METHOD OF DIFFERENTIATION INTO MESENCHYMAL STEM CELLS THROUGH CONTINUOUS SUBCULTURE OF DEDIFFERENTIATED STEM CELLS

Abstract

The present invention relates to a medium for inducing differentiation of dedifferentiated stem cells into mesenchymal stem cells, a method for preparing mesenchymal stem cells from dedifferentiated stem cells by using the same, and mesenchymal stem cells prepared by using the same. The mesenchymal stem cells prepared using the above medium and method can be differentiated into various target cells, and thus can be useful as a cell therapeutic agent for congenital and acquired musculoskeletal diseases and injuries.

Claims

1. A medium for inducing differentiation of dedifferentiated stem cells into mesenchymal stem cells, the medium comprising glucose, insulin, selenium, transferrin, and vascular endothelial growth factor (VEGF).

2. The medium for inducing differentiation of claim 1, wherein the dedifferentiated stem cells are derived from adipose tissue, bone marrow, umbilical cord blood, or a placenta.

3. The medium for inducing differentiation of claim 1, wherein the dedifferentiated stem cells are derived from a horse, a dog, a cat, a fetus a calf, a human, or a mouse.

4. The medium for inducing differentiation of claim 1, wherein the glucose is included in an amount of 100 mg/L to 10000 mg/L, the insulin is included in an amount of 0.3 mg/L to 30 mg/L, the transferrin is included in an amount of 0.27 mg/L to 27 mg/L, the selenium is included in an amount of 0.0000003 mg/L to 0.00003 mg/L, and the VEGF is included in an amount of 0.001 mg/L to 0.1 mg/L.

5. The medium for inducing differentiation of claim 1, comprising biotin and niacin.

6. The medium for inducing differentiation of claim 5, wherein the biotin is included in an amount of 0.01 mg/L to 1.0 mg/L and the niacin is included in an amount of 0.1 mg/L to 10 mg/L.

7. A method of preparing mesenchymal stem cells from dedifferentiated stem cells, the method comprising: introducing a dedifferentiation inducer protein or a polynucleotide that encodes them into isolated somatic cells or isolated adult stem cells to induce dedifferentiation of stem cells from the isolated somatic cells or the isolated adult stem cells; and culturing the induced dedifferentiated stem cells in the medium for inducing differentiation of claim 1 to induce differentiation of mesenchymal stem cells from dedifferentiated stem cells.

8. The method of claim 7, wherein the dedifferentiated stem cells are derived from adipose tissue, bone marrow, umbilical cord blood, or a placenta.

9. The method of claim 7, wherein the dedifferentiated stem cells are derived from a horse, a dog, a cat, a fetus, a calf, a human, or a mouse.

10. The method of claim 7, wherein the inducing of differentiation into mesenchymal stem cells is to perform subculture for 1 passage to 25 passages.

11. The method of claim 7, wherein the inducing of differentiation into mesenchymal stem cells is cultured for 2 days to 80 days.

12. A mesenchymal stem cell prepared by the method of claim 7.

13. The mesenchymal stem cell of claim 12, wherein the mesenchymal stem cell has surface antigenic characteristics of CD29.sup.+ and CD44.sup.+.

Description

BRIEF DESCRIPTION OF DRAWINGS

[0060] FIG. 1A shows optical microscopy images of a differentiation process of stem cells dedifferentiated into mesenchymal stem cells, wherein DT represents a period of differentiation into mesenchymal stem cells, and P represents a passage number; FIG. 1B shows optical microscopy images of differentiated stem cells at 7 passages and 35 days post-differentiation of stem cells dedifferentiated into mesenchymal stem cells; FIG. 1C shows optical microscopy images of differentiated stem cells at 14 passages and 70 days post-differentiation of stem cells dedifferentiated into mesenchymal stem cells;

[0061] FIG. 2 shows real-time PCR (RT-PCR) results of examining mRNA levels of CD44 and CD29 in equine dedifferentiated stem cells (equine induced pluripotent stem cell: E-iPS), equine adipose-derived mesenchymal stem cells (E-ASC), and mesenchymal stem cells differentiated from equine dedifferentiated stem cells (differentiated mesenchymal stem cells derived from equine induced pluripotent stem cell: Df-E-iPS);

[0062] FIG. 3 shows RT-PCR results of examining mRNA levels of OCT4 and Nanog in equine dedifferentiated stem cells (E-iPS), equine adipose-derived mesenchymal stem cells (E-ASC), and mesenchymal stem cells differentiated from equine dedifferentiated stem cells (Df-E-iPS); and

[0063] FIG. 4 shows fluorescence activated cell sorting (FACS) results of examining expression of cell surface markers CD44 and CD29 in equine dedifferentiated stem cells (E-iPS), equine adipose-derived mesenchymal stem cells (E-ASC), and mesenchymal stem cells differentiated from equine dedifferentiated stem cells (Df-E-iPS).

BEST MODE

[0064] Hereinafter, preferred examples will be provided for better understanding of the present disclosure. However, the following examples are provided only for understanding the present disclosure more easily, but the content of the present disclosure is not limited thereby.

Example 1. Preparation of Dedifferentiated Stem Cells and Induction of Differentiation of Dedifferentiated Stem Cells into Mesenchymal Stem Cells Using Medium for Inducing Differentiation

[0065] 1. Preparation of Dedifferentiated Stem Cells from Equine Adipose Tissue

[0066] An adipose tissue collected from an 8-month-old horse was washed with Dulbecco's Phosphate-buffered saline (DPBS) (GeneDEPOT) and 70% ethanol (Duksan Pure Chemicals). The adipose tissue was minced using a razor blade, and put in PBS containing 0.2% type I collagenase (Worthington Biochemical), and allowed to digest in an incubator at 37° C. for 10 minutes. The digested tissue was passed through a 70-μm nylon cell strainer (SPL Life Sciences), and a cell pellet was resuspended and washed with PBS to isolate equine adipose tissue-derived adult stem cells. The isolated equine adipose tissue-derived stem cells were incubated in a medium containing low-glucose Dulbecco's modified Eagle's medium (DMEM), 10% fetal bovine serum (FBS), and 1% penicillin/streptomycin under conditions of 37° C. and 5% CO.sub.2. The equine adipose tissue-derived adult stem cells were subcultured once. At 1.sup.st passage (1 day prior to transduction), 1×10.sup.5 cells were seeded on a 100 mm dish coated with 0.1% gelatin.

[0067] For transduction of Yamanaka factors Oct4, Sox2, KIF4, and c-Myc using lentivirus, 293FT cell line was transduced with TetO-FUW-OSKM plasmid (ADDGENE #20321) or FUW-M2rtTA plasmid (ADDGENE #20342) using a Virapower packaging mix (Invitrogen) according to the manufacturer's instructions. Thereafter, the supernatant was collected and filtered with a 0.45 μm filter (Millipore) to remove cell debris. 10 μg/ml polybrene (Sigma) was added thereto, followed by transduction for 24 hours. After completing transduction, the medium was replaced by a medium containing high glucose DMEM, 10% FBS, and penicillin/streptomycin, followed by incubation for 24 hours. Thereafter, the transduced adipose tissue-derived adult stem cells were transferred onto a feeder, of which growth was inhibited with mitomycin C, and cultured for 30 days in a medium (hereinafter, referred to as ESC medium) containing high glucose DMEM, 20% FBS, 1% GlutaMAX, 1% MEM-non-essential amino (MEM-NEAA), 1% penicillin/streptomycin, leukemic inhibitory factor (LIF) (1000 units/ml), and 0.1% mercaptoethanol, the medium mixed with 2 μg/ml doxycycline, while replacing this medium every other day. At 18 days or 30 days post-transduction, colonies having morphology similar to human embryonic stem cells were collected from the ESC medium, and transferred onto a new feeder and subcultured in ESC medium containing 2 μg/ml doxycycline to prepare equine dedifferentiated stem cells.

[0068] 2. Induction of Differentiation of Dedifferentiated Stem Cells into Mesenchymal Stem Cells Using Medium for Inducing Differentiation of Mesenchymal Stem Cells (MSCs)

[0069] The equine dedifferentiated stem cells established in 1 were detached from the culture plate by reacting with a 10 mg/mL type IV collagenase solution at 37° C. for 10 minutes, and seeded at a density of 1×10.sup.4 cells/cm.sup.2 on a 100 mm dish coated with 0.1% gelatin. A basic medium was mixed with 3 mg/L insulin, 0.000003 mg/L sodium selenite, 2.7 mg/L transferrin, 0.01 mg/L VEGF, 0.1 mg/L biotin, 1 mg/L niacinamide, and 1000 mg/L D-glucose, and FBS was added at a volume of 5% with respect to the total volume to prepare a medium for inducing MSC differentiation (hereinafter, referred to as a medium for inducing MSC differentiation)

TABLE-US-00001 TABLE 1 Basic medium Inorganic salts (mg/L) CaCl.sub.2 (anhyd.) 200 KCl 400 MgSO.sub.4 (anhyd.) 98 NaCl 6,500 NaH.sub.2PO.sub.4H.sub.2O 140 Vitamin (mg/L) L-ascorbic acid 67 D-Ca pantothenate 1 Choline chloride 1 Folic acid 1 i-inositol 2 Pyridoxal HCl 1 Riboflavin 0.1 Thiamine HCl 4 Vitamin B12 1.4 Ribonucleoside (mg/L) Adenosine 10 Cytidine 10 Guanosine 10 Uridine 10 Deoxyribonucleoside (mg/L) 2′Deoxyadenosine 10 2′Deoxycytidine••HCl 10 2′Deoxyguanosine 10 Thymidine 10 Other components (mg/L) AlbuMAX 1 4000 Lipoic acid 0.2 Reduced glutathione 0.5 Sodium pyruvate 110

[0070] The equine dedifferentiated stem cells were differentiated and proliferated while culturing the cells in the medium for inducing MSC differentiation. In detail, the medium for inducing MSC differentiation was replaced once every 1 day to 4 days without cell washing. At this time, when the cultured cells occupied 80% to 90% of the area of the culture plate, i.e., confluency reached 80% to 90%, subculture was performed. After washing with PBS, subculture was performed by adding TrypLE select (Thermo Fisher) and reacting for 5 minutes under conditions of 37° C. and 5% CO.sub.2. Subsequently, the solution in which TrypLE select and the cells were mixed was centrifuged and resuspended, and then seeded on a dish coated with 0.1% gelatin. Serial passaging was continuously performed to passage 25 using the medium for inducing MSC differentiation, thereby obtaining cells differentiated into mesenchymal stem cells. The cells differentiated into mesenchymal stem cells thus obtained were cultured not on the dish coated with 0.1% gelatin but on a general cell culture dish.

[0071] 3. Confirmation of Differentiation of Dedifferentiated Stem Cells into Mesenchymal Stem Cells

[0072] (3.1) Confirmation of Morphological Changes of Differentiated Cells

[0073] Morphological changes of the dedifferentiated stem cells obtained in 1 were examined during differentiation into mesenchymal stem cells in the medium for inducing MSC differentiation.

[0074] FIG. 1A shows images of optical microscopy of the differentiation process of dedifferentiated stem cells into mesenchymal stem cells. DT represents a period of differentiation into mesenchymal stem cells, and P represents the passage number. FIG. 1B shows images of optical microscopy of differentiated stem cells at 7 passages post-differentiation of dedifferentiated stem cells into mesenchymal stem cells. FIG. 1C shows images of optical microscopy of differentiated stem cells at 14 passages post-differentiation of dedifferentiated stem cells into mesenchymal stem cells. As shown in FIG. 1, on day 5 post-differentiation (early stage of differentiation) of culturing and proliferating equine dedifferentiated stem cells in the medium for inducing MSC differentiation, large round nucleus and small cytoplasm were observed. As the differentiation progressed, shining cells began to appear on day 10 post-differentiation at passage 1. The shining cells had spindle-shaped nuclei and cytoplasm, and showed a high cytoplasmic ratio. Such morphological characteristics of nucleus and cytoplasm were maintained even after subculture. Further, when subculture was performed while culturing in the medium for inducing MSC differentiation, undifferentiated cells and aged cells were removed, and purity of the cells differentiated into mesenchymal stem cells was increased. At passage 7, a large number of shining cells having spindle-shaped nuclei and cytoplasm appeared.

[0075] (3.2) Confirmation of CD29 and CD44 Expression in Differentiated Cells

[0076] To characterize the mesenchymal stem cells obtained in 2, which were differentiated from dedifferentiated stem cells, mRNA levels of CD29 and CD44 were examined.

[0077] Among the mesenchymal stem cells obtained in 2, mesenchymal stem cells at passage 7 were seeded on a 35 mm dish. When the culture cells occupied about 90% of the area of 35 mm dish, TRIzol and phenol/chloroform were added to the cells to isolate RNA from the cells. Subsequently, reverse transcription of the isolated RNA was performed to synthesize cDNA. Thereafter, RT-PCR was performed using cDNA as a template and a set of primers each specific to CD29 and CD44. Subsequently, PCR products were loaded on a 1.5% agarose gel, followed by electrophoresis. FIG. 2 shows RT-PCR results of examining mRNA levels of CD44 and CD29 in equine dedifferentiated stem cells, equine adipose-derived mesenchymal stem cells, and mesenchymal stem cells differentiated from equine dedifferentiated stem cells. As shown in FIG. 2, no CD29 and CD44 expression was observed in dedifferentiated stem cells, whereas high CD29 and CD44 expression was observed in differentiated mesenchymal stem cells obtained in 2. The expression levels were similar to those of equine adipose-derived stem cells as a positive control.

TABLE-US-00002 TABLE 2 Forward primer Reverse primer CD44 ATCCTCACGTCCAACACCCTC CTCGCCTTTCTGGTGTAGC (SEQ ID NO: 1) (SEQ ID NO: 2) CD29 GATGCCGGGTTTCACTTTGC TTCCCCTGTTCCATTCACCC (SEQ ID NO: 3) (SEQ ID NO: 4)

[0078] (3.3) Confirmation of OCT4 and Nanog Expression in Differentiated Cells

[0079] To characterize the mesenchymal stem cells obtained in 2, which were differentiated from dedifferentiated stem cells, mRNA levels of OCT4 and Nanog which are pluripotency markers were examined.

[0080] RT-PCR was performed in the same manner as in 3.1., except that a set of primers each specific to OCT4 and Nanog were used. Subsequently, PCR products were loaded on a 1.5% agarose gel, followed by electrophoresis. FIG. 3 shows PCR results of examining mRNA levels of OCT4 and Nanog in equine dedifferentiated stem cells, equine adipose-derived mesenchymal stem cells, and mesenchymal stem cells differentiated from equine dedifferentiated stem cells. As shown in FIG. 3, strong OCT4 and Nanog expression was observed in equine dedifferentiated stem cells, whereas OCT4 and Nanog expression was hardly observed in differentiated mesenchymal stem cells obtained in 2. The expression showed patterns similar to those of equine adipose-derived stem cells. When equine dedifferentiated stem cells were differentiated into mesenchymal stem cells in the medium for inducing differentiation, loss of pluripotency markers was observed.

TABLE-US-00003 TABLE 3 Forward primer Reverse primer OCT4 GGGACCTCCTAGTGGGTCA TGGCAAATTGCTCGAGGTCT (SEQ ID NO: 5) (SEQ ID NO: 6) Nanog TCCTCAATGACAGATTTCAGAGA GAGCACCAGGTCTGACTGTT (SEQ ID NO: 7) (SEQ ID NO: 8)

[0081] (3.4) Confirmation of CD44 and CD29 Expression on Surface of Differentiated Cells

[0082] To characterize the mesenchymal stem cells obtained in 2, which were differentiated from dedifferentiated stem cells, CD44 and CD29 expression on the cell surface was examined by flow cytometry.

[0083] At passage 7 of the mesenchymal stem cells obtained in 2, 1.5×10.sup.5 cells were suspended in 200 μl of PBS, and 2 μl of anti-human CD44-PE (Phycoerythrin) (eBioscience) as a primary antibody was added and allowed to react at 4° C. for 30 minutes. Subsequently, the cells were centrifuged at 2000 rpm for 5 minutes, and washed with PBS. Then, cell surface markers were examined using BD aria FACS. A group to which the antibody was not added was used as a control. FIG. 4 shows FACS results of examining expression of cell surface marker CD44 in equine dedifferentiated stem cells, equine adipose-derived mesenchymal stem cells, and mesenchymal stem cells differentiated from equine dedifferentiated stem cells. As shown in FIG. 4, equine dedifferentiated stem cells were negative for CD44 whereas 99.6% of the mesenchymal stem cells differentiated from equine dedifferentiated stem cells by the medium for inducing MSC dedifferentiation were positive for CD44. This was similar to the result that 99.2% of equine adipose tissue-derived stromal cells as a positive control were positive for CD44. This was consistent with the previous RT-PCR results in 3.2.

[0084] At passage 22 of the mesenchymal stem cells obtained in 2, 1.5×10.sup.5 cells were suspended in 200 μl of PBS, and 2 μl of anti-mouse CD29-PE (Phycoerythrin) (eBioscience) as a primary antibody was added and allowed to react at 4° C. for 30 minutes. Subsequently, the cells were centrifuged at 2000 rpm for 5 minutes, and washed with PBS. Then, cell surface markers were examined using BD aria FACS. A group to which the antibody was not added was used as a control. FIG. 4 shows FACS results of examining expression of the cell surface marker CD29 in equine dedifferentiated stem cells, equine adipose-derived mesenchymal stem cells, and mesenchymal stem cells differentiated from equine dedifferentiated stem cells. As shown in FIG. 4, the equine dedifferentiated stem cells were negative for CD29 whereas 99.8% of the mesenchymal stem cells differentiated from equine dedifferentiated stem cells by the medium for inducing MSC dedifferentiation were positive for CD29. This was a value of purity similar to or higher than the result that 97.3% of equine adipose tissue-derived stromal cells as a positive control were positive for CD29. This was also consistent with the previous RT-PCR results in 3.2.