SACCHAROMYCES CEREVISIAE STRAINS EXPRESSING EXOGENOUS GLUCOAMYLASE AND XYLANASE ENZYMES AND THEIR USE IN THE PRODUCTION OF BIOETHANOL

Abstract

Strains of Saccharomyces cerevisiae yeast that are genetically modified so as to co-express a gene coding a glucoamylase of fungal origin, a gene coding a glucoamylase of Saccharomyces cerevisiae var. diastaticus, and a gene coding a xylanase of fungal origin. The production yield of bioethanol through these strains is greater than that of strains that are otherwise identical but that do not include the gene coding the xylanase of fungal origin. Also, a method for obtaining these yeasts, as well as the use of these yeasts in the production of bioethanol.

Claims

1-17. (canceled)

18. A Saccharomyces cerevisiae yeast strain, wherein said yeast strain co-expresses: a gene encoding a xylanase of fungal origin; a gene encoding a glucoamylase of fungal origin; and a gene encoding glucoamylase from Saccharomyces cerevisiae var. diastaticus.

19. The Saccharomyces cerevisiae yeast strain according to claim 18, wherein the xylanase of fungal origin is an Aspergillus niger xylanase or a Trichoderma reesei xylanase.

20. The Saccharomyces cerevisiae yeast strain according to claim 19, wherein the xylanase of fungal origin is an Aspergillus niger xylanase which is encoded by the nucleic sequence SEQ ID NO: 5 or which consists of the polypeptide sequence SEQ ID NO: 6 or a functional variant of the polypeptide sequence SEQ ID NO: 6.

21. The Saccharomyces cerevisiae yeast strain according to claim 19, wherein the xylanase of fungal origin is a Trichoderma reesei xylanase which is encoded by the nucleic sequence SEQ ID NO: 7 or which consists of the polypeptide sequence SEQ ID NO: 8 or a functional variant of the polypeptide sequence SEQ ID NO: 8.

22. The Saccharomyces cerevisiae yeast strain according to claim 18, wherein the glucoamylase from Saccharomyces cerevisiae var. diastaticus is encoded by the nucleic sequence SEQ ID NO: 3 or consists of the polypeptide sequence SEQ ID NO: 4 or a functional variant of the polypeptide sequence SEQ ID NO: 4.

23. The Saccharomyces cerevisiae yeast strain according to claim 18, wherein the glucoamylase of fungal origin is selected from the group consisting of: an Aspergillus niger glucoamylase, a Saccharomycopsis fibuligera glucoamylase, a Trichoderma reesei glucoamylase, a Thermomyces lanuginosus glucoamylase, a Rhizopus oryzae glucoamylase and an Aspergillus oryzae glucoamylase.

24. The Saccharomyces cerevisiae yeast strain according to claim 23, wherein the glucoamylase of fungal origin is an Aspergillus niger glucoamylase which is encoded by the nucleic sequence SEQ ID NO: 1 or which consists of the polypeptide sequence SEQ ID NO: 2 or a functional variant of the polypeptide sequence SEQ ID NO: 2.

25. The Saccharomyces cerevisiae yeast strain according to claim 18, wherein said yeast strain comprises: m copies of the xylanase gene of fungal origin; n copies of the gene encoding glucoamylase of fungal origin; and p copies of the gene encoding glucoamylase from Saccharomyces cerevisiae var. diastaticus, where m is an integer comprised between 1 and 10, n is an integer comprised between 2 and 10, and p is an integer comprised between 2 and 10.

26. The Saccharomyces cerevisiae yeast strain according to claim 25, wherein m is 1 or 4.

27. The Saccharomyces cerevisiae yeast strain according to claim 25, wherein n is 6 and p is 4.

28. The Saccharomyces cerevisiae yeast strain according to claim 18, wherein the gene encoding xylanase of fungal origin, the gene encoding glucoamylase of fungal origin, and the gene encoding glucoamylase from Saccharomyces cerevisiae var. diastaticus are integrated within the genome of said yeast strain.

29. The Saccharomyces cerevisiae yeast strain according to claim 18, wherein said yeast strain is the strain deposited on 26 Apr. 2017 in the CNCM under number I-5201.

30. A method for obtaining a Saccharomyces cerevisiae yeast strain useful for the production of bioethanol, said method comprising the steps consisting in: (a) genetically modifying a Saccharomyces cerevisiae yeast so that it co-expresses a gene encoding a xylanase of fungal origin, a gene encoding a glucoamylase of fungal origin, and a gene encoding glucoamylase from Saccharomyces cerevisiae var. diastaticus, or obtaining a Saccharomyces cerevisiae yeast strain according to claim 18; (b) culturing and fermenting the yeast obtained in step (a) on a synthetic dextrin medium; and (c) selecting at least one strain with fermentation kinetics at least equal to or greater than the fermentation kinetics of the strain deposited on 9 Jul. 2015 in the CNCM under number I-4997.

31. A method for increasing the bioethanol production yield of a Saccharomyces cerevisiae yeast strain, said method comprising the steps consisting in: (a) providing a Saccharomyces cerevisiae yeast co-expressing a gene encoding a glucoamylase of fungal origin, and a gene encoding glucoamylase from Saccharomyces cerevisiae var. diastaticus; (b) genetically modifying the yeast of step (a) so that it further expresses a gene encoding a xylanase of fungal origin; (c) culturing and fermenting the yeast obtained in step (b) on a synthetic dextrin medium; and (d) selecting at least one strain with fermentation kinetics at least equal to or greater than the fermentation kinetics of the strain deposited on 9 Jul. 2015 in the CNCM under number I-4997.

32. The method as claimed in claim 31, wherein the Saccharomyces cerevisiae yeast of step (a) is the Saccharomyces cerevisiae yeast strain deposited on 9 Jul. 2015 in the CNCM under number I-4997.

33. A method for producing bioethanol from biomass, said method comprising the steps consisting in: (a) pre-hydrolyzing and liquefying the starch from the biomass; (b) reacting the liquefied starch obtained in step (a) with a Saccharomyces cerevisiae yeast strain according to claim 18 to produce bioethanol; and (c) extracting the bioethanol produced in step (b).

Description

LEGENDS FOR THE FIGURES

[0101] FIG. 1: (A) Mass loss observed for the transformants of the strain deposited in the CNCM under number I-4997 during fermentation in the “Alcohol Max” medium. (B) Mass loss observed for the transformants of the strain number I-4997 during fermentation in the “Dextrin” medium.

[0102] FIG. 2: (A) Comparison of the fermentation kinetics of the different strains studied. (B) Comparison of the values of ethanol content, glycerol/ethanol mass ratios and ethanol yields calculated on the glucose potential of the substrate used for the fermentation of the different strains studied.

[0103] FIG. 3: Comparison of total sugars measured at the end of fermentation for the different strains studied.

EXAMPLE 1: OBTAINING AND CHARACTERIZING TRANSFORMANTS OF STRAIN I-4997 CONTAINING 1 OR 4 COPIES OF A GENE ENCODING XYLANASE FROM ASPERGILLUS NIGER (XYN1) OR A GENE ENCODING XYLANASE FROM TRICHODERMA REESEI (XYN2)

[0104] The strategy used to clone a xylanase activity in Saccharomyces cerevisiae strain ER-GAND-8159-C1 (i.e., the strain deposited, by the Applicant, on 9 Jul. 2015 in the CNCM under number I-4997) is based on the use of a multi-integrative expression system. With this system, it is possible to simultaneously integrate one or more copies of a gene encoding a given xylanase at a given locus. The Inventors chose to integrate 1 copy or 4 copies of one of the two genes XYN1 from Aspergillus niger and XYN2 from Trichoderma reesei in order to measure a possible effect related to the copy number on xylanase activity.

A. Obtaining Expression Plasmids

[0105] Xylanase from Aspergillus niger (XYN1). The XYN1 gene encoding Aspergillus niger xylanase was previously amplified by PCR using genetic material derived from Aspergillus niger strain ATCC10577. The PCR product was then cloned into an expression vector (developed in-house) under the dependence of a strong pADH1 promoter and the tCYC1 terminator. The resulting plasmid then serves as a template for the generation of expression modules, as described in paragraph B below.

[0106] Xylanase from Trichoderma reesei (XYN2). The Trichoderma reesei xylanase that was used is encoded by the XYN2 gene. The sequence used is the cDNA version, stripped of its introns and optimized through codons to improve the translation of the protein in the Saccharomyces cerevisiae yeast. The plasmid which has the XYN2 gene dependent on the pADH1/tCYC1 pair, was used as PCR template to synthesize the expression modules.

B. Obtaining the Expression Modules

[0107] The strategy employed by the Inventors consisted in simultaneously integrating several xylanase gene expression modules into a Saccharomyces cerevisiae strain in a single step at a given locus, based on the yeast's natural ability to carry out homologous recombination in vivo. The Inventors have defined the PCR primers to be used to integrate the modules at the BUD5 locus. Depending on the strains developed, 1 or 4 A. niger xylanase or T. reesei xylanase expression modules, as well as a selection module were integrated.

[0108] Each amplified module has recombinogenic sequences (A1, B1, C1 and D1) on either side of its promoter and terminator. These sequences are provided by the floating tails of the PCR primers (Table 1) and allow the modules to specifically align and recombine by homology between these recombinogenic sequences.

[0109] The presence of sequences homologous to a given locus, for example the BUD5 locus, at the 5′ and 3′ ends of the multi-integrative expression cassette allows the simultaneous integration of the expression modules and the homologous recombination selection module at this given locus.

C. Obtaining and Selecting Transformants

[0110] Obtaining Transformants. For each construct, the different modules (see Table 2) were equimolarly mixed in order to integrate at the BUD5 locus of strain I-4997, 1 or 4 copies of A. niger or T. reesei xylanases as well as a selection module.

[0111] The selection of clones having correctly integrated the expression modules is initially made on the basis of the presence of the selection module in the integration cassette. The selection module comprises a strong promoter/terminator pair and a gene the expression os which confers on the yeasts containing it a characteristic enabling them to be selected on a given medium. The Inventors thus isolated the clones derived from each transformation.

TABLE-US-00001 TABLE 1 Listing of Primers Used and Nomenclature of Synthesized Expression Modules. Sense (F) and antisense (R) oligonucleotides Module Selection (F): CGCTCCAGAATTAGCGGACCTCTTGAGCGGTGAGCCTCTGGCAAA M0 gene GAAGAGCATAACCGCTAGAGTACTT (SEQ ID NO: 11) (R): TCACTGTACGGTGAGAACGTAGATGGTGTGCGCATAGGCCACTAG TGGATCT (SEQ ID NO: 12) A. niger (F): CACACCATCTACGTTCTCACCGTACAGTGAGCATAACCGCTAGAG M5-AN XYN1 TACTT (SEQ ID NO: 13) gene (R): CTCAAGAACGTAGGACGATAACTGGTTGGAAAGCGTAAACACGGA GTCAACAGCTTGCAAATTAAAGCCT (SEQ ID NO: 14) (F): SEQ ID NO: 13 M6-AN (R): TTACGTAGACTGAGTAGCAACGGTTGAGGACAGCTTGCAAATTAA AGCCT (SEQ ID NO: 15) (F): TCCTCAACCGTTGCTACTCAGTCTACGTAAGCATAACCGCTAGAG M7-AN TACTT (SEQ ID NO: 16) (R): TCAGTAGCACAGAGAAGTGTAGGAGTGTAGCAGCTTGCAAATTAA AGCCT (SEQ ID NO: 17) (F): CTACACTCCTACACTTCTCTGTGCTACTGAGCATAACCGCTAGAG M8-AN TACTT (SEQ ID NO: 18) (R): TTAGGATACATGCAGTAGACGAGGTAAGCACAGCTTGCAAATTAA AGCCT (SEQ ID NO: 19) (F): TGCTTACCTCGTCTACTGCATGTATCCTAAGCATAACCGCTAGAG M9-AN TACTT (SEQ ID NO: 20) (R): SEQ ID NO: 14 T. reesei (F): SEQ ID NO: 13 M5-TR XYN2 (R): SEQ ID NO: 14 gene (F): SEQ ID NO: 13 M6-TR (R): SEQ ID NO: 15 (F): SEQ ID NO: 16 M7-TR (R): SEQ ID NO: 17 (F): SEQ ID NO: 18 M8-TR (R): SEQ ID NO: 19 (F): SEQ ID NO: 20 M9-YR (R): SEQ ID NO: 14

TABLE-US-00002 TABLE 2 Mixing of modules before transformation of strain 1-4997. Copy number Modules used Strains obtained 1 copy of A. niger XYN1 M0 ER-GAND-XAN M5-AN 4 copies of A. niger XYN1 M0 ER-GAND-XAN-4C M6-AN M7-AN M8-AN M9-AN 1 copy of T. reesei XYN2 M0 ER-GAND-XTR1C M5-TR 1 copy of T. reesei XYN2 M0 ER-GAND-XTR-4C M6-TR M7-TR M8-TR M9-TR

[0112] Selection of Transformants.

[0113] (a) Functional Screening in relation to Xylanase Activity. The screening of the transformants obtained was carried out in 2 steps. First, the transformants obtained were cultured in a minimum medium containing birch xylan. Indeed, clones secreting an active xylanase have the ability to hydrolyze the xylan from the medium to xylose. After this first step of transformant growth, an inoculum of CelluX™, a yeast capable of consuming xylose, was added to each well. The wells in which CelluX™ growth is observed are identified as containing a clone secreting xylanase activity. This approach makes it possible to identify transformants exhibiting the desired phenotype. To this end, the optical density (OD at 600 nm) of the cultures is measured at the end of growth.

[0114] (b) Validation of Selected Transformants by PCR. Before evaluation in fermentation, the genotype was verified for 2 transformants per construct among those identified as exhibiting a [Xylanase]+ phenotype. A panel of PCR reactions, aimed at confirming the presence of the different genes theoretically present in the constructs obtained, was performed on the genomic DNA of the selected transformants.

D. Phenotypic Characterization (Xylanase Activity) of Selected Clones

[0115] Solid Phenotype Test. In this test, 5 μL of culture supernatant (5% YPG, 30° C., 24 hours, 150 rpm) was deposited on a medium containing birch xylan, and the hydrolysis halos of the xylan were visualized after staining with 1% Congo Red and destaining with 1 M NaCl. Hydrolysis halos were observed for all clones considered.

[0116] Liquid Phenotype Test. This phenotypic characteristic is based on the same principle as that used for the selection of transformants (see above). In this test, 5 μL of cultured supernatant (5% YPG) was incubated at 50° C. overnight in the presence of birch xylan (vol/vol), then the mixture was inoculated with a suspension calibrated at OD.sub.600 nm=0.05 of CelluX™. Samples, taken before and after inoculation with CelluX™, were analyzed by HPLC to determine the concentration of xylose during CelluX™ cell growth.

[0117] The results obtained in the phenotypic test in liquid medium confirmed the correlation between CelluX™ growth and xylose consumption for the clones considered.

TABLE-US-00003 TABLE 3 Determination of Xylose Consumption and Measurement of CelluX ™ Cell Growth for Selected Transformants. Yeast Xylose CelluX ™ growth culture concentration (g/L) OD (600 nm) super- Copy Clone Reduc- Multiplier natant no. no. T0 Tf tion (%) T0 Tf Coefficient ER- 1 cl1 0.32 0.03 −92% 0.05 2.2 44 x GAND- cl4 0.19 0.08 −59% 0.05 0.8 16 x XAN 4 cl1 0.26 0.03 −89% 0.05 1.5 30 x cl9 0.21 0.03 −87% 0.05 1.5 30 x ER- 1 cl3 0.22 0.08 −62% 0.05 0.9 18 x GAND- cl8 0.18 0.03 −81% 0.05 1.1 22 x TR 4 cl2 0.23 0.03 −88% 0.05 1.9 38 x cl10 0.42 0.06 −87% 0.05 1.2 24 x ER- control 0.16 0.03 −79% 0.05 0.4  8 x GAND- + sXYN.sup.(b) 3.59 0.23 −93% 0.05 2.9 58 x 8159.sup.(a) Ethanol control 0.14 0.06 −56% 0.05 0.4  8 x Red ® .sup.(c) + sXYN 3.52 0.25 −93% 0.05 2.9 58 x .sup.(a)ER-GAND-8159 is the strain deposited in the CNCM under number I-4997. .sup.(b)sXYN = 12 U/μL T. reesei xylanase solution .sup.(c) Ethanol Red ® is a strain deposited in the CNCM on 4 Sep. 2008, by the present Applicant, under number I-4071.

E. Evaluation of Selected Clones in Fermentation

[0118] Determination of Performance with respect to Ethanol Production in “Alcohol Max” Medium (YFAM). In order to determine whether the integration of the expression modules of A. niger xylanase and T. reesei xylanase had an impact on the transformants' ability to produce ethanol, they were characterized in a so-called “alcohol max” medium containing 280 g/kg sucrose (see composition below), which makes it possible to measure their ethanol production potential under given evaluation conditions.

[0119] The “Alcohol Max” medium contains: 280 g/kg sucrose, 5 g/kg yeast extract, 4.7 g/kg di-basic ammonium phosphate (D.A.P.), 11.5 g/kg citric acid, 13.5 g/kg sodium citrate, as well as minerals and vitamins.

[0120] The monitoring of mass losses did not reveal any negative impact of the integration of the “xylanase” expression modules on the maximum alcohol production potential of the transformants, either from a kinetic point of view or as an end point, with the exception of clone 1 which has 4 copies of the A. niger XYN1 gene which is very slightly impacted at the kinetics level (see FIG. 1(A)).

[0121] Fermentation in Dextrin medium. In order to determine whether the selected transformants retained their ability to degrade starch via the production of glucoamylase, the transformants were evaluated in a dextrin medium. Indeed, the strain used as host to integrate the xylanase expression modules corresponds to the ER-GAND-8159 strain (CNCM I-4997) which has 2 glucoamylase genes of different origin. Dextrins are molecules resulting from the hydrolysis of starch, the clones secreting glucoamylases are able to degrade them to glucose and thus produce ethanol. The fermentation conditions used were identical to those used with the YFAM medium.

[0122] “Dextrin medium” means a synthetic medium containing dextrins, as known to the skilled person. It is for example a synthetic medium containing starch dextrins (220 g/kg), yeast extract (5 g/kg), urea (2 g/kg), potassium dihydrogen phosphate (1 g/kg) as well as minerals and vitamins.

[0123] All clones tested in the dextrin fermentation medium retained their ability to degrade starch when compared with Ethanol Red® which was only able to ferment the glucose initially present in the medium (of the order of 10 g/L) (see FIG. 1(B)). It is also noted that the ER-GAND-XTR-4c c110 clone, which has 4 copies of the XYN2 gene which encodes the T. reesei xylanase, and the clone ER-GAND-XTR-1c c18, which has 1 copy of this gene, and to a lesser extent the clone ER-GAND-XTR-4c c12, which has 4 copies of this gene, are negatively impacted in their mass loss kinetics compared with the ER-GAND-8159 control, which is not the case for the ER-GAND-XTR-1c c13 clone (CNCM I-5265) with a single copy of XYN2, for which the mass loss is faster over the first 24 hours and identical to the control over the 40 hours of fermentation that follow. These results suggest an effect related to the clone considered more than they demonstrate a genuine negative impact of the integration of the XYN2 gene.

[0124] On the other hand, the four ER-GAND-XAN transformants tested that possess either 1 copy or 4 copies of the XYN1 gene (A. niger) have significantly improved mass loss production kinetics over the first 24 hours compared with the ER-8159-GAND-8159 control (CNCM I-4997).

[0125] Four transformants were deposited in the CNCM: strain ER-GAND-XAN-1C c11 deposited on 26 Apr. 2017 in the CNCM under accession number I-5201, strain ER-GAND-XAN-4C c19 deposited on 20 Dec. 2017 in the CNCM under accession number I-5264, strain ER-GAND-XTR-1C c13 deposited on 20 Dec. 2017 in the CNCM under accession number I-5265, and strain ER-GAND-XTR-4C c12 deposited on 20 Dec. 2017 in the CNCM under accession number I-5266.

F. Conclusion

[0126] The study described in this Example made it possible to obtain transformants of the ER-GAND-8159 strain. These transformants possess 1 copy or 4 copies of Aspergillus niger or Trichoderma reesei xylanase genes, using the strategy of single-step multi-copy integration by obtaining specifically designed expression modules. Second, the Inventors focused on validating, by PCR, the genotype of the transformants obtained as well as their xylan hydrolysis phenotype, and ensured that their ethanol production and starch hydrolysis capacities had not been negatively impacted by the genetic modifications performed.

EXAMPLE 2: EVALUATION OF THE FERMENTATION PERFORMANCE OF STRAINS ON A BIOETHANOL PRODUCTION SUBSTRATE

A. Preparation of a Corn Hydrolysate for Evaluation of Strains Exhibiting Xylanase Activity.

[0127] In order to implement the strains generated in this study, a fermentation medium for bioethanol production was prepared. This medium is defined to be close to the market substrates using corn. To this end, corn grits (“Crème de Maïs”-MQ-FT-19, Moulons Waast) were suspended in order to obtain a mixture with about 30% dry matter in water. The pH of this suspension was then adjusted to 6 using a 40% potassium hydroxide solution, and an α-amylase type enzyme (Liquozyme SC-DS, Novozymes) was added at a rate of 0.85 mL enzyme per kg of mobilized grits. A liquefaction heat treatment was then applied to the suspension for 3 hours at 85° C. A typical composition of sugars released after heat treatment is shown in Table 4 below (measured dry matter: 29.1%).

TABLE-US-00004 TABLE 4 Composition of Sugars Available in the Liquefied Substrate. Sugars Concentrations (g/kg) Maltose 23.9 Glucose 6.3 Fructose 0.7 Glycerol 0.3

[0128] The liquefied substrate has a total glucose potential measured by the enzymatic method of 226 g.sub.glucose/kg.sub.substrate.

B. Evaluation of the Ethanol Production Performance of Strains Modified by Adding Xylanase Genes

[0129] Four transformants were tested for their performance in alcoholic fermentation (2 clones incorporating Aspergillus niger xylanase, one possessing 1 copy of the gene and the other possessing 4 copies of the gene; and 2 clones each possessing 1 copy of the Trichoderma reesei xylanase gene) on the liquefied substrate, compared with the reference strain ER-GAND-8159 (CNCM I-4997).

[0130] Preparation of Yeast Creams from the Strains Selected for the Evaluation. Each of the five strains selected for evaluation was cultured on a Petri dish for 24 hours and then stored in the refrigerator before use. Each strain was then collected and used to inoculate 100 mL of acidic medium (for example YM medium) in 250 mL round-bottom flasks. The round-bottom flasks were placed in an incubator at 26° C. for 24 hours.

[0131] At the end of this incubation, each medium was centrifuged at 4500 rpm for 5 minutes. After removal of the supernatant, 150 mL of sterile water was added to wash the yeasts. A second centrifugation was then carried out, then after removal of the supernatant, the pellet was taken up in 20 mL of sterile water, homogenized by vortexing and stored cold before being used to inoculate the fermentation test samples.

[0132] Performing the Fermentation Tests. For each strain evaluated, 100 g of liquefied substrate was placed in a 250 mL round-bottom flask. An addition of mineral nitrogen was carried out in the form of urea at a rate of 0.5 g nitrogen per kg substrate. The pH was then adjusted to 5 using a 0.5 N sulfuric acid solution. Each strain stored in cream form was then added to the medium at a rate of 0.5 g cream dry matter per kg substrate. Once the strains were added to their respective round-bottom flasks, the tests were placed in an incubator at 32° C. with orbital shaking at 100 rpm.

[0133] The monitoring of the tests was carried out by on-line acquisition of the CO.sub.2 pressure generated by the fermentation, expressed in equivalent mass loss. At the end of fermentation, the musts were collected and analyzed by HPLC to measure the concentrations of the various biochemical compounds and determine the fermentation balances.

[0134] Results Obtained. FIG. 2(A) presents the fermentation kinetics observed. It appears that with the exception of the ER-GAND-XTR-1C-c18 strain, which shows a delay in initial kinetics, all strains show a similar onset of fermentation during the first 36 hours of fermentation. After 36 hours, the reference strain ER-GAND-8159 slows down, as does the ER-GAND-XTR-1C-c13 (1-5265) strain with identical kinetics. Both strains expressing the Aspergillus niger xylanase gene continue fermentation at a higher rate and produce a higher amount of CO.sub.2 during the test. The ER-GAND-XTR-1C-c18 strain that had an initial kinetic delay catches up with the reference at 54 hours of fermentation and exceeds it to finish slightly behind the two ER-GAND-XAN strains.

[0135] At the end of fermentation, analyses were carried out to measure the performance gains of the new transformants. FIG. 2(B) shows the values for ethanol content, glycerol/ethanol mass ratio and ethanol yield calculated on the glucose potential of the substrate used.

[0136] ER-GAND-XAN transformants are observed to have an advantage over ethanol production (higher titer and higher yield) as well as reduced glycerol production. Concerning the ER-GAND-XTR strains, only clone 8 has an advantage on these same parameters, clone 3 being similar to the reference in terms of performance.

[0137] Table 5 below presents all the data collected during the tests to compare performance to the reference. The left side of the table presents the raw values and the right side presents the gain observed relative to the reference.

[0138] Strains with a gain in ethanol production therefore have a parallel reduction in glycerol production. However, this reduction in glycerol does not explain the gain in alcohol production; the gain in yield comes from a more efficient consumption of the glucose in the medium made possible by the action of the xylanase produced by each strain. This result is confirmed by the measurements of total sugars at the end of fermentation presented in FIG. 3: strains with an advantage in ethanol yield also have a reduced residual sugar content.

TABLE-US-00005 TABLE 5 Results of Transformant Performance Tests Absolute values (in %) Relative gains compared with the reference (%) Reference* Cl1* Cl9* Cl3* Cl8* Percentage of glucose 95.9 96.4 96.2 96.0 96.6 consumption (% w/w) (0.5) (0.2) (0.0) (0.7) Ethanol content (g/kg) 113.6 116.9 117.0 113.3 115.6 (2.8) (2.9) (−0.2) (1.7) Volumetric productivity 1.62 1.59 1.60 1.62 1.58 (g/kg/h) (−2.0) (−1.9) (−0.2) (−3.1) Maximum volumetric 6.1 6.0 6.0 6.0 5.9 productivity (g/kg/h) (−1.8) (−1.2) (−1.8) (−3.5) Ethanol yield (% w/w) 39.7 40.7 40.7 39.6 40.3 (2.5) (2.6) (−0.2) (1.7) Glycerol/ethanol ratio (% w/w) 8.9 8.5 8.5 8.9 8.3 (−5.4) (−4.5) (0.1) (−7.6) Glycerol yield (% w/w) 3.43 3.31 3.35 3.42 3.20 (−3.6) (−2.2) (−0.2) (−7.1) *Reference = ER-GAND-8159; Cl1 = ER-GAND-XAN-1C-cl1 (I-5201); Cl9 = ER-GAND-XAN-4C-cl9 (I-5264); Cl3 = ER-GAND-XTR-1C-cl3 (1-5265); and Cl8 = ER-GAND-XTR-1C-cl8.

[0139] Conclusion. The introduction of genes encoding the Aspergillus niger xylanase in the ER-GAND-8159 strain (14997) significantly improved performance in ethanol production. The yield gain measured in fermentation on a corn hydrolysate was between 2.5% and 2.6% compared with the reference strain. The action of xylanase on the fermentation matrix is beneficial to the action of glucoamylases by allowing them better access to the starch in the medium while reducing the glycerol response of the strains. This dual gain in sugar (reduction of the flow directed towards glycerol and increase of the glucose released by the glucoamylases) leads to a better ethanol production. The ER-GAND-XTR-1c strain has a similar advantage, although slightly less in this example.