention of bacterial or protozoal infections, comprising the compound.
[0065] In one embodiment, the composition is in the form of tablets, capsules, lozenges, troches, hard candies, powders, sprays, creams, salves, suppositories, jellies, gels, pastes, lotions, ointments, aqueous suspensions, injectable solutions, elixirs, or syrups.
[0066] In one embodiment, the pharmaceutical composition comprises 5% to 70% by weight of the compound.
[0067] In one embodiment, the bacterial or protozoal infections are caused by microorganism selected from the group consisting of Enterococcus faecalis, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, Enterobacter cloacae, Escherichia coli, and Streptococcus pneumoniae.
[0068] In one embodiment, the present invention provides a method to inhibit NusB-NusE interaction in a microorganism, comprising the step of contacting the compound with said microorganism.
[0069] In one embodiment, the NusB is selected from NusB E81, NusB Y18 and NusB E75, and NusE is selected from NusE H15, NusE D19, and NusE R16.
[0070] In one embodiment, the microorganism is selected from the group consisting of Enterococcus faecalis, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, Enterobacter cloacae, Escherichia coli, and Streptococcus pneumoniae.
[0071] In one embodiment, the present invention provides a method of treating or preventing bacterial or protozoal infections in a subject, comprising a step of administering a therapeutically effective amount of the compound to said subject.
[0072] In one embodiment, the compound is administered through an oral, parenteral, topical, or rectal route.
[0073] In one embodiment, the microorganism is selected from the group consisting of Enterococcus faecalis, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, Enterobacter cloacae, Escherichia coli, and Streptococcus pneumoniae.
[0074] In one embodiment, the NusB is selected from NusB E81, NusB Y18 and NusB E75, and NusE is selected from NusE 1-15, NusE D19 and NusE R16.
[0075] In one embodiment, the present invention provides a compound of formula 2,
##STR00032## [0076] a pharmaceutically acceptable salt, or a solvate thereof, wherein [0077] (1) X.sub.1 is selected from the group consisting of —N═CH—, —CH═N—, —CH═CH—, —NH—CH.sub.2—, —CH.sub.2—NH—, —CH.sub.2—CH.sub.2—, —CH.sub.2—O—, —H—, —CH.sub.2—S—, —S—CH.sub.2—, —S(═O)—CH.sub.2—, —S(═O)—NH—, —CH.sub.2—S(═O)—, —NH—S(═O)—, —S(═O).sub.2—CH.sub.2—, —S(═O).sub.2—NH—, —CH.sub.2—S(═O).sub.2—, —NH—S(═O).sub.2—, —C(═O)—NH—, —NH—C(═O)—, and —C(═O)—; and [0078] (2) Each of R.sub.1-R.sub.3 is independently selected from the group consisting of hydrogen, hydroxy, nitro, acetyl, methyl, ethynyl, carboxy, carboxymethyl hydroxymethyl, methoxy, methoxycarbonyl, aminosulfonyl, aminocarbonyl, cyano, tetrazolyl, dimethylaiminosulfonylaminocarbonyl, cyanomethyl, acetylaminosulfonyl, methoxyaminocarbonyl, methylsulfonylaminocarbonyl, t-butyl, fluoro, chloro, bromo, phenyl, trifluoromethyl and benzo.
[0079] In one embodiment, the compound is selected from the group consisting of:
##STR00033##
[0080] In one embodiment, the present invention provides a compound of formula 3,
##STR00034##
a pharmaceutically acceptable salt, or a solvate thereof, wherein: [0081] (1) each of X.sub.1 and Y is independently selected from the group consisting of —NH—, —CH.sub.2—O—, and —S—; and [0082] (2) each of R.sub.1-R.sub.5 is independently selected from the group consisting of hydrogen, hydroxy, nitro, acetyl, methyl, ethynyl, carboxy, carboxymethyl hydroxymethyl, methoxy, methoxycarbonyl, aminosulfonyl, aminocarbonyl, cyano, tetrazolyl, dimethylaminosulfonylaminocarbonyl, cyanomethyl, acetylaminosulfonyl, methoxyaminocarbonyl, methylsulfonylaminocarbonyl, t-butyl, fluoro, chloro, bromo, phenyl, trifluoromethyl and benzo.
[0083] In one embodiment, the compound is
##STR00035##
EXAMPLE 1
[0084] Previously, by rational design and pharmacophore-based virtual screening, small chemical molecule inhibitors with antimicrobial activities were identified, targeting the interaction between bacterial RNA polymerase and the essential housekeeping transcription initiation factor σ..sup.12 Using a similar approach, an inhibitor against bacterial rRNA synthesis that has antimicrobial activities against S. aureus strains, including MRSA, was identified.
[0085] A bacterial rRNA transcription complex was modeled on the basis of the crystal structure of the RNA polymerase elongation complex.sup.13 with a suite of Nus transcription factors NusA, NusB, NusE, and NusG (
[0086] Examination of the published crystal structures of the Escherichia coli NusB-NusE heterodimer [Protein Data Bank (PDB) entry 3D3B] (
[0087] The structural information about the NusB-NusE heterodimer co-crystal (PDB entry 3D3B).sup.22 was used to develop a pharmacophore model (
[0088] On the basis of the pharmacophore model, an in silico screen was performed using a virtual compound library constructed by combining the mini-Maybridge library and the Enamine antibacterial library..sup.25 The top 50 hits from the initial virtual screen were re-mapped against the pharmacophore model and the energy-minimized conformations of compounds visually inspected. The compounds that poorly fit into the pharmacophore were removed. As a result, seven compounds (
[0089] The antimicrobial activity of the seven compounds against community-acquired MRSA strain USA300 were first screened. Of the analogues evaluated, MC4 (
[0090] The level of macromolecules in S. aureus ATCC 25923 cells during exponential growth due to MC4 treatment were analyzed. MC4, rifampicin, and oxacillin were added at a one-quarter MIC level, which did not interfere with the rate of growth of S. aureus ATCC 25923 cells. As shown in
[0091] Finally, to establish MC4's mode of action at the molecular level, an enzyme-linked immunosorbant assay-based inhibitory assay was performed to assess the in vitro inhibition of NusB-NusE heterodimer formation by MC4..sup.24 Purified NusB was used to coat the 96-well plate, and GST-tagged NusE was used as the probe. MC4 showed positive inhibition of the NusB-NusE interaction with an IC50 of ˜34.7±0.13 μM. By further testing a series of MC4 analogues (
[0092] The interaction between MC4 and NusB was also biophysically quantified. A previous report demonstrated that NusB bound to NusE in a 1:1 ratio with a Kd of ˜1 μM as determined by isothermal titration calorimetry (ITC)..sup.21 In similar experiments, it was found that MC4 bound specifically to NusB (
[0093] The potential impact of untreatable antibiotic-resistant infections on society is profound, and there is an urgent need to identify new drug targets..sup.28 Traditionally, the bacterial ribosome itself (both 30S and 50S subunits) has been one of the most commonly exploited targets for antibiotics inhibiting protein synthesis..sup.29 Recent drug discovery research had validated the finding that inhibition of rescuing stalled ribosomes at the end of mRNAs resulted in antibacterial activity..sup.30 Given the ribosome is positively related to fast growth/proliferation and the large difference between eukaryotic and prokaryotic rRNA transcription machinery, it is tempting to hypothesize inhibition of rRNA synthesis would be expected to have a major impact on cell growth and/or viability. This hypothesis is strengthened by recent findings showing that many anticancer drugs inhibit rRNA synthesis or maturation..sup.31
[0094] In this work, pharmacophore-based in silico screening followed by biological confirmation was used for identifying a potential new antibiotic lead. An essential interaction between transcription factors NusB and NusE that is required for the formation of highly processive complexes used for the synthesis of rRNA within bacterial cells was targeted. One of the short-listed compounds (MC4) showed specific activity against S. aureus strains, including MRSA, without significant toxicity to mammalian cell lines. This compound is like the first designed to target bacterial rRNA synthesis that has antimicrobial activities. The detailed effect of MC4 in rRNA transcription/processing, ribosome biogenesis, and S. aureus virulence is currently under investigation. Although MC4 has been shown to specifically inhibit NusB-NusE interaction at the molecular level, any potential off-target effect on bacterial cells remains to be elucidated. Because NusB and NusE are highly conserved in bacteria, the reason that MC4 has preferred antimicrobial activity against S. aureus over other pathogens needs to be further investigated.
[0095] An essential protein-protein interaction between transcription factors in the bacterial rRNA synthesis machinery as a novel antimicrobial target was validated. Other important protein-protein interactions involved in bacterial rRNA transcription, e.g., between NusE and NusG, the NusE-RNA polymerase complex might also have the potential as novel antimicrobial targets..sup.32 This work paves the way for the structural optimization of MC4, and potentially other compounds from more comprehensive screens, for development as prospective new antimicrobial lead molecules targeting bacterial rRNA synthesis.
Materials and Methods
[0096] Bacterial Strains and Chemicals. The following bacterial strains were used in this study for the microdilution assay: Enterococcus faecalis ATCC 29212, Klebsiella pneumonia ATCC 700603, Acinetobacter baumannii ATCC 19606, Pseudomonas aeruginosa PA01, Enterobacter cloacae ATCC 13047, E. coli ATCC 25922, Proteus vulgaris ATCC 6380, and S. aureus USA300, ATCC 25923, ATCC 29213, ST22, ST30, ST45, ST59, ST239, JE-2, BAA44. E. coli strain DH5a (Gibco BRL) was used in this study for cloning and BL21 (DE3) pLysS.sup.23 was used for protein overproduction. 5-fluorouracil, rifampicin and other antibiotics used in the microdilution assay were purchased from SigmaAldrich. Compounds MC1-7 were purchased from MolPort.
[0097] Molecular modeling. The antitermination complex model was constructed by consolidating a number of published crystal structures, including the Thermus thermophilus transcription elongation complex (PDB: 2O5I),.sup.34 E. coli RNA polymerase-NusG complex (PDB: 5 tbz),.sup.35 Aquifex aeolicus NusB-E in complex with boxA RNA (PDB: 3R2C), Mycobacterium tuberculosis NusA C-terminal domain-RNA complex (PDB: 2ASB);.sup.37 as well as the NMR solution structure of E. coli NusE:NusG-CTD complex (PDB: 2KVQ),.sup.38 and B. subtilis NusA N-terminal domain (PDB: 2MT4)..sup.39 Structure matching was performed using the MatchMaker function of UCSF Chimera..sup.40 Images were generated with UCSF Chimera.
[0098] Pharmacophore design and virtual screening were performed as described previously..sup.41
[0099] Antibacterial activity test. Microdilution assay was performed according to the Clinical & Laboratory Standards Institute recommendations..sup.42 Serial 2-fold dilutions of the tested compounds and antibiotic controls were made from 256 μg/ml to 0.5 μg/ml. DMSO was included as a negative control.
[0100] Cytotoxicity assay was performed as detailed previously.sup.43 except A549 lung carcinoma and HaCaT immortalized human keratinocytes were used in this study.
[0101] DNA, protein and rRNA quantitation. MC4, oxacillin and rifampicin at ¼ MIC level were added to S. aureus strain ATCC 25923 in LB medium at early log phase (OD595=0.2), which was then grown to mid-log phase (OD595==0.5). For DNA and protein quantitation, 1 ml cells were harvested and treated with 10 mg/ml lysozyme+0.5 mg/ml lysostaphin at RT for 1 hr before centrifugation at 13000 g/min for 3 min. The supernatant was discarded and cells lysed with 600 μl Nuclei Lysis Solution (Promega/Genomic DNA Purification Kit) for 5 min, followed by gentle sonication. The amount of DNA was quantified with Qubit dsDNA BR (broad range) and protein quantified with NanoOrange™ Protein Quantitation Kit (ThermoFisher). For rRNA quantitation, 1 ml culture was collected and treated with RNAProtect (Qiagen), before total RNA was extracted with an RNeasv Mini Kit (Qiagen). DNase I treatment was performed with a TURBO DNA-free Kit (ThermoFisher). The extracted RNA was subjected to Agilent 2100 analysis, and the level of major rRNA (the sum of 16S+23S rRNA) as percentage of total RNA. The values were compared across each treatment group. All experiments were repeated three times.
[0102] Plasmid Construction. All of the cloning steps were carried out in E. coli DH5α. The plasmids used and constructed in this work were confirmed by DNA sequencing, and are listed in Table 2. B. subtilis nusB was amplified using primers 5′-AAAGGAGATCTAGACATIAAAGAAGA-3′ (SEQ ID NO: 1) and 5′TTTTCTGGTACCCTAKIfTCCC-3′ (SEQ ID NO: 2) from purified B. subtilis chromosomal DNA. The nusB mutants were made by PCR splicing.sup.44 using mutant primers 5′-CTTTGCAGGCACIAgcTCAAATTGATGTC-3′ (SEQ ID NO: 3) and 5′GACACAfiTTGAgcTAGTGCCTGCAAAG-3′ (F15A) (SEQ ID NO: 4), 5′-GAATTGGAAGCTCGATgcGATTGCCAATG-3′ (SEQ ID NO: 5) and 5′-CKfTGGCAkCgc-FCGAGCTTCCAATTC-3′ (R70A) (SEQ ID NO: 6), and 5′GATTGCCAATGTTGcCCGTGCGATTTTOC-3′ (SEQ ID NO: 7) and 5′-GCAAAkFCGCACGGgCAACATGGCAC-3′ (D75A) (SEQ ID NO: 8). The amplicons were cut with XbaI and Acc65I and inserted into similarly cut pETMCSIII (Table 2) to produce pNG130, pNG1178, pNGi79, and pNl1180 respectively (Table 2). B. subtilis nusE was amplified using primers 5′-AAGGAGGGTCTAGAATGGCAAAAC-3′ (SEQ ID NO: 9) and 5′CTATATTTTAGGTACCAAGTTTAfTT-3′ (SEQ ID NO: 10) from B. subtilis chromosomal DNA and ligated into the NdeI and Acc65I sites of pNG651 to give pNG896 (Table 2).
[0103] Protein overproduction and purification. B. subtilis NusB (wild type and mutant) and NusE-GST were overproduced from plasmids (Table 2) and purified using a similar approach to that described previously..sup.45 Purified proteins were dialyzed into 20 mM KH2PO4, 150 mM NaCl, 30% glycerol, pH 7.8 and stored at 80° C.
[0104] ELISA-based assays. These assays were performed as described previously,.sup.41 except NusB was used to coat the NUNC MaxiSorp™ 96-well plates and GST-tagged NusE used as the probe.
[0105] Isothermal calorimetric titration (ITC). ITC experiments were performed as described previously..sup.41 For compound testing, a 50 mM stock made up in DMSO was diluted to 500 μM in ITC buffer (50 mM KH2PO4, 150 mM NaCl, pH 7.4). All proteins were dialysed into ITC buffer and were supplemented with the same concentration of DMSO (1% v/v) to minimize buffer miss-match. MC4 was then titrated against 50 μM NusB wild type and mutants as described previously.sup.41 using 1% DMSO in ITC buffer as the negative control.
TABLE-US-00001 TABLE I Cytotoxicity (CC50) of MC4 against human cell lines. Cell line A549 lung HaCaT immortalized Treatment carcinoma human keratinocytes 5-fluorouracil 5.62 ± 0.002 nM <1 nM MC4 183.33 ± 7.71 μM 695.15 ± 5.95 μM
TABLE-US-00002 TABLE 2 Strains and plasmids used and created in this study. Plasmids Genotype Source/Construction Vectors for cloning pETMCSIII bla Pφ.sub.10-6xHis-Tφ [46] pNG651 bla Pφ.sub.10-3CGST-Tφ [47] Vectors for protein overproduction pNG130 bla Pφ.sub.10-6His-nusB-Tφ This work. nusB cloned into XbaI and Acc65I cut pETMCSIII pNG134 bla Pφ.sub.10-6His-nusE-Tφ This work. nusE cloned into XbaI and Acc65I cut pETMC Siff pNG896 bla Pφ.sub.10-nusE-3CGST-Tφ This work. nusE cloned into NdeI and Acc65I cut pNG651 pNG1178 Bla Pφ.sub.10-6xHis-nusB.sub.(F15A)-Tφ This work. nusB.sub.(F15A) cloned into XbaI and Acc65I cut pETMCSIII pNG1179 blaPφ.sub.10-6xHis-nusB.sub.(R70A)-Tφ This work. nusB.sub.(R70A) cloned into XbaI and Acc65I cut pETMCSIII pNG1180 bla Pφ.sub.10- 6xHis-nusB.sub.(D75A)-Tφ This work. nusB.sub.(D75A) cloned into XbaI and Acc65I cut pETMCSIII
bla, cat, ampicillin and chloramphenicol resistance gene; Pφ.sub.10, phage T7 promoter; P.sub.xyl, xylose inducible promoter, T.sub.ϕ, T7 transcription terminator; 3C, the recognition sequence of 3C protease; GFP green florescence protein; GST, Glutathione S-transferase; PKA, protein kinase A recognition site.
TABLE-US-00003 TABLE 3 Comparison of MC4 and analogues in predicted properties and IC.sub.50. IC50 (μM) FitScore.sup.a AlogP.sup.a PSA-2D.sup.a(Å) MC4 34.7 ± 0.13 2.638 4.206 74.961 MC4-1 14.4 ± 2.59 NA.sup.b 3.078 74.961 MC4-2 38.2 ± 8.78 NA.sup.b 2.818 92.262 MC4-3 5.94 × 10.sup.−3 ± 1.80 NA.sup.b 3.323 95.777 MC4-4 147 ± 17.9 NA.sup.b 3.078 74.961 MC4-5 971 ± 11.6 NA.sup.b 3.565 74.961 MC4-6 8.15 × 10.sup.−3 ± 1.68 2.569 2.836 95.777 MC4-7 1639 ± 12.7 NA.sup.b 3.743 74.961 MC4-8 6.92 × 10.sup.−3 ± 0.68 2.460 2.836 95.777 .sup.aBiovia DS4.5 calculation; .sup.bNo FitScore provided by the software
EXAMPLE 2
Mc4 Analogues
[0106] The structures of further MC4 analogues are presented below with their minimum inhibitory concentrations on 9 microorganisms are shown in
[0107] The antimicrobial activity of the compounds was determined by broth microdilution according to the CLSI guidelines (1). The test medium was cation-adjusted Mueller-Hinton broth (MH). Serial two-fold dilutions were performed for the tested chemicals starting from 256 μg/ml to 0.0625 μg/ml, and the bacterial cell inoculum was adjusted to approximately 5×105 CFU per ml. Results were taken after 20 h of incubation at 37° C. MIC was defined as the lowest concentration of antibiotic with no visible growth. Experiments were performed in duplicates.
TABLE-US-00004 No. Structure Formula Mol. Wt MC4-1
REFERENCES
[0108] (1)(a) Jean, S. S., and Hsueh, P. R. (2011) Int. J. Antimicrob. Agents 37, 291-295. (b) Frieden, T. R. (2013) N. Engl. J. Med. 368, 1857-1859. [0109] (2) Chambers, H. F., and Deleo, F. R. (2009) Nat. Rev. Microbiol. 7, 629-641. [0110] (3) (a) Gardete, S., and Tomasz, A. (2014) J. Clin. Invest. 124, 2836-2840. (b) Nannini, E., Murray, B. E., and Arias, C. A. (2010) Curr. Opin. Pharmacol. 10, 516-521. [0111] (4) Jin, D. J., Cagliero, C., and Zhou, Y N. (2012) FEMS MicrobioLRev. 36, 269-287. [0112] (5) Viktorovskaya, V., and Schneider, D. A. (2015) Gene 556, 19-26. [0113] (6) Santangelo, T. J., and Artsimovitch, 1. (2011) Nat. Rev. Microbiol. 9, 319-329. [0114] (7) Richardson, J. P., and Greenblatt, J. (1996) in Escherichia coli and Salmonella: Cellular and molecular biology, 2nd ed., pp 822-848, American Society for Microbiology, Washington, DC. [0115] (8) Greive, S. J., Lins, A. F., and von Hippel, P. H. (2005) J. Biol. Chem. 280, 36397-36408. [0116] (9) (a) Nodwell, J. R., and Greenblatt, J. (1993) Cell 72, 261-268. (b) Burmann, B. M., Luo, X., Rosch, P., Wahl, M. C., and Gottesman, M. E. (2010) Nucleic Acids Res. 38, 314-326. [0117] (10) Werner, F., and Grohmann, D. (2011) Nat. Rev. Microbiol. 9, 85-98. [0118] (11) (a) Kato, J., and Hashimoto, M. (2007) Mol. Syst. Biol. 3, 132. (b) Bubunenko, M., Baker, T., and Court, D. L. (2007) J. Bacteriol. 189, 2844-2853. [0119] (12) (a) Ma, C., Yang, X., Kandemir, H., Mielczarek, M., Johnston, E. B., Griffith, R., Kumar, N., and Lewis, P. J. (2013) ACS Chem. Biol. 8, 1972-1980. (b) Ma, C., Yang, X., and Lewis, P. J. (2016) ACS Infect. Dis. 2, 39-46. [0120] (13) Vassylyev, D. G., Vassylyeva, M. N., Perederina, A., Tahirov, T. H., and Artsimovitch, I. (2007) Nature 448, 157-162. [0121] (14) Liu, B., and Steitz, T. A. (2017) Nucleic Acids Res. 45, 968-974. [0122] (15) Burmann, B. M., Schweimer, K., Luo, X., Wahl, M. C., Stitt, B. L., Gottesman. M. E., and Rosch, P. (2010) Science 328, 501-504. [0123] (16) Yang, X., Molimau, S., Doherty, G. P., Johnston, E. B., Marles-Wright, J., Rothnagel, R., Hankarner, B., Lewis, R. J., and Lewis, P. J. (2009) EMBO Rep. 10, 997-1002. [0124] (17) (a) Beuth, B., Pennell, S., Arnvig, K. B., Martin, S. R., and Taylor, I. A. (2005) EMBO J. 24, 3576-3587. (b) Prasch, S., Jurk, M., Washburn, R. S., Gottesman, M. E., W{hacek over (o)}hrl, B. M, and Rōsch, P. (2009) Nucleic Acids Res. 37, 4736-4742. [0125] (18) (a) Bubunenko, M., Court, D. L., Al Refaii, A., Saxena, S., Korepanov, A., Friedman, D. I., Gottesman, M. E., and Alix, J. H. (2013) Mol. Microbiol. 87, 382-393. (b) Wong, T., Sosnick, T. R., and Pan, T. (2005) Biochemistry 44, 7535-7542. [0126] (19) Anderson, A. C. (2003) Chem. Biol. 10, 787-797. [0127] (20) Said, N., Krupp, F., Anedchenko, E., Santos, K. F., Dybkov, O., Huang, Y. H., Lee, C. T., Loll, B., Behrmann, E., Bnrger, J., Mielke, T, Loerke, J., Urlaub, H., Spahn, C. M. T, Weber, G., and Wahl, M. C. (2017) Nat. Microbiol. 2, 17062. [0128] (21) Das, R., Loss, S., Li, J., Waugh, D. S., Tarasov, S. Wingfield, P. T., Byrd, R. A., and ltieri, A. S. (2008) J. Mol. Bi ol. 376, 705-720. [0129] (22) Luo, X., Hsiao, H. H., Bubunenko, M., Weber, G., Court, D. L., Gottesman, M. E., Urlaub, H., and Wahl, M. C. (2008) Mol. Cell 31791-802. [0130] (23) Stagno, J. R., Altieri, A. S., Bubunenko, M., Tarasov, S. G., Li, J., Court, D. L., Byrd, R. A., and Ji, X. (2011) Nucleic Acids Res. 39, 7803-7815. [0131] (24) Yang, X., Ma, C., and Lewis, P. J. (2015) Methods 86, 45-50. [0132] (25) Lipinski, C. A., Lombardo, F., Dominy B. W., and Feeney, P. J. (2001) Adv. Drug Delivery Rev. 46, 3-26. [0133] (26) (a) Luecke, L., Weiss A., Graciet, J.-C., Steffanut, P., Klein, C., and Winter, M. A. (2008) Eur. Pat. Appl. EP 1930378. (b) Luecke, L., Weiss A., Graciet, J.-C., Steffanut, P., Klein, C., and Winter, M. A. (2008) Fur. Pat. Appl. EP 1925643. [0134] (27) (a) Cangelosi, G. A., and Brabant, W. H. (1997) J. Bacteriol. 179, 4457-4463. (b) Halford, C., Gonzalez, R., Campuzano, S., Hu. B., Babbitt, J. T., Liu, J., Wang, J., Churchill, B. M., and Haake, D. A. (2013) Antirnicrob. Agents Chemother. 57, 936-943. [0135] (28) O'Neil, J. (2014) Antimicrobial resistance: Tackling a crisis for the health and wealth of nations, Wellcome Trust and HM Government, London. [0136] (29) Chellat, M. F., Raguž, L., and Riedl, R. (2016) Angew. Chem., Int. Ed. 55, 6600-6626. [0137] (30) Goralski, T. D., Dewan, K. K., Alumasa, J. N., Avanzato, V. Place, D. E., Markley, R. L., Katkere, B., Rabadi, S. M., Bakshi, C. S., Keiler, K. C., and Kirirnanjeswara, G. S. (2016) Antimicrob. Agents Chemother. 60, 3276-3282. [0138] (31) Brighenti, E., Trere, D., and Derenzini, M. (2015) Oncotarget 6, 38617-38627. [0139] (32) Ma, C., Yang, X., and Lewis, P. J. (2016) Microbiol. Mol. Biol. Rev. 80, 139-160. [0140] (33) Studier, F. W.; Moffatt, B A. (1986). Mol. Biol. 189, 113-130. [0141] (34) Vassylyev, D. G.; Vassylyeva, M. N.; Perederina. A.; Tahirov, T. H.: Artsimovitch, I. (2007) Nature 448, 157-162. [0142] (35) Liu, B.; Steitz, T. A. (2017)Nucleic Acids Res. 45, 968-974. [0143] (36) Stagno, J. R.; Altieri, A. S.; Bubunenko, M.; Tarasov, S. G.; Li, J.; Court, D. L.; Byrd R. A.; Ji, X. (2011) Nucleic Acids Res. 39, 7803-7815. [0144] (37) Beuth, B.; Pennell, S.; Arnvig, K. B.; Martin S. R.; Taylor, I. A. (2005) EMBO J. 24, 3576-3587. [0145] (38) Burmann, B. M.; Schweimer, K.; Luo, X.; Wahl, M. C.; Stitt, B. L.; Gottesman. M. E. Rosch, P. (2010) Science 328, 501-504. [0146] (39) Ma, C.; Mobli, M.; Yang, X.; Keller, A. N.; King G. F.; Lewis, P. J. (2015) Nucleic Acids Res. 43, 2829-2840. [0147] (40) Pettersen, E. F.; Goddard, T. D.; Huang, C. C.; Couch, G. S.; Greenblatt, D. M.; Meng E. C.; Ferrin, T E. (2004) J. Comput. Chem. 25, 1605-1612. [0148] (41) Yang, X.; Ma C.; Lewis, P. J. (2015) Methods 86, 45-50. [0149] (42) CLSI, Clinical and Laboratory Standards Institute. (2015) Performance Standards for Antimicrobial Susceptibility Testing, Twenty-Fifth Informational Supplement (M100S25). [0150] (43) Bi, Y; Yang, X.; Zhang, T.; Lii, Z.; Zhang, X.; Lu, J.; Cheng, K. Xu, J.; Wang, H.; Lv, G.; Lewis, P. J.; Meng Q.; Ma, C. (2015) Eur J Med Chem. 101, 71-80 [0151] (44) Heckman K. L.; Pease, L. R. (2007) Nat. Protoc. 2, 924-932. [0152] (45) Ma, C.; Yang, X.; Lewis, P. J. (2016)ACS Infect. Dis. 2, 39-46. [0153] (46) Neylon, C.; Brown, S. E.; Kralicek, A. V.; Miles, C. S.: Love, C. A.; Dixon, N. E. (2000) Biochemistry 39, 11989-11999. [0154] (47) Ma, C.; Yang, X.; Kandemir, H.; Mielczarek, M.; Johnston, E. B.; Griffith, R.; Kumar, N.; Lewis, P. J. (2013) ACS Chem. Biol. 8, 1972-1980.