White rust resistant chrysanthemum plants

11122755 · 2021-09-21

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to white rust resistant plants of the genus Chrysanthemum and to seeds, plant parts, plant cells and progeny thereof. The present invention further relates to means, and particularly molecular markers for identifying white rust resistant plants of the genus Chrysanthemum. Specifically, the present invention relates to plants belonging to the genus Chrysanthemum, the plants are resistant to white rust and the plants comprise in their genome at least one genomic region, or gene or allele, providing white rust resistance, the at least one genomic region, or gene or allele, providing white rust resistance is genetically linked to a nucleic acid sequence comprised in at least one copy in the genome of the resistant plants and is represented by SEQ ID No. 3.

Claims

1. A white rust resistant plant belonging to the genus Chrysanthemum, comprising in its genome at least one genomic region, gene, or allele providing white rust resistance, said at least one genomic region, gene, or allele providing white rust resistance being genetically linked to a nucleic acid having the sequence of SEQ ID No. 3, seed of said plant having been deposited with NCIMB under Accession No. NCIMB 42762.

2. The plant according to claim 1, wherein said plant further comprises in its genome a further genomic region, gene, or allele providing white rust resistance, said further white rust resistance providing genomic region, gene, or allele being genetically linked to a nucleic acid having the sequence of SEQ ID No. 2.

3. The plant according to claim 1, wherein said plant further comprises in its genome a further genomic region, gene, or allele providing white rust resistance, said further white rust resistance providing genomic region, gene, or allele being genetically linked to a nucleic acid having the sequence of SEQ ID No. 1.

4. The plant according to claim 1, wherein said plant further comprises in its genome a further genomic region, gene, or allele providing white rust resistance, said further white rust resistance providing genomic region, gene, or allele being genetically linked to a nucleic acid having the sequence of SEQ ID No. 2, and wherein said plant further comprises in its genome a second further genomic region, gene, or allele providing white rust resistance, said second further white rust resistance providing genomic region, gene, or allele being genetically linked to a nucleic acid having the sequence of SEQ ID No. 1.

5. The plant according to claim 1, wherein said plant comprises five copies or less of a nucleic acid having a sequence selected from the group consisting of SEQ ID No. 4, SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 7, SEQ ID No. 8, and SEQ ID No. 9.

6. The plant according to claim 1, wherein said plant is a cut Chrysanthemum or said plant is a pot Chrysanthemum.

7. The plant according to claim 1, wherein a causative pathogen of said white rust is Puccinia horiana.

8. The plant according to claim 1, wherein said plant comprises in its genome at least three genomic regions, genes, or alleles providing white rust resistance, the first genomic region, gene, or allele providing white rust resistance being genetically linked to the genomic nucleic acid having the sequence of SEQ ID No. 3, the second genomic region, gene, or allele providing white rust resistance being genetically linked to a genomic nucleic acid having the sequence of SEQ ID No. 2, and the third genomic region, gene, or allele providing white rust resistance being genetically linked to a genomic nucleic acid having the sequence of SEQ ID No. 1.

9. The plant according to claim 1, wherein said plant is a Chrysanthemum x morifolium plant, and wherein said plant is resistant to the white rust pathogen Puccinia horiana.

10. A seed, plant part or plant cell of the Chrysanthemum plant according to claim 1, wherein said seed, plant part or plant cell comprises said at least one genomic region, gene, or allele providing white rust resistance being genetically linked to a nucleic acid having the sequence of SEQ ID No. 3.

11. A progeny of the Chrysanthemum plant according to claim 1, wherein said progeny comprises said at least one genomic region, gene, or allele providing white rust resistance being genetically linked to a nucleic acid having the sequence of SEQ ID No. 3.

12. The progeny of the Chrysanthemum plant according to claim 11, wherein said progeny further comprise in its genome a further genomic region, gene, or allele providing white rust resistance, said further white rust resistance providing genomic region, gene, or allele being genetically linked to a nucleic acid having the sequence of SEQ ID No. 2 or SEQ ID No. 1.

13. A Chrysanthemum plant grown from seed deposited with NCIMB under Accession No. NCIMB 42762, wherein the Chrysanthemum plant is resistant to white rust and comprises in its genome SEQ ID NO: 3.

14. A seed, plant part, or plant cell of the Chrysanthemum plant of claim 13, wherein the seed, plant part, or plant cell is resistant to white rust and comprises in its genome SEQ ID NO: 3.

15. A method for producing a progeny Chrysanthemum plant that is resistant to white rust, the method comprising crossing a first Chrysanthemum plant that is resistant to white rust, said first plant grown from a seed deposited with NCIMB under Accession No. NCIMB 42762 with a second Chrysanthemum plant to generate offspring; and selecting one or more progeny Chrysanthemum plants that are resistant to white rust and comprise in their genome SEQ ID NO: 3.

16. The method of claim 15, wherein said progeny further comprises in its genome a further genomic region, gene, or allele providing white rust resistance, said further white rust resistance providing genomic region, gene, or allele being genetically linked to a nucleic acid having the sequence of SEQ ID No. 2 or SEQ ID No. 1.

17. The method of claim 15, wherein said progeny comprise five copies or less of a nucleic acid having a sequence selected from the group consisting of SEQ ID No. 4, SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 7, SEQ ID No. 8, and SEQ ID No. 9.

18. The method of claim 15, wherein a causative pathogen of said white rust is Puccinia horiana.

19. A seed, plant part, or plant cell of a progeny plant produced by the method of claim 15, wherein said seed, plant part or plant cell comprises at least one genomic region, gene, or allele providing white rust resistance being genetically linked to a nucleic acid having the sequence of SEQ ID No. 3.

20. The method according to claim 15, wherein said second Chrysanthemum plant is selected from the group consisting of Chrysanthemum x morifolium; Chrysanthemum x grandiflorum; Chrysanthemum x rubellum; Chrysanthemum abolinii; Chrysanthemum achillaea L.; Chrysanthemum alabasicum; Chrysanthemum brachyanthum; Chrysanthemum carinatum; Chrysanthemum chalchingolicum; Chrysanthemum cinerariifolium; Chrysanthemum coccineum; Chrysanthemum coreanum; Chrysanthemum coronarium; Chrysanthemum decaisneanum; Chrysanthemum delavayanum; Chrysanthemum dichrum; Chrysanthemum fastigiatum; Chrysanthemum frutescens; Chrysanthemum gracile; Chrysanthemum grubovii; Chrysanthemum horaimontanum; Chrysanthemum hypoleucum; Chrysanthemum indicum L.; Chrysanthemum junnanicum; Chrysanthemum kinokuniense; Chrysanthemum kokanicum; Chrysanthemum konoanum; Chrysanthemum majus; Chrysanthemum marginatum; Chrysanthemum mawei; Chrysanthemum maximum L.; Chrysanthemum miyatojimense; Chrysanthemum morifolium; Chrysanthemum multifidum; Chrysanthemum nitidum; Chrysanthemum parvifolium; Chrysanthemum przewalskii; Chrysanthemum purpureiflorum; Chrysanthemum ramosum; Chrysanthemum rhombifolium; Chrysanthemum roborowskii; Chrysanthemum segetum; Chrysanthemum shihchuanum; Chrysanthemum shimotomaii; Chrysanthemum trilobatum; Chrysanthemum tripinnatisectum; Chrysanthemum vestitum; Chrysanthemum vulgare (L.); Chrysanthemum yoshinyanthemum; and Chrysanthemum zawadskii.

Description

(1) The present invention will be further detailed in the example presented below. In the examples, reference is made figure wherein:

(2) FIG. 1: graphically shows the correlation between the estimated ratio between copies of the resistant allele and the susceptible allele and KASP genotype at two resistance loci (SNP 115 and SNP 123). For both GBS ratio and KASP ratio, a larger value indicates more copies of the resistant allele;

(3) FIG. 2: graphically shows association between genotyping-by-sequencing dosage score and resistance profile at two SNP markers in F1 individuals (selection 08041×selection 02033 cross). At both markers the association was strongly significant as individuals carrying more copies of the resistant allele were generally more resistant;

(4) FIG. 3: graphically shows association between KASP genotype score and resistance profile at two SNP markers in F1 individuals (selection 08041×selection 02033 cross). At both markers the association was strongly significant.

(5) FIG. 4: shows histograms showing the distributions of multiplex GBS dosage ratios in the F1 offspring. A larger GBS ratio indicates that that individual carries more “resistant” copies of the haplotype described;

EXAMPLES

Example 1

(6) Introduction

(7) Martin, P., & Firman, I. (1970). Resistance of Chrysanthemum Cultivars to White Rust (Puccinia horiana). Plant Pathology, 180-184 discloses several varieties of Chrysanthemum white rust resistant plants. In order to asses whether the genomic sequences linked white rust, i.e. SEQ ID Nos 1 and 2, are found in the disclosed Chrysanthemum cultivars, these cultivars were subjected to marker analyses and the results are presented in Table 1 below:

(8) TABLE-US-00001 TABLE 1 Phenotype after inoculation with NL1 isolate of P. horiana of Chrysanthemum varieties previously reported by Martin (1970) to be resistant or immune to P. horiana. Phenotype according SEQ ID SEQ ID Variety to Martin (1970) Phenotype No. 1.sup.2 No. 2 Alec Bedser Immune N.t..sup.1 − − Fred Shoesmith Immune Susceptible − − Marlene Immune Susceptible − − Polaris Immune Susceptible − − Regalia Immune N.t. + − Streamer Immune Susceptible N.t. N.t. Sweetheart Immune Susceptible − − Target Immune N.t. − − Vibrant Immune N.t. N.t. N.t. Bravo Moderate resistant Susceptible N.t. N.t. Corsair Practically immune Susceptible − − Discovery Practically immune Susceptible − − Glamour Practically immune Resistant + − Rivalry Practically immune Susceptible − − .sup.1N.t. = not tested .sup.2−: SEQ ID is not present, +: gene is present
As can be clearly seen, none of the above plants disclosed in Martin et al., comprise a genomic sequence represented by SEQ ID No. 2.

Example 2

(9) Introduction

(10) White rust is a disease in plants causing major economic losses for crop and flower breeders worldwide. White rust also affects plants in the Chrysanthemum genus, and is generally caused by the fungus Puccinia horiana. Following infection, pale-green to yellow spots which can be up to 5 mm diameter in size, develop on the upper surface. The centers of these spots become brown and necrotic in time as the plants age. On the lower surface of the leaves, raised, buff or pinkish pustules (telia) develop. The disease is generally carried on infected cuttings and plants, including cut flowers, of glasshouse Chrysanthemums.

(11) Two genomic regions, or genes, genetically linked to molecular markers SEQ ID Nos 1 and 2 affecting resistance have been previously identified, and alleles conferring resistance at each of these loci exist in the varieties an example thereof has been deposited under number NCIMB 42455 and can be obtained through the National Collection of Industrial, Food and Marine Bacteria (NCIMB), Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen AB21 9YA, United Kingdom. While both loci explain substantial amounts of variation in crosses created with the resistant varieties, they fail to explain patterns of resistance in a number of other breeds. For example, some breeds are fully resistant against white rust despite lacking alleles conferring resistance at the loci identified in NCIMB 42455. This suggests that there are, yet unknown, genes which affect resistance in Chrysanthemums. The example presented here has identified one such genomic region, or gene or allele. A plant comprising the present genomic region or gene and SEQ ID No. 3 genetically linked therewith has been deposited under number NCIMB 42762 and can be obtained through the National Collection of Industrial, Food and Marine Bacteria (NCIMB), Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen AB21 9YA, United Kingdom.

(12) Methods

(13) Crossing Scheme and Experimental Setup

(14) To test for associations between SNP markers and resistance profile, an F1 population was created by crossing an individual from the resistant santini chrysanthemum selection 08041 with an individual from the susceptible spray chrysanthemum selection 02033. Selection 08041 is highly resistant against white rust. 262 F1 individuals (CR15-995004) were then phenotyped for white rust resistance and for each F1 individual 6 clones were assayed. Inoculation with Puccinia horiana was done in a blocked design and four tests were performed (at different times) in two containers as described above. Resistance was scored such that large values indicate resistance (a maximum of 9) and low values indicate susceptibility (a minimum of 1). Replicate clones were randomly split between tests and containers. Of these, 80 clones were selected for genotyping. Selection was done to maximize the phenotypic variation present in the genotyped sample, which should increase power to detect SNP-phenotype associations.

(15) Selection 08041 Resistance Locus

(16) Using an Affymetrix SNP array with 50,000 markers for Chrysanthemum, the F1 population mentioned above was genotyped, and marker-trait associations were performed within each individual of the F1 population. This yielded 9 single-nucleotide polymorphisms (SNPs) explaining the largest amount of phenotypic variance for white rust resistance in Chrysanthemum: 7 SNPs each >50%, and 2 SNPs each over 70%. The latter two SNPS, designated SNP115 and SNP123 were then targeted for a multiplex genotyping-by-sequencing (GBS) approach as they showed the strongest association with white rust resistance. As Chrysanthemums are hexaploid, a method was designed to estimate the number of resistant copies present at a locus within an individual. Individuals of the F1 population between the 08041 and 02033 varieties were then genotyped using this method.

(17) A KASP assay was designed for the SNP115 and SNP123 markers. The KASP method is a more cost-effective method than GBS. A potential disadvantage is that it gives a much cruder measure of the number of resistant copies (KASP ratios can only be 0, 1 or 2) than the dosage ratios estimated from GBS data. The hexaploid nature of Chrysanthemums makes that the number of resistance alleles at a given locus may vary between 0 and 6. Precise knowledge of the number of resistance alleles an individual harbors can be beneficial not only for mapping purposes, but also for selecting individuals during the subsequent breeding stages. Fortunately, the KASP ratios showed to be strongly correlated with dosage ratios obtained by GBS (FIG. 1) meaning that they give a good indication of the number of resistant haplotypes an individual plant harbors. Both parents and all F1 offspring were genotyped using the KASP method.

(18) The KASP primers used for SNP 115 (Assay 4) and SNP 123 (Assay 18) for genotyping are:

(19) TABLE-US-00002 GxM_WRR_assay4_A (SEQ ID No. 10): GAAGGTGACCAAGTTCATGCTCAAGTCTTGTACAAYCAAGGAG GxM_WRR_assay4_B (SEQ ID No. 11): GAAGGTCGGAGTCAACGGATTCAAGTCTTGTACAAYCAAGGAC GxM_WRR_assay4_R (SEQ ID No. 12): TACACTTAACGAGGATAAATCAC GxM_WRR_assay18_A (SEQ ID No. 13): GAAGGTGACCAAGTTCATGCTTACAACCAAGGASCAAAACAT GxM_WRR_assay18_B (SEQ ID No. 14): GAAGGTCGGAGTCAACGGATTTACAACCAAGGASCAAAACAG GxM_WRR_assay18_R (SEQ ID No. 15): GTCGATTTTCCATACACTTAACG
Results

(20) Both among and within the F1 clones derived from offspring of the crosses between the resistant selection 08041 with the susceptible selection 02033 there was heterogeneity in resistance. Based on six replicates, some clones had a mean resistance value of 9 (fully resistant) while other clones had a mean resistance value of 1 (fully susceptible). Some clones showed little heterogeneity (standard deviation of 0 between replicates) while a few others showed larger levels of heterogeneity (standard deviation of 3.7).

(21) The two SNPs which were most strongly associated with white rust resistance in Chrysanthemum were 72689_15854_115 (hereafter called SNP 115) and 72689_15854_123 (hereafter referred to as SNP 123) on contig 72689, which maps on Tomato chromosome 1 (96.77 Mb).

(22) The DNA sequence of the haplotype which is shown to confer resistance to white rust is shown below. To facilitate interpretation, SNP115 (G) and SNP 123 (T) are highlighted in bold:

(23) TABLE-US-00003 SEQ ID No. 3: AGCAAAACATGCAGTGATTTATCCTCGTTAAGTGTATGGAAAAT CGACACCAGGGTGC
Also identified were six haplotypes which were associated with susceptibility in the dataset. SNP 115 and SNP 123 are highlighted in bold and positions where a different nucleotide was found from the resistant haplotype are underlined.

(24) TABLE-US-00004     (SEQ ID No. 4) ACCAAAACAGGCAGTGATTTATCCTCGTTAAGTGTATGGA AGATCGACACCAGAGTGC (SEQ ID No. 5) AGCAAAACAGGCAGTGATTTATCCTCGTTAAGTGTATGGA AGATCGACACCAGAGTGC (SEQ ID No. 6) ACCAAAACAGGCAGTGATTTATCCTCGTTAAGTGTACGGA AGATCGACAGCAGGGTGC (SEQ ID No. 7) ACCAAAACAGGCAGTGATTTATCCTCGTTAAGTGTACGGA AGATAGACAGCAGGGTGC (SEQ ID No. 8) AGCAAAACAGGCAGTGATTTATCCTCGTTAAGTGTATGGA AGATCGACACCAGGGTGG (SEQ ID No. 9) ACCAAAACAGGCAGTGATTTATCCTCGTTAAGTGTATGGA AGATCGACACCAGGGTGG

(25) There was a clear and strongly significant association (P in all cases <1*10.sup.−16) between GBS dosage (FIG. 2) and KASP genotype at both loci and the resistance score of the clones (FIG. 3). In the case of SNP 123, where the association between genotypes and resistance shows a pattern that could potentially suggest dominance at this locus. Individuals with a genotype score of 1 are as resistant as individuals with KASP genotype score 2, whereas individuals with genotype class 0 are generally very susceptible (with the exception of one outlier, FIG. 2). However, individuals which are classified as having a KASP genotype of zero can also harbor copies of the resistant haplotype, so more research is needed to clarify if resistance scales additively with the number of resistance copies or whether resistant haplotypes are dominant over susceptible haplotypes. For both SNP markers, there were some genotypes that were more resistant than predicted based on their genotype, while some genotypes were less resistant (FIG. 2). These instances can be explained by a sample swap either in the lab or in the experiment, or by incomplete LD between the resistance allele and the actual (unidentified) gene conferring resistance as it is likely that the identified “resistant” haplotype is close to the gene (as is confirmed by the very significant association between the number of copies of the resistance allele an individual harbors and its resistance profile) but not perfectly linked. As a result, some copies of the resistant haplotype are not perfectly tagging resistant copies of the gene due to recent and/or historical recombination events. Additional alternative explanations are that variants in other genes with small effect are present in either the 08041 or 02033 varieties, or that penetrance of the genetic variants is imperfect.

(26) An interesting observation was that some individuals had a KASP genotype of 2 for SNP 123, whereas the more resistant parent (selection 08041) only had a KASP genotype of 1 (FIG. 3). This was surprising as this suggests that some F1 offspring have more copies of the resistant haplotypes at this region than selection 08041, which is contrary to expectation. Hence we have investigated the segregation of GBS dosage ratios in the F1 in more details.

(27) We found the distribution of dosage ratios at SNP 123 highly unusual (FIG. 4). And as the dosage ratios of the parents were unknown we used simulations to test if we could replicate these distributions. We simulated crosses between parents each having one of 7 possible genotypes at the locus of interest (AAAAAA, BAAAAA, BBAAAA, etc.). For each of 49 pairwise crosses we then drew gametes at random assuming polysomic inheritance resulting in a hexaploid genotype in the offspring. This process was repeated at random for a total of 50 times.

(28) If we look at the simulated distributions, we observe that for SNP 115 the empirical distribution of dosage ratios most closely resembles that of a scenario where the most resistant parent has five copies of the resistance alleles and the susceptible parent had two copies of the resistant haplotype. For SNP 123 the observed distribution of dosage ratios does not match any of the simulated combinations of parent pairs. Whether this discrepancy has a biological or technical explanation deserves to be investigated in the future, starting with genotyping the parental lines.

CONCLUSION

(29) Precise knowledge of the genes and variants thereof which influence white rust (Puccinia horiana.) resistance is pivotal for the breeding of more resistant Chrysanthemum varieties. Two major effect loci have been previously identified (SEQ ID Nos 1 and 2).

(30) It was hypothesized that there must be other genes which can confer resistance to white rust in Chrysanthemums. The results presented here unequivocally show that variants at two closely linked SNP markers can strongly predict resistance, suggesting that these SNPs and the haplotype they are found one, are in tight linkage with causal genes.