HUMAN UTERINE CERVICAL STEM CELL POPULATION AND USES THEREOF

20210299184 · 2021-09-30

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to a method for isolating stem cells comprising preparing a cell suspension from uterine cervix tissue, to the stem cells isolated by said method, and to the conditioned medium obtained from the culture of said stem cells. The invention also encompasses the use of said stem cells or conditioned medium for treating or preventing cancer, precancerous lesions, inflammatory diseases, autoimmune diseases, chronic pathologies or infectious diseases, diseases associated to tissue loss, or for use in diagnostic, prognostic or treatment of fertility disorders, as well as for cosmetic treatment.

    Claims

    1. A method for the treatment or prevention one or more symptoms associated with disorders in which modulation of a subject's immune system is beneficial, wherein the disorders are selected from: cancer, precancerous lesions, inflammatory diseases, autoimmune diseases, chronic pathologies, infectious diseases or diseases associated to tissue loss comprising the administration to a patient in need thereof a therapeutically effective amount of an isolated non-menstrual uterine cervix mesenchymal stem cell, a cell population comprising the isolated stem cell or a conditioned medium obtained from the culture of said cell, wherein the isolated non-menstrual uterine cervix mesenchymal stem cell (a) expresses the cell markers CD29, CD44, CD73, CD90, CD105, vimentin, cytokeratin(CKAE1AE3), Klf4, Oct4 and Sox-2; (b) does not express CD34, CD117, p63 and at least one cell marker selected from the group consisting of desmin, actin HHF35, β-catenin, E-cadherin, CD133, HLA-DR, TRA1-81,CD45and CD31.

    2. The method according claim 1 wherein the isolated non-menstrual uterine cervix mesenchymal stem cell further shows: (c) a proliferating rate of from 0.4 to 2.1 doublings per 24 hours in growth medium; (d) capacity to grow in monolayer and to adhere to a substrate; and (e) a non tumorigenic capacity.

    3. The method according claim 1 wherein the isolated non-menstrual uterine cervix mesenchymal stem cell further shows (f) a fibroblast-like morphology, (g) a stable karyotype for at least 10, preferably, 20 cell passages, (h) capacity to be differentiated into an adipogenic, osteogenic, neural or myocytic cell linage, and/or(i) capacity to form spheres.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0124] FIG. 1: Uterine cervical stem cells show immune phenotype of adult mesenchymal stem cells. A. Cells obtained from cervical smear and cultured during 90 days were immnunolabeled with specific antibodies and then evaluated for protein expression. Desmin, actin HHF35, smooth muscle actin, p63, and E-cadherin expression was not detected, while CKAE1AE3 was focally expressed, and vimentin show strong expression. B. Specific stem cell markers such as klf4, oct4, and sox2 showed strong immunolabelling in uterine cervical stem cells. C. Flow cytometry analyses of human uterine cervical stem cells (hUCESCs) indicate high percentage of CD29, CD44, CD73, CD90 and CD105 proteins, but negative expression of CD31, CD34, CD45, CD117, CD133, HLA-DR, and Tra1-81 proteins. D. Isolated hUCESCs form spheroids when are cultured in specific medium.

    [0125] FIG. 2: Growth rate of hUCESCs. Growth of hUCESCs expressed as number of cells after seeding 2,000 cells/well.

    [0126] FIG. 3: Immunogenicity assay. The figure displays a representative MLR from two donors. The proliferation of PBMCs was determined in the absence of stimulator cells, in the presence of autologous mitomycin C treated PBMCs (negative control), in the presence of allogeneic mitomycin C treated PBMCs (positive control), in the presence of mitomycin C treated hUCESCs, and Con A stimulated PBMCs (positive control). The stimulator cells were tested at density of 2×10.sup.4 per well. One-way MLR assays were performed to assess the immunogenicity of hUCESCs. The proliferation of PBMCs was measured based on the increased number of metabolically active living cells in the presence of mitomycin C treated stimulator cells. Autologous and allogeneic PBMCs served as negative and positive stimulator cell controls, respectively. Con A stimulated PBMCs served as another positive stimulation control cells. hUCESCs did not induce T cell proliferation in MLR assays.

    [0127] FIG. 4: Inhibition of monocytic differentiation with stimulation in presence of hUCESCs conditioned medium. A) The viability of the U937 cells is higher than 80%. B) Effect of hUCESCs and ASCs conditioned medium on the expression of a macrophage differentiation marker. Basal level of U937 CD11b expression is 34%. Compared with the PMA treated control U937 cells, the percentage of cells stained positive for CD11b decreased from 73% in PMA treated U937 cells to 48% in hUCESCs conditioned medium treated U937 cells.

    [0128] The percentage of CD11b expression for U937 cells treated with ASCs conditioned medium is 67%.

    [0129] FIG. 5: Inhibition of monocytic differentiation: stimulation during 24 h and addition of hUCESCs conditioned medium. A) The viability of the U937 cells is higher than 80%. B) Basal level of U937 CD11b expression is 38%. Compared with the PMA treated control U937 cells, the percentage of cells stained positive for CD11b decreased from 82% in PMA treated U937 cells to 48% in U937 cell treated with hUCESCs conditioned medium produced during 24 hours (CM 24 hours) and to 34% in U937 cell treated with conditioned medium produced during 48 hours (CM 48 hours). Nevertheless the CD11b expression in ASCs CM 48 hours treated U937 cells is 77%.

    [0130] FIG. 6: Inhibition of PBMCs proliferation with conditioned medium. Both conditioned medium, 24 hours and 48 hours, suppressed PBMCs proliferation. The suppression is more effective with hUCESCs conditioned medium than ASCs conditioned medium. The magnitude of suppression by hUCESCs conditioned medium exceeded that of dexamethasone.

    [0131] FIG. 7: Conditioned medium from hUCESCs reduces cell proliferation in HT29, AGS and MDA-MB-231 cells but not in the MCF-7 cell line. A. Cell proliferation assay of colorectal (HT29) and gastric (AGS) adenocarcinoma cell line treated during 48 hours with complete medium (control), incomplete medium (w/o FBS), conditioned medium from hUCESCs produced during 24 hours or 48 hours and conditioned medium from ASC produced during 48 h. B-C. MTT assay of MCF-7 cells treated during 24 or 48 hours with complete medium (+FBS), incomplete medium (−FBS), conditioned medium from MCF-7 cells produced during 24 or 48 hours, or conditioned medium from hUCESCs produced during 24 or 48 hours. D-E. MTT assay of MDA-MB-231 cells treated during 24 or 48 hours with complete medium (+FBS), incomplete medium (−FBS), conditioned medium from MDA-MB-231 cells produced during 24 or 48 hours, or conditioned medium from hUCESCs produced during 24 or 48 hours. F. MCF-7 cells (1×10.sup.5) were labeled with CellTracker Green dye and plated in 6-well plates. Four hours later, 1×10.sup.5 hUCESCs labeled with CellTracker Red dye were added to MCF-7 cells and co-cultured in incomplete medium (without FBS) during 72 hours. Images were taken at 12, 48 and 72 hours. Last line show an example of MCF-7 cells growth in incomplete medium (−FBS), which was used as control of growth. G. MDA-MB-231 cells were labeled and co-cultured with hUCESCs as described in (F) for MCF-7 cells.

    [0132] FIG. 8: Administration of conditioned medium (CM) from hUCESCs to MDA-MB-231 cells delay cell cycle and increase apoptosis. A. MDA-MB-231 cells were treated during 48 hours with DMEM plus 10% FBS (+FBS), incomplete medium (DMEM without FBS, −FBS), or CM of 48 hours from hUCESCs, and then subject to flow cytometry using propidium iodide (PI). Percentage of cells (mean±standard deviation) in each phase is showed. B. Western blot of cyclin A, cyclin B, cyclin E, cyclin D1, and GAPDH (used as loading control) of protein extracts from MDA-MB-231 cells treated during 48 hours as described in (A). C. Apoptosis was determined in MDA-MB-231 cells cultured during 48 hours with complete (+FBS), incomplete (−FBS), or CM from hUCESCs by flow cytometry using Annexin V/Pl. Annexin V+/PI− and Annexin V+/PI+ indicates early and late apoptosis, respectively. D. Western blot of Caspase 8, -12, -9, activated caspase 3, and cleaved PARP of MDA-MB-231 protein extracts as indicated in (C). E. Western blots of the anti-apoptotic Bid, cleaved Bid, and Bim proteins in MDA-MB-231 extracts treated as in (C). GAPDH was used as loading control.

    [0133] FIG. 9: Conditioned media (CM) from hUCESCs inhibits invasion, 3D growth, and tumour volume in a xenograft mice model. A. CM of 48 hours from hUCESCs significantly decreased MDA-MB-231 cells invasion through a matrigel matrix, as compared with cells with incomplete medium (−FBS, control). B. Administration of CM from 48 hours of hUCESCs culture during 9 days significantly reduces 3D growth of MDA-MB-231 cells, as compared with cells treated with complete (+FBS) or incomplete (−FBS) medium. C. Thirteen SCID mice were injected with MDA-MB-231-luc cells in the mammary fad pat. Fifteen days later, seven mice were intratumourally injected every five days with 150 μl of conditioned medium (CM) from hUCESCs (CM-treated) and six mice injected with incomplete medium (−FBS, controls). Representative images from controls and CM-treated mice were taken at 15, 20, 25, and 30 days. D. Tumour volume was determined by measuring luminescence. Values are expressed as mean±standard deviation of relative luminescence levels. **: P=0.011 vs. controls. E. Immunohistochemical detection of activated caspase-3 expression in representative tumours of SCID mice treated with CM and placebo, as described in (C). F. Kaplan-Meier plots of overall survival in CM-treated mice vs. control mice. Mice treated with CM had a long DFS compared with control mice. The difference was statistically significant (P=0.019).

    [0134] FIG. 10: Cell proliferation in primary cultures from breast tumours with high proliferating rate is significantly reduced after administration of conditioned media (CM) from hUCESCs. A. Ten primary cultures from human breast tumours were treated with: a) complete medium (+FBS), b) incomplete medium (−FBS), c) conditioned medium (CM) produced during 48 hours by the own cells, d) CM produced during 48 hours by adipose-derived stromal cells (ASCs), and e) CM produced during 48 hours by hUCESCs. After 48 hours of culture, an MTT assay was carried out to evaluate cell proliferation. Cultures with high proliferation rate (11B512, 11B3285, 11B3171, and 11B7352, in red) showed a significant (***: P<0.001) decrease in proliferation after treatment with CM from hUCESCs, as compared with others treatments. B. Protein extracts from primary cultures with high proliferation rate treated with CM from hUCESCs or with incomplete medium (−FBS) were incubated with cyclin D1, cleaved PARP, and GAPDH (used as loading control) antibodies and assayed for Western blot.

    [0135] FIG. 11: Representative example of growth inhibition of pathogenic microorganism by hUCESCs conditioned medium in 96 microwell plates. A. Control media (M) showed E. coli growth, and hUCESCs conditioned medium (1) showed an inhibition of bacterial growth up to well 4 ( 1/20 dilution). Adipose tissue-derived MSC conditioned medium bacterial growth in all wells. B. Table of volumes added in wells for each condition. Circles indicate wells showing bacterial growth inhibition.

    [0136] FIG. 12: Representative example of growth inhibition of microorganism by hUCESCs. Significative (p<0.001) inhibition of microorganism growth by hUCEScs, analyzed by CFU counting and OD. Medium alone and normal human fibroblast (NHF) show no inhibition of E. coli growth.

    [0137] FIG. 13: Representative example of growth inhibition of microorganism by hUCESCs conditioned medium. Significative (p<0.001) inhibition of microorganism growth by hUCEScs conditioned medium (CM), analyzed by CFU counting and OD. Medium alone and normal human fibroblast conditioned medium (CM NHF) show no inhibition of E. coli growth.

    [0138] FIG. 14: Model of dry eye in rat. A. Photograph showing the extraorbital lacrimal gland before excision. B. An Adapted schirmer test was used to measure tear production. C. Schirmer's Test showing results in normal eye (NE) and dry eye (DE) 7 days after extraorbital lacrimal gland excision in the dry eye.

    [0139] FIG. 15: ‘In vivo’ epithelial regeneration. A. Representative images of fluorescein staining of the cornea just after the alkali burn (T0h), 15 hours after (T15h) and 5 days after (T5d). B. Statistical analysis of the percent of ephithelial corneal regeneration 15 hours after the alkali burn (*p<0.005). C. Statistical analysis of the percent of ephithelial corneal regeneration 5 days after the alkali burn (*p=0.005). Treatments used were the conditioned medium (CM), Medium alone, without any previous contact with cells (M), Oftalmic drops with sodium hyaluronate (SH) and no treatment (NoTreat).

    [0140] FIG. 16: Histology. Representative images of hematoxylin eosin staining of 20 μ slides from corneas treated with conditioned medium (CM), Medium alone, without any previous contact with cells (M), Oftalmic drops with sodium hyaluronate (SH) and no treatment (NoTreat) 5 days after the alkali burn (Magnification, ×10).

    [0141] FIG. 17: Anti-inflammatory effects. A-C. Statistical analysis of real-time PCR results of MCP-1 (A), MIP-1α (B) and TNF-α (C) of corneas 5 days after the alkali burn. Conditions analyzed were corneas treated with conditioned medium (CM); corneas treated with medium alone without any previous contact with cells (M); corneas treated with Oftalmic drops with sodium hyaluronate (SH), corneas from dry eyes but without any lesion (NoUlc) and corneas from healthy eyes without any lesion (Normal).

    [0142] FIG. 18 and FIG. 19 are schematic figures of the female reproductive system.

    EXAMPLES

    Example 1

    Isolation and Characterization of Human Uterine Cervical Stem cells

    [0143] I—Material and Methods

    [0144] Isolation and Growth of Human Uterine Cervical Stem Cells

    [0145] Human uterine cervical stem cells (hUCESCs) were obtained from an exfoliation of the uterine cervix during routine gynaecological examination. Briefly, cytological sample was enzymatically disaggregated with trypsin, collagenase or other enzyme which can disaggregate the cervical mucus. Then, the sample was centrifuged 5 minutes at 400 g and the pellet was collected and seeded in a culture plate. The well can be previously coated with 1% gelatin or fibronectin or other substrate to allow the adherence. Sample was culture in Dulbecco's Modified Eagle Medium: Nutrient Mixture F-12 (DMEM-F12), glutamine, with or without antibiotics, with serum, epidermal growth factor (EGF), hydrocortisone, insulin, non-essential amino acids, sodium pyruvate. The subculture of cells was carried out with trypsin or accutase or other proteolytic and/or collagenolytic enzymes.

    [0146] Flow Cytometry Characterization

    [0147] Human uterine cervical stem cells (hUCESCs) were stained with a panel of specific monoclonal antibodies: CD29-PE, CD45-FITC, CD90-PE, CD105-PE, HLA-DR-PE (Beckman Coulter), CD44-PE, CD73-PE, CD31-PE, TRA1-81-FITC (Becton Dickinson, Biosciences Pharmingen), CD34-FITC, CD117-PE and CD133-PE (Miltenyi Biotec). 7-amino-actinomycin-D (7-AAD) (BD Pharmingen) was added for dead cell discrimination. Immunophenotyping was performed on the same cells aliquoted equally into different tubes. Stained cells were re-suspended in PBS and analysed using Cytomics FC500 flow cytometer (Beckman Coulter). The computed data were analysed using CXP software provided by the manufacturer.

    [0148] Immunocytochemistry Characterization

    [0149] Human uterine cervical stem cells cells (hUCESCs) were cultured as above described. 3×10.sup.4 cells were seeded in slides, and fixed for 10 minutes in 96% ethanol, before processing for immunocytochemistry. Mouse tumours were immersion-fixed in 10% neutral buffered formalin for 24 hours and embedded in paraffin routinely.

    [0150] Sections 4 μm thick were mounted on Flex IHC microscope slides (Dako, Glostrup, Denmark). The immunohistochemical (IHC) techniques were automatically performed in an AutostainerLink 48 (Dako). FLEX ready-to-use Dako primary antibodies to CK (clone AE1/AE3), E-cadherin (clone NCH-38), vimentin (clone V9), desmin (clone D33), actin (clone HHF35), smooth muscle actin (clone 1A4), and β-catenin (clone beta-catenin-1) were employed. A ready to use monoclonal antibody to p63 (clone 4A4) from Abcam (Cambridge, UK) was also used. KLF4, OCT4, and Sox2 primary antibodies were obtained from Santa Cruz Biotechnology, Millipore, and Sigma-Aldrich, respectively. Epitope retrieval was performed in a microwave 20 minutes using EnVision FLEX target retrieval solution (pH 9). All antibodies were incubated for 20 minutes at RT except p63 which was incubated for 30 minutes. As detection system we used EnVision FLEX/HRP Dako (dextran polymer conjugated with horseradish peroxidase and affinity-isolated goat anti-mouse and anti-rabbit immunoglobulins) for 20 minutes. For E-cadherin a mouse linker (Dako) was added.

    [0151] Growth Rate

    [0152] The rate of proliferation of hUCESCs was determined by counting the total number of cells in duplicate wells every day for 12 days. Initially, cells were seeded at 2,000 cells/well in a 6-well plate culture.

    [0153] Spheroid Formation and Adipose Differentiation

    [0154] hUCESCs were cultured in DMEM/F12 medium (vol/vol) (Invitrogen), 1% B27 (Invitrogen), 10 ng/mL epidermal growth factor (EGF) and 5 ng/mL fibroblast growth factor 2 (FGF-2), 100 IU/mL penicillin, and 100 μg/mL streptomycin in a 60 mm dish, and 5-7 days after spheroids were photographed. To induce adipose differentiation hUCESCs were cultured in hMSC Differentiation Bulletkit-Adipogenic medium (Lonza Biologics, Walkersville, USA) in 60 mm dish during 12 days, and then formaldehyde fixed for Oil Red O staining (Sigma).

    [0155] Conditioned Medium Production

    [0156] Cells were plated at a density of 3×10.sup.4 cells/cm.sup.2 in DMEM:F12 medium with 10% FBS and antibiotics. After 48 hours, the cells were washed three times with phosphate buffered saline (PBS) and then, cultured in DMEM:F12 without FBS for 24 hours or 48 hours. Then, the medium was collected as conditioned medium (CM), centrifuged 10 minutes at 300 g and used immediately or kept at −20° C.

    [0157] II—Results

    [0158] Human uterine cervical stem cells (hUCESCs) obtained from exfoliation of the uterine cervix were examined for immune phenotype using immunocytochimestry and flow cytometry. As shown in FIG. 1A, hUCESCs are positively immunolabeled with β-catenin, and vimentin antibodies, and some difuse focal cells also are positive to pan-cytokeratin antibody. In addition, hUCESCs have strong expression of three transcription factors characteristic of embryonic stem cells, i.e. OCT4, KLF4, and Sox2 (FIG. 1B). hUCESCs phenotype was also determined by flow cytometry. We found that these cells were positive for CD29, CD44, CD73, and CD90, while they were negative for CD34, CD45, CD133 (hematopoietic markers), CD117, CD31, TRA-1-81 (embryonic stem cell surface marker), and HLA-DR (FIG. 1C).

    [0159] To further evaluate the characteristics of hUCESCs cells, they were induced to form spheroids. After seven days in culture, individual cells were maintained in suspension culture in serum-free conditioned medium. After seven days, the cells formed clonal spheroid structures (FIG. 1D).

    [0160] Also, the rate of proliferation of hUCESCs was determined by counting the total number of cells in duplicate wells every day for 12 days. hUCESCs proliferate at a rate of 0.4-2.1 doublings per 24 hours (FIG. 2).

    Example 2

    Inflammation Related Experiments

    [0161] I—Material and Methods

    [0162] Immunogenicity Assay

    [0163] The one-way mixed lymphocyte reaction (MLR) assay was used to determine the immunogenicity of human uterine cervical stem cells (hUCESCs). The MLR was performed in 96-well microtiter plates using RPMI 1640 medium without FBS. Peripheral blood mononuclear cells (PBMC) derived from two different donors were plated at 2×10.sup.5 cells per donor per well. Different donors were used to maximize the chance that at least one of PBMC was a major mismatch to the hUCESCs test cells. Stimulator cells used in the assay included autologous PBMC (baseline response), allogeneic PBMC (positive-control response), and hUCESCs cell population. Stimulator cells were mitomycin C treated prior to being added to the culture wells (2×10.sup.4 cells per well, 10% stimulators cells). Additional controls cultures consisted of PBMC plated in medium alone (no stimulator cells), concanavalin A (ConA) stimulated PBMC and of hUCESCs mitomycin C treated alone. Triplicate cultures were performed for each treatment. Proliferation was assessed by cell proliferation reagent WST-1 (Roche applied bioscience). Living (metabolically active) cells reduced tetrazolium salts to colored formazan compounds; dead cells do not. Thus, tetrazolium salt-based colorimetric assays detected viable cells exclusively. The absorbance of the samples was measure against a background control as blank using a microtiter plate reader. The wavelength for measuring the absorbance of the formazan product is between 420-480 nm (max. absorption at about 440 nm). The reference wavelength should be more than 600 nm.

    [0164] Inhibition of Monocytic Differentiation

    [0165] U937 cell line was used for this test. Cells were plated in a 24 wells-plate at a density of 1.5×10.sup.5 cells/well in DMEM:F12 with 10% FBS and antibiotics. 2 ng/mL of phorbol 12-myristate 13-acetate (PMA) was added, PMA treatment, which activates protein kinase C, induce a greater degree of differentiation in U937 cells as reflected by increased adherence and expression of surface markers associated with macrophage differentiation. In control wells no PMA solution was added. After 24 hours, medium was changed for conditioned medium from hUCESCs or from human adipose-derived stem cells (ASCs, StemPro®, Invitrogen), in the test wells for another 24 hours. Additional test consisted of stimulated U937 cell line with PMA in presence of conditioned medium. Supernatant was collected and adherent cells were washed, trypsinized and collected in the correspondent tube. Cells were centrifuged 5 min at 200 g and were resuspended in 100 μl of PBS. Differentiation to macrophages was monitored by the expression of monocyte differentiation marker CD11b by flow cytometry analysis. Cells were stained with PE-CD11b monoclonal antibody and with 7-AAD to assess cell viability. The Mac-1 (CD11b) antigen was originally described as a cell surface marker for macrophages. The Mac-1 antigen mediates the attachment and phagocytosis of particles coated with C3bl by granulocytes and macrophages. In addition, Mac-1 appears to mediate a wide variety of adhesion dependent functions, including granulocyte chemotaxis, adherence to surfaces and aggregation.

    [0166] Inhibition of PBMC Proliferation with Conditioned Medium

    [0167] Peripheral blood mononuclear cells (PBMC) from healthy volunteers were isolated from 20 mL heparinized peripheral blood by Histopaque-1077 (Sigma) density gradient centrifugation. Cells recovered from the interface were washed twice with PBS and resuspended in supplemented RPMI 1640. PBMC viability was determined by trypan blue exclusion. Aliquots of the isolated PBMC were frozen and stored at −80° until further use. For experiments, frozen aliquots of the PBMC were randomly chosen from the 8 unrelated donors, thawed and used.

    [0168] For assaying PBMC proliferation, isolated PBMC were cultured (2×10.sup.5 cells/well) for 4 days in 96-well flat-bottomed microtiter plates in DMEM:F12 without FBS, with conditioned medium (from hUCESCs or ASCs) and stimulated with 1 μg/mL concanavalin A (ConA). PBMC alone and ConA stimulated PBMC with 10.sup.−6 M dexamethasone served as basal proliferation control and inhibition control, respectively. Proliferation was assessed by cell proliferation reagent WST-1. This assay detects viable cells exclusively. The absorbance of the samples was measure against a background control as blank using a microtiter plate reader.

    [0169] II—Results

    [0170] One-way MLR assays were performed to assess the immunogenicity of hUCESCs. The proliferation of PBMCs was measured based on the increased number of metabolically active living cells in the presence of mitomycin C treated stimulator cells. Autologous and allogeneic PBMCs served as negative and positive stimulator cell controls, respectively. ConA stimulated PBMCs served as other positive stimulation control cells. As shown in FIG. 3, hUCESCs did not induce T cell proliferation in MLR assays.

    [0171] In addition, differentiation to macrophages was monitored by the expression of monocyte differentiation marker CD11b by flow cytometry analysis. In FIG. 4, it was shown the inhibition of monocytic differentiation with stimulation in presence of hUCESCs conditioned medium. Basal level of U937 CD11b expression was 34% and compared with the PMA treated control U937 cells, the percentage of cells stained positive for CD11b decreased from 73% in PMA treated U937 cells to 48% in hUCESCs conditioned medium treated U937 cells. The percentage of CD11b expression for U937 cells treated with ASCs conditioned medium was 67%. It is worth noting that the viability of the U937 cells, in all conditions, was higher than 80%. These data indicate an inhibition or protection of monocyte differentiation in the presence of hUCESCs conditioned medium. In FIG. 5, it is shown the inhibition of monocytic differentiation: stimulation during 24 hours and addition of hUCESCs conditioned medium. Basal level of U937 CD11b expression was 38% and compared with the PMA treated control U937 cells, the percentage of cells stained positive for CD11b decreased from 82% in PMA treated U937 cells to 48% in U937 cell treated with hUCESCs conditioned medium produced during 24 hours (CM 24 hours), and to 34% in U937 cell treated with conditioned medium produced during 48 hours (CM 48 hours). Nevertheless the CD11b expression in ASCs CM 48 hours treated U937 cells was 77%. It is worth noting that the viability of the U937 cells, in all conditions, was higher than 80%. These data indicate an inhibition of monocyte differentiation in the presence of hUCESCs conditioned medium and in the case of 48 hours conditioned medium the percentage of CD11b positive cells was appreciably the same of U937 basal level.

    [0172] In FIG. 6, it is shown the inhibition of PBMCs proliferation with conditioned medium. Both hUCESCs conditioned media, 24 hours and 48 hours, suppressed PBMCs proliferation. The suppression was more effective with hUCESCs conditioned medium than ASCs conditioned medium. The magnitude of suppression by hUCESCs conditioned medium exceeded that of dexamethasone. Dexamethasone is the more potent anti-inflammatory drug, these data suggest the high anti-inflammatory potential of hUCESCs conditioned medium.

    Example 3

    Cancer Related Experiments

    [0173] I.—Materials and Methods

    [0174] Cell Cultures

    [0175] MCF-7 and MDA-MB-231 cells (human breast adenocarcinoma cell lines) were obtained from the European Collection of Cell Cultures (Salisbury, Wilts., UK) and HT29 (colorectal adenocarcinoma cell line) and AGS (gastric adenocarcinoma cell line) were obtained from the American Type Culture Collection (ATCC, Manassas, Va., USA). These cell lines were grown in 90-mm Petri dishes in DMEM supplemented with 10% FBS, 100 U/mL penicillin and 100 μg/mL streptomycin in an air-CO.sub.2 (95:5) atmosphere at 37° C. Confluent cells were washed twice with phosphate-buffered saline and harvested by a brief incubation with trypsin-EDTA solution (Sigma-Aldrich, St. Louis, Mo., USA) in PBS. Human cervical uterine stem cells (hUCESCs, obtained as above described), primary cultures from human breast tumours, and human adipose-derived stem cells (ASCs, StemPro®, Invitrogen), were grown in 90-mm Petri dishes in DMEM-F12 (1:1) supplemented with 10% FBS, 100 U/mL penicillin, and 100 μg/mL streptomycin in an air-CO2 (95:5) atmosphere at 37° C.

    [0176] Conditioned medium (CM) from hUCESCs, ASCs, MCF-7, and MDA-MB-231 was obtained by culturing the cells to 70% confluence in DMEM-F12 (10% FBS). Then cells were washed three times in PBS, and cultured again in DMEM-F12 without FBS. After 24 or 48 hours, medium was centrifuged for 10 minutes at 300 g, supernatant collected, and used immediately.

    [0177] Three-dimensional cell culture was performed. Briefly, culture slides were coated with 60 μL of ice-cold Matrigel (BD Biosciences) and incubated at 37° C. for 20 minutes to allow the Matrigel to solidify. Cells were treated for 5 minutes with 0.25% trypsin—EDTA solution (2.5 g/L of trypsin, 0.38 g/L of EDTA) (Invitrogen). A single-cell suspension containing 5×10.sup.3 cells per 100 μL volume of medium, supplemented with 2% (vol/vol) of Matrigel, was carefully placed on top of the solidified Matrigel. Incubation was carried out at 37° C. for 30 minutes to allow the cells to attach to the Matrigel. The culture slides were then placed in six-well plates, 500 μL of medium was added per well, and the cells were cultured for 10 days. hUCESCs were then treated with different media (DMEM-F12 with 10% FBS (+FBS), DMEM-F12 without FBS (−FBS), or 48 hours-conditioned medium from hUCESCs) for 1 week. Phase contrast photographs of cells as monolayers, or in three-dimensional cultures, were taken with an Olympus DP72 camera. Quantitation of sphere diameter was performed manually by tracing a straight line across the diameter of the sphere and scoring its value as arbitrary length units.

    [0178] Co-Cultures

    [0179] Cells were cultured as described above. Medium was removed at 70% confluence and cells labeled with pre-warmed CellTracker™ solution (MCF-7 and MDA-MB-231 with CellTracker™ GREEN CMFDA, and hUCESCs with CellTracker™ RED CMPTX; Invitrogen, Eugene, USA) as per the manufacturer's instructions. Then, 1×10.sup.5 MCF-7 or MDA-MB-231 cells/well were plated at in 6-well plates, and four hours later 1×10.sup.5 hUCESCs cells were added to the MCF-7 or MDA-MB-231 cells and co-cultured during 72 hours. Images were randomly photographed at 12, 48 and 72 hours with a high-resolution digital camera (Olympus DP 72; Olympus Corp., Tokyo, Japan). A counting frame (102 μm.sup.2) was superimposed on the captured image, and only clearly visible cells were counted in at least three different fields on the photomicrographs, using the ImageJ software (National Institutes of Health, Bethesda, Md., USA).

    [0180] Colorectal and Gastric Adenocarcinoma Cell Line Proliferation

    [0181] HT29 and AGS proliferation was assessed using cell proliferation reagent WST-1 (Roche). HT29 and AGS cell line were plated at 2×10.sup.4 cells per well in 96-well flat bottom microtiter tissue culture plates. Twenty-four hours later, cells were treated with equal volumes (150 μL) of DMEM-F12 with 10% FBS (control), DMEM-F12 without FBS (w/o FBS), and 24 or 48 hours-conditioned medium from hUCESCs, ASCs during 24 or 48 hours. WST-1 reagent (15 μL) was added to each well, and the mixture was incubated for 1 hour. The absorbance (440 nm) was measure against a background control as blank using a microtiter plate reader.

    [0182] MTT Metabolization

    [0183] Cell viability/proliferation experiments were carried out using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assays. MCF-7, MDA-MB-231, or primary cultures from human breast tumours were plated at a 3×10.sup.4 cells per well in 24-well plates. Twenty-four hours later, cells were treated with equal volumes (500 μL) of DMEM-F12 with 10% FBS (+FBS), DMEM-F12 without FBS (−FBS), and 24 or 48 hours-conditioned medium from MCF-7, MDA-MB-231, hUCESCs, ASCs, or primary cultures of breast cancer tumours during 24 or 48 hours. MTT (0.5 μg/μL) was added to each well, and the mixture was incubated for 1 hour. The medium was then removed, and DMSO (500 μL) added to each well. Absorbance of samples was measured at 570 nm in a multiwell plate reader (Tecan ULTRA Evolution, Männedorf, Switzerland). Results were plotted as the mean±SD values of quadruplicates from at least two independent experiments.

    [0184] Western Blot Analysis

    [0185] MCF-7, MDA-MB-231 cells, and primary cultures from human breast tumours were lysed at 4° C. in 300 μL of lysis buffer (50 mM HEPES, pH 7.5; 150 mM NaCl; 5 mM EGTA; 1.5 mM MgCl.sub.2; 1% SDS; 10% glycerol; 1% Triton X-100; 10 mM sodium orthovanadate; 4 mM PMSF, and 50 μg/mL aprotinin). The cell lysate was then centrifuged at 14,000×g for 5 minutes at 4° C., the resulting supernatant was collected, and protein concentration determined by the Bradford method. Western blotting was carried out. Briefly, 60 μg of total protein was subjected to SDS-PAGE electrophoresis. Proteins were transferred to a nitrocellulose membrane, blocked, and immunolabeled overnight at 4° C. with a primary antibody (see Table 1), washed three times with PBS-Tween-20, and incubated with the appropriate secondary antibody for 1 hour. The signal was detected with the Pierce ECL Western blotting substrate (Thermo Scientific, Rockford, Ill., USA), and visualized by placing the blot in contact with standard X-ray film, as per the manufacturer's instructions.

    TABLE-US-00001 TABLE 1 Primary antibodies Antigen Source Application Desmin Dako ICC CK (clone AE1/AE3) Dako ICC Actin HHF35 Dako ICC Active caspase-3 (asp175) Cell Signaling IHC, WB p63 Dako ICC Cyclin D1 (clone 7213G) Santa Cruz Biotech WB Smooth muscle actin Dako ICC E-cadherin (clone NCH-38) Dako ICC KLF4 (clone B-9) Santa Cruz Biotech ICC OCT4 (clone 7F9.2) Millipore ICC Cleaved PARP Cell Signaling WB Sox2 (clone SOX2-6) Sigma-Aldrich ICC Cyclin A BD Biosciences WB Cyclin B Santa Cruz Biotech WB Cyclin E Santa Cruz Biotech WB β-catenin (clone 1) Dako ICC Vimentin (clone V9) Dako ICC GAPDH Santa Cruz Biotech WB Caspase 8 (D391) Cell Signaling WB Caspase 9 (clone 09) Cell Signaling WB Caspase 12 Cell Signaling WB Bim (clone C34C5) Cell Signaling WB Bid Cell Signaling WB ICC: immunocytochemistry, IHC: immunohistochemistry, WB: Western blot

    [0186] Cell Cycle and Apoptosis Assays

    [0187] Cell cycle and apoptosis assays were carried out by using a Guava flow cytometer (Millipore Corporation, Billerica, Mass., USA). Briefly, 2×10.sup.5 cells/well were cultured in: a) DMEM-F12 (1:1) supplemented with 10% FBS, b) DMEM-F12 (1:1) without FBS, and c) Conditioned Medium, during 48 hours, harvested, fixed with 70% cold ethanol for 30 minutes, washed with PBS, and incubated with ribonuclease (100 μg/mL), and propidium iodide (PI, 50 μg/mL) for 30 minutes in darkness, for cell cycle evaluation. Apoptosis analyses were performed using Annexin V-FITC. Cells were harvested, washed twice with PBS, and resuspended in 1× binding buffer (0.1 M Hepes (pH 7.4), 1.4 M NaCl, and 25 mM CaCl.sub.2). 5 μl of FITC-Annexin V was added and incubated for 15 minutes at room temperature in darkness. Finally, 400 μL of 1× binding buffer was added to each tube, and analyzed. Annexin V positive and PI negative indicate early apoptosis, while both Annexin V negative and PI positive indicate late apoptosis.

    [0188] Cell Invasion Assay

    [0189] Assays were performed in BD BioCoatMatrigel invasion chambers according to the manufacturer's instructions (BD Biosciences). Filters precoated with Matrigel were used for examining cell invasion. MDA-MB-231 cells were placed into the upper chamber in 0.5 mL of DMEM serum-free medium (5×10.sup.4 cells per filter). Conditioned Medium of hUCESCs from 48 hours of culture was placed in the lower chamber as a 20% FBS. After incubation for 22 hours, cells that had migrated to the lower surface of the filters were fixed in methanol for 2 minutes at room temperature, stained using crystal violet for 2 minutes, visualized and counted. Values for cell migration or invasion were expressed as the mean number of cells per microscopic field over four fields per one filter for duplicate experiments. Experiments were repeated three times.

    [0190] Animal Studies

    [0191] Female mice age-matched between 6-8 weeks, homozygous for the severe combined immune deficiency spontaneous mutation (CB17-Prkdc.sup.scid, named SCID, Parc Recerca Biomedica, Barcelona, Spain) were used for xenografting studies. Thirteen SCID mice (6 controls and 7 treated) were injected subcutaneously with 3×10.sup.6 MDA-MB-231 cells stably transfected with the pcDNA3-luciferase vector (MDA-MB-231-luc cells) into the left and right flanks. Fifteen days after cells injection, mice were injected intratumourally (150 μL) with 48 hours-conditioned medium (CM) from hUCESCs or with placebo every five days until day forty seven. After luciferin injection (150 mg/kg), tumour growth was monitored externally by luminescence using the In Vivo Imaging System (IVIS, Caliper Life Sciences, Alameda, Calif., USA). An intensity map was obtained using the Living Image software (Caliper Life Sciences). The software uses a color-based scale to represent the intensity of each pixel (ranging from blue representing low to red representing high). One control and one CM-treated mouse were sacrificed at day 31, and tumours excised, fixed in 10% neutral buffered formalin for 24 hours and embedded in paraffin for histological and immunohistochemistry studies. All remaining mice were monitored for survival analyses.

    [0192] Immunohistochemistry

    [0193] Mouse tumours were immersion-fixed in 10% neutral buffered formalin for 24 hours and embedded in paraffin routinely. Sections 4 μm thick were mounted on Flex IHC microscope slides (Dako, Glostrup, Denmark). The immunohistochemical (IHC) technique was automatically performed in an AutostainerLink 48 (Dako). An activated caspase 3 antibody (Cell signalling) was employed. Epitope retrieval was performed in a microwave 20 minutes using EnVision FLEX target retrieval solution (pH 9). All antibodies were incubated for 20 minutes at RT. As detection system we used EnVision FLEX/HRP Dako (dextran polymer conjugated with horseradish peroxidase and affinity-isolated goat anti-mouse and anti-rabbit immunoglobulins) for 20 minutes.

    [0194] II—Results

    [0195] Effect of hUCESCs on Proliferation of Human Cancer Cells

    [0196] To explore the possible effect of hUCESCs on cancer cell line, cell proliferation assay was assessed on colorectal (HT29) and gastric (AGS) adenocarcinoma cell line treated during 48 hours with complete medium (control), incomplete medium (w/o FBS), conditioned medium from hUCESCs produced during 24 hours or 48 hours and conditioned medium from ASC produced during 48 hours. The effect of hUCESCs conditioned medium on colorectal and gastric adenocarcinoma cell proliferation was more potent that conditioned medium from ASC (FIG. 7A).

    [0197] To explore the possible effect of hUCESCs on breast cancer after administration of conditioned medium (CM) from hUCESCs, the proliferation/cytotoxicity in the non-invasive human breast cancer cell line MCF-7 and in the highly invasive human breast cancer cell line MDA-MB-231 were evaluated. As shown in FIG. 7B-C, after 24 and 48 hours of administration of CM from hUCESCs (of 24 or 48 hours) to MCF-7 cells, no significant decrease of MTT metabolization was observed, as compared to cells treated with medium without FBS, or CM produced at 24 or 48 hours by MCF-7 cells. However, when the same CM from hUCESCs is administered to the MDA-MB-231 cell line, a significant decrease in cell proliferation is seen at 24 hours (CM from hUCESCs cultured during 48 hours, P<0.01) and 48 hours (CM from hUCESCs cultured during 24 and 48 hours, P<0.01 and P<0.001, respectively) (FIG. 7D-E). To evaluate whether the effect of CM from hUCESCs on cell proliferation could be maintained by co-culture of hUCESCs with MCF-7 or MDA-MB-231 cells or is dependent only on CM, MCF-7 and MDA-MB-231 cells were labeled with a green dye, and hUCESCs were labeled with a red dye. It was found that while MCF-7 cells co-cultured with hUCESCs grew as MCF-7 cultured alone (FIG. 7F), co-culture of MDA-MB-231 cells with hUCESCs significantly (P<0.01) reduced the number of MDA-MB-231cells, as compared with growth of MDA-MB-231 cells alone (FIG. 7G).

    [0198] Conditioned Medium from hUCESCs Delays Cell Cycle and Induces Apoptosis in MDA-MB-231 Cell Line

    [0199] Given that CM from hUCESCs significantly decreased proliferation of MDA-MB-231 cells, the cell cycle and apoptosis as possible mediators of this decrease were evaluated. MDA-MB-231 cells were cultured during 48 hours with DMEM plus 10% FBS (+FBS), DMEM without FBS (−FBS), or CM of 48 hours from hUCESCs, and then we performed flow cytometry using propidium iodide (PI) (to evaluate cell cycle), and annexin V/PI to evaluate apoptosis. In addition, Western blots were carried out to evaluate expression of proteins involved in both cell cycle and apoptosis. The results indicate that CM-treated cells significantly increases G0-G1 phase in relation to cells treated with complete (+FBS) or incomplete (−FBS) medium (FIG. 8A). Therefore, a visible decrease in cyclin A, cyclin B, and cyclin D1 protein expression was observed in CM-treated cells (FIG. 8B). Treatment of MDA-MB-231 cells with CM induced a significant increase of Annexin+/PI−, and Annexin+/PI+ cells vs cells cultured without FBS, suggesting that CM induces early and late apoptosis, respectively (FIG. 8C). Immunoblots of protein extracts from MDA-MB-231 cells treated with CM showed a clear increase in caspase-8, -12, -9, activated caspase-3, and cleaved PARP (FIG. 8D), and a decrease of Bid and Bim (FIG. 8E), with respect to cells treated with complete (+FBS) and incomplete (−FBS) medium.

    [0200] Invasion, 3-D Cultures Formation, Tumor Growth, and Survival Rate is Modified by Conditioned Medium from hUCESCs

    [0201] It was explored whether CM from hUCESCs affected invasion of MDA-MB-231 cells through a matrigel matrix. FIG. 9A shows a significant (P<0.001) decrease of invading capacity of MDA-MB-231 cells in presence of CM, as compared with cells in presence of incomplete medium (−FBS). The three-dimensional growth of MDA-MB-231 cells was also explored. For these experiments, MDA-MB-231 cells were cultured in matrigel, a semisolid medium in which they form spherical structures. Treatment with the CM showed a substantial decrease in the diameter of these spheres, which was not appreciable when the cells were treated with incomplete medium (CM, mean diameter=2.8±1.0 vs −FBS, mean diameter=5.7±1.6, arbitrary units, P=0.023) (FIG. 9B).

    [0202] The effect of intratumoral administration of CM in vivo using the severe immunodeficient (SCID) mouse tumor xenograft model was next evaluated. Mice were injected with MDA-MB-231 cells stably transfected with the luciferase vector in the mammary fad pad and 15 days later, when the tumor becomes visible, they were injected intratumorally, five days each, either with incomplete medium (controls) or with CM from hUCESCs (150 μl), and monitored externally by luminescence (FIG. 9C). A significant decrease (P=0.011) in tumor volume was observed after 15 days of treatment with CM (at day 30) (FIG. 9D). On day 33, two animals (one control and one CM-treated mice) were sacrificed, the tumors removed, and analyzed by immunohistochemistry for activated caspase-3 (as indicator of apoptosis). FIG. 9E shows a significant increase of activated caspase-3 expression in CM-treated mice. To evaluate the survival rate of mice, the remaining mice were injected each 5 days either with CM or with placebo, and observed until day 47. As shown in FIG. 9F, Kaplan-Meier survival plots indicate that mice treated with CM had a longer overall survival compared with control mice (P=0.019).

    [0203] Conditioned Medium Reduces Proliferation in Tumors with High Proliferation Rate

    [0204] The effect of administration of CM from hUCESCs in primary cultures from patients with breast tumors was next evaluated. Thus, ten breast cancer primary cultures were evaluated for cell proliferation using a MTT assay. While in breast tumoral cells with low proliferation rate (11B3186, 11B2445, 11B530, 11B545, 11B980, and 11B2127) administration of CM from hUCESCs had no significant effect on cell proliferation compared with the effect produced by incomplete medium (−FBS), CM from itself, or CM produced by adipose-derived stromal cells (ASCc) in primary cultures from breast tumors with higher proliferation rate (11B512, 11B3285, 11B3171, and 11B7352), administration of CM from hUCESCs induced a significant (P<0.001) decrease in cell proliferation as compared with other treatments (FIG. 10A). The cyclin D1 and cleaved PARP expression in protein extracts from these primary tumors with higher proliferation rate was also evaluated. The results are shown in FIG. 10B. A clear decrease in expression of cyclin D1 and PARP cleavage was observed when CM from hUCESCc was administered, but not in primary cultures treated with incomplete medium (without FBS).

    Example 4

    Growth Inhibition of Pathogenic Microorganism by hUCESCs

    [0205] I—Material and Methods

    [0206] Bacterial strains used were: E. coli (ATCC 25992), Staphylococcus aureus (ATCC 29213), and Enterococcus faecalis (ATCC 51299).

    [0207] Growth Inhibition in Multiwell Plates by Serial Dilution

    [0208] Growth inhibition of pathogenic microorganism was assessed in 96 microwell plates cultures to determine the maximum dilution of medium with antimicrobial activity. Briefly, 100 μl of serial 1:2 dilutions and 75 μl of serial 1:2 dilutions of control (DMEM-F12 medium without FBS) and conditioned medium (hUCESCs or adipose tissue-derived MSC) were placed in 96 wells plates. Then, the bacterial suspension in brain heart broth (1:300 dilution of 0.5 McFarland suspension) was added to each well. Plates were incubated at 37° for 24 to 48 h. Bacterial growth inhibition was determined by comparing control wells to wells which contain hUCESCs or adipose tissue-derived MSC conditioned medium.

    [0209] Inhibition of bacterial growth by hUCESCs and its conditioned medium For each experiment Escherichia coil (E. coli, ATCC 25992) colonies were seeded from frozen stocks, and grown overnight at 37° C. in liquid Luria-Bertani (LB) medium (Difco BD, USA) with slight agitation. Before each experiment, bacterial cells were washed once and resuspended in PBS, and optical density (OD at λ=600 nm) of the suspension was measured. Number of CFU was calculated as according to the following equation: OD.sub.600=1.0 corresponds to 4×10.sup.8 CFU/ml for E. coli. Assessment of direct inhibition of bacterial growth by hUCESCs or its conditioned medium (CM) was done by counting CFU and reading OD.

    [0210] Briefly, in 24-well plates, 300 CFU E. coli were added to: a) 2×10.sup.5 hUCESCs in DMEM/F-12-HAM (1:1) supplemented with 10% FBS, b) 2×10.sup.5 normal human fibroblasts (NHF) in the same culture medium, and c) culture medium alone. Then, cultures were incubated for 6 hours in humidified CO2 incubator. Optical density was measured after 2 h growing infected cultures in LB at 37° C. CFU quantification was done in LB-agar plates after overnight incubation at 37° C. The remaining infected medium was centrifuged at 15,000 rpm for 10 min and frozen at −20° C. (to eliminate any residual bacterial organisms). Samples were thawed on ice, and aliquots were transferred to a 96-well plate, inoculated with 100 CFU E. coli and incubated for 16 hours at 37° C. Then OD and CFUs were counted as described above.

    [0211] II—Results

    [0212] Growth Inhibition in Multiwell Plates by Serial Dilution

    [0213] All dilutions of control medium showed a bacterial growth. Adipose tissue-derived MSC conditioned medium showed no antimicrobial activity, although hUCESCs conditioned medium showed an inhibition of bacterial growth up to 1/20 dilution (FIG. 11).

    [0214] Inhibition of Bacterial Growth by hUCESCs and its Conditioned Medium

    [0215] Human hUCESCs significantly (p<0.001) inhibited E. coli bacterial growth compared with both control medium and control NHF cells. Both CFU and OD quantification showed a decrease of around 50% in number of colonies (FIG. 12) and absorbance (FIG. 13) respectively compared with controls (medium alone and NHF). The infected medium derived from the hUCESCs showed the same effect against E. coli as the hUCESCs. These results suggest that the antibacterial effect is produced by some soluble factor secreted by the hUCESCs.

    Example 5

    Tissue Regeneration Related Experiments: Alkali Corneal Epithelial Wound Healing in a Rat Model of Dry Eye by hUCESCs Conditioned Medium

    [0216] I—Material and Methods

    [0217] 15 female Sprague-Dawley rats weighing 200-250 g were used to do this experiment. All animals were anesthetized by intraperitoneal injection of a mixture of ketamine (0.425 ml) and xilacine (0.2 ml) soaked in NaOH (0.375 ml). At the end of the experiment, all rats were sacrificed by CO2 inhalation.

    [0218] Dry Eye Model

    [0219] 3 out of 15 rats were kept with healthy eyes, the remaining 12 rats were anesthetized and the extraocular lacrimal gland was excised bilaterally to create dry eyes. The extraocular lacrimal gland is one of the three lacrimal glands of the rat. This gland is the main gland for tear production and with an easy access (FIG. 14A). One week after the surgery, tear production was measured with the Schirmer Test (Laboratorios Cusí SA, Barcelona). The paper strips were adapted by cutting them 2 mm wide. The tip of the strip was folded at 1 mm length and introduced under the eyelid during 5 minutes. After this time, the length of the wetted strip from the folded mark (FIG. 14B, C) was measured. All 12 rats have presented dry eyes.

    [0220] Corneal Alkali Wound and Examination

    [0221] A central corneal alkali wound was produced in both eyes by applying a piece of Whatman paper (2×2 mm) soaked in 2 μl NaOH (1 mol/l) for 60 seconds. The cornea was then rinsed with saline during 30 seconds. All rats were previously anesthetized as described above. The damaged epithelium was visible after fluorescein (Colircusí Fluoresceina, Alcon Cusí, S. A., El Masnou-Barcelona) staining of the surface of the cornea in the anesthetized rat. The cornea was photographed with a digital camera (Nikon D200, Tokio, Japón) attached to a surgical microscope (Takagi OM-5 220-2, Tokio, Japón) under blue light. Quantitative measurements of the corneal injury were made on the photograph off line with the free commercial software ImageJ (Softonic International, SL) by counting the number of pixels colored with the fluorescein with respect to the total number of pixels of the surface of the eye.

    [0222] Groups and Treatments

    [0223] Fifteen rats where divided into 5 groups of 3 rats each. There was one group with healthy eyes (group Normal) and no corneal lesion and 4 groups (groups CM, M, SH and No Treat) with dry eyes and corneal alkali burn in both eyes. Treatments consisted on topical applications of eye drops dosed 4 times per day of:

    [0224] Group CM: Conditioned Medium. Group M: Culture Medium (DMEM-F12; Gibco, Life Technologies, Paisley, UK) without any previous contact with cells.

    [0225] Group SH: Ophthalmic drops with sodium hyaluronate (0.015 g/10 mL).

    [0226] Group No Treat: No Treatment.

    [0227] Conditioned Medium (CM)

    [0228] Human uterine cervical mesenchymal stem cells (cells of the invention) were cultured in 90-mm Petri dishes of 70% confluence with 5 ml of DMEM-F12 (Gibco, Life Technologies, Paisley, UK) culture medium, in air-CO.sub.2 (95:5) atmosphere at 37° C. during 48 h. After this time, sobrenadant is collected, frozen and liofilized to store at −80° C. until used. The liofilized powder was resuspended just before used in ddH.sub.2O.

    [0229] Histology

    [0230] At the end of the experiment, 5 days after the corneal alkali burn, one rat randomly selected from each group was sacrificed, the eyeball excised and immersion-fixed in 10% neutral buffered formalin. After 24 h, the cornea was dissected from the eyeball and immersed in Ethanol (70%). The cornea was then embedded in paraffin and 20 μm sections were mounted and stained with hematoxylin-eosin (H-E) for histological evaluation.

    [0231] mRNA Expression Analysis

    [0232] At the end of the experiment, 5 days after corneal lesion, the two remaining rats from each group were sacrificed and the corneas dissected. The mRNA expression levels of macrophage inflammatory protein-1 alpha (MIP-1α), monocyte chemotactic protein-1(MCP-1) and tumor necrosis factor-alpha (TNF-α) in the corneas were evaluated using real time polymerase chain reaction (real-time PCR). Total RNA was isolated from the corneas using TRIzol (Invitrogen). cDNA was synthesized from the RNA (1 μg) in a 30 μl reaction with Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics). Reactions of quantitative Real Time PCR were done with 2 μg cDNA in a 20 μl volume using iQ SYBRGreen Supermix (Bio-Rad) on iCycler equipment (7500 PCR Systems, Applied Biosystems-Life Technologies). Samples were denatured at 94° C. for 10 sec, annealed at 58° C. for 10 sec and extended at 72° C. for 10 sec for a total of 35 cycles. Samples were quantified using Sequence Detection Software 1.4 (Applied Biosystems), with β-actin as the endogenous control. The oligonucleotide sequences are described in Table 2.

    TABLE-US-00002 TABLE 2 Primer sets for real-time PCR. Forward primers Reverse primers Gene (5′ -3′) (5′ -3′) MIP-1 α ATGAAGGTCTCCACCACTGC AAAGGCTGCTGGTCTCAAAA (SEQ ID No. 1) (SEQ ID No. 2) MCP-1 ATGCAGTTAATGCCCCACTC TTCCTTATTGGGGTCAGCAC (SEQ ID No. 3) (SEQ ID No. 4) TNF- α TCAGTTCCATGGCCCAGAC GTTGTCTTTGAGATCCATGC (SEQ ID No. 5) CATT (SEQ ID No. 6) β-actin GGAGATTACTGCCCTGGCTC GACTCATCGTACTCCTGCTT CTA (SEQ ID No. 7) GCTG (SEQ ID No. 8)

    [0233] Data Analysis

    [0234] Values are expressed as mean±standard deviation. Means were compared using one-way ANOVA, with the Tukey's range test for post hoc comparisons. P values of less than 0.05 were considered statistically significant. The MATLAB R2011a Version7.1 (MathWorks, Inc) software was used for all calculations. The percentage of epithelial regeneration (% ER) was calculated with the formula:


    % ER=100(m.sub.i−m.sub.f)/m.sub.i

    [0235] Where m.sub.i is the first measurement of the corneal injury (just after the alkali burn) and m.sub.f is the final measurement 48 hours after. Both measurements represent the percentage of wounded area with respect to the total area of the cornea.

    [0236] II—Results

    [0237] Effects on Epithelial Recovery

    [0238] Corneal epithelial staining with fluorescein is indicative of epithelial defects (FIG. 15A). The percentage of epithelial regeneration (% ER) for each group was calculated as described in methods section. The recovery of the corneal surface was significantly faster in the group treated with CM than in the other groups 15 hours after the alkali burn (p<0.005, 1-way ANOVA; FIG. 15B). The means of the epithelial regeneration (ER) were: 62±5% for the group CM; 34±15% for the M group; 32±15% for the SH group and 36±13% for the NoTreat group. On day 5 after the alkali burn the recovery of the corneal surface was almost complete in all treated groups (>75%) but still significantly faster in the group treated with CM compared with the group without treatment (p=0.005, 1-way ANOVA; FIG. 15C). The means of the ER were: 92±4% for the group CM; 77±15 % for the M group; 74±15% for the SH group and 62±16% for the NoTreat group.

    [0239] Alkaline corneal epithelial wound closure on day 5, were compared after H-E staining of the cornea sections, the regeneration of the corneal epithelium is faster in the group treated with CM than in the others (FIG. 16).

    [0240] Anti-Inflammatory Effects

    [0241] To investigate the possible mechanism by which CM attenuate inflammation, we assessed the production of the chemotactic factors MIP-1α and MCP-1 and the immunostimulatory cytokine TNF-α. We found that levels of all MIP-1α, MCP-1 and TNF-α were very high in the M group (group treated with culture medium, with no contact with stem cells) compared with the rest of the groups, including the No Treat group (with lesion but no treatment) (p<0.05; 1-way ANOVA; FIG. 17). However, the group treated with the same culture medium but with previous contact with the stem cells (CM group), had lower levels of all MIP-1α, MCP-1 and TNF-α compared with the M group (p<0.05; 1-way ANOVA; FIG. 4). This result seems to indicate that the culture medium used (DMEM-F-12) has proinflammatory effects on this type of lesions and these effects were contrarested by some of the factors secreted by the cultured stem cells. In addition, Levels of MIP-1α in the CM group are similar to those in the No Les group (without corneal lesion), and lower than the other treated groups (M and SH) and the No Treat group (p<0.05; 1-way ANOVA; FIG. 17B). This result is indicative of an anti-inflammatory effect of the CM on the injured cornea.

    Example 6

    Experiments Related to Germ Cells Selection: Effect of hUCESC Conditioned Medium on Spermatozoa

    [0242] I—Material and Methods

    [0243] Conditioned medium (CM) was lyophilized and reconstituted at three concentrations 0.5:1, 1:1 and 4:1. Experiments were carried out on fresh semen and/or capacitated spermatozoa at 0 hours (T0), 3 hours (T3) and 24 hours (T24).

    [0244] Semen Analysis

    [0245] Semen analysis was performed according to 2010 World Health Organization (WHO) guidelines using light microscopy. After liquefaction, 5 μL of semen was loaded on a Neubauer counting chamber (Sefi Medical Instruments, Haifa, Israel). Total sperm count (×10.sup.6/mL) and percentage motility were measured manually. A minimum of 200 cells were counted per 5 μL drop, and at least two drops were studied per sample. Sperm vitality was studied by a dye exclusion method, also following WHO guidelines, using eosin red and nigrosin.

    [0246] Assessment of Oxidative Stress

    [0247] Dihydroethidium (DHE) is a poorly fluorescent two-electron reduction product of ethidium (Et.sup.+) that on oxidation produces DNA-sensitive fluorochromes that generate a red nuclear fluorescence when excited at 510 nm. The results obtained with this probe have been validated as a measure of the ability of human spermatozoa to generate ROS, including definitive identification of the superoxide anion. For the intracellular ROS production assay, DHE (3 μM) were diluted in PBS buffer and added to 0.5×10.sup.6 fresh spermatozoa in a final volume of 500 μl. The cells were then incubated in the dark at RT for 45 min, washed twice (2000 rpm, 5 min) and the resultant red (HE) fluorescence was analyzed by flow cytometry using a FACScan analyzer. Data were expressed as the percentage of fluorescent spermatozoa.

    [0248] Assessment of Plasma Membrane Integrity

    [0249] The integrity of mitochondrial plasma membrane has been positive correlated with sperm motility and vitality, and negative correlated with cell apoptosis. During the process of oxidative phosphorylation, the protons are pumped from inside the mitochondria to the outside, creating an electrochemical gradient called the inner mitochondrial membrane potential (MMP). The ability to discriminate between mitochondria exhibiting high MMP from those having low MMP provides a rigorous estimation of the mitochondrial metabolic function and membrane integrity. The evaluation of MMP on spermatozoa was performed by flow cytometry using the 3,3′-dihexyloxacarbocyanine iodide (DiOC.sub.6) fluorescent dye. Briefly, spermatozoa (0.5×10.sup.6) from each fresh sample were incubated with DiOC.sub.6 (0.1 nM diluted in HTF medium) at 37° C. water bath for 45 minutes in a final volume of 500 μl. Then cells were washed twice (2000 rpm, 5 min) with PBS, resuspended in 500 μl PBS buffer and analyzed by flow cytometry. As a negative control, sperm sample was also incubated with 1 mM uncoupler carbamoyl cyanide m-chlorophenylhydrazone (CCCIP).

    [0250] II—Results

    [0251] hUCESC conditioned medium (CM) shows an effect on sperm characteristics depending on concentration and time (Table 3). Compared to control (w/o CM), CM 4:1 shows a diminution of all percentages of sperm characteristics at T3 and T24, whereas CM 1:1 shows a higher effect on motility, vitality, oxidative stress and membrane potential at T24.

    TABLE-US-00003 TABLE 3 Sperm characteristics depending on hUCESC conditioned medium concentration. semen semen Control with with (w/o CM) CM 1:1 CM 4:1 T 0 Motility progression (%) 37 35 36 Total motility (%) 51 53 53 Sperm vitality (%) 79 79 77 Oxidative stress (%) 18 15 17 Mitochondrial membrane 57 53 58 potential (%) T 3 Motility progression (%) 39 21 3 Total motility (%) 56 51 8 Sperm vitality (%) 67 62 10 Oxidative stress (%) 19 19 34 Mitochondrial membrane 29 32 15 potential (%) T 24 Motility progression (%) 30 3 1 Total motility (%) 42 8 4 Sperm vitality (%) 61 10 6 Oxidative stress (%) 27 48 52 Mitochondrial membrane 26 8 4 potential (%)

    [0252] Table 4 shows that hUCESC CM 1:1 shows a higher effect than hUCESC CM 0.5:1 on sperm characteristics of fresh ejaculate and capacitated spermatozoa. hUCESC CM shows a higher effect on fresh sperm than capacitated spermatozoa, this help to the selection of good quality spermatozoa.

    TABLE-US-00004 TABLE 4 Concentration 0.5:1 Concentration 1:1 Fresh Capacitated Fresh Capacitated 1 2 1 2 1 2 1 2 T 0 Motility 61 71 85 78 61 71 85 78 progression (%) Total motility 67 82 90 88 67 82 90 88 (%) Sperm vitality 71 77 94 89 71 77 94 89 (%) Oxidative 35 24 13 21 35 24 13 21 stress (%) Mitochondrial 64 60 68 59 64 60 68 59 membrane potential (%) T 3 Motility 57 71 76 68 41 58 80 60 progression (%) Total motility 63 80 89 76 59 70 88 68 (%) Sperm vitality 64 65 77 74 42 41 52 55 (%) Oxidative 40 25 14 14 17 30 38 28 stress (%) Mitochondrial 61 68 79 78 74 62 32 64 membrane potential (%) T 4 Motility  4  7 26 12  3  1  5  2 progression (%) Total motility  9  9 45 27 15  2 24 10 (%) Sperm vitality 22 19 25 27 27 24 19 12 (%) Oxidative 51 47 21 44 36 69 58 68 stress (%) Mitochondrial 45 41 61 39 51 23 31 20 membrane potential (%)