METHOD FOR PREPARING CKO/KI ANIMAL MODEL BY USING CAS9 TECHNOLOGY

20210307303 · 2021-10-07

    Inventors

    Cpc classification

    International classification

    Abstract

    A method for preparing a CKO/KI animal model by using Cas9 technology includes a Cas9 protein expressed and purified in vitro, high-efficiency sgRNA(s) screened by sgRNA cleavage efficiency test on embryos in advance, and single-stranded DNA as targeting vector(s) are mixed with Cas9 protein and sgRNA(s) and then subjected to embryo injection and transplantation; mice born after transplantation are marked as F0 and the genotype identification of F0 is carried out; sexually mature F0 with the correct genotype are bred, and the offspring mice thereof are marked as F1; and the F1 mice are analyzed and verified, and the F1 mice with the correct genotype are the prepared CKO/KI animal model.

    Claims

    1. A method for preparing a CKO/KI animal model by using Cas9 technology, wherein: a Cas9 protein expressed and purified in vitro, high-efficiency sgRNA(s) screened by an sgRNA cleavage efficiency test on embryos and targeting a gene locus to be modified, and single-stranded DNA targeting vector(s) are mixed with Cas9 protein and sgRNA(s) and subjected to animal embryo injection and transplantation; F0 mice born after transplantation are subjected to genotype identification; F0 with the correct genotype identification are bred to obtain F1 mice; and the F1 mice are identified, analyzed and verified to obtain the CKO/KI animal model.

    2. The method of claim 1, comprising the following steps: step 1: preparation of a Cas9 protein with nuclease activity for subsequent steps, wherein the Cas9 protein is prepared by expression and purification in vitro; step 2: screening of sgRNA, applicable to synthetic RNA (1) designing an sgRNA targeting a gene locus to be modified and preparing a transcription template; (2) transcribing the sgRNA in vitro using a transcription kit, and the transcribed sgRNA being for later use; (3) transferring the sgRNA from step (2) and the Cas9 protein from step 1 into mouse fertilized eggs by microinjection or electroporation, and testing the obtained embryos for sgRNA cleavage activity; and screening out the sgRNA with the best cleavage activity for later use; step 3: design and construction of targeting vector scheme developing a model production scheme according to needs, and designing the targeting vector scheme based on the model production scheme; constructing the vector according to the targeting vector scheme, and using a single-strand DNA as the targeting vector; step 4: embryo injection and transplantation mixing the targeting vector constructed correctly in step 3, the Cas9 protein from step 1, and the sgRNA with the best cleavage activity obtained in step 2, and carrying out embryo injection and transplantation by using the mixed sample; and step 5: marking mice born after transplantation as F0 and carrying out the genotype identification of F0; breeding sexually mature F0 with the correct genotype identification, and marking the offspring mice thereof as F1; analyzing and verifying the F1 mice, and the F1 mice with the correct genotype verification being the prepared CKO/KI animal model.

    3. The method of claim 2, wherein the step (1) of step 2 is specifically: an sgRNA targeting a modified locus is designed through a design website, an sgRNA transcription vector is constructed, and an in vitro transcription template is prepared.

    4. The method of claim 3, wherein the sgRNA cleavage activity test is carried out on the obtained embryos in the step (3) of step 2 to confirm the sgRNA cleavage activity.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0030] FIG. 1 is a flow chart of application of Cas9 technology to preparation of an animal model.

    [0031] FIG. 2 is an electropherogram of cleavage activity test of Cas9-protein, wherein the Marker is Marker DL 2000.

    [0032] FIG. 3 shows the genotype identification result of Nes-CreF1 mice. A: 5-end identification result; B: 3-end identification result.

    [0033] Note: the number in the figure represents the mouse number; B6 is a negative control, and is the mouse genomic DNA (MouseGRC38/mm10); N is a blank control, the control without a template; P is a positive plasmid control; TRANS2K PLUS II strip: 8000 bp\5000 bp\3000 bp\2000 bp\1000 bp\750 bp\500 bp\250 bp\100 bp.

    [0034] FIG. 4 is a detection image of brain cells in model mice. Among them: Cre− is the abbreviation of rosa26-loxP-tdtomato-loxP-GFP mice; Cre+ is the abbreviation of offspring mice of rosa26-loxP-tdtomato-loxP-GFP and Nes-Cre. Cre− and Cre+ mice are both 15.0-week-old male mice, and the diagram is fluorescence pictures under a 200× microscope (Scale bar 50 μM).

    [0035] FIG. 5 is a detection image of spinal cord cells in model mice. Among them: Cre− is the abbreviation of rosa26-loxP-tdtomato-loxP-GFP mice; Cre+ is the abbreviation of offspring mice of rosa26-loxP-tdtomato-loxP-GFP and Nes-Cre. Cre− and Cre+ mice are both 15.0-week-old male mice, and the diagram is fluorescence pictures under a 200× microscope (Scale bar 50 μM).

    [0036] FIG. 6 shows the Cas9-mRNA+Erbb2ip donor targeting identification result. A. 5-end identification of Cas9-mRNA+Erbb2ip donor targeting; B. 3-end identification of Cas9-mRNA+Erbb2ip donor targeting; the number in the figure represents the embryo number; “-” or “B6” is a negative control, and is the embryonic genomic DNA; “Blank” and “Water” are blank controls, the controls without templates; the sizes of Marker DL strips are respectively: 2000 bp/1000 bp/750 bp/500 bp/250 bp/100 bp.

    [0037] FIG. 7 shows the Cas9-Protein+Erbb2ip donor targeting identification result. A. 5-end identification of Cas9-Protein+Erbb2ip donor targeting; B. 3-end identification of Cas9-Protein+Erbb2ip donor targeting; the number in the figure represents the embryo number; “-” or “B6” is a negative control, and is the embryonic genomic DNA; “Blank” and “Water” are blank controls, the controls without templates; the sizes of Marker DL strips are respectively: 2000 bp/1000 bp/750 bp/500 bp/250 bp/100 bp.

    [0038] FIG. 8 shows the Cas9-mRNA+Ly101 donor targeting identification result. A. 5-end identification of Cas9-mRNA+Ly101 donor targeting; B. 3-end identification of Cas9-mRNA+Ly101 donor targeting; the number in the figure represents the embryo number; “-” or “B6” is a negative control, and is the embryonic genomic DNA; “Blank” and “Water” are blank controls, the controls without templates; the sizes of Marker DL strips are respectively: 2000 bp/1000 bp/750 bp/500 bp/250 bp/100 bp.

    [0039] FIG. 9 shows the Cas9-Protein+Ly101 donor targeting identification result. A. 5-end identification of Cas9-Protein+Ly101 donor targeting; B. 3-end identification of Cas9-Protein+Ly101 donor targeting; the number in the figure represents the embryo number; “-” or “B6” is a negative control, and is the embryonic genomic DNA; “Blank” and “Water” are blank controls, the controls without templates; the sizes of Marker DL strips are respectively: 2000 bp/1000 bp/750 bp/500 bp/250 bp/100 bp.

    [0040] FIG. 10 is the electrophoresis result of F0 genotype identification. The number in the figure represents the mouse number; B6 is a negative control, and is the mouse genomic DNA; N is a blank control, the control without a template; DL2000 strips: 2000 bp\1000 bp\750 bp\500 bp\250 bp\100 bp.

    [0041] FIG. 11 is the electrophoresis result of genotype identification of F1 mice. The number in the figure represents the mouse number; B6 is a negative control, and is the mouse genomic DNA; N is a blank control, the control without a template; DL2000 strips: 2000 bp\1000 bp\750 bp\500 bp\250 bp\100 bp.

    DETAILED DESCRIPTION

    [0042] Example 1: a method for preparing a Nes-Cre animal model based on Cas9 technology is realized by the following steps.

    [0043] Step 1: a Cas9 protein was prepared. The Cas9 protein was prepared by expression and purification in vitro, and the activity thereof was tested. The protein with nuclease activity can be used for subsequent experiments. A commercial Cas9 active protein may also be purchased.

    [0044] Reagent I: PrimeSTAR Max DNA Polymerase (Takara R045A)

    [0045] Reagent II: Gel/PCR DNA Fragments Extraction Kit (Geneaid DF100)

    [0046] Reagent III: NEBuffer3.1 (10×) (NEB #B7203S)

    [0047] Reagent IV: 10× Loading Buffer (Takara 9157)

    [0048] 1) A C57BL/6 genome (MouseGRCm38/mm10) was used as a template, and PCR amplification was performed according to the operation manual of PrimeSTAR Max DNA Polymerase (Takara R045A). The primer information is as follows:

    TABLE-US-00001 Primer Stripe name Primer sequence size F TGGCTCACAAACATCCGTAATGA 685 bp (SEQ ID NO. 1) R CAGTCAGTAAACGGATCAAAGCT (SEQ ID NO. 2)

    [0049] The PCR system is as follows:

    TABLE-US-00002 Reagent Volume (μl) Specification 2x PrimerStarMax 25 ddH.sub.2O 22 F 1 10 μM R 1 10 μM C57BL/6 genome DNA 1

    [0050] The PCR procedure is as follows:

    TABLE-US-00003 PCR procedure Seg. Temp. Time Cycle 1 98° C. 3 min 2 98° C. 10 s 3 58° C. 10 s 4 72° C. 40 s 2-4, 35 5 72° C. 3 min 6 4° C. hold

    [0051] 2) The amplified target fragment was detected by agarose gel electrophoresis, and the PCR product was recovered through the operation manual of a Gel/PCR DNA Fragments Extraction Kit (Geneaid DF100). The PCR product concentration measured by an ultraviolet spectrophotometer is 76.95 ng/μl (GD 260/280=1.85), and the PCR product sequence is as set forth in SEQ ID NO.10.

    [0052] A sample addition system is as follows:

    TABLE-US-00004 Group Experimental group Control group PCR product (200 ng) 2.6 μl 2.6 μl (SEQ ID NO. 10) Cas9-Protein 2 μl — sgRNA-1 1 μl 1 μl NEBuffer 3.1 (10x) 3 μl 3 μl ddH.sub.2O 21.4 μl 23.4 μl

    [0053] The order of sample addition is: water, Buffer, Cas9-Protein, sgRNA-1, and PCR recovery product. After the sample was added, the sample was mixed well using a pipette. After mixing, the sample was incubated at 37° C. for 1 h, heated at 72° C. for 10 min, and kept at 4° C.

    [0054] The sgRNA-1 sequence is GAGGGCAGCTCTTGCAGAC (SEQ ID NO.65).

    [0055] After completion, the sample was taken out immediately and placed on ice to cool for 5 min. 3.4 μl of 1% SDS was added, and 4 μl of 10× loading buffer was added after water bath action at 55° C. for 10 min. Agarose gel electrophoresis was performed, and the electrophoresis result is as shown in FIG. 2. In the system with Cas9-protein and the corresponding sgRNA, obvious cleavage can be seen, and the control group has no cleavage. The cleavage activity of Cad-protein is judged according to the ratio of cleavage. The Cas9 protein with a cleavage ratio of 50% or above can be used for subsequent projects and experiments.

    [0056] Step 2: screening of sgRNA

    [0057] (1) The sgRNA targeting a knock-in locus was designed and an sgRNA transcription template was prepared.

    [0058] The sgRNA targeting the KI locus was designed using a Cas9sgRNA design website http://crispr.mit.edu/, and a corresponding Oligo was ordered to construct the sgRNA.

    [0059] The sgRNA sequences are as follows:

    TABLE-US-00005 sgRNA name Sequence PAM Nes-Cre-S1 GAACACTAGTGCACTTATCC TGG (SEQ ID NO. 3) Nes-Cre-S2 CTGAGCCAACAGTGGTAGTA AGG (SEQ ID NO. 4) Nes-Cre-S3 AACACTAGTGCACTTATCCT GGG (SEQ ID NO. 5) Nes-Cre-S4 CCAACAGTGGTAGTAAGGTA AGG (SEQ ID NO. 6) Nes-Cre-S5 TGGTAGTAAGGTAAGGGC AGG (SEQ ID NO. 7) Nes-Cre-S6 CCAACAGTGGTAGTAAGGTAA GGG (SEQ ID NO. 8) Nes-Cre-S7 TCTGGAAAAAGCAGTCCCAC TGG (SEQ ID NO. 9)

    [0060] Forward an reverse pnmers were annealed to orm double strands, an then the double strands were ligated with a pUC57-T7 universal vector singly digested with Bsal to construct a transcription vector containing the sgRNA sequence. The sequencing verification by a professional sequencing company showed that the target plasmid was obtained.

    [0061] The obtained target plasmid was digested at 37° C. overnight. After completion, agarose gel electrophoresis was performed. The target strips were cut for gel recovery, and a final product obtained was recovered as a transcription template.

    [0062] (2) All sgRNAs were transcribed in vitro using a transcription kit, and the transcribed sgRNAs were for later use.

    [0063] Reagent I: HiScribe™ T7 Quick High Yield RNA Synthesis Kit (NEB #E2050S)

    [0064] Reagent II: AmbionMEGAclear kit (Ambion AM1908)

    [0065] In vitro transcription of the RNAs was carried out according to the operation manual of a HiScribe™ T7 Quick High Yield RNA Synthesis Kit (NEB #E2050S), and RNA purification was carried out according to the operation manual of an AmbionMEGAclear kit (AmbionAM1908).

    [0066] (3) The sgRNA and Cas9 protein were transferred into mouse fertilized eggs by microinjection or electroporation according to the method in the “Mouse Embryo Operation Experiment Manual”. The obtained embryos were tested for sgRNA cleavage activity by nested PCR. The PCR products were sequenced and verified by a professional sequencing company, and the Nes-Cre-S2 with high efficiency of a knock-in locus was obtained by screening.

    [0067] The PCR system is as follows:

    TABLE-US-00006 Reagent Volume (μl) Specification 10x Buffer 2.5 ddH.sub.2O 17.75 primerF 0.5 10 μM primerR 0.5 10 μM Mg2+ 2 25 mM dNTPs 0.5 10 mM each Taq 0.25 5 U/μl Template 1

    [0068] PCR primers are as follows:

    TABLE-US-00007 Primer Stripe No. name Primer sequence size Remarks 1 Nes-Cre- ggcacaatgttaatc 923 bp First outF 1 cagcctgactccaa round (SEQ ID NO. 12) PCR Nes-Cre- gcttgccttgaacttc outR 1 actatatagggctta (SEQ ID NO. 13) 2 Nes-Cre- ggggccataaatgcta 647 bp Second inF 1 ttttaattccact round (SEQ ID NO. 14) PCR Nes-Cre- ccacctttcttcagtta inR 1 gcttctgtacac (SEQ ID NO. 15)

    [0069] The PCR procedure is as follows:

    TABLE-US-00008 PCR procedure Seg. Temp. Time Cycle 1 95° C. 5 min 2 95° C. 30 s 3 65° C. 30 s 2-4, 35x 4 72° C. 45 s 5 95° C. 5 min 6 72° C. 5 min

    [0070] The sgRNA cleavage efficiency is as follows:

    TABLE-US-00009 Cleavage efficiency Predicted Efficiency sgRNA name (Range: 0-100%) (Range: 0-100) Nes-Cre-S1 45 37 Nes-Cre-S2 85 40 Nes-Cre-S3 68 50 Nes-Cre-S4 50 45 Nes-Cre-S5 30 53 Nes-Cre-S6 10 45 Nes-Cre-S7 60 56

    [0071] There is a difference between the sgRAN activity score predicted by the website and the sgRNA cleavage efficiency of embryos. We chose the Nes-Cre-S2, with a higher cleavage efficiency in embryo testing, as the sgRNA for targeting.

    [0072] Step 3: a targeting vector containing a knock-in locus homologous arm, a Nestin promoter, Cre CDS, and HGHpolyA originals was designed and constructed. The above fragments were ligated with a PMID18T universal vector through a NEBuilder® HiFi DNA Assembly Master Mix (E2621 S) kit. Finally, the Nes-Cre targeting vector was obtained. The sequence of the Nes-Cre targeting vector is as set forth in SEQ ID NO. 11.

    [0073] Step 4: embryo injection and transplantation

    [0074] The correctly constructed targeting vector Nes-Cre, the Cas9 protein and the Nes-Cre-S2sgRNA were mixed, and the mixed injection sample was provided to the injection personnel for carrying out embryo injection and transplantation.

    [0075] Step 5: the mice born after transplantation were marked as F0, and sexually mature positive F0 with correct genotype identification was bred. The offspring mice were marked as F1, and theF1 mice were analyzed and verified.

    [0076] The PCR system for genotype identification of F1 mice is as follows:

    TABLE-US-00010 Reagent Volume (μl) Specification 2x PrimerStarMax 25 ddH.sub.2O 22 F 1 10 μM R 1 10 μM Template 1

    [0077] PCR primers are as follows:

    TABLE-US-00011 Primer Stripe No. name Primer sequence size Remarks 1 Nes-Cre- ATGCCCACCAAAGTC 1527 bp 5-end tF2 ATCAGTGTAG (SEQ ID NO. 16) Nes-Cre- CCTTAACTCGGGTTG tR1 CCAGGT (SEQ ID NO. 17) 2 Nes-Cre- CCTCCTCTCCTGACT 3072 bp 3-end 3tF2 ACTCCCAGTC (SEQ ID NO. 18) Nes-Cre- TCACAGAAACCATAT tR2 GGCGCTCC (SEQ ID NO. 19)
    The PCR procedure is as follows:

    TABLE-US-00012 Touch down PCR procedure (Touch down Cycling) Seg. Temp. Time Cycle ±Temp/cycle 1 95° C. 5 min 2 98° C. 30 s 3 65° C. 30 s −0.5 4 72° C. 45 s 2-4, 20x 5 98° C. 30 s 6 55° C. 30 s 7 72° C. 45 s 5-7, 20x 8 72° C. 5 min 9 10° C. hold

    [0078] The genotype identification result of the Nes-CreF1 mice is as shown in FIG. 3. The PCR products (target fragments) were sequenced and verified by a professional sequencing company, and 3 positive F1 mice were screened.

    [0079] Example 2: Functional Analysis of Nes-Cre Model Mice

    [0080] Under the action of the nestin-promoter, the model expresses a Cre enzyme specifically in the central and peripheral nervous system, and can be used as a Cre tool mouse for specific induction of LoxP recombination in the central and peripheral nervous system. The positive F1 mice obtained in Example 1 were mated with fluorescent reporter gene tool mice (rosa26-loxP-tdtomato-loxP-GFP) to breed. Rosa26-loxP-tdtomato-loxP-GFP tool mice expressed red fluorescence, and when they were mated with Cre recombinase-expres sing mice, the offspring expressed green fluorescence because tdTtomato was missing in cells expressing ere. By observing frozen sections, the expression of green fluorescence could be observed to confirm the expression of ere protein in the central and peripheral nervous system, so as to perform functional analysis of the model.

    [0081] By observing the frozen sections, it can be seen that in the offspring mice bred by mating the fluorescent reporter gene tool mice with the Nes-Cre mice, the tdTomato and stop originals in the brain and spinal cord cells were cut, and the brain and spinal cord cells could express green fluorescent EGFP. Other cells that could not express cre still expressed red fluorescence. The detection diagrams are as shown in FIG. 4 and FIG. 5.

    [0082] Example 3: a comparative test of the effects of the Cas9-mRNA and the Cas9 protein on the sgRNA-2 cleavage efficiency proves that the sgRNA cleavage efficiency of the Cas9-Protein+sgRNA combination is higher than that of the Cas9-mRNA+sgRNA combination.

    [0083] Step 1: the sgRNA-2 was used as the sgRNA for testing, and the sequence of the sgRNA-2 is as follows:

    [0084] The sequence of the sgRNA-2 is as follows:

    TABLE-US-00013 sgRNA name Sequence PAM sgRNA-2 AGTCTTCTGGGCAGGCTTAA AGG (SEQ ID NO. 20)

    [0085] Step 2: the sgRNA and the Cas9 system were transferred into mouse fertilized eggs by microinjection or electroporation according to the method in the “Mouse Embryo Operation Experiment Manual”. The obtained embryos were tested for sgRNA cleavage activity by nested PCR. The PCR products were sequenced and verified by a professional sequencing company, and the result shows that the cleavage efficiency of the Cas9-Protein+sgRNA is better than that of the Cas9-mRNA+sgRNA.

    [0086] The PCR system is as follows:

    TABLE-US-00014 Reagent Volume (μl) Specification 10x Buffer 2.5 ddH.sub.2O 16.75 primerF 1 10 μM primerR 1 10 μM Mg2+ 2 25 mM dNTPs 0.5 10 mM each Taq 0.25 5 U/μl Template 1

    [0087] PCR primers are as follows:

    TABLE-US-00015 Primer Stripe No. name Primer sequence size Remarks 1 sgRNA-2- AGACAGCCGGGTACGA 1938 bp First outF GTCGTGA round (SEQ ID NO. 21) PCR sgRNA-2- CAGCCTGGCAATATGT outR AAGATACATCAG (SEQ ID NO. 22) 2 sgRNA-2- GTGCAAGCACGTTTCC  882 bp Second inF GACTTG round (SEQ ID NO. 23) PCR sgRNA-2- CTGGTTTCATGAGTCA inR TCAGACTTCTA (SEQ ID NO. 24)

    [0088] The PCR procedure is as follows:

    TABLE-US-00016 Seg. Temp. Time Cycle 1 95° C. 5 min 2 95° C. 30 s 3 58° C. 30 s 2-4, 35x 4 72° C. 1 kb/min 5 72° C. 5 min 6 10° C. hold

    [0089] The sgRNA cleavage efficiency is as follows:

    TABLE-US-00017 Name Cleavage efficiency Cas9-mRNA + sgRNA-2 14.3% Cas9-Protein + sgRNA-2   70%

    [0090] Example 4: a comparative test of the effects of the Cas9-mRNA and the Cas9 protein on the Erbb2ip gene targeting efficiency proves that the targeting efficiency of the Cas9-Protein+sgRNA+Donor combination is higher than that of the Cas9-mRNA+sgRNA+Donor combination.

    [0091] Step 1: the sgRNA corresponding to the Erbb2ip gene was used, and the sequence of the sgRNA is as follows:

    TABLE-US-00018 sgRNA name Sequence PAM Erbb2ip-5S TCAAGGGATGCTCTTCAATA TGG (SEQ ID NO. 25) Erbb2ip-3S GAGAGGCCCAATGCCCAACG TGG (SEQ ID NO. 26)

    [0092] An Erbb2ip gene targeting donor was used, and the targeting donor sequence is as set forth in SEQ ID NO.27.

    [0093] The sgRNA, donor, and Cas9 system were transferred into mouse fertilized eggs by microinjection or electroporation according to the method in the “Mouse Embryo Operation Experiment Manual”, and the obtained embryos were tested for the gene targeting efficiency by nested PCR. The result shows that the Cas9-Protein+sgRNA+Donor combination has higher targeting efficiency than the Cas9-mRNA+sgRNA+Donor combination.

    [0094] The specific targeting efficiency result is as follows:

    TABLE-US-00019 Name Cleavage efficiency Cas9-mRNA + Erbb2ip donor 3.33% (3/90) Cas9-Protein + Erbb2ip donor 7.05% (6/85)

    [0095] The PCR system is as follows:

    TABLE-US-00020 Reagent Volume (μl) Specification 10x Buffer 2.5 \ ddH.sub.2O 17.75 \ PrimerF 0.5 10 μM PrimerR 0.5 10 μM Mg2+ 2 25 mM dNTPs 0.5 10 mM each Taq 0.25 5 U/μl Template 1 ≈100 ng/μl

    [0096] PCR primers are as follows:

    TABLE-US-00021 Primer Primer Stripe descrip- No. name Primer sequence size tion 1 Erbb2ip- GGAACCATTAGATTT 2663 bp First  geno- AACCAGAC  round outside- (SEQ ID NO. 28) F-8-1 Erbb2ip- CTGTTTACAAAGTCT geno- AAGGTGTG outside- (SEQ ID NO. 29) R-8-1 2 Erbb2ip- TTGTTTATTACAGTC KI:  Detection geno- TGTATCCC 2032 bp of 5-end inside- (SEQ ID NO. 30) Wt:  F-8-1 none Erbb2ip- AGATGTTGGAGCTCG geno- ATATCATAAC  inside- (SEQ ID NO. 31) R1-8-20 3 Erbb2ip- GATGCTCTTCAATAT KI:  Detection 5′geno- GACATAAC  676 bp of 3-end inside- (SEQ ID NO. 32) Wt:  F-9-12 none Erbb2ip- TCTGAGAGGCCCAAT 5′geno- GCCCAACG  inside- (SEQ ID NO. 33) R-9-12

    [0097] The PCR procedure is as follows:

    TABLE-US-00022 Seg. Temp. Time Cycle 1 95° C. 5 min 2 95° C. 30 s 3 60° C. 30 s 2-4, 35x 4 72° C. 1 kb/min 5 72° C. 5 min 6 10° C. hold

    [0098] The result of Cas9-mRNA+Erbb2ip donor targeting identification is as shown in FIG. 6. Among 90 test samples, 3 samples were identified as positive by PCR.

    [0099] The result of Cas9-Protein+Erbb2ip donor targeting identification is as shown in FIG. 7. Among 85 test samples, 6 samples were identified as positive by PCR.

    [0100] Example 5: a comparative test of the effects of the Cas9-mRNA and the Cas9 protein on the Ly101 gene targeting efficiency proves that the targeting efficiency of the Cas9-Protein+sgRNA+Donor combination is higher than that of the Cas9-mRNA+sgRNA+Donor combination.

    [0101] Step 1: the sgRNA corresponding to a Ly101 gene was used, and the sequence of the sgRNA is as follows:

    TABLE-US-00023 sgRNA name Sequence PAM Ly101-5′sgRNA GAGCTACCCTGAGTAGCAGA AGG (SEQ ID NO. 34) Ly101-3′sgRNA CTGGTCATCAGCCAGCTAAG AGG (SEQ ID NO. 35)

    [0102] A Ly101 gene targeting donor was used, and the sequence is as set forth in SEQ ID NO.36.

    [0103] The sgRNA, donor, and Cas9 system were transferred into mouse fertilized eggs by microinjection or electroporation according to the method in the “Mouse Embryo Operation Experiment Manual”, and the obtained embryos were tested for the gene targeting efficiency by nested PCR. The result shows that the Cas9-Protein+sgRNA+Donor combination has higher targeting efficiency than the Cas9-mRNA+sgRNA+Donor combination.

    [0104] The specific targeting efficiency result is as follows:

    TABLE-US-00024 Name Cleavage efficiency Cas9-mRNA + Ly101 donor 3.22% (3/93) Cas9-Protein + Ly101 donor 6.70% (11/164)

    [0105] The PCR system is as follows:

    TABLE-US-00025 Reagent Volume (μl) Specification 10x Buffer 2.5 \ ddH.sub.2O 17.75 \ PrimerF 0.5 10 μM PrimerR 0.5 10 μM Mg2+ 2 25 mM dNTPs 0.5 10 mM each Taq 0.25 5 U/μl Template 1 ≈100 ng/μl

    [0106] PCR primers are as follows:

    TABLE-US-00026 Primer de- Primer Stripe scrip- No.  name Primer sequence size tion 1 Ly101-5- ACCCCTAGCCTGGGCCTAGTT  Wt/wt =  5-end  geno- C none first outside-F (SEQ ID NO. 37) KI/KI =  round Ly101-5- TCGGAATTGAATATTTCTAGAC 1220 bp geno- CAGC  outside-R (SEQ ID NO. 38) 2 Ly101-5- TTCTTCTGGCCCATAGAGACC  Wt/wt =  5-end geno- A none second inside-F (SEQ ID NO. 39) KI/KI =  round Ly101-5- AGCTGGTTCTTTCCGCCTCAG  1150 bp geno- A inside-R (SEQ ID NO. 40) 3 Ly101- CTGGTGCTGCTAGTCTGGGTC Wt/wt =  3-end  geno- CT (SEQ ID NO. 41) none first outside- round F2 Ly101- CAGCTTGTGGTAAACCTGAAG KI/KI =  geno- TGA (SEQ ID NO. 42) 1544 bp outside- R2 4 Ly101- CACCTAATTGCATCGCATTG Wt/wt =  3-end geno- (SEQ ID NO. 43) none second inside-F2 KI/KI =  round Ly101- TGGCTGAACTGTAGCCTGCA 1292 bp geno- (SEQ ID NO. 44) inside-R2

    [0107] The PCR procedure is as follows:

    TABLE-US-00027 Seg. Temp. Time Cycle 1 95° C. 5 min 2 95° C. 30 s 3 58° C. 30 s 2-4, 35x 4 72° C. 1 kb/min 5 72° C. 5 min 6 10° C. hold

    [0108] The result of Cas9-m+Ly101 donor targeting identification is as shown in FIG. 8. Among 93 test samples, 3 samples were identified as positive by PCR.

    [0109] The result of Cas9-Protein+Ly101 donor targeting identification is as shown in FIG. 9. Among 164 test samples, 11 samples were identified as positive by PCR.

    [0110] Example 6: a Gsdma123-Cas9-CKO mouse model was prepared, and F1 mice with the correct genotype identification can be used as animal models for studying the Gsdma gene.

    [0111] Step 1: the sgRNA targeting a Gsdma locus was designed, and an sgRNA transcribe template was prepared.

    [0112] The sgRNA targeting the Gsdma locus was designed using a Cas9sgRNA design website http://crispr.mit.edu/, and a corresponding Oligo was ordered to construct the sgRNA.

    [0113] The sgRNA sequences are as follows:

    TABLE-US-00028 sgRNA name Sequence PAM Gsdma-5S1 CTAGCAACAGGAGTATAAGT GGG (SEQ ID NO. 45) Gsdma-3S2 CATCTTTCGATCCTTCTGCA TGG (SEQ ID NO. 46)

    [0114] Forward and reverse primers were annealed to form double strands, and then the double strands were ligated with a pUC57-T7 universal vector singly digested with Bsal to construct a transcription vector containing the sgRNA sequence. The sequencing verification by a professional sequencing company showed that the target plasmid was obtained.

    [0115] The obtained target plasmid was digested at 37° C. overnight. After completion, agarose gel electrophoresis was performed. The target strips were cut for gel recovery, and a final product obtained was recovered as a transcription template.

    [0116] Step 2: all sgRNAs were transcribed in vitro using a transcription kit, and the transcribed sgRNAs were for later use.

    [0117] Reagent I: HiScribe™ T7 Quick High Yield RNA Synthesis Kit (NEB #E2050S)

    [0118] Reagent II: AmbionMEGAclear kit (AmbionAM1908)

    [0119] In vitro transcription of the RNAs was carried out according to the operation manual of the HiScribe™ T7 Quick High Yield RNA Synthesis Kit (NEB #E2050S), and RNA purification was carried out according to the operation manual of the AmbionMEGAclear kit (AmbionAM1908).

    [0120] Step 3: the sgRNA targeting Gsdma locus and the Cas9 protein were transferred into mouse fertilized eggs by microinjection or electroporation according to the method in the “Mouse Embryo Operation Experiment Manual”. The obtained embryos were tested for sgRNA cleavage activity by nested PCR. The PCR products were sequenced and verified by a professional sequencing company, and a high-efficiency sgRNA was obtained by screening.

    [0121] The PCR system is as follows:

    TABLE-US-00029 Reagent Volume (μl) Specification 10x Buffer 2.5 ddH.sub.2O 17.75 primerF 0.5 10 μM primerR 0.5 10 μM Mg2+ 2 25 mM dNTPs 0.5 10 mM each Taq 0.25 5 U/μl Template 1

    [0122] PCR primers are as follows:

    TABLE-US-00030 Primer Stripe No.  name Primer sequence size Remarks 1 GSDMA- ATGGCCCAATATCTATGTGT 1880 bp First 5out-F1 (SEQ ID NO. 47) round GSDMA- AGTCCCTGTACTTGGACATC PCR 5out-R1 (SEQ ID NO. 48) 2 GSDMA- CCAAACTTGTGGTGCTTGCA  981 bp Second 5in-F1 (SEQ ID NO. 49) round GSDMA- CCATGTTCACTTCTTCACAG PCR 5in-R1 (SEQ ID NO. 50) 3 GSDMA- GCCATCCTTTACTTCCTCGG 1800 bp First 3out-F1 (SEQ ID NO. 51) round GSDMA- TTTGGGAGAAGTCATGGGCT PCR 3out-R1 (SEQ ID NO. 52) 4 GSDMA- AGGTATTTCAGAGGGAGAGA  820 bp Second 3in-F1 (SEQ ID NO. 53) round GSDMA- TGTGTGTATATGTTGCGTGT PCR 3in-R1 (SEQ ID NO. 54)

    [0123] The PCR procedure is as follows:

    TABLE-US-00031 Seg. Temp. Time Cycle ±Temp/cycle 1 95° C. 5 min 2 95° C. 30 s 3 65° C. 30 s −0.5 4 72° C. 1 min 2-4, 20x 5 95° C. 30 s 6 55° C. 30 s 7 72° C. 1 min 5-7, 20x 8 72° C. 5 min 9 10° C. hold

    [0124] The sgRNA cleavage efficiency is as follows:

    TABLE-US-00032 Cleavage efficiency Predicted Efficiency sgRNA name (Range: 0-100%) (Range: 0-100) Gsdma-5S 78 55 Gsdma-3S 53 57

    [0125] Step 4: an Oligo targeting vector of Gsdma-Cas9-CKO and an identification scheme were designed and prepared. According to the targeting vector scheme, the targeting OligossDNA was ordered. The sequence is as follows:

    TABLE-US-00033 Gadma123-Oligo-5: (SEQ ID NO. 55) TGGAAAGGGGATATATCGTAAACAGAACTAACAAAGACAAAGAAGTAAGT GAGAGAGAGGAACTGGGAAACAAGCCCGTGCACCCGCGGATAACTTCGTA TAATGTATGCTATACGAAGTTATACTTATACTCCTGTTGCTAGGAGGTGG GTGGGAAGGAAGTGTAGGGTACAAGCAAGTAGAGCCTTGCCAAGGAAAGG Gadma123-Oligo-3: (SEQ ID NO. 56) GGATTAAAGGCGTGCACCACCATGCCCAGCTTCCATTTTTATTTTTATTT TTTGCTACATCTTTCGATCCTTCTGCAATAACTTCGTATAATGTATGCTA TACGAAGTTATCCGCGGGGGCCCTGGTGCTAAGTCCATCACTTCCACATT GCTGCCTGTCTGTTAGCTTTAATTCACAGTCACTACTCTTCTGATCTTGT

    [0126] Step 5: embryo injection and transplantation

    [0127] The synthetic OligossDNA, the Cas9 protein, the Gsdma-5 S, and the Gsdma-3 SsgRNA were mixed, and the mixed injection sample was provided to the injection personnel for carrying out embryo injection and transplantation.

    [0128] Step 6: the mice born after transplantation were marked as F0, and sexually mature positive F0 with correct genotype identification was bred. The offspring mice were marked as F1, and the F1 mice were subjected to genotype identification. Positive F1 mice can be used as animal models for studying the Gsdma gene.

    [0129] The identification result found that the PCR positive rate of the F0 mice obtained by the Gsdma-Oligo single-stranded vector and the Cas9 technology was 8.20% (5/61).

    [0130] Genotype identification of F0 mice:

    [0131] The PCR system of F0 is as follows:

    TABLE-US-00034 Reagent Volume (μl) Specification 10x Buffer 2.5 \ ddH.sub.2O 16.75 \ PrimerF 1 10 μM PrimerR 1 10 μM Mg2+ 2 25 mM dNTPs 0.5 10 mM each Taq 0.25 5 U/μl Template 1 ≈100 ng/μl

    [0132] The PCR primers of F0 are as follows:

    TABLE-US-00035 Primer Primer Stripe descrip- No. name Primer sequence size tion 1 2103Oligo- TCCAGCCCTTGACTTGAATC Positive: Identi- 5-loxp-TF (SEQ ID NO. 57) 275 bp fication 2103Oligo- TCAGAACTGGGCAGATTCCC Wt:  of 5-  5-loxp-TR (SEQ ID NO. 58) 229 bp end  Loxp 2 2103Oligo- CAATCCAGGTATTTCAGAGG Positive: Identi- 3-loxp-TF (SEQ ID NO. 59) 440 bp fication 2103Oligo- GTGGGAAAATGTGTCGTGCA Wt:  of 3-  3-loxp-TR (SEQ ID NO. 60) 394 bp end Loxp

    [0133] The PCR procedure of F0 is as follows:

    TABLE-US-00036 Seg. Temp. Time Cycle ±Temp/cycle 1 95° C. 5 min 2 95° C. 30 s 3 65° C. 30 s −0.5 4 72° C. 30 s 2-4, 20x 5 95° C. 30 s 6 55° C. 30 s 7 72° C. 30 s 5-7, 20x 8 72° C. 5 min 9 10° C. hold

    [0134] The electrophoresis result of F0 genotype identification is as shown in FIG. 10. Among 61 mice, 5 mice were identified as positive by PCR.

    [0135] Genotype identification of F1 mice:

    [0136] The PCR system of F1 is as follows:

    TABLE-US-00037 Reagent Volume (μl) Specification 10x Buffer 2.5 \ ddH.sub.2O 16.75 \ PrimerF 1 10 μM PrimerR 1 10 μM Mg2+ 2 25 mM dNTPs 0.5 10 mM each Taq 0.25 5 U/μl Template 1 ≈100 ng/μl

    [0137] The PCR primers of F1 are as follows:

    TABLE-US-00038 Primer Primer Stripe descrip- No. name Primer sequence size tion 1 2103Oligo- TCCAGCCCTTGACTTGAATC Positive: Identi- 5-loxp-TF (SEQ ID NO. 61) 275 bp fication 2103Oligo- TCAGAACTGGGCAGATTCCC Wt:  of 5-end 5-loxp-TR (SEQ ID NO. 62) 229 bp Loxp 2 21030ligo- CAATCCAGGTATTTCAGAGG Positive: Identi- 3-loxp-TF (SEQ ID NO. 63) 440 bp fication 2103Oligo- GTGGGAAAATGTGTCGTGCA Wt:  of 3-end 3-loxp-TR (SEQ ID NO. 64) 394 bp Loxp

    [0138] The PCR procedure of F1 is as follows:

    TABLE-US-00039 Seg. Temp. Time Cycle ±Temp/cycle 1 95° C. 5 min 2 95° C. 30 s 3 65° C. 30 s −0.5 4 72° C. 30 s 2-4, 20x 5 95° C. 30 s 6 55° C. 30 s 7 72° C. 30 s 5-7, 20x 8 72° C. 5 min 9 10° C. hold

    [0139] The electrophoresis result of genotype identification of F1 mice is as shown in FIG. 11.

    [0140] The genotype identification result shows that 140#, 141#, 144#, 145#, 150-152#, and 155# were positive F1 mice with Loxp at both ends targeted.