Phytase mutants

11104908 · 2021-08-31

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided are mutants PHY1, PHY4 and PHY5 of a wild-type phytase APPA. After being treated for 10 min at 80° C., the residual enzyme activities of the mutants PHY1, PHY4 and PHY5 are respectively higher by 33.85%, 53.11% and 75.86% compared with that of APPA-M; after being treated for 5 min at 85° C., the residual enzyme activities of the mutants PHY1, PHY4 and PHY5 are respectively higher by 14.89%, 28.45% and 44.94% compared with that of APPA-M, and the heat resistance of these mutants is significantly higher than that of APPA-M.

Claims

1. A phytase mutant comprising the amino acid sequence as set forth in SEQ ID NO: 3 or SEQ ID NO: 5 or SEQ ID NO: 7 or SEQ ID NO: 9.

2. The phytase mutant of claim 1, consisting of the amino acid sequence as set forth in SEQ ID NO: 3 or SEQ ID NO: 5 or SEQ ID NO: 7 or SEQ ID NO: 9.

3. A composition comprising the phytase mutant of claim 1 or 2.

4. A feed for mono gastric animals, comprising an effective amount of the phytase mutant of claim 1 or 2.

5. A method for improving a feed for mono gastric animals, comprising adding an effective amount of the phytase mutant of claim 1 or 2 into the feed.

Description

BRIEF DESCRIPTIONS OF DRAWINGS

(1) FIG. 1 shows the map of recombinant plasmid pPIC9K-APPA;

(2) FIG. 2 shows the thermostability of PHY1, PHY4 and PHY5 compared with that of APPA-M.

EMBODIMENT

(3) The invention discloses phytase mutants, methods of production and the uses thereof, DNA molecules encoding the mutants, vectors, and host cells. Technicians having ordinary skill in the field can learn from the contents of this invention and improve the process parameters to realize it. It is particularly to be noted that all similar substitutions and modifications will be regarded as obvious and are considered to be included in the invention. The invention has described the methods and applications in the preferred embodiments, and technicians in this field can readily modify or appropriately modify and combine the methods and applications to realize and apply the invention without departing from the contents, spirit and scope of the invention.

(4) Conventional techniques and methods in the field of genetic engineering and molecular biology are used in the invention, for example, the methods recorded in MOLECULAR CLONING: A LABORATORY MANUAL, 3nd Ed. (Sambrook, 2001) and CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (Ausubel, 2003). These general references provide one of skill with a general dictionary of many of the terms used in this invention. Based on the technical scheme described in the invention, all technical and scientific terms can choose other conventional methods, experimental programs and reagents to realize the invention, not limited to that described in the embodiments of the invention. For example, the following experimental materials and reagents can be used in the invention:

(5) Strains and vectors: E. coli DH5α, Pichia pastoris strain GS115, vector pPIC9k were purchased from Invitrogen.

(6) Reagents: Amp and G418 were purchased from Invitrogen.

(7) Enzymes and Kits: PCR enzymes and ligases were purchased from Takara; restriction endonucleases were purchased from Fermentas; plasmid mini kit and gel extraction kit were purchased from Omega; geneMorph II random mutagenesis kit was purchased from MBL Beijing Biotech Co., Ltd.

(8) Medium Recipes:

(9) Lariant broth (LB medium): 0.5% yeast extract, 1% tryptone, 1% NaCl, pH7.0;

(10) LB-AMP medium: LB medium with 100 μg/mL ampicillin;

(11) Yeast extract peptone dextrose medium (YPD medium): 1% yeast extract, 1% tryptone, 1% glucose;

(12) Minimal dextrose medium (MD medium): 2% tryptone, 2% agar;

(13) BMGY medium: 2% tryptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10.sup.−5 biotin, 1% glycerol;

(14) BMMY medium: 2% tryptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10.sup.−5 biotin, 1% methanol.

(15) The invention was further illustrated by the following examples:

Example 1 Phytase Mutants

(16) Gene synthesis of the wild-type phytase APPA and phytase mutant APPA-M The wild-type phytase APPA was derived from E. coli, of which the amino acid sequence was SEQ ID NO:1 and the encoding polynucleotide sequence was SEQ ID NO: 2. In order to improve the thermostability of APPA, a phytase mutant was obtained by introducing 12 point-mutations into the amino acid sequence of SEQ ID NO:1, which were A25F, W46E, Q62W, G70E, A73P, K75C, T114H, N137V, D142R, S146E, R159Y, Y255D.

(17) The phytase mutant was named APPA-M, of which the amino acid sequence was SEQ ID NO: 3 and the encoding polynucleotide sequence was SEQ ID NO: 4. The polynucleotide sequence was optimized according to the codon preference of Pichia pastoris and synthesized by Shanghai Generay Biotech Co., Ltd with an EcoRI restriction site and a NotI restriction site added to the 5′ end and 3′ end respectively.

(18) The same method above was used to synthesize the polynucleotide sequence of the wild-type phytase APPA.

(19) Construction of the Expression Vector Carrying Phytase Gene

(20) The two polynucleotide sequences synthesized in example 1.1 and the plasmid pPIC-9k were first digested by EcoRI and NotI, and then ligated together at 16° C. overnight respectively. After that, the recombinant plasmid was transformed into E. coli DH5α. The recombinant E. coli strains then were spread onto LB+Amp plates. The plates were placed inverted and incubated at 37° C. until transformants grew up. Positive transfromants were selected and verified by colony PCR and DNA sequencing, and named as pPIC9K-APPA (the map of pPIC9K-APPA were shown in FIG. 1) and pPIC9K-APPA-M respectively. The reaction system of colony PCR contained: monoclonal sample, rTaqDNA polymerase 0.5 ul, 10×Buffer 2.0 μL, dNTPs (2.5 mM) 2.0 μL, 5′AOX primer (10M) 0.5 μL, 3′AOX primer 0.5 μL, ddH2O 14.5 μL; PCR conditions were: 95° C. for 5 min (1 cycle), 94° C. for 30 sec, 55° C. for 30 sec, 72° C. for 2 min (30 cycles), and 72° C. for 10 min (1 cycle).

(21) Construction of the Recombinant P. pastoris Strains

(22) Preparation of Competent P. pastoris Cells

(23) Host cells R pastoris GS115 were spread onto YPD plates and the plates were incubated at 30° C. for 48 h. GS115 colonies were picked up and inoculated into 6 mL YPD liquid medium and incubated for approximately 12 h at 30° C. with shaking at 220 rpm. Then the YPD liquid medium containing GS115 was inoculated into 30 mL YPD liquid medium and incubated for 5 h at 30° C. with shaking at 220 rpm. The cell density of the yeast cultures were measured using a spectrophotometer. When the optical density (OD600) between 1.1 and 1.3, 4 mL yeast cultures were added into a sterilized EP tubes and centrifuged at 9000 rpm and 4° C. for 2 min. The supernatants were removed, while the remaining yeast cells were re-suspended in 1 ml of sterile pre-cooled water. The suspension containing yeast cells was centrifuged at 9000 rpm and 4° C. for 2 min. The supernatant was removed, while the remaining yeast cells were re-suspended in 1 ml of pre-cooled sorbitol (1 mol/L). The sorbitol containing yeast cells was centrifuged at 9000 rpm and 4° C. for 2 min. The supernatant was removed, while the remaining yeast cells were re-suspended in 100-150 μl of sterile pre-cooled sorbitol (1 mol/L).

(24) 1.3.2 Transformation and Screening

(25) The recombinant plasmids pPIC9K-APPA and pPIC9K-APPA-M were linearized by Sal I and transformed into Pichia pastoris GS115 respectively by electroporation. Then the transformation mixtures were spread on MD plates and dried in a sterile bench. The MD plates were placed inverted and incubated at 30° C. for 2-3 days to obtain recombinant P. pastoris strains carrying the recombinant plasmids pPIC9K-APPA or pPIC9K-APPA-M. There were approximately 300 clones on each plate. The clones were washed down with sterile water and spread on YPD plates containing different concentrations of geneticin (0.5 mg/mL-8 mg/mL) to screen multiple copies of transformants.

(26) One of the recombinant yeast strains carrying the recombinant plasmids pPIC9K-APPA was named Pichia pastoris APPA. One of the recombinant yeast strains carrying the recombinant plasmids pPIC9K-APPA-M was named Pichia pastoris APPA-M. The two recombinant strains were first inoculated into separate flasks with BMGY medium and cultured at 30° C. for 1 d with agitation at 250 rpm, and then inoculated in BMMY medium at 30° C. for 4 d with agitation at 250 rpm. 0.5% methanol was added into the medium as an inducer every day. After that, the medium was centrifuged at 9000 rpm for 10 min. The fermentation supernatants containing phytase were retained, while the yeast cells were removed.

(27) (1) Definition of Phytase Activity Unit

(28) One phytase unit is the activity of phytase that generates 1 micromole of inorganic phosphorus per minute from 5.0 mmol/L sodium phytate at pH 5.0 and 37° C., which is indicated as U.

(29) Method for Detecting Phytase Activity

(30) 1.8 mL of acetic acid buffer (pH 5.0) and 0.2 mL of sample are both added into two separate cuvettes named A and B, mixed and warmed at 37° C. for 5 min. 4 mL of substrate solution is added into cuvette A and 4 mL of stop solution is added into cuvette B, mixed and reacted at 37° C. for 30 min. The reaction is ended by adding and mixing 4 mL stop solution in cuvette A and 4 mL substrate solution in cuvette B. After standing for 3 min, the absorbance is measured at 415 nm. Three repeats are made for each sample, and the average of the absorbance values is used for calculating the phytase activity by regression linear.
X=F×C/(30)  Enzyme activity:

(31) where: X—Unit of enzyme activity, U/g(mL);

(32) F—Total dilution factors of sample solution before reaction;

(33) C—The enzyme activity is calculated from the linear regression equation based on the absorbance of the actual sample solution, U;

(34) m—Sample mass or volume, g/mL; Reaction time;

(35) 30—Reaction time;

(36) (3) Phytase Activities were Shown in Table 1

(37) TABLE-US-00001 TABLE 1 Phytase activities Activity Sample Value 1 Value 2 Value 3 Average (U/mL) APPA 0.473 0.477 0.471 0.474 166 APPA-M 0.486 0.489 0.484 0.486 195

(38) As shown in Table 1, the enzyme activities of the fermentation supernatants of Pichia pastoris APPA and Pichia pastoris APPA-M were 166 U/mL and 195 U/mL, respectively.

(39) Fermentation Process

(40) P. pastoris APPA and P. pastoris APPA-M were cultured in two separate 10 L fermenters with the fermentation medium containing: 1.1 g/L CaSO.sub.4, 5.5 g/L KH.sub.2PO.sub.4, 55 g/L NH.sub.4H.sub.2PO.sub.4, 16.4 g/L MgSO.sub.4, 20.3 g/L K.sub.2SO.sub.4, 1.65 g/L KOH and 0.05% antifoam, and the fermentation parameters: pH 5.0, 30° C., agitation at 300 rpm, aeration at 1.0-1.5 v/v, and the dissolved oxygen kept above 20%.

(41) There were three stages of the fermentation process. The first stage was for cell culture with 7% seed inoculated and cultured at 30° C. for 24-26 h until the supplement of glucose was finished. The second stage was for cell hunger with no more carbon source supplemented. This stage lasted about 30-60 min until the concentration of dissolved oxygen rose to 80%. The third stage was for inducing the expression of phytase with methanol added as an inducer in flow, and the concentration of dissolved oxygen maintained at more than 20%, which lasted about 150-180 h. After that, the fermentation broth was treated by a plate and frame filter to obtain crude enzyme solution.

(42) The phytase activities of the crude enzyme solutions were determined by the method mentioned in 1.3.2, and the results were shown in Table 2.

(43) TABLE-US-00002 TABLE 2 Phytase activity test results Activity Sample Value 1 Value 2 Value 3 Average (U/mL) APPA 0.488 0.485 0.487 0.487 9800 APPA-M 0.459 0.461 0.462 0.461 10257

(44) The phytase activities of the crude enzyme solutions of P. pastoris APPA and P. pastoris APPA-M were 9800 U/mL and 10257 U/mL, respectively.

(45) Analysis of Enzymatic Properties

(46) Optimal Temperature

(47) The phytase activities of the crude enzyme solutions of P. pastoris APPA and P. pastoris APPA-M were measured at pH5.5 and 5° C. intervals between 30° C. and 85° C. With the highest phytase activity calculated 100%, the relative enzyme activities were calculated. The results showed that the optimal temperatures of the wild-type phytase APPA and phytase mutant APPA-M were both 75° C.

(48) Optimal pH

(49) The crude enzyme solutions of P. pastoris APPA and P. pastoris APPA-M were diluted by 0.1M acetic acid-sodium acetate buffer at pH 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0 respectively. The phytase activities were measured at 37° C., and the relative enzyme activities were calculated with the highest enzyme activity calculated 100%. The results showed that the optimal pH of wild phytase APPA and phytase mutant APPA-M was both 5.0.

(50) Thermostability

(51) The crude enzyme solutions of P. pastoris APPA and P. pastoris APPA-M were diluted 10 times with 0.25M sodium acetate buffer (pH 5.0) which was preheated for 10 min. The diluted enzyme solutions were well mixed and treated at 75° C. for 5 min.

(52) The phytase activities were measured when the diluted enzyme solutions were cooled to room temperature. With the phytase activity of the untreated enzyme solution calculated 100%, the residual phytase activities were calculated.
Residual phytase activity (%)=phytase activity of the enzyme solution being treated/phytase activity of the enzyme solution being untreated×100%.

(53) The results showed that after being treated at 75° C. for 5 min, the residual phytase activity of the wild-type phytase APPA was below 10%, while that of the phytase mutant APPA-M was above 95%. In conclusion, the thermostability of the phytase mutant APPA-M was significantly higher than that of the wild-type phytase APPA.

Example 2 Phytase Mutants

(54) In order to improve the thermostability of the phytase mutant APPA-M, the protein structure of APPA-M was analyzed. The result showed that there were two domains in the protein: domain I contained 134 amino acid residues at the N-terminus and 152 amino acid residues at C-terminus, while domain II contained the remaining 124 amino acid residues in the middle. The conserved sequences and activity center are all in domain I. Without destroying the secondary structure and activity center of the protein, Further mutations of the amino acid residuals were carried out.

(55) 2.1 Mutations of Phytase Mutant APPA-M

(56) TABLE-US-00003 Primer APPAM-FI and APPAM-R1 were designed: XynII-F1: GGCGAATTCCAGTCAGAACCAGAGTTGAAGTT  (Underlined was the recognition site of restriction endonuclease EcoRI), which was shown in SEQ ID NO: 11; XynII-R1: ATAGCGGCCGCTTACAAGGAACAAGCAGGGAT  (Underlined was the recognition site of restriction endonuclease Notl), which was shown in SEQ ID NO: 12;

(57) APPA-M gene was amplified using the primers above by a GeneMorph II random mutagenesis kit. The amplification products were recovered, and then digested with EcoRI and NotI and ligated into EcoRI-NotI-digested plasmid pET21a. After that the plasmid was transformed into E. coli BL21 (DE3) and then the recombinant E. coli cells were spread onto LB+Amp plates. After being incubated at 37° C., the colonies were transferred one by one into 96-well polypropylene microtiter plates containing LB+Amp medium with 150 ul 0.1 mM IPTG in each well. The microtiter plates were incubated at 37° C. for 6 h with shaking at 220 rpm. The supernatant was removed from the fermentation broth by centrifugation. Afterwards the cells were re-suspended with buffer and repeated freeze-thawed to obtain phytase-containing E. coli cell lysates.

(58) 40 ul cell lysates were transferred into two separate new 96-well plates, one of which was treated at 80° C. for 10 min, and the other was not. 80 ul substrates were added into each well of the plates and incubated for 30 min at 37° C. Afterwards 80 ul stop solution (ammonium vanadate:ammonium molybdate:nitric acid=1:1:2) was added to end the reaction. In each well of the plates, the contents of inorganic phosphate were determined, which reflected the activities of different mutants obtained in the invention.

(59) Compared with phytase APPA-M, the thermostabilities of some mutants were not improved, or even worse. For example, after being treated at 80° C. for 5 min, the residual enzyme activities of a three-point mutant (Q184E/Y289K/1405L) and the C-terminal (CNZSMQTD) removed mutant were reduced by 9% and 17% respectively, and two one-point mutants (Q285Y and C178N) were almost inactivated. Besides, there were some mutants with improved thermostabilities, but their enzymatic properties were significantly changed, which also limited their applications in feed.

(60) This invention provided three mutants with significantly improved thermostabilities as well as high activities and original enzymatic properties.

(61) One mutant was named PHY1 with one-point mutation A380P, its amino acid sequence was shown as SEQ ID NO: 5, and the encoding polynucleotide sequence was shown as SEQ ID NO: 6.

(62) Another mutant was named PHY4 with four-point mutations S80P, N176P, S187P and A380P, its amino acid sequence was shown as SEQ ID NO: 7, and the encoding polynucleotide sequence was shown as SEQ ID NO: 8.

(63) The other mutant was named PHY5 with five-point mutations S80P, T161P, N176P, S187P and A380P, its amino acid sequence was shown as SEQ ID NO: 9, and the encoding polynucleotide sequence was shown as SEQ ID NO: 10.

(64) 2.2 Synthesis and Amplification of Mutant Genes

(65) Three polynucleotide sequences were synthesized with reference to SEQ ID NO: 6, SEQ ID NO: 8 and SEQ ID NO: 10 and optimized based on codon bias of Pichia pastoris by Shanghai Generay Biotech Co., Ltd, of which an EcoRI restriction site and a NotI restriction site were added to the 5′ end and 3′ end respectively.

(66) 2.3 Construction of Expression Vector

(67) The three polynucleotide sequences synthesized above and the plasmids pPIC-9k were first digested by EcoRI and NotI, and then ligated together at 16° C. overnight respectively. After that, the recombinant plasmid was transformed into E. coli DH5α. The recombinant E. coli cells then were spread onto LB+Amp plates. The plates were placed inverted and incubated at 37° C. until transformants grew up. Positive transfromants were selected and verified by colony PCR (reaction was as same as in Example 1) and DNA sequencing, and were named as pPIC9K-PHY1, pPIC9K-PHY4 and pPIC9K-PHY5 respectively.

(68) 2.4 Construction of the Recombinant P. pastoris Strain

(69) The recombinant plasmids pPIC9K-PHY1, pPIC9K-PHY4 and pPIC9K-PHY5 were linearized by Sal I and transformed into host cells Pichia pastoris GS115 by electroporation. The recombinant strains P. pastoris GS115/pPIC9K-PHY1, GS115/pPIC9K-PHY4 and GS115/pPIC9K-PHY5 were obtained on MD plates after screening YPD plates containing different concentrations of geneticin (0.5 mg/mL-8 mg/mL) were used to select multiple copies of transformants.

(70) The transformants of the recombinant strains GS115/pPIC9K-PHY1, GS115/pPIC9K-PHY4 and GS115/pPIC9K-PHY5 were named Pichia pastoris PHY1, Pichia pastoris PHY4, and Pichia pastoris PHY5, respectively. The three transformants above were inoculated into separate flasks with BMGY medium and cultured at 30° C. for 1 d with agitation at 250 rpm, and then transferred and inoculated in BMMY medium at 30° C. for 4 d with agitation at 250 rpm. 0.5% methanol, as an inducer, was added every 24 h. The cells were removed from the fermentation broth by centrifugation at 9000 rpm for 10 min and the fermentation supernatants containing phytase PHY1, or phytase PHY4 or phytase PHY5 were retained.

(71) The activities of fermentation supernatants were detected by the method mentioned in 1.3.2, and the results were shown in Table 3.

(72) TABLE-US-00004 TABLE 3 Phytase activities Activity Sample Value 1 Value 2 Value 3 Average (U/mL) PHY1 0.481 0.483 0.484 0.482 211 PHY4 0.483 0.479 0.481 0.481 201 PHY5 0.491 0.488 0.489 0.489 255

(73) As shown in Table 3, the activities of the fermentation supernatants of Pichia pastoris PHY1, PHY4 and PHY5 were 211 U/mL, 201 U/mL and 255 U/mL, respectively.

(74) 2.5 Fermentation Process P. pastoris PHY1, P. pastoris PHY4 and P. pastoris PHY5 were fermented in three separate 10 L fermenters. The fermentation medium contained 1.1 g/L CaSO.sub.4, 5.5 g/L KH.sub.2PO.sub.4, 55 g/L NH.sub.4H.sub.2PO.sub.4, 16.4 g/L MgSO.sub.4, 20.3 g/L K.sub.2SO.sub.4, 1.65 g/L KOH and 0.05% antifoam.

(75) Fermentation parameters: pH 5.0, 30° C., agitation at 300 rpm, aeration at 1.0-1.5 v/v, and the dissolved oxygen was kept above 20%.

(76) There were three stages of the fermentation process. The first stage was for cell culture with 7% seed inoculated and cultured at 30° C. for 24-26 h until the supplement of glucose was finished. The second stage was for cell hunger with no more carbon source supplemented. This stage lasted about 30-60 min until the concentration of dissolved oxygen rose to 80%. The third stage was for inducing the expression of phytase with methanol added as an inducer in flow, and the concentration of dissolved oxygen maintained at more than 20%, which lasted about 150-180 h. After that, the fermentation broth was treated by a plate and frame filter to obtain crude enzyme solution.

(77) The phytase activities of the crude enzyme solutions were detected by the method mentioned in 1.3.2, and the results were shown in Table 4.

(78) TABLE-US-00005 TABLE 4 Phytase activities Activity Sample Value 1 Value 2 Value 3 Average (U/mL) PHY1 0.478 0.479 0.481 0.479 10317 PHY4 0.484 0.480 0.481 0.482 10401 PHY5 0.479 0.477 0.480 0.479 10813

(79) The phytase activities of the crude enzyme solutions of R pastoris PHY1, P. pastoris PHY4 and P. pastoris PHY5 were 10317 U/mL, 10401 U/mL, and 10813 U/mL, respectively.

(80) Analysis of Enzymatic Properties

(81) Optimal Temperature

(82) The phytase activities of the crude enzyme solutions of P. pastoris PHY1, PHY4 and PHY5 were measured at pH5.5 and 5° C. intervals between 30° C. and 85° C. With the highest phytase activity calculated 100%, the relative enzyme activities were calculated. The results showed that the optimal temperatures of phytase mutants PHY1, PHY4 and PHY5 were 75° C., which were the same with the wild-type phytase APPA and the mutant APPA-M.

(83) Optimal pH

(84) The crude enzyme solutions of P. pastoris PHY1, PHY4 and PHY5 were diluted by 0.1M acetic acid-sodium acetate buffer at pH 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0 respectively. The phytase activities were measured at 37° C., and the relative enzyme activities were calculated with the highest enzyme activity calculated 100%. The results showed that the optimal pH of the phytase mutants PHY1, PHY4 and PHY5 were 5.0, which were the same with the wild-type phytase APPA and the mutant APPA-M.

(85) Thermostability

(86) The crude enzyme solutions of P. pastoris PHY1, PHY4 and PHY5 were diluted 10 times with 0.25M sodium acetate buffer (pH 5.0) which was preheated for 10 min. The diluted enzyme solutions were well mixed and treated at 85° C. for 5 min, and 80° C. for 10 min, respectively. The phytase activities were measured when the diluted enzyme solutions were cooled to room temperature. With the phytase activity of the untreated enzyme solution calculated 100%, the residual phytase activities were calculated.

(87) As shown in FIG. 2, compared with phytase mutant APPA-M, the residual activity of the phytase mutants PHY1, PHY4 and PHY5 were higher by 33.85%, 53.11% and 75.86%, respectively, after being treated at 80° C. for 10 min, and were higher by 14.89%, 28.45% and 44.94%, respectively, after treating at 85° C. for 5 min.

(88) In conclusion, Using the mutant APPA-M as a basis, the invention provided new mutants containing additional one- or multiple-point mutations such as a one-point mutant PHY1 (A380P), a four-point mutant PHY4 (S80P, T161P, N176P and A380P) and a five-point mutant PHY5 (S80P, T161P, N176P, S187P and A380P). Compared with phytase mutant APPA-M, the optimal pH of the phytase mutants PHY1, PHY4 and PHY5 remained unchanged, but the thermostabilities of the phytase mutants PHY1, PHY4 and PHY5 had been significantly increased, which was conducive to the applications of the phytase mutants in feed.

(89) The phytase mutants provided herein are described in detail. The principles and embodiments of the invention have been described with reference to specific examples, and the descriptions of the above embodiments are merely illustrative of the method and the core idea of the present invention. It is particularly to be noted that all similar substitutions and modifications without departing from the principle will be regarded as obvious to those skilled in the field and are considered to be fallen within the scope of the claims of the invention.