TRANSGENE AND MUTATIONAL CONTROL OF SEXUALITY IN MAIZE AND RELATED GRASSES
20210277410 · 2021-09-09
Inventors
- Stephen L. Dellaporta (Branford, CT)
- Andrew HAYWARD (Madison, CT, US)
- Maria MORENO (Branford, CT, US)
- Albert KAUSCH (Stonington, CT, US)
- John MOTTINGER (North Kingstown, RI, US)
Cpc classification
C12N15/8218
CHEMISTRY; METALLURGY
C12N15/8212
CHEMISTRY; METALLURGY
C12N15/8213
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention pertains to genetically modified plants, particularly maize, sorghum and rice, with an all pistillate or all staminate phenotype and methods of the same. The survival of functional pistils in maize requires the action of the sk1 gene. SK1 encodes a glycosyltransferase (GT) that protects pistils from tasselseed-mediated cell death. sk1-dependent pistil protection at a developing floret gives rise to stamen arrest at the same floret, and so determines the pistillate floral fate. This is the first single gain-of-function gene known to control sexuality. The present invention further provides a direct strategy to extend hybrid technologies to related cereals such as sorghum and rice. Tasselseed and silkless genes represent major sex determination genes in maize, a pathway that permits the efficient production of hybrid seed and the associated benefits of heterosis-increased yield, resistance to pathogens, etc. Except for maize, current hybrid systems in cereals are fraught with genetic and environmental limitations. Genotype-independent hybrid cereal technology could potentially increase crop yields as much as 20-40% without placing additional land under agricultural production. This has profound implications for food security and the environmental impact of agriculture in some of the poorest regions of the world.
Claims
1. An isolated polynucleotide encoding a polypeptide of SEQ ID NO: 2 or an amino acid sequence variant thereof operably linked to a heterologous promoter.
2. The isolated polynucleotide of claim 1, wherein the heterologous promoter is a CaMV 35S promoter.
3. The isolated polynucleotide of claim 1 further comprising a marker gene.
4. The isolated polynucleotide of claim 3, wherein the marker gene is an herbicide resistance gene.
5. The isolated polynucleotide of claim 4, wherein the herbicide resistance gene is bar.
6. The isolated polynucleotide of claim 4, wherein the herbicide resistance gene encodes 5-enolpyruvyl-shikimate synthase (ESPS).
7. The isolated polynucleotide of claim 3, wherein the marker gene affects the visual appearance of the seed or seedling.
8. The isolated polynucleotide of claim 7, wherein the marker gene controls the appearance or distribution of anthrocyanin pigments in the seed or seedling.
9. A plant cell transformed with the isolated polynucleotide of claim 1.
10. A genetically modified plant comprising a transgene containing an sk1-encoded glycosyltransferase operably linked to a promoter for heterologous expression in the cells of the plant.
11. The genetically modified plant of claim 10, wherein the plant is maize, sorghum or rice.
12. The genetically modified plant of claim 10, wherein the genetically modified plant is a unisexual plant.
13. A genetically modified plant comprising a transgene encoding a uridine diphosphate (UDP) glycosyltransferase.
14. The genetically modified plant of claim 13, wherein the plant is maize, sorghum or rice.
15. The genetically modified plant of claim 14, wherein the genetically modified plant comprises inflorescences of the pistillate phenotype associated with sk1.
16. The genetically modified plant of claim 15, wherein the inflorescences are solely of the pistillate phenotype associated with sk1.
17. A genetically modified plant comprising a mutation or transgene targeting an endogenous UDP glycosyltransferase and disrupting its activity.
18. The plant of claim 17, wherein the UDP glycosyltransferase is sk1.
19. The genetically modified plant of claim 17, wherein the plant is maize, sorghum or rice.
20. The genetically modified plant of claim 17 comprising inflorescences of the staminate phenotype associated with the disruption of sk1.
21. The genetically modified plant of claim 17, wherein the genetically modified plant is a unisexual plant.
22. The genetically modified plant of claim 17, wherein the mutation is engineered using a CRISPR/Cas9 system.
23. A method of generating a genetically modified plant comprising transforming a cell with a construct comprising a transgene encoding a UDP glycosyltransferase, thereby promoting the expression of the UDP glycosyltransferase in one or more cells of the plant.
24. The method of claim 23, wherein the transgene is sk1.
25. The method of claim 23, wherein the transgene comprises a polynucleotide encoding a polypeptide of SEQ ID NO: 2 or an amino acid sequence variant thereof.
26. The method of any one of claim 23, wherein the transgene is operably linked to a heterologous promoter.
27. The method of claim 26, wherein the heterologous promoter is a CaMV 35S promoter.
28. The method of claim 23, wherein the UDP glycosyltransferase localizes to a peroxisome.
29. The method of any one of claim 23, wherein the construct further comprises a marker gene.
30. The method of claim 29, wherein the marker gene is an herbicide resistance gene.
31. The method of claim 30, wherein the herbicide resistance gene is bar.
32. The method of claim 30, wherein the herbicide resistance gene encodes 5-enolpyruvyl-shikimate synthase (ESPS).
33. The method of claim 29, wherein the marker gene affects the visual appearance of a seed or seedling.
34. The method of claim 33, wherein the marker gene controls the appearance or distribution of one or more anthrocyanin pigments in the seed or seedling.
35. The method according to claim 29, further comprising using the marker gene to select at least one genetically modified plant.
36. The method according to claim 35, further comprising using the genetically modified plant to generate a hybrid seed.
37. The method according to claim 29, wherein the plant is maize, rice or sorghum.
38. A method of generating a transgenic plant comprising the step of engineering a mutation or transgene targeting an endogenous UDP glycosyltransferase and disrupting its activity.
39. The method of claim 38, wherein the UDP glycosyltransferase is sk1.
40. The method of claim 38, wherein the plant is maize, sorghum or rice.
41. The method of claim 38, wherein the plant comprises at least one inflorescence of the staminate phenotype associated with the disruption of sk1.
42. The method of claim 40, wherein the wherein the transgenic plant is a unisexual plant.
43. The method of claim 38, wherein the mutation is engineered using a CRISPR/Cas9 system.
44. A method of generating a transgenic plant comprising engineering a mutation in a 5′ or 3′ regulatory element of an endogenous UDP glycosyltransferase to alter an expression level of the UDP glycosyltransferase.
45. The method of claim 44, wherein the transgenic plant is maize, rice or sorghum.
46. The method of claim 44, wherein the transgenic plant is a unisexual plant.
47. The method of any one of claim 44, wherein the mutation is engineered using a crispr/Cas9 system, zinc-finger nucleases or transcription activator-like effects.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0052] The following detailed description of preferred embodiments of the invention will be better understood when read in conjunction with the appended drawings. For the purpose of illustrating the invention, there are shown in the drawings embodiments which are presently preferred. It should be understood, however, that the invention is not limited to the precise arrangements and instrumentalities of the embodiments shown in the drawings.
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
DETAILED DESCRIPTION
The sk1 Gene
[0088] In one embodiment, the sk1 gene or coding sequence (CDS) thereof is synthetically engineered to be expressed from a heterologous promoter and transformed into a plant cell. Such heterologous promoters facilitate expression of sk1 constitutively throughout the plant or in a tissue-specific manner to block pistil death. One example of a suitable heterologous promoter is the CaMV 35S promoter. The invention should not be construed to be limited to this promoter in that any heterologous promoter that facilitates expression of sk1 to prevent pistil destruction should be considered to be included in the invention.
[0089] In another embodiment, there is provided an isolated DNA fragment comprising the coding region of the sk1-encoded glycosyltransferase from maize or closely related species, where the DNA is adapted for expression in plants, and therefore includes a suitable promoter for constitutive, tissue- or cell-specific expression. In one embodiment a transgene containing sk1-encoded glycosyltransferase is operably linked to a suitable promoter for heterologous expression in plants.
[0090] In yet another embodiment, the sk1 transgene is co-expressed with a marker gene to permit the identification of sk1 transgenic plants in the lab or the field. Non-limiting examples of marker genes are herbicide-resistance genes such as the bar or 5-enolpyruvyl-shikimate synthase (ESPS) genes that can be used as selectable markers in both the lab and the field. These stacked herbicide resistance and sk1 transgenes can be used as selectable markers in plant transformation experiments and because they co-segregate in progeny, would allow for the identification of sk1 transgenics in the field. This is useful for several purposes including, but not limited to: 1) cells transformed with sk1 transgenes can be identified using herbicides as selectable markers in tissue culture, in whole plants, or in field applications; 2) the herbicide can be used as a selection for plants containing the sk1 transgene in breeding new lines; and 3) herbicide application in the field can be used to select for sk1 transgenics in a population segregating for the transgene. The latter usage is especially important for the ability to create hybrid seed. Another example of a marker gene is one that can be visualized in the seed or seedling. In certain embodiments such marker genes can control the deposition of anthocyanin pigments in the seed or seedling.
Expression of the sk1 Gene
[0091] In one embodiment, a mutation in an endogenous sk1 gene is generated so as to facilitate expression of this gene in a heterologous manner in plants. For example, a dominant gain of function allele of sk1 can be engineered by modifying the 5′ or 3′ regulatory sequences of endogenous sk1 in order to block pistil death in a floret that would not normally express sk1 without these modifications. This targeted modification of endogenous sk1 to generate a pistillate flower can be achieved using the CRISPR/Cas9 system, zinc-finger nucleases, transcription activator-like effector nucleases, or other technologies of this type well known to the skilled artisan.
[0092] In another embodiment a transgene targeting endogenous sk1 or a closely related glycosyltransferase in plants is used to disrupt its activity. In another embodiment, a mutation in endogenous sk1 is generated in order to knock down the expression of sk1 in its natural environment. For example, pistil destruction in a floret can be promoted by the targeted disruption of sk1 using the CRISPR/Cas9 system or other similar methods. The disruption of sk1 should result in an effective recessive mutation manifesting as staminate flowers in a homozygous plant.
Methods of Using the Sk1 Gene
[0093] The present invention provides a novel and innovative approach to use heterologous expression of a maize sex determination gene, silkless1 (sk1), to achieve the production of unisexual flowers (staminate or pistillate) in maize and related cereals. The tasselseed genes, specifically ts1 and ts2 are required to eliminate pistils while permitting stamens to mature. Pistil elimination by tasselseed action results in completely staminate flowers (called florets in grasses such as maize and related cereals). The ts1 and ts2 gene products have been shown to cause pistil cell death through a jasmonic acid (JA) signaling pathway. In another embodiment a synthetic mutation in an endogenous or orthologous sk1 gene is engineered for the purposes of manipulating floral sexuality or endogenous jasmonate levels.
[0094] The invention further pertains to the application of the sk1-encoded glycosyltransferase as a method of manipulating the sexual fate of flowers. It has been discovered in the present invention that abolishing sk1 protection eliminates pistil formation in the florets. Similarly, it has been discovered in the present invention that expression of sk1 protects pistils from tasselseed-mediated elimination. The invention therefore includes the use of sk1 alone or in combination with tasselseed genes in a method of manipulating the sexual fate of florets.
[0095] Maize plants produce both staminate (“male”) and pistillate (“female”) unisexual flowers on a single plant. Specifically, a maize plant produces a primary apical staminate flower (the “tassel”) and one or more axillary pistillate flowers (the “ears”). Hybrid seed is produced by crossing staminate flowers from a selected genetic background to pistillate flowers from a second selected genetic background. There is currently no system that produces unisexual maize plants that are either completely staminate or completely pistillate in order to expedite the production of hybrid seed. Such a system would enable the rapid development of hybrid maize seed from novel genetic backgrounds. Such a system would also enable the expedited production of hybrid seed from previously established genetic backgrounds.
[0096] Accordingly, in another embodiment of the invention there is provided a genetically modified unisexual plant comprising a transgene encoding sk1 or a closely related UDP glycosyltransferase. In various embodiments, a method of producing hybrid seeds are provided where the method comprises the step of crossing unisexual plants generated by either the inclusion of an sk1 transgene or a closely related UDP glycosyltransferase or the disruption of endogenous sk1. In certain non-limiting aspects, the unisexual plants are cereal grains, for example maize, sorghum or rice.
[0097] In various embodiments, additional sk1-related glycosyltransferases with the same biological activity and synthetically engineered for peroxisome localization as sk1 are used to achieve the objectives described herein.
Definitions
[0098] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are described.
[0099] The articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element.
[0100] “About” as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of ±20% or ±10%, more preferably ±5%, even more preferably ±1%, and still more preferably ±0.1% from the specified value, as such variations are appropriate to perform the disclosed methods.
[0101] The term “abnormal” when used in the context of organisms, tissues, cells or components thereof, refers to those organisms, tissues, cells or components thereof that differ in at least one observable or detectable characteristic (e.g., age, treatment, time of day, etc.) from those organisms, tissues, cells or components thereof that display the “normal” (expected) respective characteristic. Characteristics which are normal or expected for one cell or tissue type, might be abnormal for a different cell or tissue type.
[0102] As used herein the terms “alteration,” “defect,” “variation” or “mutation” refer to a mutation in a gene in a cell that affects the function, activity, expression (transcription or translation) or conformation of the polypeptide it encodes. Mutations encompassed by the present invention can be any mutation of a gene in a cell that results in the enhancement or disruption of the function, activity, expression or conformation of the encoded polypeptide, including the complete absence of expression of the encoded protein and can include, for example, missense and nonsense mutations, insertions, deletions, frameshifts and premature terminations. Without being so limited, mutations encompassed by the present invention may alter splicing the mRNA (splice site mutation) or cause a shift in the reading frame (frameshift).
[0103] The term “amino acid sequence variant” refers to polypeptides having amino acid sequences that differ to some extent from a native sequence polypeptide. Ordinarily, amino acid sequence variants will possess at least about 70% homology, or at least about 80%, or at least about 90% homology to the native polypeptide. The amino acid sequence variants possess substitutions, deletions, and/or insertions at certain positions within the amino acid sequence of the native amino acid sequence.
[0104] As used herein, the term “binding” refers to the adherence of molecules to one another, such as, but not limited to, enzymes to substrates, antibodies to antigens, DNA strands to their complementary strands. Binding occurs because the shape and chemical nature of parts of the molecule surfaces are complementary. A common metaphor is the “lock-and-key” used to describe how enzymes fit around their substrate.
[0105] The term “coding sequence,” as used herein, means a sequence of a nucleic acid or its complement, or a part thereof, that can be transcribed and/or translated to produce the mRNA and/or the polypeptide or a fragment thereof. Coding sequences include exons in a genomic DNA or immature primary RNA transcripts, which are joined together by the cell's biochemical machinery to provide a mature mRNA. The anti-sense strand is the complement of such a nucleic acid, and the coding sequence can be deduced therefrom. In contrast, the term “non-coding sequence,” as used herein, means a sequence of a nucleic acid or its complement, or a part thereof, that is not translated into amino acid in vivo, or where tRNA does not interact to place or attempt to place an amino acid. Non-coding sequences include both intron sequences in genomic DNA or immature primary RNA transcripts, and gene-associated sequences such as promoters, enhancers, silencers, and the like.
[0106] As used herein, the terms “complementary” or “complementarity” are used in reference to polynucleotides (i.e., a sequence of nucleotides) related by the base-pairing rules. For example, the sequence “A-G-T,” is complementary to the sequence “T-C-A.” Complementarity may be “partial,” in which only some of the nucleic acids' bases are matched according to the base pairing rules. Or, there may be “complete” or “total” complementarity between the nucleic acids. The degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands. This is of particular importance in amplification reactions, as well as detection methods that depend upon binding between nucleic acids.
[0107] As used herein, the terms “conservative variation” or “conservative substitution” as used herein refers to the replacement of an amino acid residue by another, biologically similar residue. Conservative variations or substitutions are not likely to change the shape of the peptide chain. Examples of conservative variations, or substitutions, include the replacement of one hydrophobic residue such as isoleucine, valine, leucine or methionine for another, or the substitution of one polar residue for another, such as the substitution of arginine for lysine, glutamic for aspartic acid, or glutamine for asparagine, and the like.
[0108] As used herein, the term “domain” refers to a part of a molecule or structure that shares common physicochemical features, such as, but not limited to, hydrophobic, polar, globular and helical domains or properties. Specific examples of binding domains include, but are not limited to, DNA binding domains and ATP binding domains.
[0109] “Encoding” refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom. Thus, a gene encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system. Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the non-coding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA.
[0110] The term “expression” as used herein is defined as the transcription and/or translation of a particular nucleotide sequence driven by its promoter.
[0111] “Expression vector” refers to a vector comprising a recombinant polynucleotide comprising expression control sequences operatively linked to a nucleotide sequence to be expressed. An expression vector comprises sufficient cis-acting elements for expression; other elements for expression can be supplied by the host cell or in an in vitro expression system. Expression vectors include all those known in the art that pertain to expression of genes in plant cells.
[0112] As used herein, the term “fusion peptide” or “fusion polypeptide” or “fusion protein” or “fusion peptidomimetic” or “fusion non-peptide-analog” refers to a heterologous peptide, heterologous polypeptide, heterologous protein, peptidomimetic, or non-peptide analog linked to a membrane translocation domain.
[0113] As used herein, the term “fragment,” as applied to a nucleic acid, refers to a subsequence of a larger nucleic acid. A “fragment” of a nucleic acid can be at least about 15 nucleotides in length; for example, at least about 50 nucleotides to about 100 nucleotides; at least about 100 to about 500 nucleotides, at least about 500 to about 1000 nucleotides; at least about 1000 nucleotides to about 1500 nucleotides; about 1500 nucleotides to about 2500 nucleotides; or about 2500 nucleotides (and any integer value in between). As used herein, the term “fragment,” as applied to a protein or peptide, refers to a subsequence of a larger protein or peptide. A “fragment” of a protein or peptide can be at least about 20 amino acids in length; for example, at least about 50 amino acids in length; at least about 100 amino acids in length; at least about 200 amino acids in length; at least about 300 amino acids in length; or at least about 400 amino acids in length (and any integer value in between).
[0114] “Homologous” refers to the sequence similarity or sequence identity between two polypeptides or between two nucleic acid molecules. When a position in both of the two compared sequences is occupied by the same base or amino acid monomer subunit, e.g., if a position in each of two DNA molecules is occupied by adenine, then the molecules are homologous at that position. The percent of homology between two sequences is a function of the number of matching or homologous positions shared by the two sequences divided by the number of positions compared ×100. For example, if 6 of 10 of the positions in two sequences are matched or homologous then the two sequences are 60% homologous. By way of example, the DNA sequences ATTGCC and TATGGC share 50% homology. Generally, a comparison is made when two sequences are aligned to give maximum homology.
[0115] A “nucleic acid” refers to a polynucleotide and includes poly-ribonucleotides and poly-deoxyribonucleotides. Nucleic acids according to the present invention may include any polymer or oligomer of pyrimidine and purine bases, preferably cytosine, thymine, and uracil, and adenine and guanine, respectively. See Albert L. Lehninger, Principles of Biochemistry, at 793-800 (Worth Pub. 1982) which is herein incorporated in its entirety for all purposes. Indeed, the present invention contemplates any deoxyribonucleotide, ribonucleotide or peptide nucleic acid component, and any chemical variants thereof, such as methylated, hydroxymethylated or glucosylated forms of these bases, and the like. The polymers or oligomers may be heterogeneous or homogeneous in composition, and may be isolated from naturally occurring sources or may be artificially or synthetically produced. In addition, the nucleic acids may be DNA or RNA, or a mixture thereof, and may exist permanently or transitionally in single-stranded or double-stranded form, including homoduplex, heteroduplex, and hybrid states.
[0116] An “oligonucleotide” or “polynucleotide” is a nucleic acid ranging from at least 2, in certain embodiments at least 8, 15 or 25 nucleotides in length, but may be up to 50, 100, 1000, or 5000 nucleotides long or a compound that specifically hybridizes to a polynucleotide. Polynucleotides include sequences of deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) or mimetics thereof which may be isolated from natural sources, recombinantly produced or artificially synthesized. A further example of a polynucleotide of the present invention may be a peptide nucleic acid (PNA). (See U.S. Pat. No. 6,156,501 which is hereby incorporated by reference in its entirety) The invention also encompasses situations in which there is a nontraditional base pairing such as Hoogsteen base pairing which has been identified in certain tRNA molecules and postulated to exist in a triple helix. “Polynucleotide” and “oligonucleotide” are used interchangeably herein. It is understood that when a nucleotide sequence is represented herein by a DNA sequence (e.g., A, T, G, and C), this also includes the corresponding RNA sequence (e.g., A, U, G, C) in which “U” replaces T.
[0117] The term “promoter” as used herein is defined as a DNA sequence recognized by the synthetic machinery of the cell, or introduced synthetic machinery, required to initiate the specific transcription of a polynucleotide sequence.
[0118] As used herein, the term “promoter/regulatory sequence” means a nucleic acid sequence which is required for expression of a gene product operably linked to the promoter/regulatory sequence. In some instances, this sequence may be the core promoter sequence and in other instances, this sequence may also include an enhancer sequence and other regulatory elements which are required for expression of the gene product. The promoter/regulatory sequence may, for example, be one which expresses the gene product in a tissue specific manner.
[0119] A “constitutive” promoter is a nucleotide sequence which, when operably linked with a polynucleotide which encodes or specifies a gene product, causes the gene product to be produced in a cell under most or all physiological conditions of the cell.
[0120] An “inducible” promoter is a nucleotide sequence which, when operably linked with a polynucleotide which encodes or specifies a gene product, causes the gene product to be produced in a cell substantially only when an inducer which corresponds to the promoter is present in the cell.
[0121] A “tissue-specific” promoter is a nucleotide sequence which, when operably linked with a polynucleotide encodes or specified by a gene, causes the gene product to be produced in a cell substantially only if the cell is a cell of the tissue type corresponding to the promoter.
[0122] The phrase “under transcriptional control” or “operatively linked” as used herein means that the promoter is in the correct location and orientation in relation to a polynucleotide to control the initiation of transcription by RNA polymerase and expression of the polynucleotide.
[0123] As used herein, the terms “transformation” and “transfection” are intended to refer to a variety of art-recognized techniques for introducing foreign nucleic acid (e.g., DNA) into a host cell, including calcium phosphate or calcium chloride co-precipitation, DEAE-dextran-mediated transfection, lipofection, or electroporation. Suitable methods for plants include the use of gold nanoparticles and the use of a viral vector such as Agrobacterium tumefaciens. Suitable methods for transforming or transfecting host cells can be found in Sambrook, et al. (Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989), and other laboratory manuals.
[0124] As used herein, the term “wild-type” refers to the genotype and phenotype that is characteristic of most of the members of a species occurring naturally and contrasting with the genotype and phenotype of a mutant.
[0125] Ranges: throughout this disclosure, various aspects of the invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.
EXPERIMENTAL EXAMPLES
[0126] The invention is further described in detail by reference to the following experimental examples. These examples are provided for purposes of illustration only, and are not intended to be limiting unless otherwise specified. Thus, the invention should in no way be construed as being limited to the following examples, but rather, should be construed to encompass any and all variations which become evident as a result of the teaching provided herein.
[0127] Without further description, it is believed that one of ordinary skill in the art can, using the preceding description and the following illustrative examples, make and utilize the compounds of the present invention and practice the claimed methods. The following working examples therefore, specifically point out the preferred embodiments of the present invention, and are not to be construed as limiting in any way the remainder of the disclosure.
[0128] The materials and methods employed in these experiments are now described.
Materials and Methods
Genetic Stocks
[0129]
TABLE-US-00001 TABLE 1 sk1 alleles used in this study Target site Reference Allele Mutation duplication Position* (source) sk1-ref >4 kb Helitron insertion none 1562 (intron Jones et al. 1) 1925 (Maize Coop) sk1- 1379 bp Mu1 insertion GCTGGCGCT 2537 (exon 2) Rescue Mu rMu lines (Maize Coop) sk1- 3549 bp uncharacterized GTACA 2544 (intron This Allie1 insertion 1) study *Based on B73 RefGen_v3 genomic DNA sequence, maizegdb dot org/gene_center/gene?id=GRMZM2G021786
[0130] The sk1-ref allele and the sk1-mu1 allele were obtained from the Maize Genetics Cooperation Stock Center (maizecoop dot cropsci dot uiuc dot edu). Several sk1 alleles were originally found as segregating silkless plants arising from the active Mutator lines from the RescueMu project. See J. Fernandes et al., Genome Biol. 5, R82 (2004). Because these plants were derived from a population of Mutator plants with common parents, it was likely that they represented a single recessive mutation herein referred to as the sk1-mu1 allele. To determine allelism with the sk1 reference allele, sk1-mu1/sk1-mu1 pollen was crossed to female Sk1-W22/sk1-ref plants. The progeny of this cross segregated 1:1 for silkless confirming that sk1-mu1 is allelic to sk1-ref. The sk1-Allie1 allele was recovered by test crossing sk1-ref/sk1-ref plants to females homozygous for b-Peru:dSpm with an active Spms. Kernels showing a high degree of instability were selected and planted. In a population of approximately 6000, three silkless mutant plants were found that failed to complement the sk1-ref mutation, including the sk1-Allie1 mutant.
Selection and Design of Molecular Markers for Sk1-Ref Mapping
[0131] Molecular markers were initially selected from the IBM2 2004 neighbors genetic map of maize chromosome 2 available at www.maizegdb.org. This tool was developed by the Maize Mapping Project and at the time that this study began in 2009, it was the best resolved genetic map of maize with ˜2,000 loci. Table 2 presents a list of the markers used. In most cases, these were Simple Sequence Repeats (SSRs) that had previously been developed into PCR-based assays. In other cases, as noted in Table 2, the genomic sequence of the markers was obtained from W22 and sk1-ref lines and used to design CAPS (Cleaved Amplified Polymorphic Sequences) assays according to A. Konieczny, F. M. Ausubel, A procedure for mapping Arabidopsis mutations using co-dominant ecotype-specific PCR-based markers. Plant J. 4, 403-410 (1993). Additional CAPS markers were designed from predicted gene sequences previously filtered for repetitive DNA in the TIGR Maize Database.
Physical Mapping of Sk1-Ref Genetic Interval
[0132] A physical map position of sk1 was initially defined utilizing a population of 198 testcross individuals segregating 1:1 for wild-type (sk1-ref/Sk1-W22) and mutant (sk1-ref/sk1-ref) plants. Molecular marker umc34 was identified as located proximal and the closest to sk1, at ˜1.5 cM (
Mu-Taq Library Construction and Identification of Sk1-Mu1
[0133] Genomic sk1-rMu1 DNA was digested with TaqαI, end-repaired, adenylated and ligated to custom Illumina paired-end adapters as described in T. P. Howard, 3rd et al., Identification of the maize gravitropism gene lazy plant1 by a transposon-tagging genome resequencing strategy. PloS one 9, e87053 (2014) with the modifications described below. TaqαI libraries were created with genomic DNA extracted from four independent plants homozygous for the sk1-rMu1 allele. The custom adaptors used for sk1-rMu1 cloning were of an earlier iteration than those described in Howard et al. One adapter incorporated a 4 bp barcode index while the other was a common adapter (Table 2). These adaptors were essentially identical to those described previously in Elshire et al., PloS one 6, e19379 (2011). Each genomic sample was associated with a unique barcoded adapter. 18 μl of end-repaired, adenylated TaqαI fragments were ligated to adaptors by 5 μl Quick T4 DNA Ligase (NEB) in 50 μl reactions containing 28 nM each of adapter in 1× Quick Ligase Buffer (NEB). Reactions were incubated at 20° C. for 20 minutes. Excess adaptors were removed using Microcon YM-50 columns (Millipore) as described in Howard et al. Duplicate 50 μl PCR reactions were performed to enrich each sample for sequencing. Reactions contained 1× Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB), 500 nM of each primer (see Table 2), and ˜100 ng adapted DNA. Cycling instructions were as follows: 98° C. (2 minutes); 15 cycles of 98° C. (10 seconds), 65° C. (30 seconds), 72° C. (30 seconds); 72° C. (5 minutes). All barcoded, amplified samples were multiplexed (pooled) and the buffer exchanged to 1×TE using Microcon YM-30 as described in Howard et al. No gel extraction step or qPCR step was performed to normalize the concentrations of each sample before pooling. Sequencing was performed using an Illumina Genome Analyzer IIx at the Yale Center for Genome Analysis.
Genome Walking and PCR-Based Fine Mapping of Sk1 Alleles
[0134] Identification and fine mapping of the sk1-mu1, sk1-ref, and sk1-Allie1 alleles was performed by PCR reaction using insertion-specific primer pairs with Phusion DNA polymerase. Identification of the Helitron-like insertion in sk1-ref plants was mediated by NaeI, SfoI and Stul Genomewalker (CLONTECH®) libraries using nested PCR reactions. PCR primers were designed based upon the B73-reference genome. Primers and PCR conditions used for the mapping of individual sk1 alleles are available upon request.
Phylogenetic Analysis of Sk1
[0135] Phylogeny was determined using a two-step analysis. First, the top five most related proteins to SK1 (GRMZM2G021768) were determined by Blastp score under default Gramene settings (allowing some local misalignments) for B. dystachion, O. sativa, S. italica, S. bicolor, Z. mays. Analysis of two top hits from rice, Os04T0525100 and Os04T0525200, suggested that they were two exons of the same gene, and so these two sequences were combined into one for the final phylogeny (Os04T0525100-200). Amino acid sequences were aligned using the ClustalW module (BLOSUM Matrix, Gap open penality=3.0, Gap extension penalty=1.8) in MEGA6. See K. Tamura et al., Mol Biol Evol 30, 2725-2729 (2013). Regions with missing sequence were trimmed visually. A maximum likelihood method in MEGA was used to determine the optimal amino acid substitution model. An initial tree was built using MrBayes, as described in F. Ronquist, J. P. Huelsenbeck, MrBayes 3: Bayesian phylogenetic inference under mixed models, Bioinformatics 19, 1572-1574 (2003), using a Wheland and Goldman substitution model, four chains, heat 0.5, and 1,000,000 iterations. Final standard deviation of split frequencies was 0.002696. Genes separated into two general clusters in this tree (
[0136] A second phylogenetic tree was generated to better quantify the relationships between sk1 and its homologs (
[0137] A third phylogenetic tree was developed to identify the relationship of SK1 and with 107 UGT proteins identified in Arabidopsis (
Fluorescent Protein Fusion Constructs
[0138] Citrine:SVL (pYU2969) was created by fusing the coding sequence (CDS) of the last 10 AA of the SK1 protein (“−SVL” domain”) to the 3′-end of the Citrine CDS. SK1ΔSVL:Citrine:SVL (pYU2996) was created by fusing the full length SK1 CDS, excluding the −SVL domain, to the 5′-end of pYU2969. SK1:Citrine (pYU3103) and Citrine:SK1 (pYU3119) contained 3′- or 5′-end fusions of Citrine to the full length SK1 CDS. For all four constructs, these coding sequences were placed under control of the single CaMV 35S promoter with a tobacco etch viral (TEV) 5′ leader and the 35S terminator. These expression cassettes were then cloned into the plant expression vector pPZP200 described in P. Hajdukiewicz, Z. Svab, P. Maliga, The small, versatile pPZP family of Agrobacterium binary vectors for plant transformation. Plant Mol. Biol. 25, 989-994 (1994). Plasmid construction details available upon request. The peroxisomal marker used in this paper (peroxisome-mCherry) was obtained from the Arabidopsis Biological Resource Center (ABRC) stock CD3-983 described in B. K. Nelson, X. Cai, A. Nebenfuhr, A multicolored set of in vivo organelle markers for co-localization studies in Arabidopsis and other plants. Plant J. 51, 1126-1136 (2007).
Transient Expression by Agroinfiltration
[0139] GV2260 Agrobacterium containing expression vectors were grown as previously described in A. Hayward, M. Padmanabhan, S. P. Dinesh-Kumar, Virus-induced gene silencing in Nicotiana benthamiana and other plant species. Methods Mol. Biol. 678, 55-63 (2011). Briefly, Agrobacterium was grown overnight, pelleted, and resuspended in infiltration medium containing 10 mM MgCl2, 10 mM 2-morpholinoethanesulfonic acid and 200 mM acetosyringone. Strains were induced at room temperature for 4 hours followed by vacuum infiltration into 4-5 week old N. benthamiana leaves at OD600 1.2-1.4. For co-infiltration, equal volumes of Agrobacterium were mixed at OD600=1.6-1.8. A further 1:10 or 1:100 dilution of Agrobacterium in infiltration medium prior to infiltration was sometimes used to produce optimum expression levels for confocal microscopy. All fusion proteins expressed transiently in N. benthamiana tissue were confirmed by western blotting (
Fluorescence Microscopy
[0140] Live tissue microscopy was performed on a Zeiss LSM510 META confocal microscope (CARL ZEISS™) using a 40× C-Apochromat water immersion objective lens. For transient expression experiments, tissue samples were cut from N. benthamiana leaves at approximately 42 hours post infiltration. Transgenic Arabidopsis, N. benthamiana, or maize leaves were sampled from 3-6 week old plants. The 488 nm laser line of a 25 mW argon laser (COHERENT™) with BP 500-550 IR emission filter was used to image Citrine and the same laser line with META detector (651-683 nm) was used to image chloroplasts. The 561 nm laser line of a DPSS laser with BP 575-630 IR emission filter was used to image mCherry.
Analysis of Sk1 Gene Expression in Maize Tissues
[0141] Expression of sk1-B73 was determined by an in silico analysis of twenty-four RNA-seq samples from eight distinct tissue types—stem shoot apical meristem, anthers, immature tassel, meiotic tassel, immature cob, pre-pollination cob, primary root, and eighth leaf (Table 2). RNA-seq data were acquired from NCBI Short Read Archive study SRP014652. This study was selected due to the availability of three replicates for each tissue. Reads were initially aligned to Zea mays AGP v. 3.22 reference genome then counted against Zea mays v. 3.22 transcriptome annotation using the TopHat pipeline default parameters with—b2—very-sensitive option. Read counts were obtained with HTSeq with default parameters. Read counts were normalized via EdgeR and normalized pseudocounts were used for analysis.
Generation of Transgenic Plants
[0142] To generate stable transgenic SK1ΔSVL:Citrine:SVL Arabidopsis, pYU2996 was first transformed into Agrobacterium strain GV3101. Transgenic Arabidopsis lines were then generated using the floral dip method described in X. Zhang, R. Henriques, S. S. Lin, Q. W. Niu, N. H. Chua, Agrobacterium-mediated transformation of Arabidopsis thaliana using the floral dip method. Nat. Protoc. 1, 641-646 (2006). Arabidopsis transformants were selected by 0.02% BASTA spray (Finale©). Stable transgenic SK1ΔSVL:Citrine:SVL N. benthamiana plants were generated as described in T. Clemente, Nicotiana (Nicotiana tobaccum, Nicotiana benthamiana). Methods Mol. Biol. 343, 143-154 (2006) with modifications to the media as described below. Agrobacterium cultures were grown in LB medium with appropriate antibiotics. Cocultivation medium contained 1/10 MS basal media and vitamins, 30 mM MES, 3% sucrose, 1 μg/mL BAP, 100 ng/mL NAA, and 200 μM acetosyringone. Selection medium contained 1× MS basal media and vitamins, 3% sucrose, 1 μg/mL BAP, 100 ng/mL NAA, 500 μg/mL Timentin, and 3 μg/mL glufosinate. Rooting medium contained ½ MS basal media and vitamins, 1% sucrose, 100 ng/mL NAA, 500 μg/mL Timentin, and 3 μg/mL glufosinate. To generate SK1ΔSVL:Citrine:SVL maize transgenics, pYU2996 was moved into Agrobacterium strain EHA101 via electroporation. Sixty-three independent transgenic maize events were produced following the procedure of J. M. Vega, W. Yu, A. R. Kennon, X. Chen, Z. J. Zhang, Improvement of Agrobacterium-mediated transformation in Hi-II maize (Zea mays) using standard binary vectors. Plant Cell Rep. 27, 297-305 (2008) with modifications to the media described below. Plant tissue culture grade agar (8 g/L) was used in place of Gelrite until plant regeneration. To eliminate Agrobacteria post co-cultivation, 150 mg/L carbenicillin was used in conjunction with 100 mg/L vancomycin instead of cefotaxime. During plant regeneration, 100 mg/L myo-inositol was added to the medium and 3 mg/L bialaphos was maintained until transplantation. SK1ΔSVL:Citrine:SVL expression in stable transgenic Arabidopsis and N. benthamiana, and maize was confirmed by western blotting (
Screening of Transgenic SK1ΔSVL:Citrine:SVL Maize
[0143] Transgenic maize plants were screened for presence of the transgene cassettes via swabbing of mature leaves with 3% Finale® herbicide according to W. J. Gordon-Kamm et al., Transformation of Maize Cells and Regeneration of Fertile Transgenic Plants. The Plant cell 2, 603-618 (1990). Resistance or sensitivity to the herbicide was scored after 4 days. Leaves of T0 plants were screened for SK1ΔSVL:Citrine:SVL transgene expression using the 532 nm laser line of a Typhoon 9400 fluorescence imager with 526 SP filter. A subset of T1 plants were further screened for the presence of the SK1ΔSVL:Citrine:SVL transgene by PCR assay with primers targeting either A) the 3′ end of the SK1ΔSVL:Citrine:SVL coding sequence including the 35S terminator or B) the bar selectable marker (
Monitoring Protein Levels
[0144] Plant tissue expressing the proteins of interest was collected and ground in liquid nitrogen. Protein was extracted with buffer containing 50 mM NaCl, 20 mM Tris/HCL pH 7.5, 1 mM EDTA pH 8.0, 0.75% Triton X-100, 10% glycerol, 2 mM DTT, 4 mM NaF, 2 mM PMSF, and Complete Protease Inhibitors (ROCHE®). To facilitate detection of SK1-Citrine in SK1:Citrine:SVL maize leaf tissue, crude immunoprecipitation was performed to concentrate the protein using GFP-nAb magnetic beads (ALLELE®). The appropriate volume of 2×SDS loading buffer was added to each sample, and samples were heated at 90° C. for 10 minutes prior to loading. Protein was run on polyacrylamide gels and transferred to PVDF membrane (MILLIPORE®) for Western blot analysis and Citrine fusions were detected using mouse anti-GFP (COVANCE®) and rabbit anti-mouse-HRP (SIGMA®).
Quantification of Jasmonates in Terminal Inflorescences
[0145] The developing terminal inflorescence of SK1ΔSVL:Citrine:SVL T1 maize plants of +/+ and SK1-CIT/+ genotypes were dissected between 2.5 and 13 cm in length and rapidly frozen in liquid nitrogen. Tissue samples were stored at −80° C. prior to metabolite extraction. Jasmonate quantification was performed as described in W. J. Gordon-Kamm et al., Transformation of Maize Cells and Regeneration of Fertile Transgenic Plants. The Plant cell 2, 603-618 (1990) with minor modifications. Briefly, plant tissues were ground under liquid nitrogen and 200 mg of fresh frozen powder was weighed in microcentrifuge tubes. To the tubes were added 1.5 mL of acidified isopropanol, 10 μL of internal standard (d5-JA) and 5-10 glass beads. Extraction was performed in a paint shaker for 3 min, followed by centrifugation and evaporation to dryness. The extract was purified by solid phase extraction (SPE), dried again and reconstituted in 300 μL, of methanol:H2O (85:15, v/v) prior to analysis. Jasmonate profiling was achieved by ultra-high pressure liquid chromatography coupled to high resolution mass spectrometry. Concentrations of jasmonates were calculated by normalizing the obtained peaks to that of the internal standard.
Sequences
[0146]
TABLE-US-00002 TABLE 2 Primer Primer sequence ID (listed 5′ to 3′) Purpose 1811 SEQ ID NO: 3 Amplification of SSR marker AY107034 for AAAGTGTCCTGGCTTGCAG mapping of the sk1 locus ATACC 1825 SEQ ID NO: 4 Amplification of SSR marker AY107034 for AAGCATTCTAGGGCACACA mapping of the sk1 locus TTGAT 1655 SEQ ID NO: 5 Amplification of SSR marker b1 (umc1776) for AAGGCTCGTGGCATACCTG mapping of the sk1 locus* TAGT 1656 SEQ ID NO: 6 Amplification of SSR marker b1 (umc1776) for GCTGTACGTACGGGTGCAA mapping of the sk1 locus* TG 782 SEQ ID NO: 7 Amplification of indel marker bnl8.04 for GTCATCACTCATCAATCCC mapping of the sk1 locus AGC 783 SEQ ID NO: 8 Amplification of indel marker bnl8.04 for TCAACCCCCACCTCTCTATT mapping of the sk1 locus TATA 773 SEQ ID NO: 9 Amplification of CAPS (HaeIII) marker CCTACCCGCTACAACTGGA bnl12.09 for mapping of the sk1 locus CATAA 781 SEQ ID NO: 10 Amplification of CAPS (HaeIII) marker CAGTACTCGTTTGTGCAGTT bnl12.09 for mapping of the sk1 locus TGCT 1573 SEQ ID NO: 11 Amplification of SSR marker bnlg1064 for CTGGTCCGAGATGATGGC mapping of the sk1 locus* 1574 SEQ ID NO: 12 Amplification of SSR marker bnlg1064 for TCCATTTCTGCATCTGCAAC mapping of the sk1 locus* 1571 SEQ ID NO: 13 Amplification of SSR marker phi109642 for CTCTCTTTCCTTCCGACTTT mapping of the sk1 locus* CC 1572 SEQ ID NO: 14 Amplification of SSR marker phi109642 for GAGCGAGCGAGAGAGATC mapping of the sk1 locus* G 1621 SEQ ID NO: 15 Amplification of SSR marker umc1555 for ATAAAACGAACGACTCTCT mapping of the sk1 locus* CACCG 1622 SEQ ID NO: 16 Amplification of SSR marker umc1555 for ATATGTCTGACGAGCTTCG mapping of the sk1 locus* ACACC 1727 SEQ ID NO: 17 Amplification of indel marker umc1769 for GACGCGACTTATTCAGCAC mapping of the sk1 locus CAC 1733 SEQ ID NO: 18 Amplification of indel marker umc1769 for ATTGTTTCAGCGCTGCCGG mapping of the sk1 locus TTA 661 SEQ ID NO: 19 Amplification of indel marker umc34 for CAACTTCGAGGCAGTTCGT mapping of the sk1 locus TTAT 662 SEQ ID NO: 20 Amplification of indel marker umc34 for AGCTCTTGTTGCAGGAAGT mapping of the sk1 locus AGGAC 2159 SEQ ID NO: 21 Amplification of CAPS (Mwo1) marker GCGTTGTTTGGTAGATCGTT FG12180 AGCC 2160 SEQ ID NO: 22 Amplification of CAPS (Mwo1) marker CATATGCATCAGGTCAAGC FG12180 AAGGA 2180 SEQ ID NO: 23 Amplification of CAPS (SacII) marker FG06631 ACTGCATCTCACTTGTCACC GTCT 2187 SEQ ID NO: 24 Amplification of CAPS (SacII) marker FG06631 TGCAGCTTAAATTTCATGG ACGTG 2205 SEQ ID NO: 25 Amplification of CAPS (BsiHKAI) marker GCCGAGGATTTCCTGCTGA FG06659 AG 2206 SEQ ID NO: 26 Amplification of CAPS (BsiHKAI) marker GCTCATGTTGCTTCACAAC FG06659 CTCTC TA_BC1F SEQ ID NO: 27 Forward adapter used to create the ski Taq.sup.αI ACACTCTTTCCCTACACGA library for plant P19-33 CGCTCTTCCGATCTAGCTT TA_BC1R SEQ ID NO: 28 Reverse adapter used to create the sk1 Taq.sup.αI [Phos]AGCTAGATCGGAAGA library for plant P19-33 GCGTCGTGTAGGGAAAGAG TG TA_BC2F SEQ ID NO: 29 Forward adapter used to create the sk1 Taq.sup.αI ACACTCTTTCCCTACACGA library for plant P22-24 CGCTCTTCCGATCTGCTAT TA_BC2R SEQ ID NO: 30 Reverse adapter used to create the sk1 Taq.sup.αI [Phos]TAGCAGATCGGAAGA library for plant P22-24 GCGTCGTGTAGGGAAAGAG TG TA_BC3F SEQ ID NO: 31 Forward adapter used to create the sk1 Taq.sup.αI ACACTCTTTCCCTACACGA library for plant P4-48 CGCTCTTCCGATCTCTAGT TA_BC3R SEQ ID NO: 32 Reverse adapter used to create the sk1 Taq.sup.αI [Phos]CTAGAGATCGGAAGA library for plant P4-48 GCGTCGTGTAGGGAAAGAG TG TA_BC4F SEQ ID NO: 33 Forward adapter used to create the sk1 Taq.sup.αI ACACTCTTTCCCTACACGA library for plant P13-27 CGCTCTTCCGATCTGATGT TA_BC4R SEQ ID NO: 34 Reverse adapter used to create the sk1 Taq.sup.αI [Phos]CATCAGATCGGAAGA library for plant P13-27 GCGTCGTGTAGGGAAAGAG TG CommonF SEQ ID NO: 35 Forward adapter used to create the sk1 Taq.sup.αI CTCGGCATTCCTGCTGAAC library for all four sk1 plants CGCTCTTCCGATCT CommonR SEQ ID NO: 36 Reverse adapter used to create the sk1 Taq.sup.αI [Phos]GATCGGAAGAGCGGT library for all four sk1 plants TCAGCAGGAATGCCGAG Buc SEQ ID NO: 37 Primer used for Illumina ® library PCR1 AATGATACGGCGACCACCG amplification AGATCTACACTCTTTCCCTA CACGACGCTCTTCCGATCT Buc SEQ ID NO: 38 Primer used for Illumina ® library PCR2 CAAGCAGAAGACGGCATAC amplification GAGATCGGTCTCGGCATTC CTGCTGAACCGCTCTTCCG ATCT
The results of the experiments are now described.
Example 1
[0147] The only functional pistils in most lines of maize are found in the primary ear florets. The presence of these functional pistils requires the action of the silkless 1 (sk1) gene. In sk1 mutant plants all pistils are eliminated (
[0148] To investigate this model for sk1 activity, the maize sk1 gene was identified using a positional interval mapping and next generation sequencing (NGS) approach. A genetic (0.2 cM) and physical (700 kb) interval containing the sk1 gene was defined using recombination mapping in an F2 population segregating for the sk1 reference allele (sk1-ref) (
[0149] To verify GRMZM2G021786 is sk1, independent sk1 mutant alleles were examined. In the sk1-ref allele a Helitron-like transposable element was identified in the intron of GRMZM2G021786 (
[0150] The sk1 gene encodes a 512 AA protein with high similarity to family 1 UDP-glycosyltransferases (UGT) (
Example 2
[0151] All plant UGTs catalyze the transfer of donor uridine diphosphate-activated sugars (e.g. UDP-glucose) to diverse small molecule acceptor substrates. Phytohormones and secondary metabolites have been identified as targets of plant UGT activity. In vivo studies have shown that auxin, brassinosteroids, salicylic acid, flavonoids, and glucosinolates can all serve as endogenous UGT-acceptors. The inhibition of phytohormone signaling by glycosylation has been commonly described, with the glycosylated substrates undergoing sequestration or catabolism to prevent further activity. Since sk1 inhibits JA-dependent pistil abortion, its glycosyltransferase activity might inactivate JA or one of its precursors known to be synthesized in peroxisomes to disrupt JA signaling and tasselseed-mediated pistil elimination.
[0152] To further investigate the function of sk1, expression and localization, studies were conducted. A meta-analysis of RNA-seq data for GRMZM2G021786 revealed extremely low expression across all tissues probed, with no individual sample exceeding a read pseudo-count often (
Example 3
[0153] Genetic analysis has shown that sk1 is required to protect functional pistils in ear spikelets from tasselseed-mediated elimination. The elimination of all pistils in the tassel and of the secondary ear pistils requires a functional ts1 and ts2 gene and in ts1 and ts2 mutant plants all pistils in the plant fail to abort. In order to test whether ectopic sk1 expression could protect pistils destined to be eliminated by tasselseed action, maize plants were transformed and regenerated with an sk1 transgene (SK1:Citrine:SVL) driven by a constitutive CaMV 35S promoter (
Example 4
[0154] The tasselseed genes eliminate pistils by stimulating the production of jasmonates. Therefore, it was investigated whether the protection mediated by sk1 was accompanied by altered JA levels. Jasmonate levels were examined in both wild-type and pistillate tassels of T1 plants segregating 1:1 for the SK1:Citrine:SVL transgene. As expected, JA and its precursor molecule 12-oxo-phytodienoic acid (OPDA) were readily detected in developing staminate tassels that did not express the sk1 transgene (+/+;
[0155] JA signaling is attenuated by catabolism of biologically active JA-L-isoleucine via cytochrome P450 hydroxylases or IAA amidohydrolases localized in the endoplasmic reticulum. Such attenuation may prevent the persistence of costly stress-activated JA responses. The homology of SK1 to UGTs, another type of small-molecule-modifying enzymes, raises the possibility of another mechanism for JA signaling control in the developmental process of floral sexuality, in this case through the modification of JA synthesis intermediaries localized in the peroxisomes.
[0156] Untargeted metabolite profiling was performed using high resolution mass spectrometry to attempt to identify modified JA intermediates specific to SK1-Citrine activity in SK1:Citrine:SVL tassels, but were unable to identify a putative SK1 target in these experiments. The low native expression level of sk1 at the developing ear (
[0157] Maize is one of several grasses with a sex determination system that results in imperfect florets. Yet, many related grasses such as sorghum bear perfect rather than imperfect florets. Four of these related grasses with complete genome sequences available, Brachypodium distachyon, Oryza sativa, Setaria italica, and Sorghum bicolor were examined for potential sk1 orthologs. Single copy orthologs of sk1 were identified in each of these four grasses even though they possess perfect florets (
[0158] This study shows that the simple segregation of a gain-of-function sk1 transgene can be used to effectively control sexuality in maize. When this transgene is expressed in the sk1 mutant background, production of staminate and pistillate maize plants can be stably maintained even in open pollinated field conditions. Moreover, the physical linkage of an herbicide resistance trait to the sk1 transgene can be used to completely feminize a maize population by herbicide application in the field.
[0159] Although the present invention has been described in detail with reference to examples above, it is understood that various modifications can be made without departing from the spirit of the invention. Accordingly, the invention is limited only by the following claims. All cited patents and publications referred to in this application are herein incorporated by reference in their entirety.