Preparation of L-amino Acid Deaminase Mutant and Application Thereof

20210309974 · 2021-10-07

    Inventors

    Cpc classification

    International classification

    Abstract

    The disclosure discloses preparation of an L-amino acid deaminase mutant and application thereof, belonging to the technical field of gene engineering. Through pmirLAAD protein modification, analysis of a flexible loop structure around a binding site of the pmirLAAD product, and design of the best mutant, the modification method of the disclosure overcomes the defect that the catalytic efficiency of the previous wild-type enzyme is reduced due to product inhibition, and is tested by experiments. Compared with the control, the catalytic efficiency (1.61 mM.sup.−.Math.min.sup.−1) and the product inhibition constant (5.4 mM) of the finally obtained best mutant pmirLAAD.sup.M4 are respectively increased by 5.2 times and 5.7 times. The yield of α-ketoisovaleric acid can reach 96.5 g/L, and the transformation rate is greater than 97%. By adopting the method of the disclosure, the cost can be greatly reduced, and the industrialization process of production of α-ketoisovaleric acid by an enzymatic transformation method is accelerated.

    Claims

    1. An L-amino acid deaminase mutant, comprising the amino acid sequence having all of SEQ ID NO: 1 except for a mutation in one or more of amino acids at position 98, position 105, position 106 or position 341.

    2. The L-amino acid deaminase mutant according to claim 1, wherein the mutation is any of the following (a)-(g): (a) serine at position 98 of the L-amino acid deaminase is mutated to alanine; (b) threonine at position 105 of the L-amino acid deaminase is mutated to alanine; (c) serine at position 106 of the L-amino acid deaminase is mutated to alanine; (d) leucine at position 341 of the L-amino acid deaminase is mutated to alanine; (e) serine at position 98 and threonine at position 105 of the L-amino acid deaminase are mutated to alanine; (f) position 98, position 105 and position 106 of the L-amino acid deaminase are mutated to obtain the L-amino acid deaminase mutant with the amino acid sequence as shown in SEQ ID NO: 13; and (g) position 98, position 105, position 106 and position 341 of the L-amino acid deaminase are mutated to obtain the L-amino acid deaminase mutant with the amino acid sequence as shown in SEQ ID NO: 15.

    3. A recombinant bacterium, expressing the L-amino acid deaminase mutant of claim 1.

    4. The recombinant bacterium according to claim 3, wherein a host is Bacillus subtilis or Escherichia coli.

    5. A method of use of the recombinant bacterium according to claim 3 for producing α-ketoisovaleric acid, comprising obtaining a culture of the recombinant bacterium and catalyzing L-valine to obtain the α-ketoisovaleric acid.

    6. The method according to claim 5, comprising adding the recombinant bacterium to a transformation system containing 100-200 g/L L-valine, and a reaction is performed under conditions of the ventilation volume of 1-5 vvm for 22-26 h.

    7. The method according to claim 6, wherein the final concentration of the recombinant bacterium in the transformation system is 10-30 g/L.

    8. The method according to claim 7, wherein reaction conditions of the transformation system are 20-40° C. and pH 7.5-9.5.

    Description

    BRIEF DESCRIPTION OF FIGURES

    [0034] FIG. 1 is a graph showing the relation between the whole-cell catalyst concentration and the α-ketoisovaleric acid yield.

    DETAILED DESCRIPTION

    [0035] Gene source: a gene of a biological enzyme pmirLAAD involved in the disclosure is derived from Proteus mirabilis, pET28a(+) plasmids are purchased from Novagen (Madison, Wis., U.S.A.), and restriction endonuclease, T4 DNA ligase, primeSTAR and the like are purchased from TaKaRa (Dalian, China).Standard samples are purchased from SIGMA. pmirLAAD mutants are all obtained by molecular modification, and the rest reagents are all purchased from the market.

    [0036] LB medium: 10 g of peptone, 5 g of yeast powder, 10 g of sodium chloride, and distilled water to a volume of 1 L.

    [0037] Fermentation medium: (TB medium): 12 g of peptone, 24 g of yeast extract, 4 mL of glycerol, 2.31 g of potassium dihydrogen phosphate, 16.42 g of dipotassium hydrogen phosphate, and distilled water to a volume of 1 L.

    [0038] Preparation of sample for determining α-ketoisovaleric acid content by HPLC: 1 mL of a transformed transformation solution is centrifuged at 12000 rpm for 5 min, the supernatant is diluted and filtered through a 0.45 μm filtration membrane, and the filtrate is for liquid chromatography.

    [0039] Determination of α-ketoisovaleric acid content by HPLC: a waters high performance liquid chromatograph (equipped with a UV-visible detector) and a Bio-Rad Aminex HPX-87H (300×7.8 mm, 9 μm) chromatographic column are used, and the mobile phase is dilute sulfuric acid with the concentration of 2.5 mmol/L. The mobile phase is filtered through a 0.22 μm filtration membrane; the filtrate is subjected to ultrasonic degassing; and detection is performed at the flow rate of 0.6 mL/min, the column temperature of 35° C. and the ultraviolet detection wavelength of 210 nm.

    EXAMPLE 1: CONSTRUCTION AND SCREENING OF SINGLE MUTANTS

    [0040] (1) Construction of mutants: primers for mutant sites at position 98, position 105, position 106 and position 341 were designed, as shown in Table 1. The primers were constructed by full plasmid PCR.

    TABLE-US-00001 TABLE 1 Sequences of mutation primers Primer Sequence (5′-3′) S98-S GGCCGTGCATACNNKCAAATTATTAGT SEQ ID NO: 17 S98-A ACTAATAATTTGMNNGTATGCACGGCC SEQ ID NO: 18 T105-S ATTAGTTACCAANNKTCGCCAGAAATC SEQ ID NO: 19 T105-A GATTTCTGGCGAMNNTTGGTAACTAAT SEQ ID NO: 20 S106-S AGTTACCAAACANNKCCAGAAATCTTC SEQ ID NO: 21 S106-A GAAGATTTCTGGMNNTGTTTGGTAACT SEQ ID NO: 22 L341-S GGTGGCGGAGAGNNKCCGTTGGAATTC SEQ ID NO: 23 L341-A GAATTCCAACGGMNNCTCTCCGCCACC SEQ ID NO: 24

    [0041] Construction of reaction PCR amplification system: PrimSTAR enzyme 0.5 μL, 5× PrimeSTAR Buffer 10 μL, dNTP 4 μL, two primers for each mutation site 1 μL each, template (nucleotide sequence of pmirLAAD) 4 μL, and water 32.5 μL. Reaction conditions: (1) 94° C. for 3 min; (2) 98° C. for 10 s; (3) 55° C. for 30 s; (4) 72° C. for 3 min; (5) 29 cycles of steps (2)-(4); (6) 72° C. for 5 min; (7) holding at 12° C.

    [0042] The above reaction system was incubated at 37° C. for 3 h to digest the plasmid template (the digestion system was: Dpnl 0.5 μL, the above reaction PCR product 45 μL, and 10×T Buffer 5 μL). After the completion of the digestion, the obtained digestion product was introduced into E. coli BL21 competent cells by a chemical transformation method. The chemical transformation method included the following specific steps:

    [0043] 1) 10 μl of a homologous recombination product was introduced into 100 μl of BL21 competent cells.

    [0044] 2) An ice bath was applied for 15-30 min.

    [0045] 3) A 42° C. water bath was applied for heat shock for 90 s, and the mixture was quickly placed in ice and allowed to stand in an ice bath for 3-5 min.

    [0046] 4) 800 μl of a non-resistant LB medium was added, and the mixture was uniformly mixed and cultured at 37° C. at 200 rpm for 1 h.

    [0047] 5) The mixture was centrifuged at 5000 rpm for 2 min to collect the bacterium.

    [0048] 6) The supernatant was removed, and the remaining 100-200 μL of solution was uniformly mixed by blowing-suction, coated on a resistant plate containing 0.05 mg/mL kanamycin, and cultured at the constant temperature of 37° C. for about 12 h.

    [0049] 7) A monoclonal antibody was picked and placed in a resistant LB containing 0.05 mg/mL kanamycin. After 12 h of culture at 200 rpm at the constant temperature of 37° C., the product was sent to a company for sequencing. Those that were correctly sequenced are positive transformants (mutant strains). The mutation sites were respectively a mutation of S at position 98 to A, a mutation of T at position 105 to A, a mutation of S at position 106 to A, and a mutation of L at position 341 to A.

    [0050] (2) Shake flask screening of single mutants: The obtained 4 mutant strains and a strain containing wild-type L-amino acid deaminase were respectively inoculated into an LB seed medium, and cultured at 200 rpm at 37° C. for about 10 h. The products were respectively inoculated into a shake flask fermentation medium with the inoculum size of 5% of the medium by volume, and cultured at 200 rpm at 37° C. until OD.sub.600 was about 0.8. IPTG with the final concentration of 0.04 mmol/L was added for induction, and the induction was performed at 200 rpm at 25° C. for 14 h. The product was centrifuged at 6000 rpm for 8 min to collect bacterial cells. The bacterial cells collected by centrifugation were used for later transformation experiments.

    [0051] Transformation conditions: transformation temperature 25° C., reaction pH 8.0, and transformation time 24 h.

    [0052] The yield of α-ketoisovaleric acid of the transformation solution after the completion of the transformation was determined by HPLC. The results are shown in Table 2. Finally, S98A produced α-ketoisovaleric acid at the highest yield.

    TABLE-US-00002 TABLE 2 Results of shake flask screening of single mutants Mutant α-ketoisovaleric acid (g/L) WT 39.8 PmirLAAD.sup.S98A 46.9 PmirLAAD.sup.T105A 44.6 PmirLAAD.sup.S106A 44.9 PmirLAAD.sup.L341A 43.6

    EXAMPLE 2: CONSTRUCTION AND SCREENING OF DOUBLE, TRIPLE AND QUADRUPLE MUTANTS

    [0053] (1) Construction of double mutants: On the basis of the mutant PmirLAAD.sup.S98A, mutation primers T105A-S and T105A-A, S106A-S and S106A-A, as well as L341A-S and L341A-A were used to respectively construct double mutants. On the basis of the mutant PmirLAAD.sup.T105A, mutation primers S106A*-S and S106A*-A, as well as L341A-S and L341A-A were used to respectively construct double mutants. On the basis of the mutant PmirLAAD.sup.S106A, mutation primers L341A-S and L341A-A were used (Table 3). Double mutants were constructed by full plasmid PCR. For the specific implementation manner, reference can be made to step (1) in Example 1. 6 double mutants PmirLAAD.sup.S98A/T105A, PmirLAAD.sup.S98A/S106A, PmirLAAD.sup.S98A/L341A, PmirLAAD.sup.T105A/S106A, PmirLAAD.sup.T105A/L341A and PmirLAAD.sup.S106A/L341A were obtained.

    TABLE-US-00003 TABLE 3 Sequences of mutation primers of double mutants Primer Sequence (5′-3′) T105A-S ATTAGTTACCAAGCCTCGCCAGAAATC SEQ ID NO: 25 T105A-A GATTTCTGGCGAGGCTTGGTAACTAAT SEQ ID NO: 26 S106A-S AGTTACCAAACAGCACCAGAAATCTTC SEQ ID NO: 27 S106A-A GAAGATTTCTGGTGCTGTTTGGTAACT SEQ ID NO: 28 L341A-S GGTGGCGGAGAGGCACCGTTGGAATTC SEQ ID NO: 29 L341A-A GAATTCCAACGGTGCCTCTCCGCCACC SEQ ID NO: 30 S106A*-S AGTTACCAAGCCGCACCAGAAATCTTC SEQ ID NO: 31 S106A*-A GAAGATTTCTGGTGCGGCTTGGTAACT SEQ ID NO: 32

    [0054] (2) Screening of double mutants: For the specific implementation manner, reference can be made to step (3) in Example 3. The results are shown in Table 4. Finally, S98A/T105A produced α-ketoisovaleric acid at the highest yield.

    TABLE-US-00004 TABLE 4 Results of shake flask screening of double mutants Mutant α-ketoisovaleric acid (g/L) PmirLAAD.sup.S98A/T105A 52.6 PmirLAAD.sup.S98A/S106A 50.9 PmirLAAD.sup.S98A/L341A 51.5 PmirLAAD.sup.T105A/S106A 49.4 PmirLAAD.sup.T105A/L341A 47.1 PmirLAAD.sup.S106A/L341A 46.5

    [0055] (3) Construction of triple mutants: On the basis of the mutant PmirLAAD.sup.S98A/T105A, mutation primers S106A*-S and S106A*-A, as well as L341A-S and L341A-A were used to respectively construct triple mutants. On the basis of the mutants PmirLAAD.sup.S98A/S106A and PmirLAAD.sup.T105A/S106A, mutation primers L341A-S and L341A-A were used to respectively construct triplet mutants (Table 4). Triple mutants were constructed by full plasmid PCR. For the specific implementation manner, reference can be made to step (1) in Example 3. Four triple mutants PmirLAAD.sup.S98A/T105A/S106A, PmirLAAD.sup.S98A/T105A/L341A, PmirLAAD.sup.S98A/S106A/L341A and PmirLAAD.sup.T105A/S106A/L341A were obtained.

    [0056] (4) Screening of triple mutants: For the specific implementation manner, reference can be made to step (2) in Example 1. The results are shown in Table 5. Finally, S98A/T105A/S106A produced α-ketoisovaleric acid at the highest yield.

    TABLE-US-00005 TABLE 5 Results of shake flask screening of triple mutants Mutant α-ketoisovaleric acid (g/L) PmirLAAD.sup.S98A/T105A/S106A 60.6 PmirLAAD.sup.S98A/T105A/L341A 56.1 PmirLAAD.sup.S98A/S106A/L341A 53.5 PmirLAAD.sup.T105A/S106A/L341A 59.6

    [0057] (5) Construction of quadruple mutants: On the basis of the mutant PmirLAAD.sup.S98A/T105A/S106A, L341A was mutated: the mutant PmirLAAD.sup.S98A/T105A/S106A was used as a template, mutation primers L341A-S and L341A-A (Table 3) were used to perform full plasmid PCR, and the PCR product was digested. The PCR system and the digestion system were the same as those in Example 3.

    EXAMPLE 3: DETERMINATION OF KINETIC PARAMETERS AND PRODUCT INHIBITION CONSTANTS OF PARENT ENZYME AND MUTANTS

    [0058] In order to evaluate the mutants, kinetic parameters of the mutant parent PmirLAAD.sup.WT and the mutants PmirLAAD.sup.M1, PmirLAAD.sup.M2, PmirLAAD.sup.M3 and PmirLAAD.sup.M4 at 25° C. were determined in the disclosure.

    [0059] k.sub.cat/K.sub.m was calculated based on the initial rate of α-ketoisovaleric acid produced from hydrolyzed L-valine substrates with different concentrations determined at 25° C. Product inhibition of the parent enzyme and the mutants was determined by a product inhibition constant determination experiment in the transformation process. A PmirLAAD.sup.WT parent enzyme strain and mutant strains were respectively added to a reaction solution with the final concentration of wet cells of 10 g/L. 60 mM L-valine was used as the substrate, 10-100 mM α-ketoisovaleric acid was added to the transformation system, the initial reaction rate V.sub.0 was determined after about 30 min of reaction, the maximum reaction rate V.sub.max was determined after about 2 h of reaction, and the product inhibition constant K.sub.PI was calculated according to the following formula:

    [00001] V 0 = V max [ S ] K m ( 1 + [ p ] K PI ) + [ S ]

    [0060] V.sub.0: initial reaction rate, V.sub.max: maximum reaction rate, K.sub.m: Michaelis constant, [S]: substrate concentration, [P]: product concentration, K.sub.PI: product inhibition constant.

    [0061] As shown in Table 6, at 25° C., compared with the parent enzyme, the K.sub.cat/K.sub.m value of all the mutants is increased. The k.sub.cat/K.sub.m value of the mutant PmirLAAD.sup.M4 is increased by 5.2 times, resulting in greater catalytic efficiency of PmirLAAD. Accordingly, compared with the parent enzyme, the product inhibition constant of the mutants each is increased. The product inhibition constant of the mutant PmirLAAD.sup.M4 (hereinafter referred to as M4 strain) is increased by 5.7 times.

    TABLE-US-00006 TABLE 6 Kinetic parameters of PmirLAAD parent enzyme and mutants thereof k.sub.cat/K.sub.m Times of Times of Mutant (mM.sup.−1 .Math. min.sup.−1) change K.sub.PI (mM) change PmirLAAD.sup.WT 0.26 1 0.8 ± 0.6 1 PmirLAAD.sup.M1 0.75 2.9 2.08 ± 0.9  2.6 (PmirLAAD.sup.S98A) PmirLAAD.sup.M2 0.98 3.8 3.12 ± 0.4  3.9 (PmirLAAD.sup.S98A/T105A) PmirLAAD.sup.M3 1.25 4.8 3.7 ± 0.3 4.6 (PmirLAAD.sup.S98A/T105A/S106A) PmirLAAD.sup.M4 1.61 6.2 5.4 ± 0.2 6.7 (PmirLAAD.sup.S98A/T105A/S106A/L341A)

    EXAMPLE 4:PRODUCTION OF α-KETOISOVALERIC ACID FROM L-VALINE BY 1 L SYSTEM LEVEL OPTIMIZATION

    [0062] The correctly sequenced mutant M4 strain on the plate was inoculated into a resistant LB containing 0.05 mg/mL kanamycin, and cultured at 200 rpm at 37° C. for 10-12 h. The product was inoculated into a TB medium with the inoculum size of the volume ratio of 5%, and cultured at 200 rpm at 37° C. until OD.sub.600 was 3. IPTG with the final concentration of 0.04 mmol/L was added for induction, and the induction was performed at 25° C. for 14 h. The product was centrifuged at 6,000×g for 8 min to collect cells. The cells were placed in a −40° C. refrigerator for transformation.

    (1) Influences of Different Whole-Cell Catalyst Concentrations on α-Ketoisovaleric Acid Concentration

    [0063] Preparation of transformation reaction system in fermentor: L-valine was dissolved in a certain amount of Tris-HCl buffer, the L-valine solution was poured into a fermentor (such that the final concentration of the L-valine in the reaction system was 160 g/L), the temperature was adjusted to 25° C., and the rotation speed was 300 rpm. 10 g, 15 g, 20 g, 25 g and 30 g of mutant wet bacterial cells (that is, whole-cell catalyst) were also dissolved uniformly in a buffer. After the temperature of the transformation solution increased to 25° C., the dissolved bacterial solution was poured into the fermentor (the whole-cell catalyst concentrations were respectively 10 g/L, 15 g/L, 20 g/L, 25 g/L and 30 g/L).

    [0064] A transformation reaction was performed under conditions of 25° C., 600 rpm and the ventilation volume of 1 vvm, and the total volume after the transformation reaction was 1 L.

    [0065] After the completion of the transformation reaction, a part of the transformation solution was centrifuged at 12,000×g for 15 min, the supernatant was filtered through a 0.22 μm microfiltration membrane, and the filtrate was analyzed by HPLC. The results are shown in FIG. 1. When the catalyst concentration was increased from 10 g/L to 30 g/L, the α-ketoisovaleric acid concentration was increased from 76.7 g/L to 154.3 g/L. However, the product/catalyst ratio was decreased from 7.6 g/g to 5.1 g/g. Considering the industrial demands for high yield and low catalyst (bacterial cell) consumption, the whole-cell catalyst concentration of 10 g/L had higher α-ketoisovaleric acid concentration and high product/catalyst ratio (that is, the capacity for producing α-ketoisovaleric acid per unit of bacterial cells) of 7.6 g/g at the same time, and was used for transformation experiments.

    (2) Influences of Different Transformation Reaction pH Values on α-Ketoisovaleric Acid Concentration

    [0066] The specific steps were the same as those in (1). The whole-cell catalyst concentration was controlled at 10 g/L, the L-valine concentration was controlled at 100 g/L, the ventilation volume was 1 vvm, and the pH in the transformation reaction process was respectively controlled at 7.5, 8.0, 8.5, 9.0 and 9.5. The results are shown in Table 7. A weak acid or weak alkaline pH was more suitable for synthesis of α-ketoisovaleric acid, and therefore, the transformation pH was controlled at 8.5-9.0. At this time, the α-ketoisovaleric acid concentration was 78.9 g/L

    TABLE-US-00007 TABLE 7 Optimization results of transformation pH pH 7.5 8.0 8.5 9.0 9.5 A-ketoisovaleric acid 61.7 67.1 78.9 74.3 70.4 (g/L)

    (3) Influences of Different Transformation Reaction Temperature on α-Ketoisovaleric Acid Concentration

    [0067] The specific steps were the same as those in (1). The transformation pH was controlled at 8.5, the whole-cell catalyst concentration was controlled at 10 g/L, the ventilation volume was 1 vvm, and the temperature in the transformation reaction process was respectively controlled at 20° C., 25° C., 30° C., 35° C. and 40° C. The results are shown in Table 8. The temperature of 30° C. was more suitable for synthesis of α-ketoisovaleric acid, and therefore, the transformation temperature was controlled at about 30° C. At this time, the α-ketoisovaleric acid concentration was 78.9 g/L.

    TABLE-US-00008 TABLE 8 Optimization results of transformation temperature Temperature ° C. 20 25 30 35 40 A-ketoisovaleric acid 71.2 79.1 88.9 81.3 76.4 (g/L)

    (4) Influences of Different Transformation Reaction Ventilation Volumes on α-Ketoisovaleric Acid Concentration

    [0068] The specific steps were the same as those in (1). The transformation pH was controlled at 8.5, the whole-cell catalyst concentration was controlled at 10 g/L, the temperature was controlled at 30° C., and the ventilation volume was controlled at 1 vvm, 1.5 vvm, 2 vvm, 2.5 vvm and 3 vvm. The results are shown in Table 9. The ventilation volume of 1.5 vvm was more suitable for synthesis of α-ketoisovaleric acid, and therefore, the ventilation volume was controlled at about 1.5 vvm. At this time, the α-ketoisovaleric acid concentration was 96.5 g/L.

    TABLE-US-00009 TABLE 9 Optimization results of transformation ventilation volume Ventilation volume vvm 1 1.5 2 2.5 3 A-ketoisovaleric acid 88.9 96.5 87.4 80.3 75.2 (g/L)

    Comparative Example 1

    [0069] For the specific implementation manner, reference can be made to Example 4. The difference is that the mutant M4 strain was replaced the wild type WT strain for fermentation and transformation experiments. After the completion of the transformation, a part of the transformation solution was centrifuged at 12,000×g for 15 min, the supernatant was filtered through a 0.22 μm microfiltration membrane, and the filtrate was analyzed by HPLC. HPLC chromatogram results showed that the yield of α-ketoisovaleric acid was 40 g/L, and the transformation rate was 40.3%.

    [0070] Although the disclosure has been disclosed as above in the preferred examples, it is not intended to limit the disclosure. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the disclosure. Therefore, the protection scope of the disclosure should be as defined in the claims.