Chimeric norovirus P particle and preparation and use thereof

11116831 · 2021-09-14

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided is a recombinant P particle formed from a norovirus capsid P protein of a chimeric Aβ1-m peptide (m being an integer ranging from 6 to 15), wherein the recombinant P particles form an ordered and repetitive antigen array. Also provided are a nucleotide sequence encoding the recombinant P particle, a pharmaceutical composition comprising same and a use thereof for preparing a medicament for treating or preventing Alzheimer's disease. Also provided is a method for preparing the recombinant P particle.

Claims

1. A recombinant P particle formed from a norovirus capsid P protein chimerized with a Aβ1-m peptide, wherein m is an integer ranging from 6 to 15, and the recombinant P particle forms an ordered and repetitive antigen array, and the amino acid sequence of at least one of the Aβ1-m peptides is embedded into loop1, loop2 and/or loop3 of the norovirus capsid P protein, wherein the amino acid sequence of the norovirus capsid P protein comprises the sequence of SEQ ID NO: 1, and wherein N1 Aβ1-m peptide sequences are embedded behind one or more amino acid sites selected from the group consisting of amino acids 70-74 of SEQ ID NO: 1, i.e. 170, A71, G72, T73 and Q74; N2 Aβ1-m peptide sequences are embedded behind one or more amino acid sites selected from the group consisting of amino acids 148-151 of SEQ ID NO: 1, i.e. T148, S149, N150 and D151; and N3 Aβ1-m peptide sequences are embedded behind one or more amino acid sites selected from the group consisting of amino acids 168-171 of SEQ ID NO: 1, i.e. D168, G169, S170 and T171; wherein N1, N2 and N3 each are independently selected from an integer ranging from 0-40, and N1+N2+N3≥1.

2. The recombinant P particle according to claim 1, wherein multiple consecutive Aβ1-m peptide sequences embedded into the norovirus capsid P protein are linked directly or via a polypeptide linker.

3. The recombinant P particle according to claim 1, wherein the Aβ1-m peptide is linked to the norovirus capsid P protein directly or via a polypeptide linker.

4. The recombinant P particle according to claim 1, wherein the Aβ1-m peptide sequence is an amino acid sequence comprised in sequences selected from SEQ ID NOs: 2-8.

5. The recombinant P particle according to claim 1, wherein the chimerized norovirus capsid P protein is encoded by nucleic acid sequences of SEQ ID NO: 15-SEQ ID NO: 141.

6. A nucleic acid encoding the recombinant P particle according to claim 1, wherein the nucleic acid has sequences of SEQ ID NO: 15-SEQ ID NO: 141.

7. A pharmaceutical composition used for preventing or treating Alzheimer's disease, comprising the recombinant P particle according to claim 1 and a pharmaceutically acceptable carrier.

8. Use of the recombinant P particle according to claim 1 in the manufacture of a medicament for treating or preventing Alzheimer's disease, wherein the medicament is a vaccine.

9. A method for preparing the recombinant P particle according to claim 1, comprising the following steps: i) obtaining an expression vector comprising a nucleic acid encoding a norovirus capsid P protein chimerized with a Aβ1-m peptide, wherein m is an integer ranging from 6 to 15; ii) transferring the expression vector into a receptor cell; iii) expressing the chimerized norovirus capsid P protein, and allowing it to self-assemble into a recombinant P particle.

Description

BRIEF DESCRIPTION OF DRAWINGS

(1) FIG. 1 shows the maps of the various recombinant pET26b plasmid constructs.

(2) A is the schematic diagram of pET26b-P protein plasmid that has been constructed.

(3) B is the schematic diagram of pET26b-P protein-mEagI plasmid with a mEagI restriction enzyme site obtained by mutation.

(4) C is the schematic diagram of pET26b-P protein-mEagI&mKpnI plasmid with a mEagI restriction enzyme site and a mKpnI restriction enzyme site obtained by mutation.

(5) D is the schematic diagram of pET26b-P protein-10copy-Aβ1-6-loop1G.sub.72 plasmid with the gene fragment of interest P protein-10copy-Aβ1-6-loop1G.sub.72 loaded between a mKpnI restriction enzyme site and a SalI restriction enzyme site.

(6) E is the schematic diagram of pET26b-P protein-1copy-Aβ1-6-loop2S.sub.149 plasmid with the gene fragment of interest P protein-1copy-Aβ1-6-loop2S.sub.149 loaded between a mEagI restriction enzyme site and a SalI restriction enzyme site.

(7) F is a schematic diagram of pET26b-Pprotein-10copy-Aβ1-6-loop2S.sub.149 plasmid with the gene fragment of interest P protein-10copy-Aβ1-6-loop2S.sub.149 loaded between a mEagI restriction enzyme site and a SalI restriction enzyme site.

(8) G is the schematic diagram of pET26b-P protein-20copy-Aβ1-6-loop3G.sub.169 plasmid with the gene fragment of interest P protein-20copy-Aβ1-6-loop3G.sub.169 loaded between a mEagI restriction enzyme site and a SalI restriction enzyme site.

(9) H is the schematic diagram of pET26b-Pprotein-10copy-Aβ1-15-loop1G.sub.72-10copy-Aβ1-6-loop2S.sub.149 plasmid with the gene fragment of interest Pprotein-10copy-Aβ1-15-loop1G.sub.72-10copy-Aβ1-6-loop2S.sub.149 loaded between a mEagI restriction enzyme site and a mKpnI restriction enzyme site.

(10) I is the schematic diagram of pET26b-P protein-3copy-Aβ1-12-loop2S.sub.149-3copy-Aβ1-6-loop3G.sub.169 plasmid with the gene fragment of interest Pprotein-3copy-Aβ1-12-loop2S.sub.149-3copy-Aβ1-6-loop3G.sub.169 loaded between a mEagI restriction enzyme site and a mKpnI restriction enzyme site.

(11) J is the schematic diagram of pET26b-P protein-1copy-Aβ1-6-loop1G.sub.72-10copy-Aβ1-6-loop3G.sub.169 plasmid with the gene fragment of interest P protein-1copy-Aβ1-6-loop1G.sub.72-10copy-Aβ1-6-loop3G.sub.169 loaded between a mEagI restriction enzyme site and a mKpnI restriction enzyme site.

(12) K is the schematic diagram of pET26b-P protein-1copy-Aβ1-6-loop1G.sub.72-1copy-Aβ1-6-loop2S.sub.149-1copy-Aβ1-6-loop3G.sub.169 plasmid with the gene fragment of interest Pprotein-1copy-Aβ1-6-loop1G.sub.72-1copy-Aβ1-6-loop2S.sub.149-1copy-Aβ1-6-loop3G.sub.169 loaded between a mEagI restriction enzyme site and a mKpnI restriction enzyme site.

(13) L is the schematic diagram of pET26b-P protein-3 copy-Aβ1-6-loop1G.sub.72-3copy-Aβ1-6-loop2S.sub.149-3copy-Aβ1-6-loop3G.sub.169 plasmid with the gene fragment of interest P protein-3 copy-Aβ1-6-loop1G.sub.72-3copy-Aβ1-6-loop2S.sub.149-3copy-Aβ1-6-loop3G.sub.169 loaded between a mEagI restriction enzyme site and a mKpnI restriction enzyme site.

(14) M is the schematic diagram of pET26b-P protein-10copy-Aβ1-6-loop1G.sub.72-10copy-Aβ1-6-loop2S.sub.149-10copy-Aβ1-6-loop3G.sub.169 plasmid with the gene fragment of interest Pprotein-10copy-Aβ1-6-loop1G.sub.72-10copy-Aβ1-6-loop2S.sub.149-10copy-Aβ1-6-loop3G.sub.169 loaded between a mEagI restriction enzyme site and a mKpnI restriction enzyme site.

(15) FIG. 2 shows the schematic diagrams of the structures of gene fragments of interest.

(16) A is the schematic diagram of the locations of three loops of P protein (loop1, loop2 and loop3), together with site-directed mutation sites and restriction enzyme sites carried by P protein gene;

(17) B is the schematic diagram of a P particle gene fragment of interest with 10 copies of Aβ1-6 gene embedded behind site G.sub.72 into loop1, abbreviated as P protein-10copy-Aβ1-6-loop1G.sub.72;

(18) C is the schematic diagram of a P particle gene fragment of interest with one copy of Aβ1-6 gene embedded behind site S.sub.149 into loop2, abbreviated as P protein-1copy-Aβ1-6-loop2S.sub.149;

(19) D is the schematic diagram of a P particle gene fragment of interest with 10 copies of Aβ1-6 gene embedded behind site S.sub.149 into loop2, abbreviated as P protein-10copy-Aβ1-6-loop2S.sub.149;

(20) E is the schematic diagram of a P particle gene fragment of interest with 20 copies of Aβ1-6 gene embedded behind site G.sub.169 into loop3, abbreviated as P protein-20copy-Aβ1-6-loop3G.sub.169;

(21) F is the schematic diagram of a P particle gene fragment of interest with 10 copies of Aβ1-15 gene embedded behind site G.sub.72 into loop1 and 10 copies of Aβ1-6 gene embedded behind site S.sub.149 into loop2, abbreviated as P protein-10copy-Aβ1-15-loop1G.sub.72-10copy-Aβ1-6-loop2S.sub.149;

(22) G is the schematic diagram of a P particle gene fragment of interest with 3 copies of Aβ1-12 gene embedded behind site S.sub.149 into loop2 and 3 copies of Aβ1-6 gene embedded behind site G.sub.169 into loop3, abbreviated as P protein-3copy-Aβ1-12-loop2S.sub.149-3copy-Aβ1-6-loop3G.sub.169;

(23) H is the schematic diagram of a P particle gene fragment of interest with one copy of Aβ1-6 gene embedded behind site G.sub.72 into loop1 and 10 copies of Aβ1-6 gene embedded behind site G.sub.169 into loop3, abbreviated as P protein-1copy-Aβ1-6-loop1G.sub.72-10copy-Aβ1-6-loop3G.sub.169;

(24) I is the schematic diagram of a P particle gene fragment of interest with one copy of Aβ1-6 gene embedded behind site G.sub.72 into loop1, one copy of Aβ1-6 gene embedded behind site S.sub.149 into loop2 and one copy of Aβ1-6 gene embedded behind site G.sub.169 into loop3, abbreviated as P protein-1copy-Aβ1-6-loop1G.sub.72-1copy-Aβ1-6-loop2S.sub.149-1copy-Aβ1-6-loop3G.sub.169;

(25) J is the schematic diagram of a P particle gene fragment of interest with 3 copies of Aβ1-6 gene embedded behind site G.sub.72 into loop1, 3 copies of Aβ1-6 gene embedded behind site S.sub.149 into loop2 and 3 copies of Aβ1-6 gene embedded behind site G.sub.169 into loop3, abbreviated as P protein-3copy-Aβ1-6-loop1G.sub.72-3copy-Aβ1-6-loop2S.sub.149-3copy-Aβ1-6-loop3G.sub.169; and

(26) K is the schematic diagram of a P particle gene fragment of interest with 10 copies of Aβ1-6 gene embedded behind site G.sub.72 into loop1, 10 copies of Aβ1-6 gene embedded behind site S.sub.149 into loop2 and 10 copies of Aβ1-6 gene embedded behind site G.sub.169 into loop3, abbreviated as P protein-10copy-Aβ1-6-loop1G.sub.72-10copy-Aβ1-6-loop2S.sub.149-10copy-Aβ1-6-loop3G.sub.169.

(27) FIG. 3 shows the schematic diagram of 10 recombinant P particles. A is the schematic diagram of P protein-10copy-Aβ1-6-loop1G.sub.72; B is the schematic diagram of Pprotein-1copy-Aβ1-6-loop2S.sub.149; C is the schematic diagram of P protein-10copy-Aβ1-6-loop2S.sub.149; D is the schematic diagram of P protein-20copy-Aβ1-6-loop3G.sub.169; E is the schematic diagram of P protein-10copy-Aβ1-15-loop1G.sub.72-10copy-Aβ1-6-loop2S.sub.149; F is the schematic diagram of P protein-3copy-Aβ1-12-loop2S.sub.149-3copy-Aβ1-6-loop3G.sub.169; G is the schematic diagram of P protein-1copy-Aβ1-6-loop1G.sub.72-10copy-Aβ1-6-loop3G.sub.169; H is the schematic diagram of P protein-1copy-Aβ1-6-loop1G.sub.72-1copy-Aβ1-6-loop2S.sub.149-1copy-Aβ1-6-loop3G.sub.169; I is the schematic diagram of P protein-3copy-Aβ1-6-loop1G.sub.72-3copy-Aβ1-6-loop2S.sub.149-3copy-Aβ1-6-loop3G.sub.169; and J is the schematic diagram of P protein-10copy-Aβ1-6-loop1G.sub.72-10copy-Aβ1-6-loop2S.sub.149-10copy-Aβ1-6-loop3G.sub.169.

(28) FIG. 4 shows the purification and characterization of recombinant P particles. A is the SDS-PAGE and Native-PAGE graphs, as well as the electron microscope image of PP-10copy-Aβ1-6-loop1G.sub.72 protein; B is the SDS-PAGE and Native-PAGE graphs, as well as the electron microscope image of PP-1copy-Aβ1-6-loop2S.sub.149 protein; C is the SDS-PAGE and Native-PAGE graphs, as well as the electron microscope image of PP-10copy-Aβ1-6-loop2S.sub.149 protein; D is the SDS-PAGE and Native-PAGE graphs, as well as the electron microscope image of PP-20copy-Aβ1-6-loop3G.sub.169 protein; E is the SDS-PAGE and Native-PAGE graphs, as well as the electron microscope image of PP-10copy-Aβ1-15-loop1G.sub.72-10copy-Aβ1-6-loop2S.sub.149 protein; F is the SDS-PAGE and Native-PAGE graphs, as well as the electron microscope image of PP-3copy-Aβ1-12-loop2S.sub.149-3copy-Aβ1-6-loop3G.sub.169 protein; G is the SDS-PAGE and Native-PAGE graphs, as well as the electron microscope image of PP-1copy-Aβ1-6-loop1G.sub.72-10copy-Aβ1-6-loop3G.sub.169 protein; H is the SDS-PAGE and Native-PAGE graphs, as well as the electron microscope image of PP-1copy-Aβ1-6-loop1G.sub.72-1copy-Aβ1-6-loop2S.sub.149-1copy-Aβ1-6-loop3G.sub.169 protein; I is the SDS-PAGE and Native-PAGE graphs, as well as the electron microscope image of PP-3copy-Aβ1-6-loop1G.sub.72-3copy-Aβ1-6-loop2S.sub.149-3copy-Aβ1-6-loop3G.sub.169 protein; J is the SDS-PAGE and Native-PAGEgraphs, as well as the electron microscope image of PP-10copy-Aβ1-6-loop1G.sub.72-10copy-Aβ1-6-loop2S.sub.149-10copy-Aβ1-6-loop3G.sub.169 protein.

(29) FIG. 5 shows the determination of optimal immune dosage and optimal immune adjuvant of PP-10copy-Aβ1-6-loop2S.sub.149 protein vaccine in a C57BL/6J mouse model.

(30) A is the detection of anti-Aβ42 antibody in mouse immune serum after immunization with different dosages of PP-10copy-Aβ1-6-loop2S.sub.149 protein vaccine stimulated by different immune adjuvants. B is the detection of T cell responses produced by mouse spleen lymphocytes after immunization with different forms of PP-10copy-Aβ1-6-loop2S.sub.149 protein vaccine.

(31) FIG. 6 shows the ELISA detection of anti-Aβ42 antibody in mouse immune serum and the comparison of Aβ42 antibody levels from different immune groups after the mice are immunized with three different forms of protein vaccine. A is the statistical graph of four immunization results for the group of subcutaneous immunization with PBS. B is the statistical graph of four immunization results for the group of nasal immunization with PBS. C is the statistical graph of four immunization results for the group of subcutaneous immunization with CpG. D is the statistical graph of four immunization results for the group of nasal immunization with CpG. E is the statistical graph of four immunization results for the group of subcutaneous immunization with PP-1copy-Aβ1-6-loop2S.sub.149 and the adjuvant CpG. F is the statistical graph of four immunization results for the group of nasal immunization with PP-1copy-Aβ1-6-loop2S.sub.149 and the adjuvant CpG. G is the statistical graph of four immunization results for the group of subcutaneous immunization with PP-10copy-Aβ1-6-loop2S.sub.149 and the adjuvant CpG. H is the statistical graph of four immunization results for the group of nasal immunization with PP-10copy-Aβ1-6-loop2S.sub.149 and the adjuvant CpG. I is the statistical graph of four immunization results for the group of subcutaneous immunization with PP-3copy-Aβ1-6-loop1G.sub.72-3copy-Aβ1-6-loop2S.sub.149-3copy-Aβ1-6-loop3G.sub.169 and the adjuvant CpG. J is the statistical graph of four immunization results for the group of nasal immunization with PP-3copy-Aβ1-6-loop1G.sub.72-3copy-Aβ1-6-loop2S.sub.149-3copy-Aβ1-6-loop3G.sub.169 and the adjuvant CpG. K is the comparison of results after the fourth immunization for each group, wherein the best immunological effect is observed in the group of subcutaneous immunization with PP-3copy-Aβ1-6-loop1G.sub.72-3copy-Aβ1-6-loop2S.sub.149-3copy-Aβ1-6-loop3G.sub.169 and the adjuvant CpG.

SEQUENCE LISTING

(32) SEQ ID NO: 1 is the amino acid sequence of a norovirus capsid P protein.

(33) SEQ ID NOs: 2-8 are amino acid sequences of Aβ1-15 peptides from human, mouse, primate, rabbit, African clawed frog (Xenopuslaevis), rat and guinea pig.

(34) SEQ ID NO: 9 is the nucleotide sequence encoding a norovirus P protein.

(35) SEQ ID NO: 10 is the nucleotide sequence encoding an A1-15 peptide from human.

(36) SEQ ID NO: 11 is a site-directed mutation forward primer used in the process of obtaining pET26b-P protein-mEagI plasmid.

(37) SEQ ID NO:12 is a site-directed mutation reverse primer used in the process of obtaining pET26b-P protein-mEagI plasmid.

(38) SEQ ID NO: 13 is a site-directed mutation forward primer used in the process of obtaining pET26b-P protein-mEagI&mKpnI plasmid.

(39) SEQ ID NO: 14 is a site-directed mutation reverse primer used in the process of obtaining pET26b-Pprotein-mEagI&mKpnI plasmid.

(40) SEQ ID NO: 15-SEQ ID NO: 141 are nucleotide sequences encoding norovirus capsid P proteins of chimeric Aβ1-m peptides prepared in the examples of the invention.

(41) SEQ ID NO: 143-SEQ ID NO: 152 are nucleotide sequences of DNA fragments of interest synthesized in the process of constructing recombinant plasmids expressing preferred 10 recombinant P proteins, corresponding to 10copy-Aβ1-6-loop1G.sub.72, 1copy-Aβ1-6-loop2S.sub.149, 10copy-Aβ1-6-loop2S.sub.149, 20copy-Aβ1-6-loop3G.sub.169, 3copy-Aβ1-12-loop2S.sub.149-3copy-Aβ1-6-loop3G.sub.169, 10copy-Aβ1-15-loop1G.sub.72-10copy-Aβ1-6-loop2S.sub.149, 1copy-Aβ1-6-loop1-G.sub.72-10copy-Aβ1-6-loop3G.sub.169, 1copy-Aβ1-6-loop1G.sub.72-1copy-Aβ1-6-loop2S.sub.149-1copy-Aβ1-6-loop3G.sub.169, 3copy-Aβ1-6-loop1G.sub.72-3copy-Aβ1-6-loop2S.sub.149-3copy-Aβ1-6-loop3G.sub.169, and 10copy-Aβ1-6-loop1G.sub.72-10copy-Aβ1-6-loop2S.sub.149-10copy-Aβ1-6-loop3G.sub.169, respectively.

DETAILED DESCRIPTION OF THE INVENTION

Definition

(42) All the technical terms used in the present invention have the same meanings as those skilled in the art commonly understand, unless otherwise indicated.

(43) An ordered and repetitive antigen array refers to multiple Aβ1-m peptides (m is an integer ranging from 6 to 15) repetitively and orderly arranged on the surface of a norovirus recombinant P particle.

(44) P protein refers to the P protein in the norovirus capsid P proteins, which can self-assemble in vitro into a P particle. When used herein, P protein used at the gene level means a gene fragment, nucleotide sequence, plasmid, etc. encoding a P protein; P protein used at the protein level means a P protein monomer or dimer. In the accompanying figures, all schematic diagrams of protein show P protein, such as the plasmids encoding P proteins shown in FIGS. 1, 2 and 3, and the P protein monomer shown in the denatured electrophoresis of FIG. 4.

(45) P particle (abbreviated as PP) refers to a protein particle formed by the in vitro self-assembly of P protein in norovirus. The most common form of P particle is a tetracosamer. When used herein, P particle (PP) only used at the protein level means the form of polymer (such as a tetracosamer), including various proteins used for property detection and immunization, such as the polymer form shown in the denatured electrophoresis of FIG. 4.

(46) Pprotein-N1copy-Aβ1-m-loop1Ak1-N2copy-Aβ1-m-loop2Ak2-N3copy-Aβ1-m-loop 3Ak3 means that N1 copies of Aβ1-m are embedded behind the amino acid at position K2 into loop1 of P protein, N2 copies of Aβ1-m are embedded behind the amino acid at position K2 into loop2 of P protein, and N3 copies of Aβ1-m are embedded behind the amino acid at position K3 into loop3 of P protein, wherein m is an integer ranging from 6 to 15. Unless otherwise indicated, Aβ1-m is linked to P protein via a polypeptide linker having three glycines. For example, P protein-1copy-Aβ1-6-loop2T.sub.148-1copy-Aβ1-6-loop2S.sub.149-1copy-Aβ1-6-loop2N.sub.150 means a P protein in which one copy of Aβ1-6 is respectively embedded behind the amino acid at position 148, behind the amino acid at position 149, and behind the amino acid at position 150 into loop2, and each Aβ1-6 is linked to P protein via an amino acid linker having three glycines encoded by GGA.

(47) P protein-10copy-Aβ1-6-loop2S.sub.149(GGA)o means that 10 copies of Aβ1-6 are embedded behind the amino acid at position 149 into loop2 of P protein, and there is no linker between Aβ1-6 and P protein, and no amino acid linker between each Aβ1-6, i.e. Aβ1-6 is directly linked to P protein or another Aβ1-6 via a peptide bond.

(48) P protein-10copy-Aβ1-6-loop2S.sub.149(GGC).sub.3 means that 10 copies of Aβ1-6 are embedded behind the amino acid at position 149 into loop2 of P protein, Aβ1-6 is linked to P protein via an amino acid linker having three glycines encoded by GGC, and each Aβ1-6 is linked to each other via an amino acid linker having three glycines encoded by GGC.

(49) The technical solutions of the invention are further illustrated by the following examples; however, the present invention is not limited to these examples. Unless otherwise indicated, the formulations and devices used herein are all commercially available.

(50) The present invention provides 127 recombinant P particles in which multiple copies of Aβ1-m peptides (m is an integer ranging from 6 to 15) are embedded into loop1, loop2 and/or loop3 of P protein. The P proteins from which said 127 recombinant P particles are formed are shown in Table 1.

(51) TABLE-US-00001 TABLE 1 The amino acid sequences of the recombinant P proteins from which said 127 recombinant P particles of the present invention are formed and the nucleotide sequences encoding the recombinant P proteins. Nucleotide Sequences encoding the NO. Recombinant P Protein Recombinant P proteins 1 P protein-1copy-Aβ1-6-loop1I.sub.70 SEQ ID NO: 15 2 P protein-10copy-Aβ1-9-loop1I.sub.70 SEQ ID NO: 16 3 P protein-20copy-Aβ1-12-loop1I.sub.70 SEQ ID NO: 17 4 P protein-40copy-Aβ1-15-loop1I.sub.70 SEQ ID NO: 17 5 P protein-1copy-Aβ1-9-loop1A.sub.71 SEQ ID NO: 19 6 P protein-10copy-Aβ1-12-loop1A.sub.71 SEQ ID NO: 20 7 P protein-20copy-Aβ1-15-loop1A.sub.71 SEQ ID NO: 21 8 P protein-40copy-Aβ1-6-loop1A.sub.71 SEQ ID NO: 22 9 P protein-1copy-Aβ1-6-loop1G.sub.72 SEQ ID NO: 23 10 P protein-10copy-Aβ1-6-loop1G.sub.72 SEQ ID NO: 24 11 P protein-20copy-Aβ1-6-loop1G.sub.72 SEQ ID NO: 25 12 P protein-40copy-Aβ1-6-loop1G.sub.72 SEQ ID NO: 26 13 P protein-1copy-Aβ1-12-loop1T.sub.73 SEQ ID NO: 27 14 P protein-10copy-Aβ1-15-loop1T.sub.73 SEQ ID NO: 28 15 P protein-20copy-Aβ1-6-loop1T.sub.73 SEQ ID NO: 29 16 P protein-40copy-Aβ1-9-loop1T.sub.73 SEQ ID NO: 30 17 P protein-1copy-Aβ1-15-loop1Q.sub.74 SEQ ID NO: 31 28 P protein-10copy-Aβ1-6-loop1Q.sub.74 SEQ ID NO: 32 19 P protein-20copy-Aβ1-9-loop1Q.sub.74 SEQ ID NO: 33 20 P protein-40copy-Aβ1-12-loop1Q.sub.74 SEQ ID NO: 34 21 P protein-1copy-Aβ1-9-loop2T.sub.148 SEQ ID NO: 35 22 P protein-10copy-Aβ1-9-loop2T.sub.148 SEQ ID NO: 36 23 P protein-20copy-Aβ1-9-loop2T.sub.148 SEQ ID NO: 37 24 P protein-40copy-Aβ1-9-loop2T.sub.148 SEQ ID NO: 38 25 P protein-1copy-Aβ1-6-loop2S.sub.149 SEQ ID NO: 39 26 P protein-10copy-Aβ1-6-loop2S.sub.149 SEQ ID NO: 40 27 P protein-20copy-Aβ1-6-loop2S.sub.149 SEQ ID NO: 41 28 P protein-40copy-Aβ1-6-loop2S.sub.149 SEQ ID NO: 42 29 P protein-1copy-Aβ1-12-loop2N.sub.150 SEQ ID NO: 43 30 P protein-10copy-Aβ1-12-loop2N.sub.150 SEQ ID NO: 44 31 P protein-20copy-Aβ1-12-loop2N.sub.150 SEQ ID NO: 45 32 P protein-40copy-Aβ1-12-loop2N.sub.150 SEQ ID NO: 46 33 P protein-1copy-Aβ1-15-loop2D.sub.151 SEQ ID NO: 47 34 P protein-10copy-Aβ1-15-loop2D.sub.151 SEQ ID NO: 48 35 P protein-10copy-Aβ1-15-loop2D.sub.151 SEQ ID NO: 49 36 P protein-40copy-Aβ1-15-loop2D.sub.151 SEQ ID NO: 50 37 P protein-1copy-Aβ1-12-loop3D.sub.168 SEQ ID NO: 5l 38 P protein-10copy-Aβ1-12-loop3D.sub.168 SEQ ID NO: 52 39 P protein-20copy-Aβ1-12-loop3D.sub.168 SEQ ID NO: 53 40 P protein-40copy-Aβ1-12-loop3D.sub.168 SEQ ID NO: 54 41 P protein-1copy-Aβ1-6-loop3G.sub.169 SEQ ID NO: 55 42 P protein-10copy-Aβ1-6-loop3G.sub.169 SEQ ID NO: 56 43 P protein-20copy-Aβ1-6-loop3G.sub.169 SEQ ID NO: 57 44 P protein-40copy-Aβ1-6-loop3G.sub.169 SEQ ID NO: 58 45 P protein-1copy-Aβ1-15-loop3S.sub.170 SEQ ID NO: 59 46 P protein-10copy-Aβ1-15-loop3S.sub.170 SEQ ID NO: 60 47 P protein-20copy-Aβ1-15-loop3S.sub.170 SEQ ID NO: 61 48 P protein-40copy-Aβ1-15-loop3S.sub.170 SEQ ID NO: 62 49 P protein-1copy-Aβ1-9-loop3T.sub.171 SEQ ID NO: 63 50 P protein-10copy-Aβ1-9-loop3T.sub.171 SEQ ID NO: 64 51 P protein-20copy-Aβ1-9-loop3T.sub.171 SEQ ID NO: 65 52 P protein-40copy-Aβ1-9-loop3T.sub.171 SEQ ID NO: 66 53 P protein-3copy-Aβ1-6-loop1G.sub.72-3copy-Aβ1-6-loop2S.sub.149 SEQ ID NO: 67 54 P protein-10copy-Aβ1-9-loop1G.sub.72-10copy-Aβ1-9-loop2S.sub.149 SEQ ID NO: 68 55 P protein-20copy-Aβ1-12-loop1G.sub.72-20copy-Aβ1-12-loop2S.sub.149 SEQ ID NO: 69 56 P protein-40copy-Aβ1-15-loop1G.sub.72-40copy-Aβ1-15-loop2S.sub.149 SEQ ID NO: 70 57 P protein-1copy-Aβ1-6-loop1I.sub.70-1copy-Aβ1-12-loop2T.sub.148 SEQ ID NO: 71 58 P protein-3copy-Aβ1-9-loop1A.sub.71-3copy-Aβ1-6-loop2S.sub.149 SEQ ID NO: 72 59 P protein-10copy-Aβ1-15-loop1G.sub.72-10copy-Aβ1-6-loop2S.sub.149 SEQ ID NO: 73 60 P protein-20copy-Aβ1-9-loop1G.sub.72-20copy-Aβ1-15-loop2N.sub.150 SEQ ID NO: 74 61 P protein-30copy-Aβ1-15-loop1T.sub.73-30copy-Aβ1-12-loop2D.sub.151 SEQ ID NO: 75 62 P protein-40copy-Aβ1-12-loop1Q.sub.74-40copy-Aβ1-9-loop2S.sub.149 SEQ ID NO: 76 63 P protein-1copy-Aβ1-6-loop1G.sub.72-10copy-Aβ1-6-loop2S.sub.149 SEQ ID NO: 77 64 P protein-10copy-Aβ1-9-loop1G.sub.72-20copy-Aβ1-9-loop2S.sub.149 SEQ ID NO: 78 65 P protein-20copy-Aβ1-12-loop1G.sub.72-40copy-Aβ1-12-loop2S.sub.149 SEQ ID NO: 79 66 P protein-40copy-Aβ1-15-loop1G.sub.72-10copy-Aβ1-15-loop2S.sub.149 SEQ ID NO: 80 67 P protein-1copy-Aβ1-6-loop1I.sub.70-10copy-Aβ1-12-loop2T.sub.148 SEQ ID NO: 81 68 P protein-10copy-Aβ1-9-loop1A.sub.71-20copy-Aβ1-6-loop2S.sub.149 SEQ ID NO: 82 69 P protein-20copy-Aβ1-15-loop1G.sub.72-40copy-Aβ1-6-loop2S.sub.149 SEQ ID NO: 83 70 P protein-40copy-Aβ1-9-loop1G.sub.72-20copy-Aβ1-15-loop2N.sub.150 SEQ ID NO: 84 71 P protein-20copy-Aβ1-15-loop1T.sub.73-10copy-Aβ1-12-loop2D.sub.151 SEQ ID NO: 85 72 P protein-10copy-Aβ1-12-loop1Q.sub.74-1copy-Aβ1-9-loop2S.sub.149 SEQ ID NO: 86 73 P protein-1copy-Aβ1-15-loop2S.sub.149-1copy-Aβ1-15-loop3G.sub.169 SEQ ID NO: 87 74 P protein-10copy-Aβ1-12-loop2S.sub.149-10copy-Aβ1-12-loop3G.sub.169 SEQ ID NO: 88 75 P protein-20copy-Aβ1-6-loop2S.sub.149-20copy-Aβ1-6-loop3G.sub.169 SEQ ID NO: 89 76 P protein-40copy-Aβ1-9-loop2S.sub.149-40copy-Aβ1-9-loop3G.sub.169 SEQ ID NO: 90 77 P protein-1copy-Aβ1-6-loop2T.sub.148-1copy-Aβ1-9-loop3D.sub.168 SEQ ID NO: 91 78 P protein-3copy-Aβ1-12-loop2S.sub.149-3copy-Aβ1-6-loop3G.sub.169 SEQ ID NO: 92 79 P protein-10copy-Aβ1-9-loop2S.sub.149-10copy-Aβ1-15-loop3G.sub.169 SEQ ID NO: 93 80 P protein-20copy-Aβ1-15-loop2S.sub.149-20copy-Aβ1-6-loop3G.sub.169 SEQ ID NO: 94 81 P protein-30copy-Aβ1-9-loop2N.sub.150-30copy-Aβ1-12-loop3S.sub.170 SEQ ID NO: 95 82 P protein-40copy-Aβ1-15-loop2D.sub.151-40copy-Aβ1-12-loop3T.sub.171 SEQ ID NO: 96 83 P protein-1copy-Aβ1-6-loop2S.sub.149-10copy-Aβ1-6-loop3G.sub.169 SEQ ID NO: 97 84 P protein-10copy-Aβ1-9-loop2S.sub.149-20copy-Aβ1-9-loop3G.sub.169 SEQ ID NO: 98 85 P protein-20copy-Aβ1-12-loop2S.sub.149-40copy-Aβ1-12-loop3G.sub.169 SEQ ID NO: 99 86 P protein-40copy-Aβ1-15-loop2S.sub.149-10copy-Aβ1-15-loop2G.sub.169 SEQ ID NO: 100 87 P protein-1copy-Aβ1-6-loop2T.sub.148-10copy-Aβ1-9-loop3D.sub.168 SEQ ID NO: 101 88 P protein-10copy-Aβ1-15-loop2N.sub.150-20copy-Aβ1-6-loop3S.sub.170 SEQ ID NO: 102 89 P protein-20copy-Aβ1-l2-loop2S.sub.149-40copy-Aβ1-15-loop3G.sub.169 SEQ ID NO: 103 90 P protein-40copy-Aβ1-15-loop2D.sub.151-20copy-Aβ1-12-loop3T.sub.171 SEQ ID NO: 104 91 P protein-20copy-Aβ1-12-loop2S.sub.149-10copy-Aβ1-6-loop3G.sub.169 SEQ ID NO: 105 92 P protein-10copy-Aβ1-9-loop2S.sub.149-1copy-Aβ1-15-loop3G.sub.169 SEQ ID NO: 106 93 P protein-1copy-Aβ1-15-loop1G.sub.72-1copy-Aβ1-15-loop3G.sub.169 SEQ ID NO: 107 94 P protein-10copy-Aβ1-9-loop1G.sub.72-10copy-Aβ1-9-loop3G.sub.169 SEQ ID NO: 108 95 P protein-20copy-Aβ1-6-loop1G.sub.72-20copy-Aβ1-6-loop3G.sub.169 SEQ ID NO: 109 96 P protein-40copy-Aβ1-12-loop1G.sub.72-40copy-Aβ1-12-loop3G.sub.169 SEQ ID NO: 110 97 P protein-1copy-Aβ1-6-loop1.sub.170-1copy-Aβ1-9-loop3D.sub.168 SEQ ID NO: 111 98 P protein-3copy-Aβ1-6-loop1G.sub.72-3copy-Aβ1-12-loop3G.sub.169 SEQ ID NO: 112 99 P protein-10copy-Aβ1-9-loop1A.sub.71-10copy-Aβ1-15-loop3G.sub.169 SEQ ID NO: 113 100 P protein-20copy-Aβ1-12-loop1G.sub.72-20copy-Aβ1-9-loop3S.sub.170 SEQ ID NO: 114 101 P protein-30copy-Aβ1-12-loop1Q.sub.74-30copy-Aβ1-15-loop3T.sub.171 SEQ ID NO: 115 102 P protein-40copy-Aβ1-15-loop1T.sub.73-40copy-Aβ1-6-loop3G.sub.169 SEQ ID NO: 116 103 P protein-1copy-Aβ1-6-loop1G.sub.72-10copy-Aβ1-6-loop3G.sub.169 SEQ ID NO: 117 104 P protein-10copy-Aβ1-9-loop1G.sub.72-20copy-Aβ1-9-loop3G.sub.169 SEQ ID NO: 118 105 P protein-20copy-Aβ1-12-loop1G.sub.72-40copy-Aβ1-12-loop3G.sub.169 SEQ ID NO: 119 106 P protein-40copy-Aβ1-15-loop1G.sub.72-10copy-Aβ1-15-loop3G.sub.169 SEQ ID NO: 120 107 P protein-1copy-Aβ1-6-loop1I.sub.70-10copy-Aβ1-9-loop3D.sub.168 SEQ ID NO: 121 108 P protein-3copy-Aβ1-6-loop1G.sub.72-10copy-Aβ1-12-loop3G.sub.169 SEQ ID NO: 122 109 P protein-10copy-Aβ1-12-loop1G.sub.72-1copy-Aβ1-15-loop3S.sub.170 SEQ ID NO: 123 110 P protein-20copy-Aβ1-9-loop1A.sub.71-40copy-Aβ1-15-loop3G.sub.169 SEQ ID NO: 124 111 P protein-40copy-Aβ1-9-loop1Q.sub.74-20copy-Aβ1-12-loop3T.sub.171 SEQ ID NO: 125 112 P protein-30copy-Aβ1-15-loop1T.sub.73-15copy-Aβ1-6-loop3G.sub.169 SEQ ID NO: 126 113 P protein-1copy-Aβ1-6-loop1I.sub.70-10copy-Aβ1-9-loop2T.sub.148-20copy- SEQ ID NO: 127 Aβ1-12-looρ3D.sub.168 114 P protein-10copy-Aβ1-15-loop1A.sub.71-20copy-Aβ1-12-loop2S.sub.149- SEQ ID NO: 128 40copy-Aβ1-9-loop3G.sub.169 115 P protein-1copy-Aβ1-6-loop1G.sub.72-3copy-Aβ1-9-loop2N.sub.150- SEQ ID NO: 129 10copy-Aβ1-15-loop3S.sub.170 116 P protein-10copy-Aβ1-6-loop1Q.sub.74-30copy-Aβ1-12-loop2D.sub.151- SEQ ID NO: 130 20copy-Aβ1-15-loop3T.sub.173 117 P protein-10copy-Aβ1-6-loop1T.sub.73-10copy-Aβ1-6-loop2S.sub.149- SEQ ID NO: 131 10copy-Aβ1-6-loop3G.sub.169 118 P protein-1copy-Aβ1-6-loop1G.sub.72-1copy-Aβ1-6-loop2S.sub.149- SEQ ID NO: 132 1copy-Aβ1-6-loop3G.sub.169 119 P protein-3copy-Aβ1-6-loop1G.sub.72-3copy-Aβ1-6-loop2S.sub.149- SEQ ID NO: 133 3copy-Aβ1-6-loop3G.sub.169 120 P protein-10copy-Aβ1-6-loop1G.sub.72-10copy-Aβ1-6-loop2S.sub.149- SEQ ID NO: 134 10copy-Aβ1-6-loop3G.sub.169 121 P protein-40copy-Aβ1-6-loop1G.sub.72-40copy-Aβ1-6-loop2S.sub.149- SEQ ID NO: 135 40copy-Aβ1-6-loop3G.sub.169 122 P protein-10copy-Aβ1-6-loop2S.sub.149(GGA).sub.0 SEQ ID NO: 136 123 P protein-10copy-Aβ1-6-loop2S.sub.149(GGA).sub.1 SEQ ID NO: 137 124 P protein-10copy-Aβ1-6-loop2S.sub.149(GGA).sub.5 SEQ ID NO: 138 125 P protein-10copy-Aβ1-6-loop2S.sub.149(GGA).sub.10 SEQ ID NO: 139 126 P protein-10copy-Aβ1-6-loop2S.sub.149(GGC).sub.3 SEQ ID NO: 140 127 P protein-1copy-Aβ1-6-loop2T.sub.148-1copy-Aβ1-6-loop2S.sub.149-1copy- SEQ ID NO: 141 Aβ1-6-loop2N.sub.150

(52) The number of the recombinant P protein or recombinant P particle in the following tables respectively corresponds to the corresponding number of recombinant P protein in Table 1.

(53) The present invention also provides a method for preparing said recombinant P protein particles, comprising the following steps:

(54) 1. Synthesizing artificially a DNA fragment comprising a DNA fragment encoding loop1, loop2 and/or loop3 domain(s) of a P protein embedded with multiple copies of Aβ1-m peptide;

(55) 2. Constructing pET26b-P protein plasmid (as shown in FIG. 1A);

(56) 3. Carrying out site-directed mutation at the position before loop1 and behind loop3 of P protein by a point mutation method on condition that the amino acid sequence remains unchanged, to obtain the new restriction enzyme sites mKpnI and mEagI (as shown in FIG. 1B);

(57) 4. According to various construction requirements, replacing multiple wild-type circular DNA in its entirety with the synthetic DNA fragment encoding loop1, loop2 and/or loop3 domain(s) of a P protein embedded with multiple copies of Aβ1-m peptide obtained in step 1 by using the restriction enzyme site SalI in the nucleic acid encoding P protein and the obtained enzyme sites mKpnI and mEagI in order to construct various recombinant P protein expression plasmids carrying multiple copies of Aβ1-m peptide respectively (as shown in FIG. 1D-1M);

(58) 5. Transferring the expression plasmids obtained in step 4 into Escherichia coli, where the P protein embedded with an Aβ1-m immunogen is stably expressed and self-assembles into a P particle in the form of a tetracosamer.

(59) Furthermore, according to the present invention, the following analysis and verification experiments were carried out:

(60) 1. Ten preferred protein vaccines were characterized by particle diameter determination and electron microscope analysis (as shown in FIG. 4).

(61) 2. Experiments were carried out with different immune dosages and different immune adjuvants in a C57BL/6J mouse model, using PP-10copy-Aβ1-6-loop2S.sub.149 protein vaccine. Results show that when CpG is used as the immune adjuvant, 25 μg protein vaccine could stimulate the mouse to produce the highest titer of a specific antibody against Aβ1-42, and meanwhile would not induce the mouse to produce T cell responses against Aβ1-42 (as shown in FIG. 5).

(62) 3. Using PP-1copy-Aβ1-6-loop2S.sub.149, PP-10copy-Aβ1-6-loop2S.sub.149 and PP-3copy-Aβ1-6-loop1G.sub.72-3copy-Aβ1-6-loop2S.sub.149-3copy-Aβ1-6-loop3G.sub.169 as the immunogens, and CpG as the immune adjuvant, the immunological effects of the three protein vaccines were compared in mouse models, and the effects of both subcutaneous and nasal immunization on the immunological effects of the protein vaccines were analyzed (as shown in FIG. 6). Experimental results show that compared with nasal immunization, subcutaneous immunization is more beneficial for the protein vaccines to induce antibodies.

(63) 4. Immunization was carried out with 127 candidate proteins. Various proteins were compared for their immunological effects, and the optimal candidate vaccine was screened. Results show that various vaccines can stimulate the mouse to produce a specific antibody against Aβ1-42 compared with the PBS control group; wherein the ten proteins, PP-10copy-Aβ1-6-loopG.sub.72, PP-1copy-Aβ1-6-loop2S.sub.149, PP-10copy-Aβ1-6-loop2S.sub.149, PP-20copy-Aβ1-6-loop3G.sub.169, PP-10copy-Aβ1-15-loop1G.sub.72-10copy-Aβ1-6-loop2S.sub.149, PP-3copy-Aβ1-12-loop2S.sub.149-3copy-Aβ1-6-loop3G.sub.169, PP-1copy-Aβ1-6-loop1G.sub.72-10copy-Aβ1-6-loop3G.sub.169, PP-1copy-Aβ1-6-loop1G.sub.72-1copy-Aβ1-6-loop2S.sub.149-1copy-Aβ1-6-loop3G.sub.169, PP-3 copy-Aβ1-6-loop1G.sub.72-3copy-Aβ1-6-loop2S.sub.149-3copy-Aβ1-6-loop3G.sub.169, PP-10copy-Aβ1-6-loop1G.sub.72-10copy-Aβ1-6-loop2S.sub.149-10copy-Aβ1-6-loop3G.sub.169, have the optimal immunological effects and can stimulate the production of a high concentration of Aβ1-42.

Example 1. Construction of pET26b-P Protein Plasmid

(64) 1 μL of Nde I enzyme and 1 μL of Xho I enzyme (purchased from Takara Corporation), and 5 μL of enzyme cleavage buffer (purchased from Takara Corporation) were respectively added to 4 μg of pET26b vector plasmid (purchased from Novagen Corporation), and finally sterile water was added to the system to reach a final volume of 50 μL. Digestion was carried out at 37° C. for 5 hours. Then the products were subjected to agarose gel electrophoresis, and recovered using a recovery column (purchased from Invitrogen) to obtain a plasmid vector having double enzyme-digested sticky ends.

(65) A P protein nucleotide sequence as shown in SEQ ID NO: 9 was synthesized by gene synthetic method. The synthetic gene fragment was subjected to Nde I/Xho I double-enzyme digestion using the same method as mentioned above. The products were subjected to agarose gel electrophoresis, and recovered using a recovery column to obtain a gene fragment having double enzyme-digested sticky ends.

(66) The above double enzyme-digested vector fragment and fragment of interest (with a molar ratio of 1:3, and a total volume of 15 μL) were mixed, and 0.75 μL of T4 ligase (purchased from Takara Corporation) and 1.5 μL of ligase buffer (purchased from Takara Corporation) were added. The ligation was carried out at 16° C. overnight to obtain a pET26b-P protein plasmid that can express a P protein particle, as shown in FIG. 1A.

Example 2. Construction of pET26b-P Protein Plasmid with Restriction Enzyme Sites mKpnI and mEagI

(67) The site-directed mutation method was as follows:

(68) 1. 5′CCGCCG3′ was mutated to 5′CGGCCG3′ by site-directed mutation method using the pET26b-P protein plasmid constructed in Example 1 to obtain pET26b-P protein-mEagI plasmid containing a mEagI restriction enzyme site without altering the amino acid sequence. The specific method was as follows: a pair of perfectly complementary bidirectional primers containing the mutation site was used:

(69) TABLE-US-00002 (forward): SEQ ID NO: 11 5′CGTTCACTTGGCTCCGGCCGTGGCTCCAACC3′, and (reverse): SEQ ID NO: 12 5′GGTTGGAGCCACGGCCGGAGCCAAGTGAACG3′;
the entire plasmid was subjected to PCR reaction, wherein the PCR reaction system was a KOD-Plus DNA polymerase system (purchased from TOYOBO Corporation), and the total volume of the reaction system was 50 μL (5 μL buffer, 0.2 mM dNTP, 1 mM magnesium sulfate, 0.3 μM upstream primer and 0.3 NM downstream primer, 50 ng template DNA, 1 μL KOD enzyme, and water which was added to a final volume of 50 μL). PCR was carried out in accordance with the reaction system instructions to obtain 20 μL of PCR products. 1 μL of DpnI enzyme (purchased from NEB Corporation) was added to the PCR products. Digestion was carried out at 37° C. for 1 h. 10 μL of the digested products were added to Trant-Blue competent cells (purchased from Peking TransGen Biotech, Ltd.), and placed on ice for 30 min. After that, the cells were subjected to heat shock at 42° C. for 45 s, placed on ice for 2 min. and then were added to 600 μL of fluid LB medium without resistance, and recovered at 200 rpm at 37° C. for 1 h. The culture broth was plated on a LB solid culture plate containing kanamycin (15 μg/mL), and were placed upside down at 37° C. overnight. The obtained mutant plasmid clones were verified by sequencing. pET26b-P protein-mEagI plasmid is shown as FIG. 1B.

(70) 2. 5′GGCACA3′ was mutated to 5′GGTACC3′ using the pET26b-P protein-mEagI recombinant plasmid (as shown in FIG. 1B) constructed in the previous step to obtain pET26b-P protein-mEagI&mKpnI plasmid containing both a mEagI restriction enzyme site and a mKpnI restriction enzyme site without altering the amino acid sequence. The specific method was as follows:

(71) a pair of perfectly complementary bidirectional primers containing the mutation site was used:

(72) TABLE-US-00003 (forward): SEQ ID NO: 13 5′GGTGTCCTGCTCGGTACCACCCAGCTCTCACC3′, and (reverse): SEQ ID NO: 14 5′GGTGAGAGCTGGGTGGTACCGAGCAGGACACC3′;
and pET26b-P protein-mEagI&mKpnI plasmid was obtained by the same construction method as mentioned above and verified by sequencing. pET26b-P protein-mEagI&mKpnI plasmid is shown as in FIG. 1C.

Example 3. Synthesis of P Particle Loop Gene Fragments of Interest Embedded with Human Aβ1-m Genes

(73) This step involves three different synthesis schemes in total:

(74) The first is a P particle loop gene fragment of interest embedded with a human Aβ1-m gene located between a mKpnI restriction enzyme site and a SalI restriction enzyme site. That is, N1 copies of Aβ1-m gene are merely embedded into loop1. The P protein prepared by this method is abbreviated as P protein-N 1copy-Aβ1-m-loop1.

(75) The second is a P particle loop gene fragment of interest embedded with a human Aβ1-m gene located between a SalI restriction enzyme site and a mEagI restriction enzyme site. That is, (1) N2 copies of Aβ1-m gene are merely embedded into loop2, and the P protein prepared by this method is abbreviated as P protein-N2copy-Aβ1-m-loop2; (2) N3 copies of Aβ1-m gene are merely embedded into loop3, and the P protein prepared by this method is abbreviated as P protein-N3copy-Aβ1-m-loop3; and (3) N2 copies of Aβ1-m gene are embedded into loop2 and N3 copies of Aβ1-m gene are embedded into loop3, and the P protein prepared by this method is abbreviated as P protein-N2copy-Aβ1-m-loop2-N3copy-Aβ1-m-loop3, wherein each m is independently selected from an integer ranging from 1 to 40.

(76) The third is a P particle loop gene fragment of interest embedded with a human Aβ1-m gene located between a mKpnI restriction enzyme site and a mEagI restriction enzyme site. That is, (1) N1 copies of Aβ1-m gene are embedded into loop1 and N2 copies of Aβ1-m gene are embedded into loop2, and the P protein prepared by this method is abbreviated as protein-N1copy-Aβ1-m-loop1-N2copy-Aβ1-m-loop2; (2) N1 copies of Aβ1-m gene are embedded into loop1 and N3 copies of Aβ1-m gene are embedded into loop3, and the P protein prepared by this method is abbreviated as P protein-N1copy-Aβ1-m-loop1-N3copy-Aβ1-m-loop3; and (3) N1 copies of Aβ1-m gene are embedded into loop1, N2 copies of Aβ1-m gene are embedded into loop2 and N3 copies of Aβ1-m gene are embedded into loop3, and the P protein prepared by this method is abbreviated as P protein-N1copy-Aβ1-m-loop1-N2copy-Aβ1-m-loop2-N3 copy-Aβ1-m-loop3, wherein each m is independently selected from an integer ranging from 1 to 40.

(77) The above three synthesis schemes are illustrated as follows:

(78) 3.1 Scheme I:

(79) 3.1.1

(80) The loop1 gene fragment embedded with DNA encoding 10 copies of Aβ1-6 peptide of P protein-10copy-Aβ1-6-loop1 G.sub.72 (as shown in FIG. 2B) was synthesized. The sequence of the synthetic gene fragment is shown as SEQ ID NO: 143.

(81) 3.2 Scheme II

(82) 3.2.1

(83) The loop2 gene fragment embedded with DNA encoding one copy of Aβ1-6 peptide of P protein-1copy-Aβ1-6-loop2S.sub.149 (as shown in FIG. 2C) was synthesized. The sequence of the synthetic gene fragment is shown as SEQ ID NO: 144.

(84) 3.2.2

(85) The loop2 gene fragment embedded with DNA encoding 10 copies of Aβ1-6 peptide of P protein-10copy-Aβ1-6-loop2S.sub.149 (as shown in FIG. 2D) was synthesized. The sequence of the synthetic gene fragment is shown as SEQ ID NO: 145.

(86) 3.2.3

(87) The loop3 gene fragment embedded with DNA encoding 20 copies of Aβ1-6 peptide of P protein-20copy-Aβ1-6-loop3G.sub.169 (as shown in FIG. 2E) was synthesized. The sequence of the synthetic gene fragment is shown as SEQ ID NO: 146.

(88) 3.2.4

(89) The loop2 gene fragment embedded with DNA encoding 3 copies of Aβ1-12 peptide and loop3 gene fragment embedded with DNA encoding 3 copies of Aβ1-6 peptide of P protein-3copy-Aβ1-12-loop2S.sub.149-3copy-Aβ1-6-loop3G.sub.169 (as shown in FIG. 2G) were synthesized. The sequence of the synthetic gene fragments is shown as SEQ ID NO: 147.

(90) 3.3 Scheme III

(91) 3.3.1

(92) The loop1 gene fragment embedded with DNA encoding 10 copies of Aβ1-15 peptide and loop2 gene fragment embedded with DNA encoding 10 copies of Aβ1-6 peptide of P protein-10copy-Aβ1-15-loop1G.sub.72-10copy-Aβ1-6-loop2S.sub.149 (as shown in FIG. 2F) were synthesized. The sequence of the synthetic gene fragments is shown as SEQ ID NO: 148.

(93) 3.3.2

(94) The loop1 gene fragment embedded with DNA encoding 1 copy of Aβ1-6 peptide and loop3 gene fragment embedded with DNA encoding 10 copies of Aβ1-6 peptide of P protein-1copy-A61-6-loop1 G.sub.72-10copy-Aβ1-6-loop3S.sub.169 (as shown in FIG. 2H) were synthesized. The sequence of the synthetic gene fragments is shown as SEQ ID NO: 149.

(95) 3.3.3

(96) The loop123 gene fragment embedded respectively with DNA encoding 1 copy of Aβ1-6 peptide of P protein-1copy-Aβ1-6-loop1G.sub.72-1copy-Aβ1-6-loop2S.sub.149-1copy-Aβ1-6-loop3G.sub.169 (as shown in FIG. 2I) was synthesized. The sequence of the synthetic gene fragment is shown as SEQ ID NO: 150.

(97) 3.3.4

(98) The loop1, loop2, loop3 gene fragments embedded respectively with DNA encoding 3 copies of Aβ1-6 peptide of P protein-3copy-Aβ1-6-loop1G.sub.72-3copy-Aβ1-6-loop2S.sub.149-3copy-Aβ1-6-loop3G.sub.169 (as shown in FIG. 2J) were synthesized. The sequence of the synthetic gene fragments is shown as SEQ ID NO: 151.

(99) 3.3.5

(100) The loop1, loop2, loop3 gene fragments embedded respectively with DNA encoding 10 copies of Aβ1-6 peptide of Pprotein-10copy-Aβ1-6-loop1G.sub.72-10copy-Aβ1-6-loop2S.sub.149-10copy-Aβ1-6-loop3G.sub.169 (as shown in FIG. 2K) were synthesized. The sequence of the synthetic gene fragments is shown as SEQ ID NO: 152.

(101) Furthermore, in addition to the above 10 recombinant P proteins, synthetic methods of other 117 recombinant P proteins respectively involved the above three schemes, as specifically shown in Table 2.

(102) TABLE-US-00004 TABLE 2 Synthetic methods of 127 recombinant P proteins and construction methods of 127 plasmids expressing the recombinant P proteins according to the invention Construction methods Synthetic methods of of plasmids expressing recombinant P proteins recombinant P proteins Similar Similar NO. Scheme Scheme Scheme Scheme 1 1 3.1.1 1 4.1.1 2 1 3.1.1 1 4.1.1 3 1 3.1.1 1 4.1.1 4 1 3.1.1 1 4.1.1 5 1 3.1.1 1 4.1.1 6 1 3.1.1 1 4.1.1 7 1 3.1.1 1 4.1.1 8 1 3.1.1 1 4.1.1 9 1 3.1.1 1 4.1.1 10 1 3.1.1 1 4.1.1 11 1 3.1.1 1 4.1.1 12 1 3.1.1 1 4.1.1 13 1 3.1.1 1 4.1.1 14 1 3.1.1 1 4.1.1 15 1 3.1.1 1 4.1.1 16 1 3.1.1 1 4.1.1 17 1 3.1.1 1 4.1.1 28 1 3.1.1 1 4.1.1 19 1 3.1.1 1 4.1.1 20 1 3.1.1 1 4.1.1 21 2 3.2.1 2 4.2.1 22 2 3.2.1 2 4.2.1 23 2 3.2.1 2 4.2.1 24 2 3.2.1 2 4.2.1 25 2 3.2.1 2 4.2.1 26 2 3.2.1 2 4.2.1 27 2 3.2.1 2 4.2.1 28 2 3.2.1 2 4.2.1 29 2 3.2.1 2 4.2.1 30 2 3.2.1 2 4.2.1 31 2 3.2.1 2 4.2.1 32 2 3.2.1 2 4.2.1 33 2 3.2.1 2 4.2.1 34 2 3.2.1 2 4.2.1 35 2 3.2.1 2 4.2.1 36 2 3.2.1 2 4.2.1 37 2 3.2.3 2 4.2.3 38 2 3.2.3 2 4.2.3 39 2 3.2.3 2 4.2.3 40 2 3.2.3 2 4.2.3 41 2 3.2.3 2 4.2.3 42 2 3.2.3 2 4.2.3 43 2 3.2.3 2 4.2.3 44 2 3.2.3 2 4.2.3 45 2 3.2.3 2 4.2.3 46 2 3.2.3 2 4.2.3 47 2 3.2.3 2 4.2.3 48 2 3.2.3 2 4.2.3 49 2 3.2.3 2 4.2.3 50 2 3.2.3 2 4.2.3 51 2 3.2.3 2 4.2.3 52 2 3.2.3 2 4.2.3 53 3 3.3.1 3 4.3.1 54 3 3.3.1 3 4.3.1 55 3 3.3.1 3 4.3.1 56 3 3.3.1 3 4.3.1 57 3 3.3.1 3 4.3.1 58 3 3.3.1 3 4.3.1 59 3 3.3.1 3 4.3.1 60 3 3.3.1 3 4.3.1 61 3 3.3.1 3 4.3.1 62 3 3.3.1 3 4.3.1 63 3 3.3.1 3 4.3.1 64 3 3.3.1 3 4.3.1 65 3 3.3.1 3 4.3.1 66 3 3.3.1 3 4.3.1 67 3 3.3.1 3 4.3.1 68 3 3.3.1 3 4.3.1 69 3 3.3.1 3 4.3.1 70 3 3.3.1 3 4.3.1 71 3 3.3.1 3 4.3.1 72 3 3.3.1 3 4.3.1 73 2 3.2.4 2 4.3.1 74 2 3.2.4 2 4.3.1 75 2 3.2.4 2 4.3.1 76 2 3.2.4 2 4.3.1 77 2 3.2.4 2 4.3.1 78 2 3.2.4 2 4.3.1 79 2 3.2.4 2 4.3.1 80 2 3.2.4 2 4.3.1 81 2 3.2.4 2 4.3.1 82 2 3.2.4 2 4.3.1 83 2 3.2.4 2 4.3.1 84 2 3.2.4 2 4.3.1 85 2 3.2.4 2 4.3.1 86 2 3.2.4 2 4.3.1 87 2 3.2.4 2 4.3.1 88 2 3.2.4 2 4.3.1 89 2 3.2.4 2 4.3.1 90 2 3.2.4 2 4.3.1 91 2 3.2.4 2 4.3.1 92 2 3.2.4 2 4.3.1 93 3 3.3.2 3 4.3.1 94 3 3.3.2 3 4.3.1 95 3 3.3.2 3 4.3.1 96 3 3.3.2 3 4.3.1 97 3 3.3.2 3 4.3.1 98 3 3.3.2 3 4.3.1 99 3 3.3.2 3 4.3.1 100 3 3.3.2 3 4.3.1 101 3 3.3.2 3 4.3.1 102 3 3.3.2 3 4.3.1 103 3 3.3.2 3 4.3.1 104 3 3.3.2 3 4.3.1 105 3 3.3.2 3 4.3.1 106 3 3.3.2 3 4.3.1 107 3 3.3.2 3 4.3.1 108 3 3.3.2 3 4.3.1 109 3 3.3.2 3 4.3.1 110 3 3.3.2 3 4.3.1 111 3 3.3.2 3 4.3.1 112 3 3.3.2 3 4.3.1 113 3 3.3.3 3 4.3.1 114 3 3.3.3 3 4.3.1 115 3 3.3.3 3 4.3.1 116 3 3.3.3 3 4.3.1 117 3 3.3.3 3 4.3.1 118 3 3.3.3 3 4.3.1 119 3 3.3.3 3 4.3.1 120 3 3.3.3 3 4.3.1 121 3 3.3.3 3 4.3.1 122 2 3.2.1 2 4.2.1 123 2 3.2.1 2 4.2.1 124 2 3.2.1 2 4.2.1 125 2 3.2.1 2 4.2.1 126 2 3.2.1 2 4.2.1 127 2 3.2.1 2 4.2.1

Example 4. Construction of a pET26b Vector Stably Expressing a P Protein Embedded with an Aβ1-m Immunogen

(103) Corresponding to Example 3, this step involves three different synthesis schemes in total:

(104) The first, directed at Scheme I of Example 3, is a P particle loop gene fragment of interest embedded with a human Aβ1-m gene located between a mKpnI restriction enzyme site and a SalI restriction enzyme site. That is, N1 copies of API-m gene are merely embedded into loop1. The P protein prepared by this method is abbreviated as P protein-N1copy-Aβ1-m-loop1.

(105) The second, directed at Scheme II of Example 3, is a P particle loop gene fragment of interest embedded with a human API-m gene located between a SalI restriction enzyme site and a mEagI restriction enzyme site. That is, (1) N2 copies of Aβ1-m gene are merely embedded into loop2, and the P protein prepared by this method is abbreviated as P protein-N2copy-Aβ1-m-loop2; (2) N3 copies of Aβ1-m gene are merely embedded into loop3, and the P protein prepared by this method is abbreviated as P protein-N3copy-Aβ1-m-loop3; and (3) N2 copies of Aβ1-m gene are embedded into loop2 and N3 copies of Aβ1-m gene are embedded into loop3, and the P protein prepared by this method is abbreviated as P protein-N2copy-Aβ1-m-loop2-N3copy-Aβ1-m-loop3.

(106) The third, directed at Scheme III of synthesizing a P protein embedded with an API-m immunogen in Example 3, is a P particle loop gene fragment of interest embedded with a human API-m gene located between a mKpnI restriction enzyme site and a mEagI restriction enzyme site. That is, (1) N1 copies of Aβ1-m gene are embedded into loop1 and N2 copies of Aβ1-m gene are embedded into loop2, and the P protein prepared by this method is abbreviated as P protein-N1copy-Aβ1-m-loop1-N2copy-Aβ1-m-loop2; (2) N1 copies of Aβ1-m gene are embedded into loop1 and N3 copies of Aβ1-m gene are embedded into loop3, and the P protein prepared by this method is abbreviated as P protein-N1copy-Aβ1-m-loop1-N3copy-Aβ1-m-loop3; and (3) N1 copies of Aβ1-m gene are embedded into loop1, N2 copies of Aβ1-m gene are embedded into loop2 and N3 copies of Aβ1-m gene are embedded into loop3, and the P protein prepared by this method is abbreviated as P protein-N1copy-Aβ1-m-loop1-N2copy-Aβ1-m-loop2-N3copy-Aβ1-m-loop3.

(107) The above three synthesis schemes are illustrated as follows:

(108) 4.1 Scheme I:

(109) The pET26b-P protein-mEagI-mKpnI plasmid vector obtained in Example 2 was subjected to SalI/KpnI double-enzyme digestion, using the mKpnI restriction enzyme site obtained by mutation and the SalI restriction enzyme site carried by the sequence itself, in order to excise the original loop1 region. The plasmid was recovered as the vector.

(110) Meanwhile, the recombinant loop1 DNA fragment comprising multiple copies of the human Aβ1-m sequence synthesized in Example 3 was subjected to SalI/KpnI double-enzyme digestion in order to obtain the DNA fragment of interest.

(111) The digested DNA fragment of interest was ligated to the digested vector in order to obtain a pET26b plasmid that can express a recombinant P protein embedded with an Aβ1-m immunogen. Finally, the plasmid was verified by sequencing, and thus a correct plasmid was obtained.

(112) 4.1.1 Construction of a plasmid vector expressing PP-10copy-Aβ1-6-loop1G.sub.72 Protein

(113) 1 μL of Sal I enzyme and 1 μL of Kpn I enzyme (purchased from Takara Corporation) and 5 μL of digestion buffer (purchased from Takara Corporation) were added respectively to 4 μg of pET26b-P protein-mEagI-mKpnI vector plasmid obtained in Example 2, and finally sterile water was added to the system to reach a final volume of 50 μL. Digestion was carried out at 37° C. for 5 hours. The digested products were subjected to agarose gel electrophoresis, and recovered using gel recovery kit (purchased from Tiangen Biotech Co., Ltd.) to obtain a plasmid vector having sticky ends.

(114) Meanwhile, the DNA fragment 10copy-Aβ1-6-loop1G.sub.72 synthesized in Example 3 was subjected to SalI/KpnI double-enzyme digestion by the same method to obtain the gene fragment of interest.

(115) The digested vector was mixed with the digested gene fragment of interest. 0.75 μL of T4 ligase (purchased from Takara Corporation) and 1.5 μL of ligase buffer (purchased from Takara Corporation) were added to the mixture. The ligation was carried out at 16° C. overnight to obtain a plasmid vector expressing PP-10copy-Aβ1-6-loop1G.sub.72 protein. The plasmid was verified by sequencing, as shown in FIG. 1D.

(116) 4.2 Scheme II

(117) The pET26b-P protein-mEagI-mKpnI plasmid vector obtained in Example 2 was subjected to SalI/EagI double-enzyme digestion, using the mKpnI restriction enzyme site obtained by mutation and the SalI restriction enzyme site carried by the sequence itself, in order to excise the original loop2 and loop3 regions. The plasmid was recovered as the vector.

(118) Meanwhile, the recombinant loop2 and loop3 DNA fragments comprising multiple copies of the human Aβ1-m sequence synthesized in Example 3 was subjected to SalI/EagI double-enzyme digestion to obtain the DNA fragment of interest.

(119) The digested DNA fragment of interest was ligated to the digested vector to obtain a pET26b plasmid that can express a recombinant P protein embedded with an Aβ1-m immunogen. Finally, the plasmid was verified by sequencing, and thus a correct plasmid was obtained.

(120) 4.2.1 Construction of a Plasmid Vector Expressing PP-1Copy-Aβ1-6-loop2S.sub.149 Protein

(121) 1 μL of SalI enzyme and 1 μL of EagI enzyme (purchased from Takara Corporation) and an appropriate amount of digestion buffer (purchased from Takara Corporation) were respectively added to 4 μg of the pET26b-P protein-mEagI-mKpnI plasmid vector obtained in Example 2, and finally sterile water was added to reach a final volume of 50 μL. Digestion was carried out at 37° C. for 5 hours. The digested products were subjected to agarose gel electrophoresis, and recovered using gel recovery kit (purchased from Tiangen Biotech Co., Ltd.) to obtain a plasmid vector having sticky ends.

(122) Meanwhile, the DNA fragment 1copy-Aβ1-6-loop2S.sub.149 synthesized in Example 3 was subjected to SalI/KpnI double-enzyme digestion by the same method to obtain the gene fragment of interest.

(123) The digested vector was mixed with the digested gene fragment of interest. 0.75 μL of T4 ligase (purchased from Takara Corporation) and 1.5 μL of ligase buffer (purchased from Takara Corporation) were added to the mixture. The ligation was carried out at 16° C. overnight to obtain a plasmid vector expressing PP-1copy-Aβ1-6-loop2S.sub.149 protein. The plasmid was verified by sequencing, as shown in FIG. 1E.

(124) 4.2.2 Construction of a Plasmid Vector Expressing PP-10Copy-Aβ1-6-loop2S.sub.149 Protein

(125) A plasmid vector expressing PP-10copy-Aβ1-6-loop2S.sub.149 protein was constructed, using the same method as 4.2.1. The plasmid is shown in FIG. 1F.

(126) 4.2.3 Construction of a Plasmid Vector Expressing PP-20Copy-Aβ1-6-loop3G.sub.169 Protein

(127) A plasmid vector expressing PP-20copy-Aβ1-6-loop3G.sub.169 protein was constructed, using the same method as 4.2.1. The plasmid is shown in FIG. 1G.

(128) 4.2.4 Construction of a Plasmid Vector Expressing PP-3Copy-Aβ1-12-loopS.sub.149-3Copy-Aβ1-6-loop3G.sub.169 Protein

(129) A plasmid vector expressing PP-3copy-Aβ1-12-loopS.sub.149-3copy-Aβ1-6-loop3G.sub.169 protein was constructed, using the same method as 4.2.1. The plasmid is shown in FIG. 1I.

(130) 4.3 Scheme III

(131) The pET26b-P protein-mEagI-mKpnI plasmid vector obtained in Example 2 was subjected to mKpnI/mEagI double-enzyme digestion, using the mEagI restriction enzyme site and the mKpnI restriction enzyme site obtained by mutation, in order to excise the original loop1, loop2 and loop3 regions. The plasmid was recovered as the vector.

(132) Meanwhile, the recombinant loop1, loop2 and loop3 DNA fragments comprising multiple copies of the human Aβ1-m sequence synthesized in Example 3 was subjected to mKpnI/mEagI double-enzyme digestion in order to obtain the DNA fragment of interest.

(133) The digested DNA fragment of interest was ligated to the digested vector in order to obtain a pET26b plasmid that can express a recombinant P protein embedded with an Aβ1-m immunogen. Finally, the plasmid was verified by sequencing, and thus a correct plasmid was obtained.

(134) 4.3.1 Construction of a Plasmid Vector Expressing PP-3Copy-Aβ1-6-Loop 1-G.sub.72-3Copy-Aβ1-6-loop2S.sub.149-3Copy-Aβ1-6-loop3G.sub.169 Protein

(135) 1 μL of KpnI enzyme and 1 μL of EagI enzyme (purchased from Takara Corporation) and an appropriate amount of digestion buffer (purchased from Takara Corporation) were added respectively to 4 μg of the pET26b-P protein-mEagI-mKpnI vector plasmid obtained in Example 2, and finally sterile water was added to reach a final volume of 50 μL. Digestion was carried out at 37° C. for 5 hours. The digested products were subjected to agarose gel electrophoresis, and recovered using gel recovery kit (purchased from Tiangen Biotech Co., Ltd.) to obtain a plasmid vector having sticky ends.

(136) Meanwhile, the DNA fragment 3copy-Aβ1-6-loop1G.sub.72-3copy-Aβ1-6-loop2S.sub.149-3copy-Aβ1-6-loop3G.sub.169 synthesized in Example 3 was subjected to EagI/KpnI double-enzyme digestion by the same method to obtain the gene fragment of interest.

(137) The digested vector was mixed with the digested gene fragment of interest. 0.75 μL of T4 ligase (purchased from Takara Corporation) and 1.5 μL of ligase buffer (purchased from Takara Corporation) were added to the mixture. The ligation was carried out at 16° C. overnight to obtain a plasmid vector expressing PP-1copy-Aβ1-6-loop2S.sub.149 protein. The plasmid was verified by sequencing, as shown in FIG. 1L.

(138) 4.3.2 Construction of a plasmid vector expressing PP-10copy-Aβ1-15-loop1G.sub.72-10copy-Aβ1-6-loop2S.sub.149 protein

(139) A plasmid vector expressing PP-10copy-Aβ1-15-loop1G.sub.72-10copy-Aβ1-6-loop2S.sub.149 protein was constructed, using the same method as 4.3.1. The plasmid is shown in FIG. 1H.

(140) 4.3.3 Construction of a Plasmid Vector Expressing PP-1Copy-Aβ1-6-loop1G.sub.72-10Copy-Aβ1-6-loop3G.sub.169 Protein

(141) A plasmid vector expressing PP-1copy-Aβ1-6-loop1G.sub.72-10copy-Aβ1-6-loop3G.sub.169 protein was constructed, using the same method as 4.3.1. The plasmid is shown in FIG. 1J.

(142) 4.3.4 Construction of a Plasmid Vector Expressing PP-1Copy-Aβ1-6-loop1G.sub.72-1Copy-Aβ1-6-loop2S.sub.149-1Copy-Aβ1-6-loop3G.sub.169 Protein

(143) A plasmid vector expressing PP-1copy-Aβ1-6-loop1G.sub.72-1copy-Aβ1-6-loop2S.sub.149-11copy-Aβ1-6-loop3G.sub.169 protein was constructed, using the same method as 4.3.1. The plasmid is shown in FIG. 1K.

(144) 4.3.5 Construction of a Plasmid Vector Expressing PP-10Copy-Aβ1-6-loop1G.sub.72-10Copy-Aβ1-6-loop2S.sub.149-10 Copy-Aβ1-6-loop3G.sub.169 Protein

(145) A plasmid vector expressing PP-10copy-Aβ1-6-loop1G.sub.72-10copy-Aβ1-6-loop2S.sub.149-10copy-Aβ1-6-loop3G.sub.169 protein was constructed, using the same method as 4.3.1. The plasmid is shown in FIG. 1M.

(146) Furthermore, in addition to the above 10 recombinant P proteins, construction methods of other 117 plasmids expressing recombinant P proteins respectively involve the above three schemes, specifically as shown in Table 2. The obtained recombinant plasmids are not shown.

Example 5 Expression and Purification of a P Protein Embedded with a Human Aβ1-m Immunogen

(147) 5.1 Expression of a Recombinant P Particle Protein

(148) 1 μL of the recombinant plasmids prepared in the above examples were respectively added to 100 μL of E. coli BL21 competent cells (purchased from TransGen Corporation), ice-bathed for 30 min, heat shocked for 90 s in a water-bath at 42° C., and then ice-bathed for 2 min. 600 μL of LB medium was added to the mixture, and cultured at 180 rpm/min at 37° C. for 1 h. The mixture was coated evenly on a LB solid medium containing kanamycin (15 μg/mL) resistance and cultured at 37° C. for 24 h to obtain strains that can stably express recombinant proteins. A growing colony was picked and inoculated into 20 mL of LB medium. The mixture was cultured at 220 rpm at 37° C. When the OD value of the culture mixture reached 1.0, induction by Isopropyl β-D-Thiogalactoside (IPTG at a final concentration of 0.33 mmol/L) was carried out at 220 rpm at 16° C. overnight. After the induction, the culture broth was centrifuged at 4000 rpm for 20 min. The supernatant was discarded, and the bacterial precipitates were resuspended with PBS. Centrifugation was conducted again at 4000 rpm for 20 min and the supernatant was discarded to obtain the bacterial precipitates containing proteins of interest.

(149) 5.2 Extraction and Purification of Recombinant P Particle Proteins

(150) The bacterial precipitates obtained in 5.1 were resuspended by adding 20 mL of protein buffer (pH8.0, containing 50 mM Tris and 300 mM KCl). The bacteria were lysed by sonication on ice for 30 min. The mixture was centrifuged at 12,000 rpm at 4° C. for 30 min. Subsequently, the supernatant was taken and allowed to pass through 0.45 μm filter membrane to obtain crude extracts of proteins.

(151) The structures of recombinant P particle proteins are shown as FIG. 3A-J.

(152) The crude extracts of proteins were purified using a cation exchange column (purchased from GE Corporation). The specific scheme was as follows: First, the exchange column was rinsed with ultrapure water in a volume of about 100 mL, followed by equilibration with PB solution (pH 5.0) at a flow rate of 2 mL/min. Then 20 mL of the crude extracts of proteins were added to the exchange column at a flow rate of 1 ml/min. After the sample was completely loaded onto the column, the exchange column was rinsed with PB solution (pH 7.0) to remove protein impurities, and then eluted with PB solution containing 1 mol/L NaCl. The proteins at peak value were collected to obtain the proteins of interest.

(153) The proteins were further purified by a hydrophobic chromatography column (purchased from GE Corporation). The specific scheme was as follows: First, the column was rinsed with ultrapure water, and then with PB solution (pH 7.0) at a flow rate of 2 mL/min. After the column was equilibrated well, the protein sample was loaded onto it. After the sample was completely loaded onto the column, the column was eluted by gradient with PB (pH 7.0) and 1 mol/L NaCl solution for 2 hours. The concentration of NaCl decreases from 1 mol/L to 0.1 mol/L. The proteins were collected at peak value.

(154) The sizes of 10 P particle protein monomers were identified by reductive SDS-PAGE. The upper panels of FIGS. 4A-J respectively show that the size of PP-10copy-Aβ1-6-loop1G72 protein is 45 KD; the size of PP-1copy-Aβ1-6-loop2S.sub.149 protein is 37 KD; the size of PP-10copy-Aβ1-6-loopS.sub.149 protein is 45 KD; the size of PP-20copy-Aβ1-6-loop3G.sub.169 protein is 55 KD; the size of PP-10copy-Aβ1-15-loop1G.sub.72-10copy-Aβ1-6-loop2S.sub.149 protein is 66 KD; the size of PP-3copy-Aβ1-12-loop2S.sub.149-3copy-Aβ1-6-loop3G.sub.169 protein is 38 KD; the size of PP-1copy-Aβ1-6-loop1G.sub.72-10copy-Aβ1-6-loop3G.sub.169 protein is 47 KD; the size of PP-1copy-Aβ1-6-loop1G.sub.72-1copy-Aβ1-6-loop2S.sub.149-1copy-Aβ1-6-loop3G.sub.169 protein is 3 KD; the size of PP-3copy-Aβ1-6-loop1G.sub.72-3copy-Aβ1-6-loop2S.sub.149-3copy-Aβ1-6-loop3G.sub.169 protein is KD; and the size of PP-10copy-Aβ1-6-loop1G.sub.72-10copy-Aβ1-6-loop2S.sub.149-10copy-Aβ1-6-loop3G.sub.169 is 66 KD.

(155) Then the tetracosamers of P protein particles were further isolated and purified using a Superdex 200 molecular sieve (purchased from GE Corporation). The procedures were as follows: The column was rinsed with ultrapure water at a flow rate of 1 mL/min for one volume of the column, and then again with about 120 mL of PB buffer (pH 5). After that, 2 mL of protein extraction solution was added to the column and washed with PB buffer at a flow rate of 1 mL/min. The proteins at peak value were collected to obtain the tetracosamers of P particle proteins. Three proteins were tested for their polymer structures by native polyacrylamide gel electrophoresis, as shown in the middle panels of FIGS. 4A-J. All ten protein bands are above 225 KDa, which indicates that recombinant proteins can self-assemble into tetracosamers of P protein particles, and they can remain their polymer form after being purified.

Example 6 Characterization of a P Protein Particle Embedded with a Human Aβ1-m Immunogen

(156) Inventors further analyzed the particle diameter and morphology of 10 protein polymers. The particle diameter was tested using a nanoparticle diameter analyzer (purchased from Malvern Corporation) in accordance with the instructions of the manufacturer. The analysis results showed that there were particles having an average diameter of about 20 nm in the solution of the above 10 recombinant P particles. As shown in the lower panels of FIGS. 4A-J, PP-10copy-Aβ1-6-loop1G.sub.72 protein particle has a particle diameter of 27.88 nm; PP-1copy-Aβ1-6-loop2S.sub.149 protein particle has a particle diameter of 17.44 nm; PP-10copy-Aβ1-6-loop2S.sub.149 protein particle has a particle diameter of 27.64 nm; PP-20copy-Aβ1-6-loop3G.sub.169 protein particle has a particle diameter of 32.55 nm; PP-10copy-Aβ1-15-loop1G.sub.72-10copy-Aβ1-6-loop2S.sub.149 protein particle has a particle diameter of 35.88 nm; PP-3copy-Aβ1-12-loop2S.sub.149-3copy-Aβ1-6-loop3G.sub.169 protein particle has a particle diameter of 17.02 nm; PP-1copy-Aβ1-6-loop1G.sub.72-10copy-Aβ1-6-loop3G.sub.169 protein particle has a particle diameter of 28.92 nm; PP-1copy-Aβ1-6-loop1G.sub.72-1copy-Aβ1-6-loop2S.sub.149-1copy-Aβ1-6-loop3G.sub.169 protein particle has a particle diameter of 18.14 nm; PP-3copy-Aβ1-6-loop1G.sub.72-3copy-Aβ1-6-loop2S.sub.149-3copy-Aβ1-6-loop3G.sub.169 protein particle has a particle diameter of 25.56 nm; and PP-10copy-Aβ1-6-loop1G.sub.72-10copy-Aβ1-6-loop2S.sub.149-10copy-Aβ1-6-loop3G.sub.169 protein particle has a particle diameter of 36.09 nm. Meanwhile, the results of electron microscope tests show that the recombinant P proteins are in the form of approximately spherical particles, and in the form of polymers. According to the ruler, 10 protein polymers mainly comprise particles of about 20 nm. Thus, all the above 10 recombinant P proteins can self-assemble in vitro to form tetracosamers of P particles.

(157) The sizes and P particle diameters of the 127 P particle proteins according to the invention are shown as Table 3.

(158) TABLE-US-00005 TABLE 3 The sizes and P particle diameters of 127 different forms of recombinant P particle proteins Size of protein P particle diameter NO. (KD) (nm) 1 36.2 17.75 2 48.4 31.23 3 68.2 36.37 4 114.4 39.86 5 36.6 16.98 6 51.7 31.53 7 74.8 38.13 8 74.8 38.2 9 36.2 16.98 10 45.1 27.88 11 55.0 32.07 12 74.8 37.89 13 36.9 17.89 14 55.0 31.99 15 55.0 31.68 16 88.0 39.54 17 37.2 17.89 28 45.1 18.03 19 61.6 34.66 20 101.2 39.75 21 36.5 16.77 22 48.4 31.15 23 61.6 34.15 24 88.0 39.65 25 36.2 17.44 26 45.1 27.64 27 55.0 31.97 28 74.8 38.17 29 36.9 17.95 30 51.7 31.67 31 68.2 36.34 32 101.2 39.67 33 37.2 18.01 34 55.0 32.01 35 74.8 38.22 36 114.4 39.92 37 36.9 18.02 38 51.7 31.42 39 68.2 36.41 40 101.2 40.11 41 36.2 17.51 42 45.1 27.61 43 55.0 32.55 44 74.8 38.21 45 37.2 18.13 46 55.0 31.87 47 74.8 38.17 48 114.4 40.17 49 36.5 18.16 50 48.4 31.26 51 61.6 36.18 52 88.0 39.18 53 41.5 25.06 54 61.9 34.09 55 101.5 40.06 56 193.9 45.3 57 38.2 19.2 58 42.5 26.2 59 65.2 35.88 60 101.5 39.83 61 144.4 43.7 62 154.3 44.01 63 46.4 30.31 64 75.1 31.88 65 134.5 42.67 66 134.5 43.12 67 53.0 31.99 68 68.5 36.28 69 114.7 39.67 70 127.9 40.02 71 91.6 39.77 72 53.4 31.89 73 49.4 18.24 74 68.5 36.44 75 75.1 38.17 76 141.1 42.55 77 37.8 17.1 78 43.5 17.02 79 68.5 35.21 80 94.9 39.62 81 124.6 41.41 82 180.7 45.23 83 46.4 28.31 84 75.1 38.21 85 134.5 42.71 86 134.5 41.93 87 49.7 31.19 88 75.1 38.38 89 147.7 44.22 90 147.7 43.91 91 78.4 39.4 92 50.7 31.87 93 39.4 18.31 94 61.9 34.67 95 75.1 38.09 96 167.5 45.8 97 37.8 18.45 98 43.4 27.67 99 68.5 36.38 100 94.9 40.01 101 144.4 43.96 102 154.3 44.38 103 46.4 28.92 104 75.1 38.22 105 134.5 42.51 106 134.5 42.79 107 49.7 31.33 108 55.0 32.09 109 54.0 32.91 110 141.1 43.68 111 121.3 40.03 112 109.8 38.88 113 83.1 39.44 114 141.5 43.21 115 60.6 35.87 116 134.9 42.57 117 65.6 36.12 118 38.8 18.14 119 44.8 25.56 120 65.6 36.09 121 154.7 44.11 122 41.5 20.45 123 42.7 24.24 124 47.5 28.99 125 53.6 32.01 126 45.1 27.64 127 38.9 18.15

(159) 3. Immunological Effects of Recombinant P Particle Protein Vaccines

(160) 3.1 Determination of Immune Dosages and Adjuvants of P Particle Protein Vaccines

(161) The PP-10copy-Aβ1-6-loop2S.sub.149 protein vaccine was selected for use in female C57BL/6 mice aged 6-8 weeks (purchased from Beijing HFK Bioscience Co., LTD) to determine the immune dosage and immune adjuvant. The immune dosages were respectively 12.5 μg, 25 μg and 50 μg/animal, and were increased to 100 μL/animal with sterile PBS. Each group contained 6 mice. The immunization was performed by subcutaneous injection. The immune adjuvants were an aluminium adjuvant (purchased from Brenntag Biosector Corporation) and an CpG adjuvant that can specifically stimulate the body to produce humoral immunity (purchased from Takara Corporation). The nucleotide sequence of CpG adjuvant was as follows: TGTCGTCGTCGTTTGTCGTTTGTCGTT (SEQ ID NO: 153). The immunization was carried out at day 1, day 15 and day 29 (three times in total). Blood was taken on the day before every immunization. The mice were sacrificed two weeks after the third immunization. The recombinant P particle protein vaccine was tested for immunological responses of the induced humoral immunity and cellular immunity in mice. There were 7 test groups and 3 control groups. The immune dosage, adjuvant and immunizing antigen for each group are shown in Table 4.

(162) TABLE-US-00006 TABLE 4 Immunization scheme of PP-10copy-Aβ1-6-loop2S.sub.149 Group Immune dosage (100 μl) Adjuvant Immunizing antigen Negative — — — control group — aluminium — adjuvant (200 μg) — CpG — (10 μg) Test group 12.5 μg — PP-10copy-Aβ1-6-loop2S.sub.149 25 μg — PP-10copy-Aβ1-6-loop2S.sub.149 50 μg — PP-10copy-Aβ1-6-loop2S.sub.149 25 μg aluminium PP-10copy-Aβ1-6-loop2S.sub.149 adjuvant (200 μg) 25 μg CpG PP-10copy-Aβ1-6-loop2S.sub.149 (10 μg) 25 μg aluminium PP-10copy-Aβ1-6-loop2S.sub.149 adjuvant + CpG (10 μg) 100 μg Freund's adjuvant Aβ1-42 (100 μl)

(163) 3.1.1 Humoral Immunity-ELISA Detection Experiment

(164) Tails of the mice were cut and blood was taken on the day before every immunization. Blood samples were placed at 37° C. for 2 h, then placed at 4° C. for 1 h, and centrifuged at 3,000 rpm to take the supernatant serum. The serum was frozen for use. Aβ1-42 (purchased from GL Biochem (Shanghai) Ltd.) was used as antigen and formulated into 1 mg/mL solution with sterile PBS. The solution was diluted to 1 ng/L with antigen coating solution and used for coating a 96-well plate (100 μL/well). The plate was coated at 4° C. overnight. After each well was washed three times with 300 μL of PBST (pH 7.4, 0.01 mol/L PBS, containing 0.05% Tween-20), blocking solution (pH 7.4, 0.01 mol/L PBS, 20% fetal bovine serum) was added. Blocking was carried out at 37° C. for 2 hours. Each well was washed three times with PBST. To the wells were added different dilution gradients (1:200, 1:800, 1:3200, 1:12800, 1:51200 and 1:204800) of antiserum (100 μL/well), and incubation was carried out at 37° C. for 1 hour. Each well was washed three times with PBST. To the wells were added 0.3 μg/ml of HPR (horse radish peroxidase) goat-anti-mouse secondary antibody (purchased from Beijing Dingguochangsheng Biotechnology Co. LTD) (100 μL/well), and incubation was carried out at 37° C. for 1 hour. Each well was washed three times with PBST. To the wells were added the substrate tetramethylbenzidine (TMB) (purchased from Tiangen Biotech Co., Ltd.) (100 μL/well), and color was developed in the dark for 25 min. 50 μL of 2M sulfuric acid was added to each well to terminate the reaction. Absorbance was detected at 450 nm using a microplate reader (purchased from Bio-red Corporation).

(165) Experimental results are shown in FIG. 5A. When CpG is used as immune adjuvant and the immune dosage is 25 μg, or the immune dosage is 50 μg and no immune adjuvant is used, PP-10copy-Aβ1-6-loop2-S.sub.149 protein vaccine at all the shown dilutions can stimulate the mouse to produce relatively high titers of specific antibodies against Aβ42.

(166) 3.1.2 Cellular Immunity-ELISPOT Detection

(167) A 96-well plate was coated with the monoclonal antibody against cytokine interferon γ (from elispot kit purchased from BD Corporation) in a concentration of 5 μg/mL (50 μL/well), and covered at 4° C. overnight. After discarding the coating antibody and washing once with a complete medium containing 10% fetal bovine serum, 200 μL of this complete medium was added to each well. Blocking was carried out at 37° C. for 1 hour, and then the medium was discarded. Mice used in the experiment were sacrificed by neck-pulling. Spleen cells of the mice were taken out and formulated into a cell suspension in a concentration of 10.sup.7/mL. The cell suspension was added to the coated 96-well plate (100 μL/well). 100 μL of 1 μg/mL specific antigen Aβ1-42 was added to each well. The plate was then cultured at 37° C. in an incubator containing 5% CO.sub.2 for 24 h to stimulate and activate the cells. 24 h later, the plate was washed two times with sterile water, and six times with sterile PBST (pH7.4, 0.01 mol/L PBS, containing 0.05% Tween-20) buffer to wash the cells away. 50 μL of 2 μg/mL antibody against interferon γ (from elispot kit purchased from BD Corporation) was added to each well and incubated at room temperature for 2 hours. The 96-well plate was washed, and horse radish peroxidase labeled biotin secondary antibody (from elispot kit purchased from BD Corporation) was added (50 μL/well). The plate was cultured at room temperature for 2 h, and washed four times with PBST, and two times with PBS. 50 μL of Elispot color developing solution (AEC substrate) was added to each well and reacted in the dark at room temperature for 5-60 min. The staining solution was discarded, and the plate was washed with distilled water. After being dried overnight, the sample was calculated for the number of activated cells using a microscope.

(168) The results are shown in FIG. 5B. In the T cell response-positive control group Aβ42 group, a large number of spots emerge, which demonstrates a strong T cell response. In the 25 μg protein+aluminium adjuvant group, a large number of spots also emerge, which demonstrates that the aluminium adjuvant could stimulate the body to produce a certain T cell response. Nevertheless, the 25 μg PP-10copy-Aβ1-6-loop2-S.sub.149+CpG adjuvant group and 50 μg group have no or fewer positive spots, which demonstrates no evident T cell response occurring in the body, and as described in 3.1.1, this immunization strategy can stimulate the mice to produce the highest titer of specific antibodies against Aβ42. Considering the safety of vaccines, 25 g PP-10copy-Aβ1-6-loop2S.sub.149+CpG adjuvant was selected as the optimal immunization strategy.

(169) 3.2 Comparison of Immunological Effects of Three Recombinant P Particle Protein Vaccines

(170) After the experiments for determining immune dosages and immune adjuvants of protein vaccines, the applicant first selected three representative recombinant proteins, adopted the strategy of a protein vaccine dosage of 25 μg/animal and CpG as the adjuvant, compared immunological effects of the three recombinant P particle protein vaccines in female C57BL/6 mice aged 6-8 weeks by the two immunization routes via nasal and subcutaneous injections in order to compare the effects of nasal and subcutaneous immunizations, and identify the differences in immunological effects of various proteins. Similar to the method in 3.1.1, immunization was carried out every two weeks and four times in total. Tails of the mice were cut and blood was taken before every immunization. Serum was tested by ELISA detection. The mice were divided into 7 test groups and 3 control groups. The immunogen and immunization route for each group are shown as in FIG. 5.

(171) TABLE-US-00007 TABLE 5 Immunization schemes of 3 representative P particle proteins Group Immunogen immunization route Control PBS subcutaneous group PBS nasal CpG subcutaneous CpG nasal test PP-1copy-Aβ1-6-loop2S.sub.149 + CpG subcutaneous group PP-10copy-Aβ1-6-loop2S.sub.149 + CpG subcutaneous PP-3copy-Aβ1-6-loop1G.sub.72-3copy-Aβ1-6-loop2S.sub.149- subcutaneous 3copy-Aβ1-6-loop3S.sub.169 + CpG PP-1copy-Aβ1-6-loop2S.sub.149 + CpG nasal PP-10copy-Aβ1-6-loop2S.sub.149 + CpG nasal PP-3copy-Aβ1-6-loop1G.sub.72-3copy-Aβ1-6-loop2S.sub.149- nasal 3copy-Aβ1-6-loop3S.sub.169 + CpG

(172) An ELISA plate was coated with Aβ1-42 as the antigen, using the method described in 3.1.1. A reaction was carried out using the immunized mouse serum as the primary antibody, HRP goat-anti-mouse antibody as the secondary antibody, TMB as the substrate, and sulfuric acid as the termination solution. After the termination of reaction, absorbance was detected at 450 nm using a microplate reader. The contents of antibodies in the serum were compared based on the absorbance. Experiment was carried out using PBS as the negative control, and the commercial antibody 6e10 (purchased from Covance Corporation) as the positive control, and using the sera before and after immunizing mice with three proteins as the test groups. Results are shown in FIG. 6. All the three proteins can stimulate the mouse body to produce specific antibodies against Aβ42, which demonstrates that the vaccines of the present invention have good immunogenicity. Standard curve was plotted using the commercial antibody 6e10 as the positive control in order to calculate the concentration of antibodies. The comparison results of immunological effects are shown in FIG. 6. The two immunization routes of the three proteins can all produce specific antibodies against Aβ42, the OD values of which are all significantly higher than those of the PBS group and CpG group. Moreover, with the increase of immunization times, the concentration of the antibody continuously increases and can reach the highest value at the fourth immunization. By comparison, it can be seen that the subcutaneous immunization has better effect than the nasal immunization.

(173) 3.3 Comparison of Immunological Effects of Various Recombinant P Particle Protein Vaccines

(174) The applicant determined that the adopted immune dosage was 25 μg/animal and the immunization route was subcutaneous injection by the experiments for determining immune dosages and immune adjuvants of protein vaccines, and immunological experiments of three representative recombinant proteins, and determined the immunological effects of 127 candidate vaccines in female C57BL/6 mice aged 6-8 weeks. Immunization procedures and method are as described in 3.2. Comparison results of immunological effects are shown in Table 6.

(175) TABLE-US-00008 TABLE 6 Concentrations of Aβ42 antibody produced by mice stimulated with protein vaccines having 127 different forms of P particles as the immunogens group Concentration of the produced Aβ42 number antibody after the fourth immunization 1 94.88 2 90.28 3 64.55 4 29.09 5 85.62 6 77.10 7 65.75 8 55.98 9 101.79 10 153.34 11 103.01 12 63.67 13 38.57 14 40.87 15 48.89 16 34.82 17 89.98 28 111.76 19 77.09 20 38.78 21 105.87 22 162.36 23 55.38 24 44.70 25 162.78 26 189.83 27 137.62 28 82.09 29 187.23 30 83.42 31 56.67 32 54.31 33 87.47 34 77.21 35 68.47 36 42.12 37 98.09 38 67.92 39 21.83 40 34.01 41 108.53 42 145.61 43 158.96 44 43.57 45 76.37 46 64.89 47 56.17 48 29.02 49 68.78 50 75.26 51 77.15 52 39.58 53 130.09 54 144.98 55 36.75 56 24.98 57 99.90 58 78.79 59 178.46 60 71.14 61 88.82 62 22.19 63 109.70 64 142.06 65 20.08 66 19.98 67 111.49 68 109.15 69 41.78 70 39.75 71 96.58 72 123.43 73 169.92 74 178.83 75 120.47 76 21.10 77 102.80 78 197.09 79 95.03 80 76.78 81 55.87 82 23.56 83 139.92 84 159.80 85 25.73 86 33.09 87 87.82 88 58.97 89 27.41 90 24.46 91 73.45 92 82.67 93 168.21 94 116.81 95 82.39 96 43.08 97 142.97 98 158.03 99 103.64 100 59.82 101 21.11 102 11.87 103 165.27 104 66.72 105 47.86 106 34.56 107 150.98 108 75.73 109 99.17 110 45.43 111 31.25 112 67.87 113 155.87 114 101.23 115 135.15 116 79.75 117 202.44 118 215.93 119 245.12 120 222.76 121 23.89 122 149.78 123 152.29 124 166.09 125 113.11 126 189.83 127 160.08

(176) In the above P particles, the 17 P particles, PP-10copy-Aβ1-6-loop1G.sub.72, PP-1copy-Aβ1-6-loop2S.sub.149, PP-10copy-Aβ1-6-loop2S.sub.149, PP-10copy-Aβ1-6-loop3G.sub.169, PP-20copy-Aβ1-6-loop3G.sub.169, PP-3copy-Aβ1-6-loop1G.sub.72-3 copy-Aβ1-6-loop2S.sub.149, PP-10copy-Aβ1-15-loop1G.sub.72-10copy-Aβ1-6-loop2S.sub.149, PP-20copy-Aβ1-15-loop1G.sub.72-40copy-Aβ1-6-loop2S.sub.149, PP-3copy-Aβ1-12-loop2S.sub.149-3copy-Aβ1-6-loop3G.sub.169, PP-1 copy-Aβ1-6-loop2S.sub.149-10copy-Aβ1-6-loop3G.sub.169, PP-20copy-Aβ1-12-loop2S.sub.149-10copy-Aβ1-6-loop3G.sub.169, PP-3copy-Aβ1-6-loop1G.sub.72-3copy-Aβ1-12-loop3G.sub.169, PP-1copy-Aβ1-6-loop1G.sub.72-10copy-Aβ1-6-loop3G.sub.169, PP-3copy-Aβ1-6-loop1G.sub.72-10copy-Aβ1-12-loop3G.sub.169, PP-1copy-Aβ1-6-loop1G.sub.72-1copy-Aβ1-6-loop2S.sub.149-1copy-Aβ1-6-loop3 G.sub.169, PP-3copy-Aβ1-6-loop1G.sub.72-3copy-Aβ1-6-loop2S.sub.149-3copy-Aβ1-6-loop3G.sub.169, PP-10copy-Aβ1-6-loop1G.sub.72-10copy-Aβ1-6-loop2S.sub.149-10copy-Aβ1-6-loop3G.sub.169, have good immunological effects and can induce the production of high concentrations of antibodies.

(177) The standard curve is plotted in accordance with positive antibody 6e10, and its linear fitting curve is y=47.692x+0.2964, R2=0.99. According to this standard curve, the concentration of the antibody produced by induction can be calculated within the linear range, wherein PP-3copy-Aβ1-6-loop1G.sub.72-3copy-Aβ1-6-loop2S.sub.149-3copy-Aβ1-6-loop3G.sub.169 produce antibodies in a concentration of about 245.12 μg/mL after the fourth immunization. Therefore, the present invention has good immunological effects and induces a high concentration of Aβ1-42 antibody in mouse serum after immunization. The present invention has very good therapeutical effects and is a protein vaccine with great potentials for treating AD.