Microorganism producing L-lysine and method for producing L-lysine using the same

11104925 · 2021-08-31

Assignee

Inventors

Cpc classification

International classification

Abstract

The present disclosure relates to a microorganism producing L-lysine and a method for producing L-lysine by using the same. More specifically, the present disclosure relates to a microorganism of the genus Corynebacterium, which is modified such that the activity of a protein involved in cell wall hydrolysis is inactivated in comparison with the endogenous activity thereof; and a method for producing L-lysine using the same.

Claims

1. A method for preparing L-Iysine, comprising: (i) culturing a microorganism of the genus Corynebacterium in a culture medium wherein the microorganism is capable of producing L-lysine, and the microorganism is modified to have an inactivated N-acetylmuramoyl-L-alanine amidase compared to an unmodified microorganism, wherein the N-acetylmuramoyl-L-alanine amidase comprises the amino acid sequence of SEQ ID NO:4, and wherein the modification is carried out by deleting all or a part of the entire endogenous gene encoding the N-acetylmuramoyl-L-alanine amidase; and (ii) recovering L-lysine from the culture medium or the microorganism.

2. The method of claim 1, wherein the microorganism of the genus Corynebacterium is Corynebacterium glutamicum.

Description

BEST MODE

(1) In order to achieve the above objects, an aspect of the present disclosure provides a microorganism of the genus Corynebacterium producing L-lysine, which is modified such that an activity of a protein involved in cell wall hydrolysis is inactivated in comparison with an endogenous activity thereof.

(2) As used herein, the term “protein involved in cell wall hydrolysis” refers to a relevant protein capable of hydrolyzing a cell wall in a microorganism of the genus Corynebacterium. The protein involved in cell wall hydrolysis may be a cell wall-associated hydrolase or an N-acetylmuramoyl-L-alanine amidase, but is not limited thereto.

(3) As described above, as long as a protein has an activity of a relevant protein capable of hydrolyzing a cell wall in the microorganism, the protein and gene sequences can be obtained from a known database. In addition, Genbank of NCBI, etc. may be used as examples of the known database, but these are not limited thereto.

(4) The cell wall-associated hydrolase may be an NCgl1480 gene-encoding protein, NCgl2107 gene-encoding protein, or NCgl2108 gene-encoding protein derived from a microorganism of the genus Corynebacterium, specifically from Corynebacterium glutamicum, but is not limited thereto. As a specific example, the cell wall-associated hydrolase may have the amino acid of SEQ ID NOS: 1, 2, or 3, but may include the protein sequence having the activity above without limitation. In addition, any nucleotide sequences may be included therein without limitation as long as it is a nucleotide sequence encoding a protein having the activity of the cell wall-associated hydrolase. As a specific example, it may be a protein encoded by the nucleotide sequence of SEQ ID NOS: 5, 6, or 7, but is not limited thereto.

(5) The N-acetylmuramoyl-L-alanine amidase may be an NCgl2986 gene-encoding protein derived from a microorganism of the genus Corynebacterium, specifically from Corynebacterium glutamicum. Specifically, the N-acetylmuramoyl-L-alanine amidase may have the amino acid sequence of SEQ ID NO: 4, but any amino acid sequences of the protein having the activity above may be included without limitation. In addition, any nucleotide sequence may be included without limitation as long as the nucleotide sequence encodes a protein having the activity of the N-acetylmuramoyl-L-alanine amidase. For example, it may be a protein encoded by the nucleotide sequence of SEQ ID NO: 8, but is not limited thereto.

(6) Each of the proteins described above may include without limitation, in addition to the amino acid sequences represented by SEQ ID NOS, any amino acid sequence which has a homology to the above-listed amino acid sequences of 80% or higher, preferably 90% or higher, more preferably 95% or higher, and even more preferably 97% or higher, as long as the amino acid sequences encode proteins which have an effect substantially the same as or corresponding to each of the proteins. Additionally, it is obvious that any modified protein having the homology described above can belong to the scope of the present disclosure, although the protein may have an amino acid sequence with a partial deletion, modification, substitution, or addition therein.

(7) Additionally, the genes encoding each of the proteins of the present disclosure may also include without limitation, in addition to the nucleotide sequences described by SEQ ID NOS, any gene sequence encoding the proteins which has homology to each of the above-listed nucleotide sequences of 80% or higher, preferably 90% or higher, more preferably 95% or higher, even more preferably 98% or higher, and most preferably 99% or higher, as long as the gene sequences encodes a protein which has an effect substantially the same as or corresponding to each of the proteins. Additionally, it is obvious that any nucleotide sequence having the above homologies can belong to the scope of the present disclosure, although the sequence may have a partial deletion, modification, substitution, or addition therein.

(8) As used herein, “homology” refers to the similarity in nucleotide sequences or amino acid sequences of gene coding for a protein. When homology is sufficiently high, products of the corresponding gene may be the same or have a similar activity. That is, it refers to a percentage of identity between two polynucleotide or polypeptide moieties. Sequence correspondence from one moiety to another may be determined by a technique known in the art. For example, homology may be determined by aligning the sequence information of two polynucleotide molecules or two polypeptide molecules directly by using a computer program that is readily available and capable of aligning sequence information. The computer program may be BLAST (NCBI), CLC Main Workbench (CLC bio), MegAlign™ (DNASTAR Inc), etc. In addition, homology may be determined by hybridizing the polynucleotides under the condition for forming a stable double-strand in the homologous regions and then digesting the hybridized strand by a single-strand-specific nuclease to determine a size of a digested fragment.

(9) As used herein, the term “endogenous activity” refers to a protein activity in the state before a microorganism modification or in its native state.

(10) As used herein, the term “activity of an enzyme modified to be inactivated in comparison with its endogenous activity” refers to an activity where a gene encoding an enzyme is not expressed at all compared to a wild-type strain or a strain before a modification, or refers to a reduction or elimination of an activity even when the gene is expressed.

(11) The “inactivation of an activity compared to its endogenous activity” refers to a reduction or elimination of the activity when compared with that possessed in its natural state or the state before a modification. The reduction is a concept referring to a case when the activity of an enzyme is reduced compared with that originally possessed by the microorganism due to a modification in the enzyme-encoding gene, a case when the level of overall enzyme expression is lower than that of the natural type strain of the microorganism or the strain before a modification, or a combination thereof.

(12) The “elimination of an activity” refers to a case when a gene encoding an enzyme is not expressed at all compared to that of the natural type strain or the strain before a modification, and/or refers to a case when the gene is expressed but exhibits no activity.

(13) The method of a modification to inactivate the enzyme activity can be achieved by application of various methods well known in the art. Examples of the methods may include a method of replacing the gene encoding the enzyme on the chromosome with a mutated gene so that the enzyme activity can be reduced, including the case when the enzyme activity is removed; a method of introducing a modification on the expression-regulating sequence of the gene encoding the enzyme on the chromosome; a method of replacing the expression-regulating sequence of the gene encoding the enzyme with a sequence having a weak activity or no activity; a method of deleting a part of or the entire gene encoding the enzyme on the chromosome; a method of introducing an antisense oligonucleotide (e.g., antisense RNA), which inhibits the translation from the mRNA into an enzyme via a complementary binding to the transcript of the gene on the chromosome; a method of making the attachment of ribosome impossible by forming a secondary structure by artificially adding a Shine-Dalgarno (SD) sequence and its complementary sequence on the front end of the SD sequence of the gene encoding the enzyme; a method of reverse transcription engineering (RTE), which adds a promoter so as to be reversely transcribed on the 3′ terminus of the open reading frame (ORF) of the corresponding sequence, etc., and also include a combination thereof, but are not limited thereto.

(14) Specifically, the method of deleting a part of or the entire gene encoding an enzyme may be performed by replacing the polynucleotide, which encodes the endogenous target protein within the chromosome via a vector for inserting chromosome into a microorganism, with a polynucleotide or a marker where part of the nucleic acid sequence is deleted. For example, a method of gene deletion via homologous recombination may be used.

(15) As used herein, the term “part”, although it may vary depending on the kinds of polynucleotide, may specifically refer to 1 nucleotide to 300 nucleotides, more specifically 1 nucleotide to 100 nucleotides, and even more specifically 1 nucleotide to 50 nucleotides, but is not limited thereto.

(16) As used herein, the term “homologous recombination” refers to genetic recombination that occurs via crossover at a locus of a gene chain having a mutual homology.

(17) According to an exemplary embodiment of the present disclosure, the proteins were inactivated by homologous recombination.

(18) Specifically, the method of modifying an expression regulatory sequence may be carried out by inducing a modification on the expression regulatory sequence through deletion, insertion, non-conservative or conservative substitution of a nucleic acid sequence of the expression regulatory sequence, or a combination thereof; or may be carried out by replacing the sequence with a weaker promoter. The expression regulatory sequence includes a promoter, an operator sequence, a sequence encoding a ribosome-binding site, and a sequence for regulating the termination of transcription and translation.

(19) Additionally, the method of modifying a gene sequence on the chromosome may be carried out by inducing a modification in the sequence by deletion, insertion, non-conservative or conservative substitution of the gene sequence, or a combination thereof so as to further reduce the enzyme activity; or by replacing the sequence with a gene sequence improved to have an additional weaker activity or with a gene sequence improved to have no activity.

(20) As used herein, the term “microorganism producing L-lysine” refers to a microorganism strain capable of producing L-lysine by fermentation. For example, it includes a strain capable of increasing L-lysine productivity by modifying the sequence via the manipulation of the present disclosure such that an activity of a protein involved in cell wall hydrolysis is inactivated in comparison with its endogenous activity; and by regulating cell lysis for the production of lysine, which occurs during fermentation, but is not limited thereto.

(21) In the present disclosure, the microorganism producing L-lysine may include all microorganisms of the genus Corynebacterium, which is capable of being modified such that an activity of a protein involved in cell wall hydrolysis is inactivated in comparison with its endogenous activity. For example, Corynebacterium glutamicum, Corynebacterium ammoniagenes, Corynebacterium thermoaminogenes, Brevibacterium flavum, or Brevibacterium fermentum may be used, but the microorganism is not limited thereto. For example, Corynebacterium glutamicum may be used for the microorganism of the genus Corynebacterium. The modified microorganism of the genus Corynebacterium is characterized in that L-lysine productivity is enhanced compared to a microorganism which is not modified such that an activity of a protein involved in cell wall hydrolysis is inactivated in comparison with its endogenous activity.

(22) Another aspect of the present disclosure provides a method for preparing L-lysine, including: (i) culturing the microorganism of the genus Corynebacterium, which is modified such that an activity of a protein involved in cell wall hydrolysis is inactivated in comparison with its endogenous activity; and (ii) recovering L-lysine from the culture medium or the microorganism.

(23) The microorganism of the genus Corynebacterium, in which L-lysine productivity is increased, is as described above.

(24) As used herein, the term “culture” refers to culturing of a microorganism under artificially controlled environmental conditions. In the present disclosure, the method of culturing L-lysine using the microorganism of the genus Corynebacterium may be conducted using a method widely known in the art. Specifically, examples of the culture include a batch process and a fed batch or repeated fed batch process in a continuous manner, but are not limited thereto.

(25) The medium used for the culturing should satisfy the requirements for a specific strain in an appropriate manner (for example, Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington D.C., USA, 1981). Carbon sources that may be used in the present disclosure may include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as gluconic acid, acetic acid, and pyruvic acid, but these are not limited thereto. These substances may be used alone or in a mixture. Nitrogen sources that may be used in the present disclosure may include peptone, yeast extract, meat extract, malt extract, corn steep liquor, defatted soybean cake, and urea or inorganic compounds, such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate, but these are not limited thereto. These nitrogen sources may also be used alone or in a mixture. Phosphorus sources that may be used in the present disclosure may include potassium dihydrogen phosphate or dipotassium hydrogen phosphate, or corresponding sodium-containing salts, but these are not limited thereto. In addition, the culture medium may contain a metal salt such as magnesium sulfate or iron sulfate, which is required for the growth. Lastly, in addition to the above-described substances, essential growth factors such as amino acids and vitamins may be used. Additionally, suitable precursors may be used in the culture medium. These substances may be added to the medium during culturing in a batch or continuous manner. Such a variety of culture methods is disclosed, for example, in the literature (“Biochemical Engineering” by James M. Lee, Prentice-Hall International Editions, pp 138-176).

(26) Basic compounds such as sodium hydroxide, potassium hydroxide, or ammonia, or acidic compounds such as phosphoric acid or sulfuric acid may be added to the culture medium in a suitable manner to adjust the pH of the culture medium. In addition, an anti-foaming agent such as fatty acid polyglycol ester may be used to suppress the formation of bubbles. In order to maintain the culture medium in an aerobic state, oxygen or oxygen-containing gas (e.g., air) may be injected into the culture medium. The temperature of the culture medium may be usually 20° C. to 45° C., preferably 25° C. to 40° C., but may be changed depending on conditions. The culture may be continued until the maximum amount of a desired L-amino acid is produced, and it may generally be achieved within 10 hours to 160 hours. L-Lysine may be released into the culture medium or contained in cells.

(27) The method of the present disclosure for producing L-lysine may include a step of recovering lysine from the microorganism or the medium. Methods known in the art, such as centrifugation, filtration, anion-exchange chromatography, crystallization, HPLC, etc., may be used for the method for recovering L-lysine from the microorganism or the culture, but the method is not limited thereto.

(28) The step of recovering may include a purification process.

MODE FOR INVENTION

(29) Hereinbelow, the present disclosure will be described in detail with accompanying exemplary embodiments. However, the exemplary embodiments disclosed herein are only for illustrative purposes and should not be construed as limiting the scope of the present disclosure.

Example 1: Preparation of Random Mutant Library Using Transposon

(30) In order to obtain genes increasing lysine productivity, a vector library was prepared by the following method. The plasmid obtained using EZ-Tn5™<R6Kγori/KAN-2>Tnp Transposome™ Kit (Epicentre) was transformed using the strain KCCM11016P (the microorganism had been designated as KFCC10881 and re-deposited with the international depository institution under the Budapest Treaty, and was then designated the deposit accession number of KCCM11016P; Korean Patent No. 10-0159812) as a parent strain, and then spread on a complex medium plate containing kanamycin (25 mg/L) to obtain about 20,000 colonies.

(31) <Complex Medium Plate (pH 7.0)>

(32) 10 g of glucose, 10 g of peptone, 5 g of beef extract, 5 g of yeast extract, 18.5 g of Brain Heart Infusion, 2.5 g of NaCl, 2 g of urea, 91 g of sorbitol, 20 g of agar (based on 1 L of distilled water)

Example 2: Screening of Random Mutant Library Using Transposon

(33) Each of about 20,000 colonies obtained in Example 1 was inoculated into a selection medium (300 μL), and cultured in 96 deep well plates at 32° C. at 1000 rpm for about 24 hours. A ninhydrin method was used to analyze the amount of L-lysine produced in the culture medium (Moore, S., Stein, W. H., Photometric ninhydrin method for use in the chromatography of amino acids. J. Biol. Chem. 1948, 176, 367-388). Upon completion of the cultivation, the culture supernatant (10 μL) and ninhydrin reaction solution (190 μL) were reacted at 65° C. for 30 minutes. Thereafter, the absorbance was measured at a wavelength of 570 nm using a spectrophotometer, and about 60 kinds of colonies were selected as modified strains showing high absorbance as compared with the control, KCCM11016P. Other colonies showed similar or decreased absorbance compared to that of the control, the KCCM11016P strain.

(34) 60 kinds of the selected strains were cultured in the same manner as above, and the ninhydrin reaction was repeatedly performed. As a result, the top 10 strains having improved L-lysine productivity compared to the strain KCCM11016P were selected.

(35) <Selection Medium (pH 8.0)>

(36) 10 g of glucose, 5.5 g of ammonium sulfate, 1.2 g of MgSO.sub.4 7H.sub.2O, 0.8 g of KH.sub.2PO.sub.4, 16.4 g of K.sub.2HPO.sub.4, 100 μg of biotin, 1000 μg of thiamine HCl, 2000 μg of calcium pantothenate, 2000 μg of nicotinamide (based on 1 L of distilled water)

Example 3: Analysis of L-Lysine Productivity of Selected Random Mutant Strains

(37) In order to finally select strains having increased L-lysine productivity, a reproducibility test was carried out in a flask using the medium below for 10 kinds of the strains selected in Example 2. 10 kinds of the strains and the control were inoculated in a corner-baffled flask (250 mL) containing the seed medium below (25 mL), and cultured while shaking at 30° C. and 200 rpm for 20 hours. The seed medium and production medium have the following compositions. Upon completion of the cultivation, L-lysine concentrations in the culture solution were analyzed using HPLC, and the L-lysine concentrations of each of the mutant strains are shown in Table 1 below.

(38) <Seed Medium (pH 7.0)>

(39) 20 g of glucose, 10 g of peptone, 5 g of yeast extract, 1.5 g of urea, 4 g of KH.sub.2PO.sub.4, 8 g of K.sub.2HPO.sub.4, 0.5 g of MgSO.sub.4.7H.sub.2O, 100 μg of biotin, 1000 μg of thiamine HCl, 2000 μg of calcium pantothenate, 2000 μg of nicotinamide (based on 1 L of distilled water)

(40) <Production Medium (pH 7.0)>

(41) 100 g of glucose, 40 g of (NH.sub.4).sub.2SO.sub.4, 2.5 g of soy bean protein, 5 g of corn steep solid, 3 g of urea, 1 g of KH.sub.2PO.sub.4, 0.5 g of MgSO.sub.4.7H.sub.2O, 100 μg of biotin, 1000 μg of thiamine HCl, 2000 μg of calcium pantothenate, 3000 μg of nicotinamide, 30 g of CaCO.sub.3 (based on 1 L of distilled water)

(42) TABLE-US-00001 TABLE 1 L-Lysine concentration of 10 selected mutant strains L-Lysine (g/L) Strain Batch 1 Batch 2 Batch 3 Average Control KCCM11016P 42.5 42.8 42.7 42.7 1 KCCM11016P/mt-1 48.8 48.9 48.5 48.7 2 KCCM11016P/mt-2 43.0 43.1 43.4 43.2 3 KCCM11016P/mt-3 42.7 43.1 42.9 42.9 4 KCCM11016P/mt-4 44.9 45.1 45.3 45.1 5 KCCM11016P/mt-5 44.3 44.1 44.0 44.1 6 KCCM11016P/mt-6 42.4 42.9 42.8 42.7 7 KCCM11016P/mt-7 43.8 43.2 43.7 43.6 8 KCCM11016P/mt-8 47.2 46.9 47.1 47.1 9 KCCM11016P/mt-9 44.1 44.4 44.2 44.2 10  KCCM11016P/mt-10 43.1 43.7 43.2 43.3

(43) Among the 10 selected mutants above, KCCM11016P/mt-1 and KCCM11016P/mt-8 were finally selected as strains having significantly improved L-lysine productivity.

Example 4: Confirmation of Genes Involved in L-Lysine Productivity in Finally-Selected Strains and Selection of Additional Candidate Genes

(44) In this Example, identification of genes which are deficient due to random insertion of a transposon was attempted from the strains finally selected in Example 3. Genomic DNAs of KCCM11016P/mt-1 and KCCM11016P/mt-8 were extracted and then digested. Thereafter, the resultants were ligated, transformed into E. coli DH5a, and then plated on an LB solid medium containing kanamycin (25 mg/L). After selecting 20 kinds of the transformed colonies, plasmids containing parts of the unknown genes were obtained, and nucleotide sequences were analyzed using the sequences of SEQ ID NO: 9 and SEQ ID NO: 10 in the EZ-Tn5™ <R6Kγori/KAN-2>Tnp Transposome™ Kit (Table 2). As a result, it was confirmed that each of NCgl2108 and NCgl2986 genes was inactivated in the mutant strains.

(45) TABLE-US-00002 TABLE 2 Sequence SEQ ID NO Kit primer ACCTACAACAAAGCTCTCATCAACC 9 Kit primer CTACCCTGTGGAACACCTACATCT 10

(46) The NCgl2108 and NCgl2986 genes identified as being deficient in the mutant strains selected in Example 3 were endogenously present in Corynebacterium, and thus identified as proteins involved in cell wall hydrolysis.

(47) Based on the results of selecting 2 kinds of proteins involved in cell wall hydrolysis in random mutant strains using transposons, it was considered that deficiency in genes involved in cell wall hydrolysis would be effective in increasing L-lysine productivity. Accordingly, a search was conducted in the National Center for Biotechnology Information (NCBI) for genes involved in cell wall hydrolysis other than the NCgl2108 and NCgl2986 genes.

(48) As a result of the search, NCgl1480 and NCgl2107 genes, which are endogenously present in Corynebacterium, were additionally selected as proteins involved in cell wall hydrolysis. Accordingly, in order to confirm whether deletion of the NCgl1480 and NCgl2107 genes affects L-lysine productivity, these genes were selected as additional deletion candidate genes.

Example 5: Production of Recombinant Plasmids for Inactivation of NCgl1480, NCgl2107, NCgl2108, and NCgl2986 Genes

(49) In this Example, in order to confirm whether inactivation of the NCgl1480, NCgl2107, NCgl2108, and NCgl2986 genes would affect L-lysine production, recombinant plasmids for deletion of the NCgl1480, NCgl2107, NCgl2108, and NCgl2986 genes selected in Example 4 on the chromosomes of the L-lysine-producing strains in Corynebacterium were produced.

(50) Based on the nucleotide sequences reported in the U.S. National Institutes of Health GenBank (NIH Genbank), amino acid sequences of SEQ ID NOS: 1, 2, 3, and 4 of NCgl1480, NCgl2107, NCgl2108, and NCgl2986, as well as nucleotide sequences of SEQ ID NOS: 5, 6, 7, and 8 encoding the same, were obtained. In order to produce gene fragments, in which the open reading frame of each of NCgl1480, NCgl2107, NCgl2108, and NCgl2986 are internally deleted, the primers of SEQ ID NOS: 11 to 14 for NCgl1480, 15 to 18 for NCgl2107, 19 to 22 for NCgl2108, and 23 to 26 for NCgl2986 were produced based on the above SEQ ID NOS: 5, 6, 7, and 8. The sequences thereof are shown in Table 3 below.

(51) TABLE-US-00003 TABLE 3 SEQ ID Primer Sequence NO NCgl1480 primer CCGGGGATCCTCTAGAACCTTGAAACTTC 11 CACTC NCgl1480 primer CTCCTGACGAACTATTTCAAATCCCCTAT 12 CAACCTC NCgl1480 primer CACCGAGGTAAATTGCCATGCAAGCGCA 13 ATCAACGC NCgl1480 primer GCAGGTCGACTCTAGAAACCACACATTAT 14 CGATC NCgl2107 primer CCGGGGATCCTCTAGAGCACAGGGCACC 15 CCTGTTG NCgl2107 primer CTCCTGACGAACTATTTCAAATCCCCTAT 16 CAACCTC NCgl2107 primer GAGGTTGATAGGGGATTTGAAATAGTTCG 17 TCAGGAG NCgl2107 primer GCAGGTCGACTCTAGAAACCACACATTAT 18 CGATC NCgl2108 primer CCGGGGATCCTCTAGAGAACCCTTAGTAG 19 TTGGG NCgl2108 primer GTAATCCAAGGAGTGCTCACCCACTGATG 20 AAACTCC NCgl2108 primer GGAGTTTCATCAGTGGGTGAGCACTCCTT 21 GGATTAC NCgl2108 primer GCAGGTCGACTCTAGACGAGCCTCAATAT 22 CAATC NCgl2986 primer CCGGGGATCCTCTAGATTAGGAGAAACCA 23 TGAGC NCgl2986 primer ATCAGTCAGAACTGCCAGGACTGCAGTAA 24 GAATACC NCgl2986 primer GGTATTCTTACTGCAGTCCTGGCAGTTCT 25 GACTGAT NCgl2986 primer GCAGGTCGACTCTAGAGTTGAGGCGTTTG 26 GATAC

(52) PCR was performed using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template along with nucleotide sequence pairs of SEQ ID NOS: 11 and 12, 13 and 14, 15 and 16, 17 and 18, 19 and 20, 21 and 22, 23 and 24, and 25 and 26, as primers (Sambrook et al., Molecular Cloning, a Laboratory Manual (1989), Cold Spring Harbor Laboratories). The PCR was performed under the following conditions: 30 cycles, each consisting of denaturation at 95° C. for 30 seconds, annealing at 50° C. for 30 seconds, and elongation at 72° C. for 1 minute.

(53) As a result, two pairs of DNA fragments of 319 bp and 410 bp (NCgl1480-A and NCgl1480-B, respectively) containing upstream and downstream regions of the NCgl1480 gene; two pairs of DNA fragments of 324 bp and 300 bp (NCgl2107-A and NCgl2107-B, respectively) containing upstream and downstream regions of the NCgl2107 gene; two pairs of DNA fragments of 381 bp and 377 bp (NCgl2108-A and NCgl2108-B, respectively) containing upstream and downstream regions of the NCgl2108 gene; and two DNA fragments of DNA fragments of 356 bp and 374 bp (NCgl2986-A and NCgl2986-B, respectively) containing upstream and downstream regions of the NCgl2986 gene were obtained. The DNA fragments amplified by the PCR were conjugated to the pDZ plasmid (Korean Patent No. 10-0924065) using an Infusion Cloning Kit (Invitrogen), transformed into E. coli DH5a, and then plated on an LB solid medium containing kanamycin (25 mg/L). After selecting colonies transformed with the plasmids in which the desired genes are inserted through the PCR, plasmids were obtained using a plasmid extraction method conventionally known in the art. The thus-obtained plasmids were designated as pDZ-ΔNCgl1480, pDZ-ΔNCgl2107, pDZ-ΔNCgl2108, and pDZ-ΔNCgl2986, respectively. In pDZ-ΔNCgl1480, a 1672 bp gene fragment of the NCgl1480 gene was deleted; in pDZ-ΔNCgl2107, a 1026 bp gene fragment of the NCgl2107 gene was deleted; in pDZ-ΔNCgl2108, a 576 bp gene fragment of the NCgl2108 gene was deleted; and in pDZ-ΔNCgl2986, a 1092 bp gene fragment of the gene NCgl2986 was deleted.

Example 6: Production and Evaluation of Cell Wall Hydrolysis-Associated Protein Gene-Inactivated Strain Derived from Lysine-Producing Strain KCCM11016P

(54) Based on KCCM11016P, the representative L-lysine-producing strain of the genus Corynebacterium, the cell wall hydrolysis-associated protein gene-inactivated strain selected from the above was prepared and evaluation of its lysine productivity was attempted.

(55) Each of the 4 recombinant plasmids (pDZ-ΔNCgl1480, pDZ-ΔNCgl2107, pDZ-ΔNCgl2108, and pDZ-ΔNCgl2986) produced in Example 5 was transformed into Corynebacterium glutamicum KCCM11016P by an electric pulse method, and strains wherein the target gene was inactivated by homologous recombination were prepared by a PCR method. The prepared inactivated strains were named KCCM11016P::ΔNCgl1480, KCCM11016P::ΔNCgl2107, KCCM11016P::ΔNCgl2108, and KCCM11016P::ΔNCgl2986, respectively.

(56) Each of the 4 strains and a control strain were inoculated in a corner-baffled flask (25 mL) containing 25 mL of the following seed medium, and was cultured while shaking at 30° C. and 200 rpm for 20 hours. Thereafter, the seed culture (1 mL) was inoculated in a corner-baffled flask (1 mL) containing 24 mL of the following production medium, and was cultured while shaking at 37° C. and 200 rpm for 96 hours. The composition of each of the seed medium and the production medium is as follows.

(57) <Seed Medium (pH 7.0)>

(58) 20 g of glucose, 10 g of (NH.sub.4).sub.2SO.sub.4, 10 g of peptone, 5 g of yeast extract, 1.5 g of urea, 4 g of KH.sub.2PO.sub.4, 8 g of K.sub.2HPO.sub.4, 0.5 g of MgSO.sub.4.H.sub.2O, 100 μg of biotin, 1000 μg of thiamine HCl, 2000 μg of calcium-pantothenate, 2000 μg of nicotinamide (based on 1 L of distilled water)

(59) <Production Medium (pH 7.0)>

(60) 100 g of glucose, 40 g of (NH.sub.4).sub.2SO.sub.4, 2.5 g of soybean protein, 5 g of corn steep solid, 3 g of urea, 1 g of KH.sub.2PO.sub.4, 0.5 g of MgSO.sub.4.H.sub.2O, 100 μg of biotin, 1000 μg of thiamine HCl, 2000 μg of calcium-pantothenate, 3000 μg of nicotinamide, 30 g of CaCO.sub.3 (based on 1 L of distilled water)

(61) Upon completion of the cultivation, L-lysine concentrations were analyzed using HPLC, and the concentrations are shown in Table 4 below. The results in Table 4 are the results of three repeated experiments, and the productivity was evaluated based on the average value.

(62) TABLE-US-00004 TABLE 4 Lysine (g/L) Batch 1 Batch 2 Batch 3 Average KCCM11016P 42.7 42.6 43.0 42.8 KCCM11016P-ΔNCgl1480 44.3 44.1 44.0 44.1 KCCM11016P-ΔNCgl2107 45.1 44.9 45.2 45.1 KCCM11016P-ΔNCgl2108 48.1 48.3 48.0 48.1 KCCM11016P-ΔNCgl2986 49.3 49.1 49.2 49.2

(63) As a result, as shown in Table 4 above, the lysine productivity of the strain wherein each of the NCgl1480, NCgl2107, NCgl2108, and NCgl2986 genes was inactivated increased to 3.2%, 5.4%, 13%, and 15%, respectively, compared to that of the parent strain KCCM11016P.

(64) These results suggest that the L-lysine productivity can be improved by inactivating proteins involved in cell wall hydrolysis, which may cause cell fusion in a microorganism of the genus Corynebacterium.

(65) Accordingly, experiments were conducted as below to determine whether or not similar effects can be exhibited in a case where the proteins involved in cell wall hydrolysis are inactivated in various microorganisms of the genus Corynebacterium.

Example 7: Production and Evaluation of Cell Wall Hydrolysis-Associated Protein-Inactivated Strains Derived from L-Lysine-Producing Strain KCCM10770P

(66) In order to examine whether the effects of inactivation of cell wall hydrolysis-associated proteins in the L-lysine-producing strain Corynebacterium glutamicum KCCM10770P (Korean Patent No. 10-0924065) having an enhanced lysine biosynthetic pathway are similar to the experimental results of Example 6, strains in which each of the 4 proteins involved in cell wall hydrolysis was inactivated was prepared in the same manner as described in Example 6. The prepared strains were named KCCM10770P::ΔNCgl1480, KCM10770P::ΔNCgl2107, KCCM10770P::ΔNCgl2108, and KCM10770P::ΔNCgl2986. The L-lysine productivity was compared therebetween.

(67) In order to compare the lysine productivity of the strains above, the strains and a control strain were cultured in the same manner as in Example 6. Upon completion of the cultivation, the L-lysine concentrations analyzed using HPLC are shown in Table 5 below. The results in Table 5 are the results of three repeated experiments, and the productivity was evaluated based on the average value.

(68) TABLE-US-00005 TABLE 5 Lysine (g/L) Batch 1 Batch 2 Batch 3 Average KCCM10770P 46.0 46.3 46.1 46.1 KCCM10770P-ΔNCgl1480 47.3 47.1 47.0 47.1 KCCM10770P-ΔNCgl2107 48.0 48.2 48.1 48.1 KCCM10770P-ΔNCgl2108 51.7 51.9 51.6 51.7 KCCM10770P-ΔNCgl2986 53.1 52.9 52.1 52.7

(69) As a result, as shown in Table 5 above, the lysine productivity of the strain wherein each of the NCgl1480, NCgl2107, NCgl2108, and NCgl2986 genes was inactivated increased to 2.2%, 4.3%, 12.1%, and 14.2%, respectively, compared to that of the parent strain KCCM10770P.

(70) Accordingly, it was found that in Corynebacterium glutamicum KCCM10770P (Korean Patent No. 10-0924065), the L-lysine productivity can also be improved by inactivating proteins involved in cell wall hydrolysis in the same manner as in Example 6.

Example 8: Production and Evaluation of Cell Wall Hydrolysis-Associated Protein-Inactivated Strains Derived from L-Lysine-Producing Strain KCCM11347P

(71) In order to examine the effects of inactivation of cell wall hydrolysis-associated proteins in the L-lysine-producing strain Corynebacterium glutamicum KCCM11347P (the microorganism had been designated as KFCC10750 and re-deposited with the international depository institution under the Budapest Treaty, and was then designated the deposit accession number of KCCM11347P; Korean Patent No. 10-0073610) prepared by artificial modification, strains in which each of the 4 proteins involved in cell wall hydrolysis was inactivated was prepared in the same manner as described in Example 6. The prepared strains were named KCCM11347P::ΔNCgl1480, KCCM11347P:ΔNCgl2107, KCCM11347P::ΔNCgl2108, and KCCM11347P:ΔNCgl2986. The L-lysine productivity was compared therebetween.

(72) In order to compare the lysine productivity of the strains above, the strains and a control strain were cultured in the same manner as in Example 6. Upon completion of the cultivation, the L-lysine concentrations were analyzed using HPLC, and are shown in Table 6 below. The results in Table 6 are the results of three repeated experiments, and the productivity was evaluated based on the average value.

(73) TABLE-US-00006 TABLE 6 Lysine (g/L) Batch 1 Batch 2 Batch 3 Average KCCM11347P 38.2 38.6 38.3 38.4 KCCM11347P-ΔNCgl1480 39.0 39.4 39.1 39.2 KCCM11347P-ΔNCgl2107 39.1 39.5 39.3 39.3 KCCM11347P-ΔNCgl2108 39.8 40.2 39.9 42.9 KCCM11347P-ΔNCgl2986 39.9 40.3 40.1 43.9

(74) As a result, as shown in Table 6 above, the lysine productivity of the strain wherein each of the NCgl1480, NCgl2107, NCgl2108, and NCgl2986 genes was inactivated increased to 2%, 2.4%, 11.7%, and 14.4%, respectively, compared to that of the parent strain KCCM11347P.

(75) Accordingly, it was found that in Corynebacterium glutamicum KCCM11347P (Korean Patent No. 10-0073610), the L-lysine productivity can also be improved by inactivating proteins involved in cell wall hydrolysis in the same manner as in Examples 6 and 7.

Example 9: Production and Evaluation of Cell Wall Hydrolysis-Associated Protein-Inactivated Strains Derived from L-Lysine-Producing Strain CJ3P

(76) In order to examine whether the effects of inactivation of cell wall hydrolysis-associated proteins in Corynebacterium glutamicum CJ3P (Binder et al. Genome Biology 2012, 13:R40), which produces L-lysine by introducing 3 kinds of modifications [pyc(P458S), hom(V59A), and lysC(T311I)] in wild-type Corynebacterium glutamicum, are similar to the experimental results of Examples 6, 7, and 8, strains in which each of the 4 proteins involved in cell wall hydrolysis was inactivated were prepared in the same manner as described in Example 6. The prepared strains were named CJ3P::ΔNCgl1480, CJ3P::ΔNCgl2107, CJ3P::ΔNCgl2108, and CJ3P::ΔNCgl2986. The L-lysine productivity was compared therebetween.

(77) In order to compare the lysine productivity of the strains above, the strains and a control strain were cultured in the same manner as in Example 6. Upon completion of the cultivation, the L-lysine concentrations analyzed using HPLC are shown in Table 7 below. The results in Table 7 are the results of three repeated experiments, and the productivity was evaluated based on the average value.

(78) TABLE-US-00007 TABLE 7 Lysine (g/L) Batch 1 Batch 2 Batch 3 Average CJ3P 7.8 8.0 7.9 7.9 CJ3P-ΔNCgl1480 8.3 8.0 8.1 8.1 CJ3P-ΔNCgl2107 8.0 7.9 8.1 8.0 CJ3P-ΔNCgl2108 8.8 8.9 9.0 8.9 CJ3P-ΔNCgl2986 9.1 9.2 9.2 9.2

(79) As a result, as shown in Table 7 above, the lysine productivity of the strain wherein each of the NCgl1480, NCgl2107, NCgl2108, and NCgl2986 genes was inactivated increased to 3%, 1.3%, 12.7%, and 16%, respectively, compared to that of the parent strain CJ3P.

(80) Accordingly, it was found that in Corynebacterium glutamicum CJ3P, the L-lysine productivity can also be improved by inactivating proteins involved in cell wall hydrolysis in the same manner as in Examples 6, 7, and 8.

Example 10: Production and Evaluation of Cell Wall Hydrolysis-Associated Protein-Simultaneously Inactivated Strain Derived from L-Lysine-Producing Strain KCCM11016P

(81) After confirming from the Examples above that the L-lysine productivity was increased when each of the proteins involved in cell wall hydrolysis was inactivated in the L-lysine-producing strain Corynebacterium, identification was attempted as to whether the L-lysine productivity would be also increased when the 2 relevant proteins were simultaneously inactivated.

(82) Therefore, the following experiment was carried out to confirm the effect of simultaneous inactivation of proteins involved in cell wall hydrolysis in the L-lysine-producing strain Corynebacterium. The strain in which two types of the protein genes (NCgl2108 and NCgl2986) involved in cell wall hydrolysis, which are highly effective in enhancing L-lysine productivity when each of the proteins is deficient, were simultaneously inactivated was prepared in the same manner as in Example 6. The prepared strain was designated as KCCM11016P::ΔNCgl2108/ΔNCgl2986. The L-lysine productivity was compared.

(83) In order to compare the L-lysine productivity of the strain above, the strain and a control strain were cultured in the same manner as in Example 6. Upon completion of the cultivation, the L-lysine concentrations analyzed using HPLC are shown in Table 8 below. The results in Table 8 are the results of three repeated experiments, and the productivity was evaluated based on the average value.

(84) TABLE-US-00008 TABLE 8 Lysine (g/L) Batch 1 Batch 2 Batch 3 Average KCCM11016P 43.4 43.1 43.2 43.2 KCCM11016P-ΔNCgl2108/ 52.6 52.4 52.7 52.6 ΔNCgl2986

(85) As a result, as shown in Table 8, the lysine productivity of the strain wherein the NCgl2108 and NCgl2986 genes were simultaneously inactivated was increased to 21.6%, compared to that of the parent strain KCCM11016P.

(86) This result suggests that the L-lysine productivity can be improved even when not only one protein but also two or more proteins involved in cell wall hydrolysis were simultaneously inactivated in a microorganism of the genus Corynebacterium.

(87) In this regard, the strain above, KCCM11016P-ΔNCgl2986, was named CA01-2292. CA01-2292 was deposited with the Korean Culture Center of Microorganisms (KCCM), an international depository institution, under the Budapest Treaty, and was then designated the deposit accession number of KCCM11627P.

(88) Based on these results, it was confirmed that the L-lysine-producing strains had the effect of enhancing the L-lysine productivity by regulating cell lysis during the fermentation in which the proteins involved in cell wall hydrolysis were inactivated in comparison with their endogenous activity. Additionally, it was also confirmed that the L-lysine productivity can be improved when not only one but also two or more proteins involved in cell wall hydrolysis were simultaneously inactivated, thereby providing the novel strain producing L-lysine.

(89) While the present disclosure has been described with reference to particular illustrative embodiments, it will be understood by those skilled in the art to which the present disclosure pertains that the present disclosure may be embodied in other specific forms without departing from the technical spirit or essential characteristics of the present disclosure. Therefore, the embodiments described above are considered to be illustrative in all respects and not restrictive. Furthermore, the scope of the present disclosure is defined by the appended claims rather than the detailed description, and it should be understood that all modifications or variations derived from the meanings and scope of the present disclosure and equivalents thereof are included in the scope of the appended claims.