Method of Obtaining Multileaflet Medicago Sativa Materials by Means of MsPALM1 Artificial Site-Directed Mutants

20210269816 · 2021-09-02

Assignee

Inventors

Cpc classification

International classification

Abstract

Disclosed is a method for obtaining multileaflet Medicago sativa materials by means of MsPALM1 artificial site-directed mutants. The method comprises: selecting a target site from an exon region of a compound leaf developmental regulatory gene MsPALM1 of Medicago sativa and constructing a plant CRISPR/Cas9 editing recombinant vector MsCRISPR/Cas9::PALM1 and introducing the vector into Medicago sativa cells and regenerating into plants, cutting and repairing to cause a loss-of-function mutation in the MsPALM1 gene of Medicago sativa cells, and then screening the mutant plants by restriction endonuclease digestion and/or targeted deep sequencing of the target sites of the regenerated plants to obtain lines carrying four MsPALM1 allelic genes with simultaneous loss of function mutation. After phenotypic identification, it was confirmed that the compound leaves of the regenerated plants changed from three leaflets to five leaflets. The method can quickly obtain multileaflet Medicago sativa materials with a short breeding period and stable trait.

Claims

1. A method of obtaining multileaflet Medicago sativa materials by means of MsPALM1 artificial site-directed mutants, wherein, the method comprises the following steps: Step (1), Selecting a target site in an exon region of a compound leaf developmental regulatory gene MsPALM1 of Medicago sativa; wherein, one strand in the double-stranded structure of the target site has a structure of NGG, wherein N represents any one of bases A, T, C, G; Step (2), According to the nucleotide sequence of the target site, constructing a binary expression vector MsCRISPR/Cas9::PALM1 which is used for transforming Medicago sativa by Agrobacterium tumefaciens and further editing the MsPALM1 gene of Medicago sativa, the binary expression vector MsCRISPR/Cas9::PALM1 comprises an sgRNA expression frame and a Cas9 nuclease expression frame, the sgRNA expression frame comprises the guide sequence of the MsPALM1 target site; Step (3), Introducing the binary expression vector MsCRISPR/Cas9::PALM1 after being transformed by Agrobacterium tumefaciens into Medicago sativa cells, so that the sgRNA expression frame and the Cas9 gene expression frame are co-expressed in Medicago sativa cells; cutting the target site in the double-strand of MsPALM1 gene, inducing the DNA repairing function of Medicago sativa cells themselves; randomly inserting or deleting bases at target sites, to cause a loss-of-function mutation in the MsPALM1 gene of cells; Step (4), Regenerating plants from the Medicago sativa cells in step 3; Step (5), Performing PCR amplification on the DNA segment comprising the target site of MsPALM1 gene in the regenerated plants obtained from step 4, and then detecting by restriction endonuclease digestion and/or targeted deep sequencing; Step (6), Selecting the regenerated plants carrying four alleles with simultaneous loss-of-function mutation for phenotypic identification, observing the compound leaf phenotype of the regenerated plants, and selecting plants with more than 3 leaflets in all the compound leaves as the generated multileaflet Medicago sativa materials.

2. The method of obtaining multileaflet Medicago sativa materials by means of MsPALM1 artificial site-directed mutants according to claim 1, wherein, one strand in the double-stranded structure of the target site has a structure of 5′-G(N)x-NGG-3′, wherein (N)x represents a sequence of x bases {N1, N2 . . . Nx}, and each of N1, N2 . . . Nx represents any one of A, G, C, T.

3. The method of obtaining multileaflet Medicago sativa materials by means of MsPALM1 artificial site-directed mutants according to claim 1, wherein, the sgRNA expression frame can be expressed in Medicago sativa cells and its nucleotide sequence is as shown in Seq ID NO. 1.

4. The method of obtaining multileaflet Medicago sativa materials by means of MsPALM1 artificial site-directed mutants according to claim 1, wherein, the Cas9 gene expression frame can be expressed in Medicago sativa cells and its nucleotide sequence is as shown in Seq ID NO. 2.

5. The method of obtaining multileaflet Medicago sativa materials by means of MsPALM1 artificial site-directed mutants according to claim 2, wherein, the sgRNA expression frame comprises: a MtU6 promoter from Medicago truncatula, its nucleotide sequence is as shown in positions 1 to 500 of Seq ID NO. 1; a guide sequence of the target site with a structural feature of G(N)x and an artificially synthesized sgRNA skeleton sequence, their nucleotide sequences are as shown in positions 501 to 606 of Seq ID NO. 1; and a Poly-T terminator, its nucleotide sequence is as shown in positions 607 to 615 of Seq ID NO. 1, the Cas9 gene expression frame comprises: a CaMV 35S promoter, its nucleotide sequence is as shown in positions 1 to 345 of Seq ID NO. 2; a Cas9 coding sequence, as shown in positions 487 to 4756 of Seq ID NO. 2; and a tNOS terminator, as shown in positions 4794 to 5046 of Seq ID NO. 2.

6. The method of obtaining multileaflet Medicago sativa materials by means of MsPALM1 artificial site-directed mutants according to claim 3, wherein, the sgRNA expression frame comprises a CRISPR RNA sequence, which has G(N)x in 5′-G(N)x-NGG-3′ of the target site or a complementary sequence thereof.

7. The method of obtaining multileaflet Medicago sativa materials by means of MsPALM1 artificial site-directed mutants according to claim 2 wherein, the G(N)x in 5′-G(N)x-NGG-3′ of the target site or the complementary sequence thereof comprises a sequence of 5′-GGAGACGAGCACGGTCGCGG-3′, which is a reverse complementary sequence of the nucleotide sequence 5′-CCGCGACCGTGCTCGTCTCC-3′ at the positions 323-343 after the translation initiation codon ATG in the single exon of MsPALM1 gene.

8. The method of obtaining multileaflet Medicago sativa material by means of MsPALM1 artificial site-directed mutants according to claim 7, wherein the target site comprises one BstUI restriction endonuclease recognition site.

9. An application of the MsPALM1 artificial site-directed mutants of claim 1 in Medicago sativa breeding and genome editing breeding.

10. The method of obtaining multileaflet Medicago sativa materials by means of MsPALM1 artificial site-directed mutants according to claim 6, wherein, the G(N)x in 5′-G(N)x-NGG-3′ of the target site or the complementary sequence thereof comprises a sequence of 5′-GGAGACGAGCACGGTCGCGG-3′, which is a reverse complementary sequence of the nucleotide sequence 5′-CCGCGACCGTGCTCGTCTCC-3′ at the positions 323-343 after the translation initiation codon ATG in the single exon of MsPALM1 gene.

11. The method of obtaining multileaflet Medicago sativa materials by means of MsPALM1 artificial site-directed mutants according to claim 10, wherein the target site comprises one BstUI restriction endonuclease recognition site.

12. An application of the MsPALM1 artificial site-directed mutants of claim 2 in Medicago sativa breeding and genome editing breeding.

13. An application of the MsPALM1 artificial site-directed mutants of claim 3 in Medicago sativa breeding and genome editing breeding.

14. An application of the MsPALM1 artificial site-directed mutants of claim 4 in Medicago sativa breeding and genome editing breeding.

15. An application of the MsPALM1 artificial site-directed mutants of claim 5 in Medicago sativa breeding and genome editing breeding.

16. An application of the MsPALM1 artificial site-directed mutants of claim 6 in Medicago sativa breeding and genome editing breeding.

17. An application of the MsPALM1 artificial site-directed mutants of claim 7 in Medicago sativa breeding and genome editing breeding.

18. An application of the MsPALM1 artificial site-directed mutants of claim 8 in Medicago sativa breeding and genome editing breeding.

19. An application of the MsPALM1 artificial site-directed mutants of claim 10 in Medicago sativa breeding and genome editing breeding.

20. An application of the MsPALM1 artificial site-directed mutants of claim 11 in Medicago sativa breeding and genome editing breeding.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0035] FIG. 1 shows the agarose gel electrophoresis results of PCR-RE analyses for screening PALM1 mutants out from the regenerated plants that are generated by transforming Medicago sativa with the CRISPR/Cas9 expression vector MsCRISPR/Cas9::PALM1 containing the guide sequence of the target site of PALM1 gene using Agrobacterium tumefaciens;

[0036] FIG. 2 shows the partial sequencing results of PCR products of PALM1 gene of Medicago sativa wild-type and mutant-type plants;

[0037] FIG. 3 shows the leaf phenotype of wild-type and mutant-type plants obtained by transforming Medicago sativa with the CRISPR/Cas9 expression vector containing the guide sequence of the target site of PALM1 gene using Agrobacterium tumefaciens.

DETAILED DESCRIPTION

[0038] The test methods used in the following examples are all conventional methods, unless otherwise specifically noted.

[0039] The materials and reagents used in the following examples are all commercially available, unless otherwise specifically noted.

[0040] The breeding method employed in one example of the present disclosure will be described below.

[0041] First. Preparation of a recombinant vector for editing the Medicago sativa MsPALM1 gene

[0042] 1.1. Selecting the reverse complementary sequence, 5′-GGAGACGAGCACGGTCGCGG-3′, of the nucleotide sequence 5′-CCGCGACCGTGCTCGTCTCC-3′ at the positions 323-343 after the translation initiation codon ATG in the single exon of MsPALM1 gene (HM038483) of Medicago sativa as the target site, and after the sequence was a PAM sequence “CGG”. The sequence comprised one BstUI restriction endonuclease recognition site.

[0043] 1.2. Synthesizing a forward oligonucleotide strand (MsPA1_1F) and a complementary reverse oligonucleotide strand (MsPA1_1R) according to the selected target site (BGI),

[0044] The specific sequences were:

TABLE-US-00001 MsPA1_1F: TTTGGAGACGAGCACGGTCGCGG MsPA1_1R: AAACCCGCGACCGTGCTCGTCTC

[0045] Wherein, the non-underlined parts were the sequence from the target site or its complementary sequence without NGG, and the underlined parts were the cohesive ends for ligating the vector.

[0046] 1.3. After annealing, the two strands MsPA1_1F and MsPA1_1R were annealed to form a double-stranded DNA with cohesive ends, which was used as the insertion fragment for constructing the recombinant vector.

[0047] 1.4. Digesting the Medicago sativa CRISPR/Cas9 binary expression vector MsCRISPR/Cas9 comprising an sgRNA expression frame (its nucleotide sequence was as shown in Seq ID NO. 1) that can be expressed in Medicago sativa cells and a Cas9 gene expression frame (its nucleotide sequence was as shown in Seq ID NO. 2) that can be expressed in Medicago sativa cells with Aarl endonuclease (NEB Co.) at 37° C.; cutting the Medicago sativa CRISPR/Cas9 expression vector with Aarl endonuclease for 8 hours; inactivating the digestion system at 65° C. for 10 minutes, as the backbone fragments for constructing the recombinant vector.

[0048] 1.5. Ligating the MsCRISPR/Cas9 vector backbone fragments and the insertion fragments with T4 DNA ligase (NEB Co.) to construct a vector MsCRISPR/Cas9::PALM1 for MsPALM1 editing, and then transferring into the Escherichia coli. After verification by sequencing, the positive transformants were extracted to form a recombinant vector MsCRISPR/Cas9::PALM1 for genome editing of Medicago sativa MsPALM1 gene.

[0049] Second. Genome editing of Medicago sativa MsPALM1 gene editing by stably transformation with Agrobacterium and acquisition of multileaflet Medicago sativa materials.

[0050] 2.1. The obtained recombinant vector MsCRISPR/Cas9::PALM1 for genome editing of Medicago sativa MsPALM1 gene was transformed into Agrobacterium tumefaciens EHA105 (preserved by Guangdong Sanjie Forage Biotech Co., Ltd.) by a freezing-thawing method, to obtain positive clones.

[0051] 2.2. Taking mature seeds of Medicago sativa varieties, they were washed with sterile water for 5 times, and soaked with 75% alcohol for 1 min. After discarding the alcohol, the seeds were washed with sterile water for 5 times, soaked with 0.1% mercuric chloride solution for 20 min, and washed with sterile water for 5 times. The seeds were inoculated on the germinating medium and cultured in light at 26-28° C. for 7 days. When two cotyledons were just opened, the cotyledons and hypocotyls were cut for Agrobacterium transformation.

[0052] 2.3. The Agrobacterium tumefaciens into which the recombinant expression vector was transferred was subjected to the genetic transformation of Medicago sativa, the specific transformation operations were as below:

[0053] 1. Germination of Medicago sativa seeds: Plump and well-colored Medicago sativa seeds were selected, soaked with 75% alcohol for 2 minutes, washed with sterile water for two times, 1 minute for each time; then soaked with 0.1% mercuric chloride and shaken by hands for 10 minutes, and washed with sterile water for five times. The sterilized seeds were spread out in a large sterile culture dish containing filter papers, air-dried, inoculated on a MS solid medium, and germinated in an illuminated incubator or culture room for 7-14 days;

[0054] 2. Induction of callus: Cotyledons and hypocotyls of the germinated seedlings were cut into small pieces with a sterile scalpel and inoculated in a callus induction medium, and cultured in an incubator or culture room in dark at 25±1° C. for 3 days. The ingredients of the callus induction medium were: SH basal medium+2 mg/L 2,4-D+0.2 mg/L KT+0.3 mg/L casein hydrolysate+30 g/L sucrose+8 g/L agar;

[0055] 3. Infection: 1-2 days in advance, the prepared Agrobacterium tumefaciens strains were inoculated in 50-100 mL YM liquid medium and cultured at 28° C. on a shaker at 200 r/min until the OD value 260/280 was between 0.5-0.8; the bacteria solution was transferred into a 50 mL sterile centrifuge tube, and centrifuged at 4° C. in a centrifuge at 4000 r/min for 12 minutes; the centrifuge tube was taken out, the supernatant was discarded, and a resuspension solution was added for resuspension until the OD value 260/280 was between 0.5-0.8; Corresponding volume of acetosyringone at 100 μmol/mL was added according to adding 100 μmol acetosyringone per liter, and the resuspension solution was MS liquid medium (MS+30 g/L sucrose); The explants induced in step 2 were collected into a 100 mL sterile triangular flask with a breathable and plastic sealing membrane, into which was poured a suitable amount of the resuspended bacteria solution (as long as covering the materials); The triangular flask was sealed with its own sealing membrane, and evacuated in a vacuum pump to 0.5 kpa for totally 1 h, during which the flask was shaken gently every 15 min; The triangular flask was taken out and shaken at 28° C. on a shaker at 120 r/m in for 1 h; All the bacteria solution was poured out, and the materials were spread out in a sterile culture dish containing filter papers to dry out;

[0056] 4. Co-cultivation: The dried infected materials were inoculated in a co-cultivation medium (spreading a piece of sterile filter paper in the medium); the ingredients of the co-cultivation medium were: MS basal medium+2 mg/L 2,4-D+0.2 mg/L KT+30 g/L sucrose+8 g/L agar+100 μmol/L acetosyringone. They were cultivated in dark in an incubator or in a culture room at 25±1° C. for 3 days.

[0057] 5. Screening: The co-cultivated materials were inoculated in a screening medium; the ingredients of the screening medium were: SH basal medium+2 mg/L 2,4-D+0.2 mg/L KT+30 g/L sucrose+8 g/L agar+250 mg/L cefotaxime+250 mg/L carbenicillin+15 mg/L hygromycin; they were cultivated in light in an incubator or in a culture room at 25±1° C. for 30-60 days;

[0058] 6. Differentiation: The recovered materials were transferred into a differentiation medium; the ingredients of the differentiation medium were: UM basal medium+2 g/L casein hydrolysate+0.4 mg/L KT+30 g/L sucrose+8 g/L agar+250 mg/L cefotaxime+5 mg/L hygromycin; they were cultivated in light in an incubator or in a culture room at 25±1° C. for 15-30 days;

[0059] 7. Rooting: The differentiated sprouts of 1-3 cm were transferred into a rooting medium; the ingredients of the rooting medium were: MS basal medium+1 mg/L IBA+15 g/L sucrose+8 g/L agar+250 mg/L cefotaxime.

[0060] regenerated Medicago sativa plants were obtained totally.

[0061] 2.4. The genome DNA was extracted from the obtained 25 transgene Medicago sativa plants containing the recombinant vector targeting the Medicago sativa MsPALM1 gene by means of a plant genome extraction mini kit (Tiangen Biotech Co., Ltd). With the genome DNA as the template, the sequence containing a target site was subjected to PCR amplification by using an ExTaq DNA polymerase (Takara Co.), wherein the primers used for PCR amplification were:

TABLE-US-00002 MsPA1 genome F: AATTTCATCCCCCACCCCATTA MsPA1 genome R: TTCTCCACACACTGAAAAAGAGAGA

[0062] 2.5 The obtained PCR amplification fragments were digested with BstUI restriction endonuclease (NEB Co.) to screen the mutants. The digestion results showed that, in the 25 tested plants, 13 plants contained mutations in the MsPALM1 gene, with a mutation efficiency of 52%, the results were as shown in FIG. 1; wherein there were 3 plants which were regenerated lines carrying four mutated MsPALM1 alleles, with a mutation efficiency of 12%.

[0063] 2.6. Bands which cannot be digested with BstUI restriction endonuclease were cloned by TA to ligate with the pMD19-T vector (Takara Co) and transformed into Escherichia coli DH5a (preserved by Guangdong Sanjie Forage Biotech Co., Ltd.); 10 monoclones were selected and sequenced by using M13F universal primers, and the mutations at the target sites were analyzed. The sequencing results showed that, there were mutations at the target sites in all the mutated plants obtained from the screening. Partial results were as shown in FIG. 2 (The shaded part of the image, that was, CCGCGACCGTGCTCGTCTCC starting from position 10 was the target site for editing), the forms of mutation included the insertion and/or deletion of bases.

[0064] 2.7. The compound leaf phenotypes of the regenerated plants carrying four MsPALM1 allelic genes with simultaneous loss-of-function mutation were observed, wherein the compound leaves of 3 Medicago sativa plants showed pentatrinate compound leaves phenotypes significantly, indicating that the 3 transgene lines carrying four MsPALM1 allelic genes with simultaneous loss-of-function mutation were the directed produced multileaflet Medicago sativa materials, see FIG. 3.

[0065] Compared with traditional breeding methods, the present method has the following 330 benefits:

[0066] {circle around (1)} Short breeding period, the whole directional production process of the materials can be completed within 7 months, while the traditional hybridization method requires at least 3 to 5 years.

[0067] {circle around (2)} Only one gene in the recipient varieties is changed, the obtained materials are 335 changed to pentatrinate compound leaves with other agronomic trait unchanged; while the traditional hybridization method may introduce other genes linked with MsPALM1, which may influence the agronomic trait of the recipient varieties.

[0068] {circle around (3)} In strictly cross-pollinated autotetraploid Medicago sativa, a stable genetic homozygous mutant with all the four alleles mutated can be quickly obtained; However, it is very difficult to obtain a stable genetic homozygous mutant by the traditional hybridization method.