Method for obtaining a plant extract and associated compositions
11129864 · 2021-09-28
Assignee
Inventors
- Chérif Rabhi (Bretigny sur Orge, FR)
- Léon Cariel (Paris, FR)
- Jamal Ouazzani (Massy, FR)
- Guillaume Arcile (Les Ulis, FR)
Cpc classification
A61P1/04
HUMAN NECESSITIES
A61P29/00
HUMAN NECESSITIES
A23L33/105
HUMAN NECESSITIES
A61P17/02
HUMAN NECESSITIES
A61P9/10
HUMAN NECESSITIES
A23V2002/00
HUMAN NECESSITIES
A61P43/00
HUMAN NECESSITIES
A61K36/81
HUMAN NECESSITIES
A61P1/00
HUMAN NECESSITIES
A61K2236/19
HUMAN NECESSITIES
A23L33/135
HUMAN NECESSITIES
International classification
A61K36/00
HUMAN NECESSITIES
A23L33/105
HUMAN NECESSITIES
A23L33/135
HUMAN NECESSITIES
Abstract
The invention relates to a tablet or capsule containing a plant extract, to assist in the treatment or prevention of disorders or diseases. The tablet or capsule includes bioconverted products provided by fermenting Withania Somnifera extract, Emblica officinalis extract, and Bacopa monnieri extract.
Claims
1. A tablet or a capsule comprising a composition comprising the bioconverted products of fermenting Withania Somnifera extract, Emblica officinalis extract, and Bacopa monnieri extract, which are bioconverted Withania Somnifera extract, bioconverted Emblica officinalis extract, and bioconverted Bacopa monnieri extract, respectively, wherein the bioconverted Withania Somnifera extract is detoxified by a filamentous fungus by biocatalysis.
2. The tablet or the capsule of claim 1, wherein the bioconverted Withania somnifera extract is present by weight between 5 g/L and 100 g/L of the composition.
3. The tablet or the capsule of claim 1, wherein the bioconverted Withania somnifera extract is present by weight of 20 g/L of the composition.
4. The tablet or the capsule of claim 1, further comprising at least one extract selected from the group consisting of Punica granatum, Curcuma longa, Piper longum and Calendula officinals.
5. The tablet or the capsule of claim 1, wherein the fungus is a filamentous fungus of the family Cordycipitaceae.
6. The tablet or the capsule of claim 1, wherein the filamentous fungus from the family Cordycipitaceae is from the genus Beauveria.
Description
DESCRIPTION OF THE DRAWINGS
(1) The foregoing aspects and many of the attendant advantages of this invention will become more readily appreciated as the same become better understood by reference to the following detailed description, when taken in conjunction with the accompanying drawings, wherein:
(2) Other objects, features, aspects and advantages of the invention will appear more clearly on reading the description and examples that follow:
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
DETAILED DESCRIPTION
(25) The Withania somnifera plant is obtained from India. The root of this plant is marketed by Alp Erbo (Marseille).
(26) The extracts are produced using all the means known to a person skilled in the art, such as a maceration in aqueous, alcohol or alcohol-water solutions of plant powders derived from one or more of the various parts of the plant, such as the root, leaves, stem, branches, fruit or flowers, as well as by decoction, by supercritical or subcritical fluid extraction, and by adsorption. (Indian J Pharm Sci. 2010 September-October; 72(5): 659-663), EP2138054, thesis from the University of Toulouse, “Étude des procédés d'extraction et de purification de produits bioactifs à partir de plantes par couplage de techniques séparatives à basses et hautes pressions” [Study of the methods of extraction and purification of bioactive products from plants by coupling of separation techniques at low and high pressures] submitted by Petko Ivanov PENCHEV, 2010.
(27) The filamentous fungus used for fermentation is selected from fungi of the family Cordycipitaceae. Preferably, the fungus is selected from among the fungi belonging to the genus Beauveria. Even more preferably, the filamentous fungus is derived from the strain Beauveria bassiana, more particularly the strain having reference ATCC 7159. The strain Beauveria bassiana presents advantageous catalytic properties and is not toxic to humans. This strain is commonly used in agriculture in the biological fight against insects, as well as being used as a probiotic for animals.
(28) Thus, the controlled fermentation, including that of the strain Beauveria bassiana ATCC 7159 (American Type Culture Collection), detoxifies the Withania Somnifera extract by a series of biocatalysis of various molecules contained in this extract and, more particularly, the chemical family of withanolide aglycones, the substances mainly responsible for the toxicity of the extract.
(29) The term “fermentation” is used to mean the transforming of vegetable substances under the action of microorganisms.
(30) The term “suitable medium” is used to mean any medium known to a person skilled in the art that is used to grow the fungal biomass required for the fermentation. Examples of suitable media are Sabouraud Dextrose Agar (SAB) (Gibco, France), Brain-Heart Infusion Agar (BHI) (Gibco, France), Malt Extra Broth (MEB) (Gibco, France), Yeast Malt extract (YM) (Gibco, France), Yeast Extract-Phosphate Medium (YEP) (Gibco, France), Dermatophyte Test Medium (DTM) (Gibco, France), Potato dextrose Agar and Broth (PDA, RDB) (Gibco, France), or C-Medium. Preferably, C-Medium having the following composition is used. 10 g of molasses, 0.5 g of MgSO.sub.4, 2 g of NaNO.sub.3, 0.5 g of KCl and 0.02 g of FeSO.sub.4 added to 1 litre of water (compounds obtained from Sigma, France).
(31) The term “detoxification” is used to mean elimination by the microorganism of potentially toxic molecules in the medium.
(32) According to one feature, the method according to the invention includes a filtration step of the incubation medium used during the fermentation stage, in order to eliminate the microorganism used during fermentation. This filtration step may be carried out by decantation or mechanical filtration, using any means known to a person skilled in the art, such as filter paper or filters.
(33) According to another feature, the method according to the invention may include a sterilisation step that can be carried out by any means known to a person skilled in the art, including the use of an autoclave, for example at 120° C. for 20 minutes, by ultrafiltration or by irradiation.
(34) Preferably, after the fermentation, filtration and sterilisation steps, the incubation medium is then subjected to an ultrafiltration in order to obtain the solution which constitutes the plant extract ((Millipore, Applied Membranes), Ultrafiltration of a strongly clogging food fluid: flow limit, critical flow and cleanability of a polymeric membrane, Ndeye Wemsy Diagne, Murielle Rabiller-Baudry, IUT Rennes, University of Rennes I, UMR CNRS 6226).
(35) In a preferred embodiment, the method of the invention may be implemented for plants other than Withania somnifera. In particular, extracts may also be produced from Emblica officinalis, originating in India and marketed by Infrag, Bengalore), Bacopa monnieri (India) marketed by Alp Erbo (Marseille), Punica granatum (China) (Shanghai Brightol International Co, Ltd (Shanghai), Curcuma longa (India) (Omnipharm, Chambery), Piper longum (Thailand) (Omnipharm, Chambery), or Calendula officinalis (China) (Shanghai Brightol International Co, Ltd (Shanghai), using the same procedure).
(36) According to another mode of production, the method of the invention includes the step of adding an Emblica officinalis extract and a Bacopa monnieri extract to the Withania somnifera extract, before carrying out fermentation of said extracts with said filamentous fungus, in a suitable medium.
(37) According to this mode of production, the method involves independent extraction steps for each plant extract used in the realisation of the said preparation. That is to say, the plant extracts are produced independently of one another.
(38) Another object of the invention relates to the composition derived from the method of the invention.
(39) This composition according to the invention thus contains an extract of Withania somnifera. It may also include at least one of the following extracts: extracts of Emblica officinalis, Bacopa monnieri, Punica granatum, Curcuma longa, Piper longum, or Calendula officinalis.
(40) Advantageously, this composition includes, by weight, between 5 and 100 g/L of Withania somnifera, preferably 20 g/L. Preferentially, this composition also includes one of the following extracts, expressed by weight: between 5 and 100 g/L of Emblica officinalis, preferably 15 g/L, between 5 and 100 g/L of Bacopa monnieri, preferably 15 g/L, between 5 and 50 g/L of Punica granatum, preferably 10 g/L, between 5 and 250 g/L of Curcuma longa, preferably 20 g/L, between 20 and 50 mg/L of Piper longum, preferably 30 mg/L, between 5 and 50 g/L of Calendula officinalis, preferably 10 g/L,
(41) Preferably, the composition according to the invention comprises an extract of the plants Withania somnifera, Emblica officinalis and Bacopa monnieri which can be obtained by the method of the invention.
(42) The composition may be in liquid, gel, emulsion, solid or injectable form.
(43) The composition according to the invention is formulated for topical, ophthalmic, transdermal, oral, rectal or parenteral administration.
(44) A person skilled in the art of pharmaceutical formulation will implement the various useful forms for administration of the products and/or supplements of the invention.
(45) The composition according to the invention may additionally include suspensions, emulsions, syrups containing conventionally used inert diluents, and possibly other substances such as wetting agents, sweeteners, preservatives, thickeners, colourings or any other substance known to a person skilled in the art suitable for oral or ocular administration, in particular ((sodium sorbate (E201) (Sigma-Aldrich), anthocyanin (E163) (FBC Industries, USA), sodium metabisulphite (E223) (Sigma-Aldrich), alpha-tocopherol (E307) (FBC Industries, USA).
(46) The composition according to the invention may also comprise solvents or other excipients such as water, propylene glycol, vegetable oils or other suitable organic solvents.
(47) The term “excipient” is used to mean any compound which does not interfere with the effectiveness of the biological activity of the composition according to the invention, and which is not toxic to the host to which it is administered.
(48) The composition according to the invention may also contain adjuvants, such as wetting agents, isotoning agents, emulsifiers, salts or any other substances known to a person skilled in the art that can be used as adjuvants (Polydimethylsiloxane, polyvinyl alcohol (PVA), hydrogels (Carbopol), polyvinylpyrrolidone, hydroxypropyl cellulose (HPC), poloxamer 188, EDTA, chlorobutanol) (Lubrizol, France, Dow Corning, USA).
(49) Advantageously, the composition according to the invention may comprise other substances in the formulation of the said food supplement or drug, such as vitamins, mineral salts, a pharmaceutically acceptable vector, stabilisers, antioxidants, or any other substance known to a person skilled in the art and intended to be integrated into a food supplement or drug.
(50) The terms “pharmaceutically acceptable vector” is used to mean any vector which does not interfere with the effectiveness of the biological activity of the composition according to the invention and which is not toxic to the host to which it is administered.
(51) Following this process, the composition obtained is usable for a mammal, and more particularly for humans, to assist in the treatment or prevention of disorders or diseases linked to neovascularisation.
(52) Said composition can thus be used as a food supplement.
(53) The term “food supplement” is used to mean a product containing said composition and intended to supplement the food by providing nutrients that are beneficial to health according to the definition given by European directive 2002/46/EC. For example, a food supplement may be a capsule or a tablet for swallowing, or a powder or small vial to mix with a food and providing beneficial health effects.
(54) Said composition can also be used as a medicinal product.
(55) The term “medicinal product” is used to mean a product containing an accurate dose of said preparation according to European directive 65/65/EC, namely any substance or composition described as possessing curative or preventive properties with respect of human or animal disease. For example, the medicinal product containing said preparation at therapeutic doses can be administered orally as a capsule or a tablet, or injected intravitreously, or via any other route to confer the beneficial effects.
(56) The composition according to the invention can be used to assist in the treatment or the prevention of disorders or diseases linked to neovascularisation, such as ARMD, diabetic retinopathy, punctate keratopathies and glaucomas associated with anarchic vascularisation. It is also useful in the treatment of rheumatoid arthritis, osteoarthritis, Crohn's disease, atherosclerosis, the various forms of birthmarks appearing in childhood or related to hereditary diseases, for the treatment of cancer and, more particularly, of solid tumours and metastases, as well as for the treatment of benign tumours such as acoustic neuroma, neurofibroma, trachoma and pyogenic granuloma.
(57) The daily dose of the compositions and/or supplements according to the invention may vary according to the needs and severity of symptoms of the patient. Typically, the daily dose is between 10 mg/ml and 300 mg/ml of the solution after fermentation.
(58) Preferably, the daily dose for an adult human is between 30 and 100 mg/ml of the solution after fermentation.
(59) The present invention is now described using embodiments, which are for illustration purposes only and do not limit the scope of the invention.
Example 1: Extract of Withania somnifera Before Fermentation
(60) The extract of Withania somnifera (originating in Southern Asia and sourced from India) was produced from a quantity of 650 g of root (Alp Erbo, Marseille), in a mixture of 8 litres of alcohol-water solvent, ethanol/water (60:40).
(61) An amorphous extract of 87 g was obtained, i.e. a yield of 13.4%, which contained withanosides A and B, withanosides and sitoindosides (
(62) In order to eliminate the withanolides considered to be toxic, a liquid/liquid extraction was carried out with CH.sub.2Cl.sub.2. After rinsing and drying the organic phase, 81.5 g of amorphous powder was obtained, i.e. a yield of 94%.
(63) This extract was subsequently analysed and then identified by HPLC, HPLC-MS and NMR techniques, in order to obtain a chromatographic fingerprint of the Withania somnifera extract (
(64) The samples obtained were analysed on an HPLC system equipped with a Sunfire III C18 (4.6×150 mm) 3.5 μm (Waters) reversed-phase column, an Alliance® Waters W2695 HPLC system fitted with a Waters 2996 PDA detector. This chromatographic system was coupled to a Waters 2424 evaporative light scattering detector (ELSD). The HPLC system was controlled by the Empower 2 software (Waters).
(65) The solvents used were composed of HPLC water (milli Q)+0.1% Formic Acid, acetonitrile (HPLC grade)+0.1% Formic Acid. The standard gradient used was 0 to 100% acetonitrile in 40 min+10 min to 100% acetonitrile (total duration 50 minutes). The flow rate was 0.7 ml/min and the injection volume 20 to 100 depending on the sample.
(66) For the mass spectrometry, HPLC-MS analyses were carried out on a Waters Alliance® HPLC system coupled to a Waters 2998 PDA type UV detector, a Waters 2420 evaporative light scattering detector ELSD and a Micromass® ZQ mass detector (Waters).
(67) The solvents were composed of HPLC water (milli Q)+0.1% Formic Acid and acetonitrile (HPLC grade)+0.1% Formic Acid. The standard gradient used was 0 to 100% acetonitrile in 40 min+10 min to 100% acetonitrile (total duration 50 minutes). The flow rate was 0.7 ml/min and the injection volume was 20 to 100 depending on the sample.
(68) The samples of each composition for HPLC analysis were 0.45 micron filtered (Ait-France, ref: SFNY 013045N) and then a volume of the order of 50 μl was injected.
Example 2: Bacopa monnieri Extract Before Fermentation
(69) The Bacopa monnieri extraction was carried out starting with a quantity of order of 418 g in a mixture of 5 litres of alcohol-water solvent, ethanol/water (50:50).
(70) An amorphous extract of 77.1 g was obtained, i.e., a yield of 18.4%, which contains bacosides A and B.
(71) This extract was analysed and then identified by HPLC, HPLC-MS and NMR techniques, in order to obtain a chromatographic fingerprint of the Bacopa monnieri extract (
Example 3: Extract of Emblica officinalis Before Fermentation
(72) The Emblica officinalis extraction was carried out on a quantity of order of 512 g in a mixture of 7 litres of alcohol solvent comprising 100% ethanol.
(73) An amorphous extract of 166.5 g was obtained, i.e., a yield of 32.5%, which contained gallic tannins, vitamin C and ellagic acid.
(74) This extract was analysed and then identified by HPLC, HPLC-MS and NMR techniques, in order to obtain a chromatographic fingerprint of the Emblica officinalis extract (
Example 4: Extract of Calendula officinalis Before Fermentation
(75) The Calendula officinalis extract, titrated with 10% lutein and 0.9% zeaxanthin, was obtained from Shanghai Brightol International Co, (Shanghai).
(76) This extract was analysed and then identified by HPLC, HPLC-MS and NMR techniques, in order to obtain a chromatographic fingerprint of the Calendula officinalis extract (
Example 5: Extract of Punica granatum Before Fermentation
(77) The Punica granatum extract, titrated with 40% ellagic acid was obtained from Shanghai Brightol International Co, Ltd (Shanghai).
(78) This extract was analysed and then identified by HPLC, HPLC-MS and NMR techniques, in order to obtain a chromatographic fingerprint of the Punica granatum extract (
Example 6: Extract of Curcuma longa Before Fermentation
(79) The extract of curcuma rhizome titrated with 95% curcumin came from COOPER, Melun, (Batch no.: 120 105 B, CE no. 207-280-5).
(80) This extract was analysed and then identified by HPLC, HPLC-MS and NMR techniques, in order to obtain a chromatographic fingerprint of the Curcuma longa extract (
Example 7: Piper longum Powder Before Fermentation
(81) The Piper longum was used as powder, which contains piperine.
(82) This powder was analysed and then identified by HPLC, HPLC-MS and NMR techniques, in order to obtain a chromatographic fingerprint of the Piper longum (
Example 8: Composition Containing Plant Extracts Before Fermentation
(83) A composition containing an extract of Withania Somnifera at a concentration of 20 g/L, of Emblica officinalis at a concentration of 15 g/L and of Bacopa monnieri at a concentration of 15 g/L was prepared from plants.
(84) The plant material was briefly ground. Each plant was chopped independently of other plants, using grinders of the HGB50E-Blender type, so as to obtain the finest powders possible, of the order of 80 microns in diameter.
(85) Extractions were then performed for each plant extract by maceration. During such extraction by maceration, the temperature is between 40° C. and 60° C. and the pressure is 100 bar during the two 1-hour cycles. After extraction, the heterogeneous solutions obtained were filtered on filter paper with a thickness of 870 μm and a diameter of 170 mm. The solutions obtained were collected and concentrated under reduced pressure using a BUCHI R-220-SE Rotavapor to provide an aqueous solution. These solutions were frozen at −80° C., before being deposited in a freeze dryer at −55° C. and under a pressure of 0.1 mbar (Edwards Modulyo Freeze Dryer) to produce the dried extracts.
(86) The various dry extracts were then mixed in a volume of water. The solution obtained was analysed and then identified by NMR, HPLC, HPLC-MS techniques, in order to obtain a chromatographic footprint, as illustrated in
Example 9: Composition of Example 8 after Fermentation
(87) Prior to incubation, the composition resulting from example 8 was diluted in water to which glucose had been added at a concentration of 50 g/L and ammonium nitrate at a concentration of 20 g/L. The composition obtained was then subjected to bioconversion by controlled fermentation using the strain Beauveria bassiana ATCC 7159.
(88) This strain was cultivated beforehand in a culture medium composed of (per litre of water) 0.5 g/L KH.sub.2PO.sub.4; 1 g/L KH.sub.2PO.sub.4; 1 g/L MgSO.sub.4; 2 g/L NaNO.sub.3; 0.5 g/L KCl; 0.02 g/L FeSO.sub.4; 30 g/L glucose and 10 g/L of corn steep liquor (Rocket). The culture was then agitated at 200 rotations per minute, for 72 hours at 27° C. It was then filtered by non-sterile methods on a filter paper to separate the fungal biomass from the culture medium. The fungal biomass was then washed thoroughly with water and incubated with 60 g of fresh biomass per litre of incubation, that contained 37.5 g of glucose and 15 g of ammonium nitrate.
(89) After incubation, this seeded composition was agitated at 200 rpm for 7 days at a temperature of 27° C.
(90) After 7 days, the incubation medium was filtered on a filter paper, the samples for HPLC assay were also filtered using a 0.45 micron filter (Ait-France, ref: SFNY 013045N).
(91) A brownish solution was obtained which was then analysed and identified by NMR, HPLC, HPLC-MS techniques, in order to obtain a chromatographic footprint, as shown in
(92) The samples obtained were analysed as in example 1.
Example 10: Composition Containing Plant Extracts Before Fermentation
(93) A composition containing an extract of Withania Somnifera at a concentration of 20 g/L, of Emblica officinalis at a concentration of 15 g/L, of Bacopa monnieri at a concentration of 15 g/L, of Punica granatum at a concentration of 10 g/L, of Curcuma longa at a concentration of 20 g/L, of Piper longum at a concentration of 0.03 g/L, and of Calendula officinalis at a concentration of 10 g/L, was prepared from plants.
(94) The plant material was briefly ground. Each plant was chopped independently of other plants, using grinders of the HGB50E-Blender type, so as to obtain the finest powders possible, of the order of 80 microns in diameter.
(95) Extractions were then performed for each plant extract by maceration. During such extraction by maceration, the temperature is between 40° C. and 60° C. and the pressure is 100 bar during the two 1-hour cycles. After extraction, the heterogeneous solutions obtained were filtered on filter paper with a thickness of 870 μm and a diameter of 170 mm. The solutions obtained were collected and concentrated under reduced pressure using a BUCHI R-220-SE Rotavapor to provide an aqueous solution. These solutions were frozen at −80° C., before being deposited in a freeze dryer at −55° C. and under a pressure of 0.1 mbar (Edwards Modulyo Freeze Dryer) to produce the dried extracts.
(96) The various dry extracts were then mixed in a volume of water. The solution obtained was analysed and then identified by NMR, HPLC, HPLC-MS techniques, in order to obtain a chromatographic footprint, as illustrated in
Example 11: Composition of Example 10 after Fermentation
(97) Prior to incubation, the composition resulting from example 10 was diluted in water to which glucose had been added at a concentration of 50 g/L and ammonium nitrate at a concentration of 20 g/L. The composition obtained was then subjected to bioconversion by controlled fermentation using the strain Beauveria bassiana ATCC 7159.
(98) This strain was cultivated beforehand in a culture medium composed of (per litre of water) 0.5 g/L KH.sub.2PO.sub.4; 1 g/L KH.sub.2PO.sub.4; 1 g/L MgSO.sub.4; 2 g/L NaNO.sub.3; 0.5 g/L KCl; 0.02 g/L FeSO.sub.4; 30 g/L glucose and 10 g/L of corn steep liquor (Rocket). The culture was then agitated at 200 rotations per minute, for 72 hours at 27° C. It was then filtered by non-sterile methods on a filter paper to separate the fungal biomass from the culture medium. The fungal biomass was then washed thoroughly with water and incubated with 60 g of fresh biomass per litre of incubation, that contained 37.5 g of glucose and 15 g of ammonium nitrate.
(99) After incubation, this seeded composition was agitated at 200 rpm for 7 days at a temperature of 27° C.
(100) After 7 days, the incubation medium was filtered on a filter paper, the samples for HPLC assay were also filtered using a 0.45 micron filter (Ait-France, ref: SFNY 013045N).
(101) A brownish solution was obtained which was then analysed and identified by NMR, HPLC, HPLC-MS techniques, in order to obtain a chromatographic footprint, as shown in
(102) The samples obtained were analysed as in example 1.
Example 12: A Composition According to the Invention Before Fermentation
(103) The composition is composed of Withania somnifera at a concentration of 40 g/L, Emblica officinalis at a concentration of 30 g/L, and Bacopa monnieri at a concentration of 30 g/L.
(104) It has been analysed by the same techniques as in the previous example (
Example 13: Characterisation of Elements of the Composition According to Example 12
(105) After the fermentation step, the composition of example 12 was characterised more precisely (
(106) The incubation medium was filtered on a filter paper, the samples for HPLC analysis were also filtered using a 0.45 micron filter (Ait-France, ref: SFNY 013045N) prior to injection for analysis. The markers identified in the composition were Withanoside IV, Withanoside VI, Bacoside A3, Bacopaside X, Bacopasaponin C, as well as gallic acid and its derivative.
(107) ##STR00001## ##STR00002##
(108) Gallic Acid and its Osidic Derivative
Example 14: Composition According to the Invention Before Fermentation
(109) The preparation is composed of Withania somnifera at a concentration of 20 g/L, Emblica officinalis at a concentration of 15 g/L, Bacopa monnieri at a concentration of 15 g/L, Piper longum at a concentration of 20 mg/L, and Curcuma at a concentration of 20 g/L (
Example 15: Anti-Angiogenic Properties of the Compositions of Examples 10 and 11 (Before and after Fermentation)
(110) Biological tests in ovo, according to the chicken chorioallantoic membrane (CAM) technique were conducted using the composition of example 10 and of example 11.
(111) The eggs were supplied by EARL Les Bruyères, DANGERS. The eggs used for the tests were delivered on the day of laying, or no later than the day following the day of laying. The eggs were obtained from a cross of JA57 hens and 166 cocks, which are normally intended to produce 1657 chicks.
(112) Two sets of 12 eggs were treated, 7 days after fertilisation. The first set had 40 μL of the composition from example 10 administered onto the CAM. The second set had 40 μL of the composition from example 11 administered onto the CAM.
(113) Photographs were taken of the CAM before administration, and at 24 h, 48 h and 72 h after administration of the composition, in order to follow the development of vascularisation
(114) At 24 hours, 100% of the embryos from the first set were dead (
(115) After 78 hours, only two embryos from the 12 of the second set are dead. In addition, the fermented composition of example 1 led to a very sharp reduction in the vascular network among all the eggs handled, as observed in
(116) The composition according to the invention therefore has anti-vascularising properties.
(117) In addition, this test evidences the detoxification in ovo of the composition obtained according to the method of the invention.
Example 16: Evaluation of Compound of the Invention as Modulator of VEGF Expression/Secretion
(118) The compounds of examples 8 and 9 were dissolved in DMSO at a stock solution of 10 mg/mL. Starting working concentration was that of 500 ng/mL in DMSO. Avastin (Bevacizumab®, ROCHE, Germany) is used as a positive control. Avastin is a humanized monoclonal antibody to VEGF that inhibits VEGF-receptor interaction. Given its known interaction with VEGF and the induced downstream effects to its receptor, Avastin was used as a positive control for the demonstration of compounds' effects on VEGF expression/secretion.
(119) The tests were performed in endothelial cells, namely replicating human umbilical vein endothelial cells (HUVEC) or in replicating (young) human foreskin fibroblasts (BJ). Both cell types were cultured at 37° C., 5% CO.sub.2 in ambient oxygen concentration. HUVEC cells were cultured in Medium 199 (GIBCO, France) including 15% Fetal Bovine Serum (FBS) and Large Vessel Endothelial Supplement (LVES) 1× (GIBCO). Human newborn foreskin (BJs) fibroblasts were obtained from the American Tissue Culture Collection and were maintained in Dulbecco's modifies Eagle's medium (Gibco Life Technologies), supplemented with 10% (v/v) fetal bovine serum, 2 mM glutamine and 1% non-essential amino acids. In all experimental procedures, proliferating cells were subcultured at a split ratio 1:2 (when confluent) by using a trypsin/EDTA solution (Gibco Life Technologies).
(120) Viability after cell exposure to the compounds or Avastin was determined by the 3-(4,5-dimethylthiazol-2-yl)-2,5 diphenyltetrazolium bromide (MTT) assay (Sigma, France). Used concentrations of the compounds were those of 500 ng/mL up to 10 μg/mL, while concentration of Avastin was that of 125 and 250 μg/mL. Cell were plated in 96-well plates and the day after, were treated with the compounds or Avastin. Then, at 24-hrs post treatment cells' metabolic activity (indicative of cell survival) was measured by the addition of the MTT compound. Specifically, following the completion of the treatment the medium was replaced by MTT dissolved at a final concentration of 1 mg/mL in serum-free, phenol red-free medium. The reduction of the dye by the living cells was allowed to take place for 3-4 h. The MTT solution was discarded and isopropanol was added to dissolve the formazan crystals. The absorbance of the solution was measured at 570 nm wavelength. Survival of control cells was arbitrarily set to 100%. For cell proliferation analyses, seeded cells were viewed-photographed and counted following a period of 96 hrs exposure to the compounds. Briefly, cells were plated in 96-well plates and were left to replicate for 96 hrs in the presence (or absence) of the compounds. Cells' morphology as well as cells' number was then recorded. Cells morphology during treatment was recorded by phase contrast imaging using an Eclipse TS-100F NIKON inverted microscope, while cell number was measured in a cell coulter counter [Countess, Automated Cell Counter (Invitrogen)].
(121) VEGF-165 levels in cell culture supernatant were measured by using the Human VEGF Quantikine ELISA kit (DVE00, R&D Systems); a standard curve was also established as per manufacturer instructions.
(122) To analyze the rate of protein secretion after the addition of the compounds (or in control samples), total cell culture supernatants were collected.
(123) Samples were prepared on ice in NP-40 lysis buffer [150 mM NaCl, NP-40, 1.0%, Tris-Cl 50 mM, pH 8.0] containing protease inhibitors (Phosphatase Inhibitor Cocktail 1 [microcystinLR, cantharidin, (−)-p-bromotetramisole (P2850, SIGMA; France)], Phosphatase Inhibitor Cocktail 2 [sodium orthovanadate, sodium molybdate, sodium tartrate, imidazole (P5726, SIGMA)] and Protease Inhibitor [AEBSF, aprotinin, bestatin, E-64, leupeptin, pepstatin A (P8340, SIGMA)].
(124) Supernatants were centrifuged for 10 min at 19 000 g (4° C.), adjusted by Bradford (Bio-Rad); and were then analyzed by SDS-PAGE to fractionate cell or supernatant protein and immunoblotting using antibodies in order to differentially measure protein expression in the samples analyzed.
(125) Primary antibodies used were against VEGF of human origin [147 (sc-507) or C-1 (7269) from Santa Cruz, Germany]. Secondary antibodies were goat anti-rabbit IgG-HRP sc-2004, goat anti-mouse IgG-HRP sc-2005 (Santa Cruz, Germany). Primary and secondary antibodies were applied for 1 h at room temperature.
(126) Immunoblots were developed using the enhanced chemiluminescence reagent kit “Clarity Western ECL Substrate” (170-5061, BIORAD, USA).
(127) Blots quantification was performed by scanning densitometry.
(128) For gene expression analyses, new primers were designed for the VEGF-A, HIF-1A and MMP-2 genes, as these genes are, likely, activated upon reduced VEGF extracellular signaling.
(129) Sequence of RT-PCR primers is as follows:
(130) H-VEGFA-Forward CGAGGCAGCTTGAGTTAAACG
(131) H-VEGFA-Reverse GGTGAGAGATCTGGTTCCCG
(132) H-HIF1A-Forward GCCAGACGATCATGCAGCTA
(133) H-HIF1A-Reverse ATCCATTGATTGCCCCAGCA
(134) H-MMP2-Forward ATAACCTGGATGCCGTCGTG
(135) H-MMP2-Reverse AGCCTAGCCAGTCGGATTTG
(136) H-B2M-Forward ACT-GAA-TTC-ACC-CCC-ACT-GA
(137) H-B2M-Reverse AAG-CAA-GCA-AGC-AGA-ATT-TGG
(138) H-HMBS-Forward AAG-AGA-CCA-TGC-AGG-CTA-CCA
(139) H-HMB S-Reverse ACA-AGT-TGG-CCA-GGC-TGA-TG
(140) Samples were analyzed by Quantitative Real Time PCR analyses after exposing HUVEC cells for 24 hrs to the compounds of examples 8 and 9. For normalization, two different genes were used, namely B2M and HMBS.
(141) The human B2M or beta-2-microglobulin encodes a serum protein found in association with the major histocompatibility complex (MHC) class I heavy chain on the surface of nearly all nucleated cells.
(142) The HMBS or hydroxymethylbilane synthase encodes a member of the hydroxymethylbilane synthase superfamily. The encoded protein is the third enzyme of the heme biosynthetic pathway and catalyzes the head to tail condensation of four porphobilinogen molecules into the linear hydroxymethylbilane.
(143) Results None of the compounds was toxic in either BJs (
(144) The compound of example 9 (which is detoxified), has a significant effect on the VEGF regulatory pathway, contrary to compound of example 8 (before detoxification).
(145) The results show that this detoxified compound exerts an Avastin-like effect on HUVEC cells.
(146) While illustrative embodiments have been illustrated and described, it will be appreciated that various changes can be made therein without departing from the spirit and scope of the invention.