Expression system for Psicose epimerase and production for Psicose using the same
11111485 · 2021-09-07
Assignee
Inventors
- Jin Sol Heo (Incheon, KR)
- Hye Jung KIM (Daejeon, KR)
- Min Jeong KIM (Suwon-si, KR)
- Jeong Yoon Choi (Seoul, KR)
- Chong Jin PARK (Daejeon, KR)
- Kang Pyo Lee (Seoul, KR)
Cpc classification
C12Y501/03
CHEMISTRY; METALLURGY
C12N15/67
CHEMISTRY; METALLURGY
International classification
Abstract
A gene expression cassette capable of producing psicose at high yield with high stability, a GRAS (Generally recognized as safe) microorganism, a method of producing the enzyme by using the GRAS microorganism, and a method of producing the psicose by using the GRAS microorganism and enzyme are provided.
Claims
1. A method of producing a psicose epimerase, comprising: culturing a recombinant Corynebacterium sp. cell transformed by a vector comprising a gene expression cassette, and reacting a fructose-containing substrate with at least one selected from the group consisting of an psicose epimerase obtained from the culture of the recombinant Corynebacterium sp., a recombinant cell, a culture of the recombinant cell, a lysate of the recombinant cell and an extract of cell culture or the cell lysate, and wherein the gene expression cassette, producing a psicose epimerase in Corynebacterium sp., and comprising: a nucleotide sequence encoding the psicose epimerase; and a regulating sequence being operably connected to the nucleotide sequence in the upstream regulating the expression of the nucleotide sequence in Corynebacterium sp., and comprising a promoter, a ribosome binding site (RBS) sequence and a first spacer sequence in the direction of 5′ to 3′, wherein the promoter includes the nucleotide sequence of SEQ ID NO: 1, the ribosome binding site (RBS) sequence is a nucleotide sequence in a size of 7 to 20 bases including the nucleotide sequence of SEQ ID NO: 2, and the first spacer sequence is selected from the group consisting of the nucleotide sequences of SEQ ID NO: 4 to SEQ ID NO: 6.
2. The method according to claim 1, wherein the reacting step is performed by contacting the fructose-containing substrate with a support immobilized by the psicose epimerase or the recombinant cell.
3. The method according to claim 1, wherein the method comprise further a step of adding at least a metal ion selected from the group consisting of a copper ion, a manganese ion, a calcium ion, a magnesium ion, a zinc ion, a nickel ion, a cobalt ion, an iron ion and an aluminum ion.
4. The method according to claim 1, wherein the fructose-containing substrate comprises a fructose at a concentration of 40 to 75 (w/w) %.
5. The method according to claim 1, wherein the method is performed under the condition of pH 6 to 9 and temperature of 40 to 80° C.
6. The method according to claim 1, wherein the regulating sequence further comprises a second RBS sequence which is connected to 3′-end of the first spacer directly or via a linker sequence in a length of 5 to 100 bases, and wherein the second RBS sequence is a nucleotide sequence in a size of 7 to 20 bases including the nucleotide sequence of SEQ ID NO: 2.
7. The method according to claim 6, wherein the linker sequence is a nucleotide sequence in a size of 42 to 100 bp which includes the nucleotide sequence of SEQ ID NO: 12.
8. The method according to claim 1, wherein the regulating sequence further comprises a second spacer sequence selected from the group consisting of the nucleotide sequences of SEQ ID NO: 7 to SEQ ID NO: 11, wherein the second spacer is connected to 3′-end of the second RBS.
9. The method according to claim 7, wherein the regulating sequence further comprises a second spacer sequence selected from the group consisting of the nucleotide sequences of SEQ ID NO: 7 to SEQ ID NO: 11, wherein the second spacer is connected to 3′-end of the second RBS.
10. The method according to claim 6, wherein the regulating sequence comprise a nucleotide sequence selected from the group consisting of the sequences of SEQ ID NO: 14 to SEQ ID NO: 16.
11. The method according to claim 7, wherein the regulating sequence comprise a nucleotide sequence selected from the group consisting of the sequences of SEQ ID NO: 14 to SEQ ID NO: 16, and the linker sequence of SEQ ID NO: 12.
12. The method according to claim 1, wherein the regulating sequence comprises the promoter nucleotide sequence of SEQ ID NO: 1, the RBS nucleotide sequence of SEQ ID NO: 2, the first spacer sequence selected from the group consisting of the sequences of SEQ ID NO: 4 to SEQ ID NO: 6; and further comprises a second RBS nucleotide sequence of SEQ ID NO: 2, and a second spacer sequence selected from the group consisting of the sequences of SEQ ID NO: 7 to SEQ ID NO: 11.
13. The method according to claim 1, wherein the Corynebacterium sp. is at least one selected from the group consisting of Corynebacterium glutamicum, Corynebacterium acetoglutamicum, Corynebacterium acetoacidophilum, Corynebacterium thermoaminogenes, Corynebacterium melassecola and Corynebacterium efficiens.
14. The method according to claim 1, wherein the psicose epimerase is derived from Clostridium scidens, Treponema primitia, Ensifer adhaerens or Ruminococcus torques.
15. The method according to claim 14, wherein the psicose epimerase is an amino acid sequence selected from the group consisting of nucleotides of SEQ ID NO: 33 to SEQ ID NO: 36.
16. The method according to claim 15, wherein the nucleotide sequence encoding the psicose epimerase is a nucleotide sequence selected from the group consisting of nucleotides of SEQ ID NO: 37 to SEQ ID NO: 44.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1) The file of this patent contains at least one drawing executed in color. Copies of this patent with color drawing(s) will be provided by the Patent and Trademark Office upon request and payment of the necessary fee.
(2)
(3)
MODE FOR INVENTION
(4) A better understanding of the present invention may be obtained through the following examples which are set forth to illustrate, but are not to be construed as the limit of the present invention.
Example 1. Plasmid Production
Example 1-1: Vector Production with Sod Promoter
(5) The nucleotide sequence (CDPE gene; Genbank: EDS06411.1) encoding psicose epimerase derived from Clostridiuim scindens ATCC 35704 was optimized for E. coli to produce a modified nucleotide sequence which was called as CDPE. The optimized polynucleotide (SEQ ID NO: 36), sod regulating sequence (SEQ ID NO: 17: sod promoter-RBS-SPACER R1TT-LINKER) derived from Corynebacterium gDNA, and T7 terminator of pET21a vector were amplified by PCR method to produce each template and were ligated to one template according to the overlapping PCR method. The one template was cloned into pGEM T-easy vector according to T-vector cloning method and was analyzed for the sequence. Specifically, the polynucleotide included the sod regulating sequence of SEQ ID NO: 17, the optimized CDPE coding sequence for E. coli of SEQ ID NO: 36, and T7-terminator.
(6) The whole polynucleotide was inserted into the same restriction recognition site of pCES208 (J. Microbiol. Biotechnol., 18:639-647, 2008) with restriction enzyme NotI and XbaI (NEB), to produce the recombinant vector of pCES208/psicose epimerase (pCES_sodCDPE). The cleavage map of recombinant vector (pCES_sodCDPE) is shown in
Example 1-2: Vector Production with Saturation Mutagenesis
(7) In order to prepare a vector using the saturation mutagenesis, the primers including -NN- as a target site were prepared. Specifically, TT in the 3′-end of first RBS (GAAGGA) and the second RBS were decided as target site and asked Genotec to synthesize the primer. The primer sequences, saturation mutagenesis site, and primer binding site were summarized in Table 2.
(8) TABLE-US-00003 TABLE 2 Primer name sequence (5′ -> 3′) SEQ ID NO RBS1_F GGTGCGGAAACCTACGAAAGGANNTTTTACCCATGGCTGTATACG 45 AAC RBS1_R GTTCGTATACAGCCATGGGTAAAANNTCCTTTCGTAGGTTTCCGC 46 ACC RBS2_F GACTACGCATACGACGAAAGGANNACAAAATGAAACACGGTATCT 47 ACTAC RBS2_R GTAGTAGATACCGTGTTTCATTTTGTNNTCCTTTCGTCGTATGCGT 48 AGTC
(9) The front fragment and the rear fragment divided by a reference site of -NN- were obtained by PCR, to produce one template produced according to the overlapping PCR method. The template was inserted into pCES208 plasmid by ligating with XbaI and NotI site, so as to obtain the plasmid according to the Saturation mutagenesis.
Example 2. Transformation and Screening Transformed E. coli
Example 2-1: E. coli Transformation
(10) E. coli DH10b strain was transformed with the plasmid obtained in EXAMPLE 1 by electrophoresis and screened. Specifically, kanamycin was poured to 1.5 ml tube to be 15 μg/ml of the final concentration of kanamycin, and add with 1 ml of LB (tryptone 10 mg/L, NaCl 10 mg/L, yeast extract 5 mg/L). The randomly-selected colonies were inoculated on the plate and cultured at 37° C. for about 16 hours. Then, the cell was harvested to remove the culture medium, was reacted with 50% fructose (substrate) dissolved in 50 mM PIPES buffer (pH 7.0) by the addition of 1 mM Mn.sup.2+ at 60° C. for 30 minutes, and quenched at 100° C. for 5 minutes.
Example 2-2: Screening with Psicose Conversion Rate
(11) The product of EXAMPLE 2-1 was analyzed with LC analysis to compare the conversion rate of psicose with that of pCES_sodCDPE. Then, the transformant with modified gene having a higher conversion rate was selected. Specifically, the conversion rate was obtained by analyzing the LC peak of substrate (fructose) and product (psicose) and the peak area.
(12) The comparison of LC peak area confirmed that the decreasing extent of psicose production and substrate consumption. The standard curves were obtained by preparing the samples with different fructose concentrations of 10, 20, 50, 100, 120, 150 mM and the samples with different psicose concentration of 1, 2, 5, 10, 20, 50 mM to be R.sup.2 of 0.99 or higher. Then, each formula was inferred from the standard curves, and the fructose concentration and psicose concentration were obtained by using the LC peak area.
(13) The final values were indicated as psicose conversion rate which was proportional to the amount of expressed CDPE. Thus, as the amount of produced psicose increase, the amount of expressed CDPE increases.
(14) As a result, 6 mutants including three mutants at R1 site and 3 mutants at R2 site were selected and designated as name R1-1, R1-4, R1-8, R2-1, R2-5, or R2-11. Compared to the LC analysis result of the control including unmodified sequence (pCES_sod CDPE), four mutants were selected based on the psicose conversion rate and shown in Table 3.
(15) TABLE-US-00004 TABLE 3 Sample Psicose conversion rate (%) sod_CDPE 5.15 R1-1 8.59 R1-4 8.94 R2-5 5.66 R2-11 6.07
(16) As shown in Table 3, finally-selected mutants showing increased conversion rate of psicose were R1-1 and R1-4 at R1 site and R2-5 and R2-11 at R2 site, and thus, 4 mutants showed increased CDPE expression.
Example 2-3: Identification of Modified Sequence
(17) On the basis of nucleotide sequence of SEQ ID NO: 3 in the unmodified pCES_sodCDPE, R1-1 had GA substituted and R1-4 had GG substituted at TT of control target site.
(18) On the basis of nucleotide sequence of SEQ ID NO: 7 in the non-mutated pCES_sodCDPE, R2-5 and R2-11 had GG substituted at TT of control target site.
Example 3. Measurement of CDPE Expression Rate in Corynebacterium
(19) Corynebacterium glutaricum was transformed with the plasmid obtained in EXAMPLE 1 by electrophoresis. The colony was inoculated on LB medium (tryptone 10 g/L, NaCl 10 g/L, yeast extract 5 g/L) enriched with Kanamycin to be final concentration of Kanamycin as 15 μg/ml, and cultured at 30° C. and 250 rpm for 16 hours. Then, 1 mL of culture solution was inoculated in 100 ml LB medium containing 15 μg/ml of Kanamycin and then cultured at 30° C. and 250 rpm for 16 hours.
(20) The recombinant Corynebacterium glutaricum transformed with the plasmid obtained in EXAMPLE 1-1 (pCES_sodCDPE) was deposited on Oct. 29, 2014, at the Korea Culture Center of Microorganisms (KCCM) located at 25 Hongjenae-2ga-gil, Seodaemun-gu, Seoul, Republic of Korea, as Accession number of KCCM11593P.
(21) In addition, Corynebacterium glutaricum was transformed with 4 mutants obtained in EXAMPLE 2 respectively and obtained by culturing them in 100 mL of LB medium. The cells were lysed and purified by using His-tag purification method. Then, the cell lysate was carried out with SDS-PAGE to identify the conversion rate of CDPE.
(22) Specifically, the cultured cells were lysed with Bead beater and the supernatant was collected, mixed with sample buffer at 1:1 and heated at 100° C. for 5 minutes. The prepared sample was analyzed with electrophoresis by suing 12% SDS-PAGE gel (composition: running gel—3.3 ml H.sub.2O, 4.0 ml 30% acrylamide, 2.5 ml 1.5M Tris buffer (pH 8.8), 100 μl 10% SDS, 100 μl, 10% APS, 4 μl TEMED/stacking gel—1.4 ml H.sub.2O, 0.33 ml 30% acrylamide, 0.25 ml 1.0 M Tris buffer (pH 6.8), 20 μl 10% SDS, 20 μl 10% APS, 2 μl TEMED) at 180 V for 50 minutes to identify the protein expression.
(23) After identifying the CDPE expression on SDS-PAGE gel, the product was purified according to His-Tag purification method using Ni-NTA resin, and the conversion rate of psicose was calculated by using the formula of conversion rate (%)=(Purified protein (mg)/Total soluble protein (mg))*100). The calculated conversion rate was indicated in Table 4.
(24) In following Table 4, the whole cellular proteins means all proteins inside the cell expressing cell psicose epimerase, and the amount of psicose epimerase is referred to an amount of purified psicose epimerase. Therefore, the conversion rate means the calculated value showing a ratio of expressed target protein to the whole cellular proteins.
(25) TABLE-US-00005 TABLE 4 sample CDPE conversion rate (%) Sod_CDPE 10 R1-1 15 R1-4 9.5 R2-5 8.3 R2-11 8.5
(26) As shown in Table 4, the concentration of purified CDEP of R1-1 showed about 1.5 times as high as the transformant with recombinant vector (pCES_sodCDPE). On the other hand, other samples showed a low conversion rate.
Example 4. Psicose Production by Using Enzyme Reaction
(27) Corynebacterium glutaricum was transformed with 4 mutants of R1-1, R1-4, R2-5, and R2-11 obtained in EXAMPLE 2 respectively and obtained by culturing them in 100 mL of LB medium. The unpurified crude enzyme was used for converting 50 mM fructose-containing substrate to psicose. Then, the amount of produced psicose was analyzed.
(28) The mutant cells expressing CDPE were broken. The supernatant including the protein was obtained, measured to be 0.007 mg/ml of the concentration of whole cellular protein, and added to the substrate containing 50 mM fructose added by 1 mM Mn.sup.2+. Then, the reaction was carried out at pH 7.0 PIPES 50 mM and 60° C. for 5, 10, or 15 minutes, and then quenched with heating at 100° C. for 5 minutes.
(29) The conversion rate of psicose was compared by LC analysis. Specifically, the conversion rate was obtained by analyzing the LC peak of substrate (fructose) and product (psicose) and the peak area.
(30) The LC analysis was performed by using Refractive Index Detector (Agilent 1260 RID) of HPLC (Agilent, USA) equipped with Aminex HPX-87C column (BIO-RAD), water with the temperature of 80° C. as a mobile phase, and the column speed of 0.6 ml/min. Then, the conversion rate of psicose was calculated on the basis of the formula of conversion rate by using the amount of produced psicose and unconsumed fructose measured from the LC peak. The calculated values are shown in Table 5.
Conversion rate (%)=Amount of produced psicose (g/l)/(amount of produced psicose+amount of remaining fructose) (g/l)*100 [Formula]
(31) TABLE-US-00006 TABLE 5 Psicose conversion rate (%) Sample at reaction for 5 minutes Sod-CDPE 15.66 R1-1 17.24 R1-4 14.39 R2-5 14.10 R2-11 13.65
(32) As shown in Table 5, the conversion rate of R1-1 was higher than sod-CDPEII. Other modified sequence showed a somewhat reduction of conversion rate, compared to sod-CDPE.
Example 5. Psicose Production by Using Corynebacterium Cell Reaction
(33) Corynebacterium glutaricum was transformed with 4 mutants of R1-1, R1-4, R2-5, and R2-11 obtained in EXAMPLE 2 respectively and obtained by culturing them in 100 mL of LB medium. The substrate containing 50 wt % of fructose was reacted by using the cell reaction and the conversion rate was compared.
(34) Specifically, The 0.5 to 2 mg/ml of mutant cells expressing CDPE were added to the substrate containing fructose at solid content of 50 wt % and 1 mM Mn.sup.2+, reacted at pH 7.0 PIPES 50 mM and 60° C. and quenched by heating at 100° C. for 5 minutes.
(35) The conversion reaction was performed by using each mutant cell and the conversion rate was calculated according to the LC analysis method. the LC analysis was performed by using Refractive Index Detector (Agilent 1260 RID) of HPLC (Agilent, USA) equipped with Aminex HPX-87C column (BIO-RAD), water with the temperature of 80° C. as a mobile phase, and the column speed of 0.6 ml/min. Then, the conversion rate of psicose was calculated on the basis of the formula of conversion rate by using the amount of produced psicose and unconsumed fructose measured from the LC peak. The calculated values are shown in Table 6.
Conversion rate (%)=amount of produced psicose (g/l)/(amount of produced psicose+amount of unconsumed fructose) (g/l)*100 [Formula]
(36) TABLE-US-00007 TABLE 6 Sample Psicose conversion rate (%) Sod-CDPEII 6.02 R1-1 8.34 R1-4 5.99 R2-5 4.79 R2-11 5.29
(37) As shown in Table 6, the conversion rate of mutant R1-1 was higher than sod-CDPEII. Other modified sequence showed a somewhat reduction of conversion rate, compared to sod-CDPE.
Example 6: Comparison of Heat Stability in Corynebacterium Cell Reaction
(38) Besides the high conversion rate of the cell, the cell converting the psicose epimerase stably is also important in the industrial field. Therefore, this experiment was carried out to confirm the heat stability of the cell.
(39) In order to confirm the heat stability of cell at 50° C., 1.0 mg/ml of cells pre-treated with surfactant was re-suspended in 50 mM PIPES buffer (pH 7.0) and heated at 50° C. The cell was sampled at each heating hour and was used for the conversion reaction that the sampled cell was added to substrate containing 50% fructose and 1 mM of Mn.sup.2+ and reacted at 50° C. for 60 minutes.
(40) The psicose conversion rate and the decreased extent of sampled cells were shown in Table 7, by referencing zero of conversion rate and zero of heating time.
(41) TABLE-US-00008 TABLE 7 psicose Relative psicose conversion Relative heat conversion heat Reaction rate (%) of stability of rate (%) stability Minutes pCES_sodCDPE pCES_sodCDPE of R1-1 of R1-1 0 8.4 100 11.62 100 120 7.5 89.21 10.77 92.7 240 7.27 86.56 9.56 82.27 360 7.02 83.52 9.03 77.74 540 6.81 81.05 9.19 79.1 840 6.54 77.88 8.9 76.6 1020 6.52 77.65 8.4 72.31 1200 6.15 73.17 7.32 62.98 1320 5.94 70.64 8.04 69.24 1560 5.92 70.42 8.15 70.14 1680 5.71 67.92 7.75 66.75 1740 5.24 62.32 6.82 58.73
(42) As shown in Table 7, the heat stability of R-1 was not different from pCES_sodCDPE and thus R1-1 mutant had good heat stability. The half-life of R1-1 was expected to be about 1800 minutes.
Example 7: Production of Modified Regulating Sequence and CDPE Expression
Example 7-1: Vector Production Including a Modified Regulating Sequence
(43) TT in the 3′-end of first RBS (GAAGGA) and the second RBS were decided as target site and asked Genotec to synthesize the -NN-primer in order to substitute TT with GT, GC, or GG. The primer sequences, saturation mutagenesis site, and primer binding site were summarized in Table 8.
(44) TABLE-US-00009 TABLE 8 Primer sequence (5′->3′) Seq ID No RBS1GT_F GGTGCGGAAACCTACGAAAGGAGTTTTTACCCATGGCTGTATAC 49 GAAC RBS1GT_R GTTCGTATACAGCCATGGGTAAAAACTCCTTTCGTAGGTTTCCGC 50 ACC RBS1GC_F GGTGCGGAAACCTACGAAAGGAGCTTTTACCCATGGCTGTATAC 51 GAAC RBS1GC_R GTTCGTATACAGCCATGGGTAAAAGCTCCTTTCGTAGGTTTCCGC 52 ACC RBS1GG_F GGTGCGGAAACCTACGAAAGGAGGTTTTACCCATGGCTGTATAC 53 GAAC RBS1GG_R GTTCGTATACAGCCATGGGTAAAACCTCCTTTCGTAGGTTTCCGC 54 ACC
(45) The front fragment and the rear fragment divided by a reference site of -NN- were obtained by PCR, to produce one template produced according to the overlapping PCR method. The template was inserted into pCES208 plasmid by ligating with XbaI and NotI site, so as to obtain the plasmid according to the Saturation mutagenesis.
Example 7-2: Measurement of CDPE Expression Rate
(46) Corynebacterium glutaricum was transformed with the plasmid including the mutated sequence obtained in EXAMPLE 7-2, cultured in 100 ml of LB medium, and lysed and purified according to the His-tag purification method using Ni-NTA resin. The concentration of whole cellular protein and the purified protein (CDPE) were measured according to Bradford assay and the conversion rate of target protein was calculated.
(47) Specifically, the cultured cells were lysed with Bead beater and the supernatant was collected, mixed with sample buffer at 1:1 and heated at 100° C. for 5 minutes. The prepared sample was analyzed with electrophoresis by suing 12% SDS-PAGE gel (composition: running gel—3.3 ml H.sub.2O, 4.0 ml 30% acrylamide, 2.5 ml 1.5M Tris buffer (pH 8.8), 100 μl 10% SDS, 100 μl, 10% APS, 4 μl TEMED/stacking gel—1.4 ml H.sub.2O, 0.33 ml 30% acrylamide, 0.25 ml 1.0 M Tris buffer (pH 6.8), 20 μl 10% SDS, 20 μl 10% APS, 2 μl TEMED) at 180 V for 50 minutes to identify the protein expression.
(48) After identifying the CDPE expression on SDS-PAGE gel, the product was purified according to His-Tag purification method using Ni-NTA resin, and the conversion rate of psicose was calculated by using the formula of conversion rate (%)=(Purified protein (mg)/Total soluble protein (mg))*100). The calculated conversion rate was indicated in Table 9.
(49) TABLE-US-00010 TABLE 9 Whole cellular psicose epimerase plasmid protein(mg) enzyme (mg) conversion rate (%) pCES_sodCII 10.7 1.1 10.3 R1GA 11.5 1.7 14.8 R1GT 10.9 1.6 14.7 R1GC 8.2 0.8 9.8 R1GG 10.8 0.7 6.5
(50) As shown in Table 9, the conversion rates of R1GA and R1GT were higher than pCES_sodCDPE. R1GC shows similar enzyme activity and R1GG showed decreased enzyme activity.
Example 7-3: Psicose Production with Cellular Reaction
(51) According to the substantially same method of EXAMPLE 5, Corynebacterium strain was transformed with mutants respectively, cultured in 100 ml of LB medium, and add to the psicose conversion reaction to compare the psicose conversion rate. The result was shown in Table 10.
(52) TABLE-US-00011 TABLE 10 sample psicose conversion rate (%) Relative conversion rate (%) R1GG 4.58 100 R1TT 6.73 147 R1GA 9.76 213 R1GT 9.17 200 R1GC 7.39 161
(53) As shown in Table 10, by referencing 100 of psicose conversion rate of R1GG, the relative conversion rate of R1GA was 213, R1GT was 200, and R1GC was 161, and R1TT was 147. Therefore, all mutant showed increased conversion rate.
7-4: Comparison of Heat Stability in Cell Reaction
(54) Besides the high conversion rate of the cell, the cell converting the psicose epimerase stably is also important in the industrial field. Therefore, this experiment was carried out to confirm the heat stability of the cell.
(55) In order to confirm the heat stability of cell at 50° C., 1.0 mg/ml of cells pre-treated with surfactant was re-suspended in 50 mM PIPES buffer (pH 7.0) and heated at 50° C. The cell was sampled at each heating hour and was used for the conversion reaction that the sampled cell was added to substrate containing 50% fructose and 1 mM of Mn.sup.2+ and reacted at 50° C. for 60 minutes.
(56) The psicose conversion rate and the decreased extent of sampled cells were shown in Table 11, by referencing zero of conversion rate and zero of heating time.
(57) TABLE-US-00012 TABLE 11 Reaction minutes pCES_sodCII R1GA R1GT R1GC R1GG 0 100 100 100 100 100 240 86.6 82.3 83.9 91 83.8 360 83.5 77.7 74.1 84.8 79.2 840 77.9 76.6 72.3 84.7 78.1 1200 73.2 75.8 73.2 81.9 64.2 1560 70.4 70.1 66.9 77.6 62.3 1680 67.9 66.7 65.2 73.8 56.1 1740 62.3 58.7 56.2 52.4 55.3
Example 8: Production of Modified Regulating Sequence and CDPE Expression
8-1: Vector Production Including a Modified Regulating Sequence
(58) As a result of the modified sequence according to the Saturation mutagenesis, TT located in the first spacer after the first RBS affected the CDPE expression. Thus, TT located in the first spacer after the first RBS was substituted with GT, GC, or GG, tested for the CDPE expression and selected as R1-1(GA substituted for TT after the first RBS). The nucleotide sequence of R1-1 was used as a template for substituting TT after the second RBS with GA, GT, GC, or GG. The mutants were tested for the psicose conversion rate.
(59) The double mutants were produced by using the mutant (R1-1) obtained in EXAMPLE 5 as a template and the following primer in Table 12.
(60) TABLE-US-00013 TABLE 12 Primer Sequence (5′->3′) SEQ ID NO RBS1GA/RBS2GA_F GACTACGCATACGACGAAAGGAGAACAAAATGAA 55 ACACGGTATCTACTAC RBS1GA/RBS2GA_R GTAGTAGATACCGTGTTTCATTTTGTTCTCCTTTC 56 GTCGTATGCGTAGTC RBS1GA/RBS2GT_F GACTACGCATACGACGAAAGGAGTACAAAATGAA 57 ACACGGTATCTACTAC RBS1GA/RBS2GT_R GTAGTAGATACCGTGTTTCATTTTGTACTCCTTTC 58 GTCGTATGCGTAGTC RBS1GA/RBS2GC_F GACTACGCATACGACGAAAGGAGCACAAAATGAA 59 ACACGGTATCTACTAC RBS1GA/RBS2GC_R GTAGTAGATACCGTGTTTCATTTTGTGCTCCTTTC 60 GTCGTATGCGTAGTC RBS1GA/RBS2GG_F GACTACGCATACGACGAAAGGAGGACAAAATGAA 61 ACACGGTATCTACTAC RBS1GA/RBS2GG_R GTAGTAGATACCGTGTTTCATTTTGTCCTCCTTTC 62 GTCGTATGCGTAGTC
8-2: Measurement of CDPE Expression Rate
(61) According to the same method of EXAMPLE 7-2, Corynebacterium glutaricum was transformed with the plasmid including the modified regulating sequence. The CDPE conversion rate was determined and indicated in Table 13.
(62) As shown in Table 13, the whole cellular proteins means all proteins inside the cell expressing cell psicose epimerase, and the amount of psicose epimerase is referred to an amount of purified psicose epimerase. Therefore, the conversion rate means the calculated value showing a ratio of expressed target protein to the whole cellular proteins.
(63) TABLE-US-00014 TABLE 13 whole cellular protein psicose epimerase conversion microorganism (mg) enzyme (mg) rate (%) pCES_sodCII 10.7 1.1 10.3 R1GA/R2GA 10.3 1.5 14.5 R1GA/R2GT 10.7 1.6 15.0 R1GA/R2GC 12.8 1.8 14.1 R1GA/R2GG 11.9 1.7 14.3
(64) As shown in Table 13, the double mutations of R1GA/R2GA, R1GA/R2GT, R1GA/R2GC and R1GA/R2GG showed an increased conversion rate of CDPE than pCES_sodCDPE.
8-3: Psicose Production by Using Cellular Reaction
(65) According to the same method of EXAMPLE 8-2, Corynebacterium glutaricum was transformed with the plasmid including the modified regulating sequence, and cultured in 100 ml of LB medium. The CDPE conversion rate was determined by the cellular reaction and indicated in Table 14.
(66) To identify the product, the conversion rate was obtained by analyzing the LC peak of substrate (fructose) and product (psicose) and the peak area. As a result, the initial psicose production rate of cell (Unit/g-DCW) was analyzed by using on various surfactant solutions and indicated in Table 14.
(67) The LC analysis was performed by using Refractive Index Detector (Agilent 1260 RID) of HPLC (Agilent, USA) equipped with Aminex HPX-87C column (BIO-RAD), water with the temperature of 80° C. as a mobile phase, and the column speed of 0.6 ml/min.
(68) TABLE-US-00015 TABLE 14 psicose conversion Sample rate (%) Relative conversion rate (%) R1GG 4.58 100 R1GA/R2GC 9.95 217
(69) As shown in Table 14, the relative conversion rate (%) of double mutation R1GA/R2GC on showed 217, on the basis of 100 of psicose conversion rate of R1GG.
8-4: Comparison of Heat Stability in Cellular Reaction
(70) Besides the high conversion rate of the cell, the cell converting the psicose epimerase stably is also important in the industrial field. Therefore, this experiment was carried out to confirm the heat stability of the cell.
(71) In order to confirm the heat stability of cell at 50° C., 1.0 mg/ml of cells pre-treated with surfactant was re-suspended in 50 mM PIPES buffer (pH 7.0) and heated at 50° C. The cell was sampled at each heating hour and was used for the conversion reaction that the sampled cell was added to substrate containing 50% fructose and 1 mM of Mn.sup.2+ and reacted at 50° C. for 60 minutes.
(72) The psicose conversion rate and the decreased extent of sampled cells were shown in Table 15 by referencing zero of conversion rate and zero of heating time.
(73) TABLE-US-00016 TABLE 15 Reaction times R1GA/ R1GA/ R1GA/ R1GA/ (minutes) pCES_sodCII R2GA R2GT R2GC R2GG 0 100 100 100 100 100 240 86.6 86.9 90.8 90.4 88.5 360 83.5 90 81.5 92.2 83.6 840 77.9 80.9 68.4 77.4 82.4 1200 73.2 77.3 64.6 73.6 72.2 1560 70.4 74.1 62.7 70.8 75.4 1680 67.9 70.5 59.6 67.4 71.8 1740 62.3 66.4 56.9 61.7 63.2
(74) As shown in Table 15, by comparing the heat stability of pCES_sodCDPE and double mutation, the heat stability of double mutation was not different from pCES_sodCDPE and thus the double mutant had good heat stability. Accordingly, the modified regulating sequence affect the expression of CDPE, but not influence the heat stability.