METHOD OF PRODUCING A SIALYLATED N-GLYCOSYLATED RECOMBINANT PROTEIN IN PERIPLASM OF A RECOMBINANT ESCHERICHIA COLI

Abstract

Disclosed herein is a method for producing a sialylated N-glycosylated recombinant protein in periplasm of a recombinant Escherichia coli. The sialylated N-glycosylated recombinant protein is produced in the periplasm of a recombinant Escherichia coli strain W3110ΔnanKETA::Kan, and a sialylated oligosaccharide chain is Neu5Ac-α-2,6-Gal-β-1,4-GlcNAc-β-1,3 -Gal-β-1,3-GlcNAc.

Claims

1. A method of producing a sialylated N-glycosylated recombinant protein in periplasm of a recombinant Escherichia coli, comprising: cloning a glycosyltransferase a glycosyltransferase LsgCDEF gene cluster from Haemophilus influenzae, an undecaprenyl-phosphate alpha-N-acetylglucosaminyltransferase WecA gene from Escherichia coli, a oligosaccharide flippase pglK gene from Campylobacter jejuni, an oligosaccharyltransferase pglB gene from Campylobacter jejuni, a sialic-acid synthase NeuBCA gene cluster from Campylobacter jejuni, an α-2,6-sialytransferase Δ16psp2,6ST gene from Vibrionaceae Photobacterium sp. JT-ISH-224 and a gene of a protein to be modified with a sialylated oligosaccharide chain at N terminal into an Escherichia coli expression vector through genetic recombination to construct an expression system of the sialylated N-glycosylated recombinant protein; and transferring the expression system of the sialylated N-glycosylated recombinant protein into an Escherichia coli strain suitable for production of the sialylated N-glycosylated recombinant protein followed by auto-induction culture to produce the sialylated N-glycosylated recombinant protein.

2. The method of claim 1, wherein the sialylated oligosaccharide is Neu5Ac-α-2,6-Gal-β-1,4-GlcNAc-β-1,3-Gal-β-1,3-GlcNAc.

3. The method of claim 1, wherein the method comprises: (1) constructing an Escherichia coli strain suitable for the production the sialylated N-glycosylated recombinant protein; (2) constructing the expression system of the sialylated N-glycosylated recombinant protein; (3) producing a sialylated N-glycosylated recombinant protein crude product in the Escherichia coli strain suitable for the production of the sialylated N-glycosylated recombinant protein; and (4) purifying the sialylated N-glycosylated recombinant protein crude product obtained in step (3) to obtain the sialylated N-glycosylated recombinant protein.

4. The method of claim 3, wherein the step (1) comprises: knocking out a nanKETA gene cluster in a W3110 genome from Escherichia coli K-12 using a Red homologous recombination system to block an alternative pathway to synthesize a sialic acid to construct the Escherichia coli strain suitable for the production of the sialylated N-glycosylated recombinant protein; wherein a genotype of the Escherichia coli strain suitable for the production of the sialylated N-glycosylated recombinant protein is defined as W3110ΔnanKETA::Kan.

5. The method of claim 3, wherein the step (2) comprises: constructing the glycosyltransferase LsgCDEF gene cluster, the undecaprenyl-phosphate alpha-N-acetylglucosaminyltransferase WecA gene, the oligosaccharide flippase pglK gene and the oligosaccharyltransferase pglB gene onto the Escherichia coli expression vector to construct a vector capable of performing N-glycosylation; and cloning the sialic-acid synthase NeuBCA gene cluster, the α-2,6-sialytransferase Δ16psp2,6ST gene and the gene of the protein to be modified on the vector capable of performing N-glycosylation through gene recombination to construct the expression system of the sialylated N-glycosylated recombinant protein.

6. The method of claim 3, wherein the step (3) comprises: transferring the expression system of the sialylated N-glycosylated recombinant protein obtained in step (2) to the Escherichia coli strain W3110ΔnanKETA::Kan obtained in step (1); and subjecting the Escherichia coli strain W3110ΔnanKETA::Kan to the auto-induction culture in the absence of external sialic acid to produce the sialylated N-glycosylated recombinant protein crude product.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0025] FIG. 1 schematically depicts a pC15-Ara-pglB-WecA-pglK-lsgCDEF vector;

[0026] FIG. 2 schematically depicts a pIG6-Fn3-P-Δ16psp2,6ST-neuBCA vector;

[0027] FIG. 3 schematically depicts a pIG6-Fn3vector;

[0028] FIG. 4 shows Western Blotting results of Fn3 recombinant protein expressed in a recombinant Escherichia coli; where 1: unglycosylated Fn3 recombinant protein; 2: unsialylated N-glycosylated Fn3 recombinant protein; and 3: sialylated N-glycosylated Fn3 recombinant protein;

[0029] FIGS. 5A-5B show lectin blot results of the Fn3 recombinant protein expressed in the recombinant Escherichia coli;

[0030] where 5A: lectin ECA (Catalog Number: H-5901-1, EY Laboratories, Inc. (US)) for specifically recognizing Gal-β-1,4-GlcNAc; 5B: lectin SNA-I (Catalog Number: H-6802-1, EY Laboratories, Inc. (US)) for specifically recognizing Neu5Ac-α-2,6-Gal; 1: unglycosylated Fn3 recombinant protein; 2: unsialylated N-glycosylated Fn3 recombinant protein; and 3: sialylated N-glycosylated Fn3 recombinant protein; and

[0031] FIGS. 6A-6B show composition of an oligosaccharide chain of the sialylated N-glycosylated recombinant protein; where 6A: high-energy collision-induced dissociation (HCD) mass spectroscopy/mass spectroscopy (MS/MS) spectrum; and 6B: deconvoluted MS/MS spectrum.

DETAILED DESCRIPTION OF EMBODIMENTS

[0032] This disclosure will be further described with reference to the accompanying drawings and the embodiments, which are not intended to limit the scope of the present disclosure. Unless otherwise specified, the experimental instruments, materials and reagents used herein are commercially available. The Escherichia coli strain W3110 is purchased from the Coli Genetic Stock Center of Yale University (US).

Example 1 Construction of an Escherichia coli Strain for Producing the Sialylated N-Glycosylated Recombinant Protein

[0033] An original Escherichia coli strain for genetic modification was an Escherichia coli strain W3110 from the Escherichia coli line K-12. A nanKETA gene cluster (SEQ ID NO: 1) was knocked out from the genome of the strain W3110 using a Red homologous recombination system, where the involved plasmids included pKD13 and pKD46. The gene knockout of the nanKETA gene cluster was specifically described as follows.

[0034] According to the base sequences at two ends of the nanKETA gene cluster and the base sequences at two ends of a kanamycin resistance gene on the pKD13, two pairs of primers were designed for the knockout, shown as follows:

TABLE-US-00001 del nanKETA F1:  (SEQ ID NO: 7) 5′-gcatccgcgccagccaactcccectgcgctgccgctgcgtgtaggct ggagctgctt-3′;  del nanKETA R1:  (SEQ ID NO: 8) 5′-tggtgtacaacattccagccctgagtggggtaaaactctgtcaaaca tgagaattaa-3′;  del nanKETA F2:  (SEQ ID NO: 9) 5′-gtcaccctgcccggcgcgcgtgaaaatagttttcgcatccgcgccag ccaactccccct-3′;  del nanKETA R2:  (SEQ ID NO: 10) 5′-gcaattattgattcggcggatggtttgccgatggtggtgtacaacat tccagccctgag-3′. 

[0035] A polymerase chain reaction (PCR) amplification was conducted in the presence of the primer pair del nanKETA F1 and del nanKETA R1 using the pKD13 as template, and the generated PCR product was used as template to perform another PCR amplification in the presence of the primer pair del nanKETA F2 and the del nanKETA R2 to obtain a PCR fragment. The PCR fragment had 75 bp and 71 bp sequences on two ends, which were homologous to the gene sequences at two ends of the nanKETA gene cluster. Moreover, the PCR fragment also had the kanamycin resistance gene. The PCR fragment was subjected to electrophoresis and gel extraction, and then was transferred to the Escherichia coli strain W3110 carrying a homologous recombinase expressed by pKD46 through electroporation and integrated into the W3110 genome through the homologous recombinase expressed by pKD46 to replace the nanKETA gene cluster, so as to obtain a transformant. The transformant was spread on a LB plate containing kanamycin (15 μg/mL) and incubated at 30° C. overnight. The grown monoclonal bacterial colony was subjected to colony PCR identification using an identification primer pair JD nanKETA F: 5′-cgcactggcaatcagttgtg-3′ and JD nanKETA R: 5′-cgtcacgccgttctactatc-3′, and the PCR amplification product was sequenced to confirm whether the nanKETA gene cluster has been successfully knocked out.

[0036] In order to remove the plasmid pKD46, a positive monoclonal colony was picked and transferred to 3 mL of a LB liquid medium containing kanamycin (15 μg/mL), and then incubated at 42° C. for 12 hours. The bacterial suspension was spread on a LB plate containing kanamycin (15 μg/mL) and incubated at 37° C. overnight. The monoclonal bacterial colony was then subjected to a resistance selection using a LB plate containing ampicillin (100 μg/mL) and a LB plate containing kanamycin (15 μg/mL). If the bacterial colony grew on the kanamycin-containing LB plate but did not grow on the ampicillin-containing LB plate, it was indicated that the plasmid pKD46 had been removed. The Escherichia coli strain with the deletion of the nanKETA gene cluster was named as W3110 ΔnanKETA::Kanmm, in which an alternative pathway for synthesizing sialic acid was blocked.

[0037] The LB solid medium was prepared by dissolving 10 g/L of tryptone, 5 g/L of yeast extract, 10 g/L of sodium chloride and 15 g/L of agar powder in ddH.sub.2O.

[0038] The LB liquid medium was prepared by dissolving 10 g/L of tryptone, 5 g/L of yeast extract and 10 g/L of sodium chloride in ddH.sub.2O.

Example 2 Construction of an Expression Vector of the Sialylated N-Glycosylated Recombinant Protein

[0039] (1) Construction of N-Glycosylation Mechanism

[0040] The glycosyltransferase LsgCDEF gene cluster (GenBank: M94855.1), the undecaprenyl-phosphate alpha-N-acetylglucosaminyltransferase WecA gene (Gene ID: 948789), the oligosaccharide flippase pglK gene (Gene ID: 905421) and the oligosaccharyltransferase pglB gene (Gene ID: 905417) were constructed on a vector pACYC184 using conventional gene recombination technology, and an Arabinose promoter (Ara) was introduced to regulate expressions of these genes to obtain a vector pC15-Ara-pglB-WecA-pglK-lsgCDEF (as shown in FIG. 1) for performing N-glycosylation. A sequence of the vector pC15-Ara-pglB-WecA-pglK-lsgCDEF was shown in SEQ ID NO: 2.

[0041] (2) Construction of Synthesis and Transfer Pathways of Sialic Acid

[0042] A recombinant human fibronectin type III domain (Fn3) was used herein as a receptor protein to instigate the sialylation of N-glycosylated recombinant protein in periplasm of Escherichia coli. The gene encoding the recombinant protein Fn3 carried a FLAG tag-coding (amino acid sequence: DYKD, in which D was an aspartic acid residue; Y was a tyrosine residue; and K was a lysine residue) sequence at the 5′-end to facilitate the Western Blotting analysis, and carried a sequence encoding a recognition site DQNAT (D was aspartic acid residue; Q was a glutamine residue; N was an asparagine residue; A was an alanine residue; and T was threonine residue) of the oligosaccharyltransferase pglB at the 3′-end. Moreover, a 6×histidine tag sequence was introduced downstream of the sequence encoding recognition site DQNAT for the separation and purification of the recombinant protein. The gene (SEQ ID NO: 3) encoding the recombinant protein Fn3, the sialic acid synthase NeuBCA gene cluster (GenBank: AF400048.1), the α-2,6-sialytransferase Δ16psp2,6ST gene (GenBank: AB293985.1) from Vibrionaceae Photobacterium sp. JT-ISH-224 and a 332 bp regulatory sequence (abbreviated as P, SEQ ID NO: 4) from upstream of the Pgl gene cluster (GenBank: Y11648.1) from Campylobacter jejuni were cloned to a vector pIG6, so as to obtain an expression vector pIG6-Fn3-P-Δ16psp2,6ST-neuBCA (as shown in FIG. 2) of the recombinant protein Fn3 and the synthase and transferase of sialic acid. A sequence of the expression vector pIG6-Fn3-P-Δ16psp2,6ST-neuBCA was shown in SEQ ID NO: 5. Further, the gene encoding the recombinant protein Fn3 was cloned to the vector pIG6 alone to obtain a Fn3 expression vector pIG6-Fn3 as control (as shown in FIG. 3). A sequence of the expression vector pIG6-Fn3 was shown in SEQ ID NO: 6.

Example 3 Production of the Sialylated N-Glycosylated Recombinant Protein in Escherichia coli and Purification

[0043] The vector pC15-Ara-pglB-WecA-pglK-lsgCDEF and the vector pIG6-Fn3-P-Δ16psp2,6ST-ne-uBCA were co-transferred into the recombinant Escherichia coli strain W3110 ΔnanKETA::Kan to obtain a recombinant Escherichia coli strain carrying the expression vector of the sialylated N-glycosylated recombinant protein.

[0044] The transformant was inoculated onto a LB plate containing kanamycin (15 μg/mL), ampicillin (100 μg/mL) and chloramphenicol (34 μg/mL), and incubated overnight at 37° C. for 12 hours. Then the monoclone was picked and inoculated into 3 mL of a LB liquid medium containing ampicillin (100 μg/mL) and chloramphenicol (34 μg/mL), and then incubated at 220 rpm and 37° C. overnight. On the next day, the bacterial suspension was inoculated into 500 mL of an auto-induction medium containing ampicillin (100 μg/mL) and chloramphenicol (34 μg/mL) at a ratio of 1:100 (v/v), and incubated at 220 rpm and 25° C. for 40 hours, during which L-arabinose (200 μg/mL) was added as an inducer every 12 hours. Then the bacterial suspension was centrifuged at 4000 rpm and 4° C., and the cells were collected, and then subjected to ultrasonic disruption and high-speed low-temperature centrifugation to obtain a supernatant containing a sialylated N-glycosylated Fn3 recombinant protein. A nickel column was equilibrated with 10 column volumes of an equilibration buffer. The supernatant was loaded onto the nickel column at a low speed, and then the nickel column was eluted with 20 column volumes of a 20 mM imidazole buffer and then underwent gradient elution with 40 mM, 60 mM, 120 mM, 240 mM and 500 mM imidazole buffers, respectively. The eluate was collected, and then subjected to separation and purification to obtain the sialylated N-glycosylated Fn3 recombinant protein, where the sialylated oligosaccharide chain was Neu5Ac-α-2,6-Gal-β-1,4-GlcNAc-β-1,3-Gal-β-1,3-GlcNAc. The purified sialylated N-glycosylated Fn3 recombinant protein was desalted using a desalting column and stored at 4° C. for use.

[0045] At the same time, an Escherichia coli strain W3110 ΔnanKETA::Kan only carrying the vector pIG6-Fn3 and an Escherichia coli strain W3110 ΔnanKETA::Kan carrying the vector pIG6-Fn3 and the vector pC15-Ara-pglB-WecA-pglK-lsgCDEF were also incubated as control groups, and the specific steps were described as follows.

[0046] The vector pIG6-Fn3 was transferred into the Escherichia coli strain W3110 ΔnanKETA::Kan. The obtained transformant was inoculated on a LB plate containing kanamycin (15 μg/mL) and ampicillin (100 μg/mL), and incubated overnight at 37° C. for 12 hours. A monoclone was selected and inoculated into 3 mL of a LB liquid medium containing ampicillin (100 μg/mL), and then incubated at 220 rpm and 37° C. overnight. On the next day, the bacterial suspension at a ratio of 1:100 was inoculated into 500 mL of an auto-induction medium containing ampicillin (100 μg/mL), and incubated at 220 rpm and 25° C. for 40 hours.

[0047] The vector pIG6-Fn3 and the vector pC15-Ara-pglB-WecA-pglK-lsgCDEF were co-transferred into the Escherichia coli strain W3110 ΔnanKETA::Kan. The obtained transformant was inoculated on a LB plate containing kanamycin (15 μg/mL), ampicillin (100 μg/mL) and chloramphenicol (34 μg/mL), and incubated overnight at 37° C. for 12 hours. A monoclone was selected and inoculated into 3 mL of a LB liquid medium containing ampicillin (100 μg/mL) and chloramphenicol (34 μg/mL), and then incubated at 220 rpm and 37° C. overnight. On the next day, the bacterial suspension at a volume ratio of 1:100 was inoculated into 500 mL of an auto-induction medium containing ampicillin (100 μg/mL) and chloramphenicol (34 μg/mL), and incubated at 220 rpm and 25° C. for 40 hours, during which L-arabinose (200 μg/mL) was added as an inducer every 12 hours.

[0048] The cell collection, purification and desalination were the same as those mentioned in the preparation of the sialylated N-glycosylated Fn3 recombinant protein, and an unglycosylated Fn3 recombinant protein and an unsialylated N-glycosylated Fn3 recombinant protein were obtained, respectively.

[0049] The LB solid medium was prepared by dissolving 10 g/L of tryptone, 5 g/L of yeast extract, 10 g/L of sodium chloride and 15 g/L of agar powder in ddH.sub.2O.

[0050] The LB liquid medium was prepared by dissolving 10 g/L of tryptone, 5 g/L of yeast extract and 10 g/L of sodium chloride in ddH.sub.2O.

[0051] The auto-induction medium was prepared by dissolving 10 g/L of tryptone, 5 g/L of yeast extract, 5 g/L of glycerol, 0.5 g/L of glucose, 2 g/L of lactose, 7.1 g/L of disodium hydrogen phosphate, 6.8 g/L of potassium dihydrogen phosphate, 3.3 g/L of ammonium sulfate, 0.9 g/L of sodium sulfate and 0.25 g/L of magnesium sulfate heptahydrate in ddH.sub.2O.

Example 4 Detection of the Sialylated N-Glycosylated Recombinant Protein Produced in Escherichia coli

[0052] The sialylation of the recombinant protein was analyzed respectively by Western Blotting, lectin blot and mass spectrometry.

[0053] (1) In the Western Blotting analysis, an anti-FLAG M1 monoclonal antibody produced by Sigma-Aldrich LLC. (Germany) was used as a primary antibody, and a horseradish peroxidase-labeled goat anti-mouse IgG produced by Solarbio Life Sciences Co., Ltd. (Beijing, China) was used as a secondary antibody; the purified and desalted unglycosylated Fn3 recombinant protein and the unsialylated N-glycosylated Fn3 recombinant protein were used as negative controls to analyze the sialylated N-glycosylated Fn3 recombinant protein. The N-glycosylation and sialylation of the Fn3 recombinant protein were determined by comparing molecular mobilities. The results were shown in FIG. 4, from which it can be observed that the molecular weight of the Fn3 recombinant protein was increased after the N-glycosylation, and was further increased after the sialylation.

[0054] (2) With regard to the lectin blot detection, a lectin ECA (Catalog Number: H-5901-1) produced by EY Laboratories, Inc. (US) that specifically recognized Gal-β-1,4-GlcNAc and a lectin SNA-I (Catalog Number: H-6802-1) produced by EY Laboratories, Inc. (US) that specifically recognized Neu5Ac-α-2,6-Gal were used; the purified and desalted unglycosylated Fn3 recombinant protein and the unsialylated N-glycosylated Fn3 recombinant protein were used as negative controls to detect and analyze the sialylated N-glycosylated Fn3 recombinant protein. The detection result was shown in FIGS. 5A-5B. FIG. 5A illustrated the lectin blot detection results using the lectin ECA (Catalog Number: H-5901-1), in which a specific band was not detected in the purified and desalted unglycosylated Fn3 recombinant protein and the sialylated N-glycosylated Fn3 recombinant protein, whereas the specific band appeared in the unsialylated N-glycosylated Fn3 recombinant protein, proving that the Fn3 recombinant protein was N-glycosylated. FIG. 5B illustrated the lectin blot results using the lectin SNA-I (Catalog Number: H-6802-1), in which a specific band was not detected in the purified and desalted unglycosylated Fn3 recombinant protein and the unsialylated N-glycosylated Fn3 recombinant protein, whereas the specific band appeared in the sialylated N-glycosylated Fn3 recombinant protein, proving that the Fn3 recombinant protein was sialylated and N-glycosylated.

[0055] (3) Analysis of Composition of Sugar Chain of the Sialylated N-Glycosylated Fn3 Recombinant Protein

[0056] The composition analysis of the sugar chain was performed as follows. The purified and desalted sialylated N-glycosylated Fn3 recombinant protein obtained in Example 3 was digested with trypsin (promega V5280) and endoproteinase Glu-C (promega), and then qualitatively detected by a Thermo Orbitrap Exactive HF liquid chromatograph-mass spectrometer (LC-MS). The main glycoform involved in the modification was determined according to b and y ions of the secondary spectrogram and the match of mass number.

[0057] Detector: Thermool Orbitrap Exactive HF mass spectrometer (Thermo fisher).

[0058] Mobile phase: A: 0.1% formic acid+99.9% water; B: 99.9% acetonitrile+0.1% formic acid; flow rate: 0.6 μL/min. The analysis result was shown in FIGS. 6A-6B. The glycopeptide was IGGGGSDQNATK with a molecular weight of 1104.1, where I: isoleucine residue; G: glycine residue; S: serine residue; D: aspartic acid residue; Q: glutamine residue; N: asparagine residue; A: alanine residue; T: threonine residue; and K: lysine residue. The modification site was located at the asparagine residue. FIG. 6A showed specific peaks of NeuAc (molecular weight: 292.10), NeuAc-H.sub.2O (molecular weight: 274.09) and NeuAc(1)Hex(1)HexNAc(1) (molecular weight: 657.23). After deconvolution, a specific peak of a glycopeptide IGGGGSDQNATK carrying a glycan NeuAc(1)Hex(2)HexNAc(2) (molecular weight: 2125.89) was found in FIG. 6B. A glycopeptide IGGGGSDQNATK carrying glycan Hex(2)HexNAc(2) (molecular weight: 1634.79), a glycopeptide IGGGGSDQNATK carrying glycan Hex(1)HexNAc(1) (molecular weight: 1469.66) and a glycopeptide IGGGGSDQNATK carrying glycan HexNAc(1) (molecular weight: 1307.61) shown in FIG. 6A were obtained respectively after removing the NeuAc, Hex or HexNAc of the glycopeptide IGGGGSDQNATK carrying glycan NeuAc(1)Hex(2)HexNAc(2). According to the results of the mass spectrometry analysis, the Western Blotting detection and the lectin blot detection, it was verified that the terminally sialylated oligosaccharide chain of the modified Fn3 recombinant protein was Neu5Ac-Gal-β-1,4-GlcNAc-β-1,3-Gal-β-1,3-GlcNAc.

[0059] The embodiments demonstrate that the method provided herein for producing a sialylated N-glycosylated recombinant protein in periplasm of a recombinant Escherichia coli is simple and efficient, and the production cost is low, providing a technical support for producing a more stable therapeutic protein drug or a polysaccharide vaccine.

[0060] Described above are merely preferred embodiments, and other embodiments can be made according to the common technical knowledge and general methods in the field without departing from the spirit of this disclosure. Modifications, replacements and variations made by those skilled in the art according to the technical solutions and the spirit of this disclosure, such as using other Escherichia coli expression vectors, sialytransferase genes with the same function and receptor protein expression genes to produce sialylated N-glycosylated recombinant protein in the Escherichia coli, should fall within the scope of the present disclosure defined by the appended claims.