RECOMBINANT BACILLUS SUBTILIS FOR INCREASING YIELD OF MENAQUINONE 7 AND APPLICATION THEREOF

20210261910 · 2021-08-26

Assignee

Inventors

Cpc classification

International classification

Abstract

The present disclosure provides a recombinant Bacillus subtilis for increasing the yield of menaquinone 7 (MK-7) and application thereof, and belongs to the field of genetic engineering. In the present disclosure, 14 recombinant strains BS1-BS14 are constructed through the modification of genes related to the biosynthetic pathway of MK-7 on a chromosome of Bacillus subtilis, wherein BS6-BS14 significantly increase the yield of the MK-7, reaching up to 33.5 mg/L, which is 3.53 times the yield of the original strain of wild-type Bacillus subtilis 168. The present disclosure further provides a method for modifying the MK-7 biosynthetic pathway in microorganisms to increase the yield of the MK-7, providing a theoretical basis for constructing a high-yielding strain of the MK-7.

Claims

1. A recombinant Bacillus subtilis for increasing the yield of menaquinone 7, c wherein Bacillus subtilis 168 is taken as an original strain; natural promoters of a menaquinone-specific isochorismate synthase gene menF and a dihydroxynaphthoic acid synthetase gene menB on a chromosome are replaced with P.sub.43 promoters; natural promoters of an O-succinylbenzoic acid-CoA ligase gene menE and a transketolase gene tkt on the chromosome are replaced with P.sub.hbs promoters; an exogenous isochorismate synthase gene entC and an exogenous phosphoenolpyruvate synthetase gene ppsA are expressed on the chromosome with P.sub.43 promoters, and a phosphotransferase system (PTS) glucose-specific enzyme IICBA component gene ptsG on the chromosome is knocked out; the sequence of the P.sub.43 promoter is shown in SEQ ID NO. 3; and the sequence of the P.sub.hbs promoter is shown in SEQ ID NO. 5.

2. The recombinant Bacillus subtilis according to claim 1, wherein the sequence of the menF gene is shown in genebank ID: 937190; the sequence of the menB gene is shown in genebank ID: 937195; the sequence of the menE gene is shown in genebank ID: 937132; the sequence of the tkt gene is shown in genebank ID: 937377; the sequence of the entC gene is shown in genebank ID: 945511; the sequence of the ppsA gene is shown in genebank ID: 946209; and the sequence of the ptsG gene is shown in genebank ID: 939255.

3. The recombinant Bacillus subtilis according to claim 1, wherein the recombinant strain is modified on the basis of claim 1 as follows: an exogenous aroG.sup.fbr gene is expressed on the chromosome with the P.sub.hbs promoter; and the sequence of the aroG.sup.fbr gene is shown in SEQ ID NO. 6.

4. The recombinant Bacillus subtilis according to claim 3, wherein the recombinant strain is modified on the basis of claim 3 as follows: natural promoter of a shikimate kinase gene aroK on the chromosome is replaced with the P.sub.43 promoter.

5. The recombinant Bacillus subtilis according to claim 4, wherein the recombinant strain is modified on the basis of claim 4 as follows: natural promoter of a farnesyl diphosphate synthase gene ispA on the chromosome of Bacillus subtilis is replaced with the P.sub.hbs promoter.

6. The recombinant Bacillus subtilis according to claim 5, wherein the recombinant strain is modified on the basis of claim 5 as follows: natural promoter of a heptaprenyl diphosphate synthase component I (hepS/T, genebank ID: 938998) gene on the chromosome of Bacillus subtilis is replaced with the P.sub.43 promoter.

7. The recombinant Bacillus subtilis according to claim 6, wherein the recombinant strain is modified on the basis of claim 6 as follows: an exogenous 2-dehydro-3-deoxy-phosphogluconate aldolase gene kdpG is expressed on the chromosome with the P.sub.hbs promoter.

8. The recombinant Bacillus subtilis according to claim 7, wherein the recombinant strain is modified on the basis of claim 7 as follows: natural promoter of a 1-deoxy-D-xylulose-5-phosphate reductoisomerase gene dxr on the chromosome of Bacillus subtilis is replaced with the P.sub.43 promoter.

9. The recombinant Bacillus subtilis according to claim 8, wherein the recombinant strain is modified on the basis of claim 8 as follows: natural promoter of a 1-deoxyxylulose-5-phosphate synthase gene dxs on the chromosome is replaced with the P.sub.43 promoter.

10. The recombinant Bacillus subtilis according to claim 9, wherein the recombinant strain is modified on the basis of claim 9 as follows: natural promoter of a gene in an isopentenyl diphosphate isomerase (type II) (fni, genebank ID: 938985) on the chromosome of Bacillus subtilis is replaced with the P.sub.43 promoter.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0032] FIG. 1: BS1 colony PCR verification result; M: marker; 1: colony PCR result; and 2: colony PCR result.

[0033] FIG. 2: Synthesis pathway of MK-7 in Bacillus subtilis.

[0034] FIG. 3: The effect of enhanced enzyme expression level in the MK-7 synthesis pathway on the yield.

[0035] FIG. 4: The effect of enhanced chorismate pathway on the yield of MK-7.

[0036] FIG. 5: The effect of enhanced isoprene synthesis on the yield of MK-7.

[0037] FIG. 6: Analysis on the relative expression of overexpressed genes.

DESCRIPTION OF THE EMBODIMENTS

[0038] MK-7 detection method: A mixture of isopropanol and n-hexane (1:2 v/v) 4 times fermentation broth is added to the fermentation broth, vortex shaking is performed for 30 min for extraction, and the extract is filtered out and centrifuged at 8,000 r/min for 15 min. The supernatant is collected. At this time, MK-7 is dissolved in the phase, and the supernatant is placed in a refrigerator at −80° C. for freezing to remove lipid crystals. The filtrate is collected and the content of the MK-7 is detected by HPLC.

[0039] Detection of MK-7 yield by HPLC: An Agilent ZORBAX EclipseXDB-C18 separation column (5 μm, 250×4.6 mm) is used, the detection temperature is 40° C., the mobile phase uses methanol and dichloromethane (9:1, v/v), the flow rate is 1 mL/min, the detection wavelength is 254 nm, and the injection volume is 10 μL.

EXAMPLE 1

Construction of Recombinant Strain BS1

[0040] The natural promoter of menF on the chromosome of Bacillus subtilis was replaced with a constitutive promoter P.sub.43 to enhance expression of a menaquinone-specific isochorismate synthase (menF, genebank ID: 937190) gene. An unmarked genetic modification strategy was used, referring to the article (Yan, X., Yu, H.-J., Hong, Q., Li, S. P., 2008. Cre/lox system and PCR-based genome engineering in Bacillus subtilis. Appl Environ Microb. 74, 5556-5562). The specific construction process was as follows:

[0041] (1) Gene Cloning

[0042] I. The genome of Bacillus subtilis 168 was used as a template, and primers menF-up.FOR and menF-up.REV were used for amplification to obtain the upstream homologous arm sequence menF-up (with the sequence shown in SEQ ID NO. 1) of the menF gene.

[0043] II. A lox71-zeo-lox66 cassette containing a bleomycin gene (with the sequence shown in SEQ ID NO. 2) was artificially synthesized.

[0044] III. The genome of Bacillus subtilis 168 was used as a template, and primers P.sub.43. For and P.sub.43.Rev were used for amplification to obtain the P.sub.43 promoter sequence (with the sequence shown in SEQ ID NO. 3).

[0045] IV. The genome of Bacillus subtilis 168 was used as a template, and primers menF.FOR and menF.REV were used for amplification to obtain the menF gene segment (with the sequence shown in SEQ ID NO. 4).

[0046] (2) Obtaining of Fused Segment

[0047] Overlap extension PCR was performed on the four segments: the menF-up, the lox71-zeo-lox66 cassette, the P.sub.43 promoter sequence, and the menF gene segment obtained in step (1). The PCR conditions were as follows: pre-denaturation was performed at 98° C. for 5 min; then denaturation was performed at 98° C. for 10 s; annealing was performed at 55° C. for 5 s; extension was performed at 72° C. for 2 min; and a total of 30 cycles were performed. The segments of the correct size were recovered by gel extraction to obtain the fused gene segment menF.sub.up-lox71-zeo-lox66-P.sub.43-menF.

[0048] (3) Homologous Recombination

[0049] The fused segment obtained in step (2) was transformed into the competent cell of the wild-type strain Bacillus subtilis 168. Since the upstream sequence of menF existing in the fused segment was genetically homologous to the upstream sequence of menF on the chromosome of Bacillus subtilis 168, and the menF gene existing in the fused segment was genetically homologous to the menF gene on the chromosome of Bacillus subtilis 168, through homologous recombination, the natural promoter of the menF gene on the chromosome of Bacillus subtilis 168 was replaced with the bleomycin resistance gene zeo and the P.sub.43 promoter in the fused segment. The specific steps were as follows:

[0050] I. The fused segment constructed in step (2) was electro-transformed into competent cells of Bacillus subtilis 168, and the amount of the fused segment added was 100-300 ng. The electro-transformation conditions were as follows: the voltage was 2.5 kV, the electric shock time was 5 ms, resuscitation was performed at 37° C. for 5 h, the Bacillus subtilis 168 was spread on a bleomycin-resistant LB plate with a final concentration of 10 μg/mL, and anaerobic culture was performed at 37° C. for 48 h. The Bacillus subtilis positive in bleomycin resistance was successfully transformed.

[0051] II. The single colony growing on the plate was selected, and primers BS1 YZ.FOR and BS1 YZ.REV were used for verifying the colony by PCR. After replacement, the amplified segment length was 1,350 bp (see FIG. 1). Sequencing was performed, and if the sequence was correct, the natural promoter of the menF gene on the chromosome of Bacillus subtilis 168 was successfully replaced with the lox71-zeo-lox66-P.sub.43 fused gene. Finally, through a Cre/lox recombination system, the bleomycin resistance gene zeo was knocked out, and finally a strain Bacillus subtilis 168, P.sub.43-menF was obtained, named BS1.

TABLE-US-00003 TABLE 3 Primer sequence list Primer Sequence (5′-3′) No. menF- GCATTCATCGTCATATCATCATAGCTGAGC SEQ ID  up.FOR NO. 7 menF- TGTGAAATTGTTATCCGCTCGAGACATTCCT SEQ ID  up.REV CCATAATCCTTAAAATGCTTTTAATACC NO. 8 P43.For TGATAGGTGGTATGTTTTCGCTTGAAC SEQ ID  NO. 9 P43.Rev GTGTACATTCCTCTCTTACCTATAATGG SEQ ID  NO. 10 menF.FOR TTTAAGGATTATGGAGGAATGTCTCGAGCG SEQ ID  GATAACAATTTCACACAGGAAAC NO. 11 menF.REV AATCATACCTACCACAATATCATGCTCAAG SEQ ID  NO. 12 BS1  TTCCATATCCTGCGGCGTTTGT SEQ ID  YZ.For NO. 13 BS1  ACGAAGTTATTCAGTCCTGCTCCTC SEQ ID  YZ.Rev NO. 14

EXAMPLE 2

Construction of Recombinant Strain BS2

[0052] On the basis of the strain BS1 obtained in Example 1, by using the method similar to that in Example 1, the natural promoter of the dihydroxynaphthoic acid synthetase (menB, genebank ID: 937195) gene on the chromosome of Bacillus subtilis 168 was replaced with a P.sub.43 promoter. The specific construction process was as follows:

[0053] (1) Obtaining of Fused Segment

[0054] The genome of Bacillus subtilis 168 was used as a template, and the upstream homologous arm sequence menB-up and the menB gene segment of the menB gene, and the P.sub.43 promoter sequence were amplified separately. A lox71-zeo-lox66 cassette sequence (with the sequence shown in SEQ ID NO. 2) was artificially synthesized. Then overlap extension PCR was performed on the four segments: the menB-up, the lox71-zeo-lox66 cassette, the P.sub.43 promoter sequence, and the menB gene segment to obtain a fused gene segment menB.sub.up-lox71-zeo-lox66-P.sub.43-menB.

[0055] (2) Homologous Recombination

[0056] The fused segment obtained in step (1) was transformed into the competent cells of BS1, and the BS1 was spread on a bleomycin-resistant LB plate. The single colony growing on the plate was selected, and PCR verification and sequencing were performed on the colony. Finally, through the Cre/lox recombination system, the bleomycin resistance gene zeo in the strain was knocked out, and finally a Bacillus subtilis 168, P.sub.43-menF P.sub.43-menB was obtained, named BS2.

EXAMPLE 3

Construction of Recombinant Strain BS3

[0057] On the basis of the strain BS2 obtained in Example 2, by using the method similar to that in Example 1, the natural promoter of an O-succinylbenzoic acid-CoA ligase (menE, genebank ID: 937132) gene in Bacillus subtilis was replaced with a P.sub.hbs promoter (with the sequence shown in SEQ ID NO. 5). The specific construction process was as follows:

[0058] (1) Obtaining of Fused Segment

[0059] The genome of Bacillus subtilis 168 was used as a template, and the upstream homologous arm sequence menE-up and the menE gene segment of the menE gene, and the P.sub.hbs promoter sequence were amplified separately. A lox71-zeo-lox66 cassette sequence (with the sequence shown in SEQ ID NO. 2) was artificially synthesized. Then overlap extension PCR was performed on the four segments: the menE-up, the lox71-zeo-lox66 cassette, the P.sub.hbs promoter sequence, and the menE gene segment to obtain a fused gene segment menE.sub.up-lox71 -zeo-10x66-P.sub.hbs-menE.

[0060] (2) Homologous Recombination

[0061] The fused segment obtained in step (1) was transformed into the competent cells of BS2. Then, through the Cre/lox recombination system, the bleomycin resistance gene zeo in the strain was knocked out to obtain a strain Bacillus subtilis 168, P.sub.43-menF P.sub.43-menB P.sub.hbs-menE, named BS3.

EXAMPLE 4

Construction of Recombinant Strain BS4

[0062] On the basis of the strain BS3 obtained in Example 3, by using the method similar to that in Example 1, an isochorismatase (siderophore specific) (dhbB, genebank ID: 936582) gene on the chromosome of Bacillus subtilis was replaced with an isochorismate synthase (entC, genebank ID: 945511) gene derived from E. coli K12 and containing a P.sub.43 promotor. The specific construction process was as follows:

[0063] (1) Obtaining of Fused Segment

[0064] The genome of Bacillus subtilis 168 was used as a template, and the upstream homologous arm sequence dhbB-up of the dhbB gene, the downstream homologous arm sequence dhbB-down of the dhbB and the P.sub.43 promoter sequence were amplified separately. A lox71-zeo-lox66 cassette sequence (with the sequence shown in SEQ ID NO. 2) was artificially synthesized. The genome of E. coli K12 was used as a template, and the entC gene sequence was amplified. Then overlap extension PCR was performed on the five segments: the dhbB-up, the lox71-zeo-lox66 cassette, the P.sub.43 promoter sequence, the entC gene sequence, and the dhbB-down gene segment to obtain a fused gene segment dhbB.sub.up-lox71-zeo-lox66-P.sub.43-entC-dhbB.sub.down.

[0065] (2) Homologous Recombination

[0066] The fused segment obtained in step (1) was transformed into the competent cells of BS3. Then, through the Cre/lox recombination system, the bleomycin resistance gene zeo in the strain was knocked out to obtain a strain Bacillus subtilis 168, P.sub.43-menF P.sub.43-menB P.sub.hbs-menE P.sub.43-entC ΔdhbB, named BS4.

EXAMPLE 5

Construction of Recombinant Strain BS5

[0067] On the basis of the strain BS4 obtained in Example 4, by using the method similar to that in Example 1, the natural promoter of a transketolase (tkt, genebank ID: 937377) gene on the chromosome of Bacillus subtilis was replaced with a P.sub.hbs promoter. The specific construction process was as follows:

[0068] (1) Obtaining of Fused Segment

[0069] The genome of Bacillus subtilis 168 was used as a template, and the upstream homologous arm sequence tkt-up and the tkt gene segment of the tkt gene, and the P.sub.hbs promoter sequence were amplified separately. A lox71-zeo-lox66 cassette sequence (with the sequence shown in SEQ ID NO. 2) was artificially synthesized. Then overlap extension PCR was performed on the four segments: the tkt-up, the lox71-zeo-lox66 cassette, the P.sub.hbs promoter sequence, and the tkt gene segment to obtain a fused gene segment tkt.sub.up-lox71-zeo-lox66-P.sub.hbs-tkt.

[0070] (2) Homologous Recombination

[0071] The fused segment obtained in step (1) was transformed into the competent cells of BS4. Then, through the Cre/lox recombination system, the bleomycin resistance gene zeo in the strain was knocked out to finally obtain a strain Bacillus subtilis 168, P.sub.43-menF P.sub.43-menB P.sub.hbs-menE P.sub.43-entC ΔdhbB P.sub.hbs-tkt, named BSS.

EXAMPLE 6

Construction of Recombinant Strain BS6

[0072] On the basis of the strain BS5 obtained in Example 5, by using the method similar to that in Example 1, a phosphoenolpyruvate synthetase (ppsA, genebank ID: 946209) gene derived from E. coli K12 and containing a P.sub.43 promotor was integrated between an N-acetylmuramic acid deacetylase (yjeA, genebank ID: 936440) gene and a yjfA (genebank ID: 939830) gene on the chromosome of Bacillus subtilis, and a phosphotransferase system (PTS) glucose-specific enzyme IICBA component (ptsG, genebank ID: 939255) gene on the chromosome was knocked out. The specific construction process was as follows:

[0073] (1) Obtaining of Fused Segment

[0074] The genome of E. coli K12 was used as a template, and the ppsA gene was amplified. The genome of Bacillus subtilis 168 was used as a template, and the yjeA gene, the yjfA gene and the P.sub.43 promoter sequence were amplified separately. A lox71-zeo-lox66 cassette sequence (with the sequence shown in SEQ ID NO. 2) was artificially synthesized. Then overlap extension PCR was performed on the five segments: the yjeA, the lox71-zeo-lox66 cassette, the P.sub.43, the ppsA, and the yjfA to obtain a fused gene segment yjeA-lox71-zeo-10x66-P.sub.43-ppsA-yjfA.

[0075] The genome of Bacillus subtilis 168 was used as a template, and the upstream homologous arm ptsG-up and downstream homologous arm ptsG-down of the ptsG were amplified separately. Overlap extension PCR was performed on the ptsG-up, the lox71-zeo-lox66 and the ptsG-down to obtain a fused gene segment ptsG.sub.up-lox71-zeo-lox66-ptsG.sub.down.

[0076] (2) Homologous Recombination

[0077] The fused segments yjeA-lox71-zeo-10x66-P.sub.43-ppsA-yjfA and ptsG.sub.up-lox71-zeo-lox66-ptsG.sub.down obtained in step (1) were both transformed into the competent cells of BS5. Then, through the Cre/lox recombination system, the bleomycin resistance gene zeo in the strain was knocked out to finally obtain Bacillus subtilis 168 P.sub.43-menF P.sub.43-menB P.sub.hbs-menE P.sub.43-entC ΔdhbB P.sub.hbs-tkt P.sub.43-ppsA ΔptsG, named BS6.

EXAMPLE 7

Construction of Recombinant Strain BS7

[0078] On the basis of the strain BS6 obtained in Example 6, by using the method similar to that in Example 1, an artificially synthetic aroG.sup.fbr gene (with the sequence shown in SEQ ID NO. 6) was fused with a promotor P.sub.hbs and then integrated between a stress protein (ytxj, genebank ID: 937308) gene and a 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase (aroA, genebank ID: 937853) gene on the genome of Bacillus subtilis. The specific construction process was as follows:

[0079] (1) Obtaining of Fused Segment

[0080] An aroG.sup.fbr gene (with the sequence shown in SEQ ID NO. 6) was artificially synthesized. The genome of Bacillus subtilis 168 was used as a template, and a ytxj gene, an aroA gene and the P.sub.hbs promoter sequence were amplified separately. Then overlap extension PCR was performed on the five segments: the ytxj, the lox71-zeo-lox66, the P.sub.hbs, the aroG.sup.fbr and the aroA to obtain a fused gene segment ytxj-lox71-zeo-lox66-P.sub.hbs-aroG.sup.fbr-aroA.

[0081] (2) Homologous Recombination

[0082] The fused segment obtained in step (1) was transformed into the competent cells of BS6. Then, through the Cre/lox recombination system, the bleomycin resistance gene zeo in the strain was knocked out to finally construct a strain Bacillus subtilis 168 P.sub.43-menF P.sub.43-menB P.sub.hbs-menE P.sub.43-entC ΔdhbB P.sub.hbs-tkt P.sub.43-ppsA ΔptsG P.sub.hbs-aroG.sup.fbr, named BS7.

EXAMPLE 8

Construction of Recombinant Strain BS8

[0083] On the basis of the strain BS7 obtained in Example 7, by using the method similar to that in Example 1, the natural promoter of a shikimate kinase (aroK, genebank ID: 938343) gene on the chromosome of Bacillus subtilis was replaced with a P.sub.43 promoter. The specific construction process was as follows:

[0084] (1) Obtaining of Fused Segment

[0085] The genome of Bacillus subtilis 168 was used as a template, and the upstream homologous arm sequence aroK-up and the aroK gene segment of the aroK gene, and the P.sub.43 promoter sequence were amplified separately. A lox71-zeo-lox66 cassette sequence (with the sequence shown in SEQ ID NO.2) was artificially synthesized. Then overlap extension PCR was performed on the four segments: the aroK-up, the lox71-zeo-lox66 cassette, the P.sub.43 promotor sequence and the aroK gene segment to obtain a fused gene segment aroK.sub.up-lox71-zeo-lox66-P.sub.43-aroK.

[0086] (2) Homologous Recombination

[0087] The fused segment obtained in step (1) was transformed into the competent cells of BS7. Then, through the Cre/lox recombination system, the bleomycin resistance gene zeo in the strain was knocked out to finally construct a strain Bacillus subtilis 168 P.sub.43-menF P.sub.43-menB P.sub.hbs-menE P.sub.43-entC ΔdhbB P.sub.hbs-tkt P.sub.43-ppsA ΔptsG P.sub.hbs-aroG.sup.fbr P.sub.43-aroK, named BS8.

EXAMPLE 9

Construction of Recombinant Strain BS9

[0088] On the basis of the strain BS8 obtained in Example 8, by using the method similar to that in Example 1, the natural promoter of a farnesyl diphosphate synthase (ispA, genebank ID: 938652) gene on the chromosome of Bacillus subtilis was replaced with a P.sub.hbs promoter. The specific construction process was as follows:

[0089] (1) Obtaining of Fused Segment

[0090] The genome of Bacillus subtilis 168 was used as a template, and the upstream homologous arm sequence ispA-up and the ispA gene segment of the ispA gene, and the P.sub.hbs promoter sequence were amplified separately. A lox71-zeo-lox66 cassette sequence (with the sequence shown in SEQ ID NO. 2) was artificially synthesized. Then overlap extension PCR was performed on the four segments: the ispA-up, the lox71-zeo-lox66 cassette, the P.sub.hbs promoter sequence, and the ispA gene segment to obtain a fused gene segment ispA.sub.up-lox71-zeo-lox66-Phb.sub.s-ispA.

[0091] (2) Homologous Recombination

[0092] The fused segment obtained in step (1) was transformed into the competent cells of BSB. Then, through the Cre/lox recombination system, the bleomycin resistance gene zeo in the strain was knocked out to finally construct a strain Bacillus subtilis 168 P.sub.43-menF P.sub.43-menB P.sub.hbs-menE P.sub.43-entC ΔdhbB P.sub.hbs-tkt P.sub.43-ppsA ΔptsG P.sub.hbs-aroG.sup.fbr P.sub.43-aroK P.sub.hbs-ispA, named BS9.

EXAMPLE 10

Construction of Recombinant Strain BS10

[0093] On the basis of the strain BS9 obtained in Example 9, by using the method similar to that in Example 1, the natural promoter of a heptaprenyl diphosphate synthase component I (hepS/T, genebank ID: 938998) gene on the chromosome of Bacillus subtilis was replaced with a P.sub.43 promoter. The specific construction process was as follows:

[0094] (1) Obtaining of Fused Segment

[0095] The genome of Bacillus subtilis 168 was used as a template, and the upstream homologous arm sequence hepS/T-up and the hepS/T gene segment of the hepS/T gene, and the P.sub.43 promoter sequence were amplified separately. A lox71-zeo-lox66 cassette sequence (with the sequence shown in SEQ ID NO. 2) was artificially synthesized. Then overlap extension PCR was performed on the four segments: the hepS/T -up, the lox71-zeo-lox66 cassette, the P.sub.43 promoter sequence, and the hepS/T gene segment to obtain a fused gene segment hepS/T.sub.up-lox71-zeo-lox66-P.sub.43-hepS/T.

[0096] (2) Homologous Recombination

[0097] The fused segment obtained in step (1) was transformed into the competent cells of BS9. Then, through the Cre/lox recombination system, the bleomycin resistance gene zeo in the strain was knocked out to finally construct a strain Bacillus subtilis 168 P.sub.43-menF P.sub.43-menB P.sub.hbs-menE P.sub.43-entC ΔdhbB P.sub.hbs-tkt P.sub.43-ppsA ΔptsG P.sub.hbs-aroG.sup.fbr P.sub.43-aroK P.sub.hbs-ispA P.sub.43-hepS/T, named BS10.

EXAMPLE 11

Construction of Recombinant Strain BS11

[0098] On the basis of the strain BS10 obtained in Example 10, by using the method similar to that in Example 1, a 2-dehydro-3-deoxy-phosphogluconate aldolase (kdpG, genebank ID: 33073472) gene derived from Zymomonas mobilis was fused with a promoter P.sub.hbs and then integrated between a putative uronase (yclG, genebank ID: 938292) gene and a spore germination receptor subunit (gerkA, genebank ID: 938285) gene on the chromosome of Bacillus subtilis. The specific construction process was as follows:

[0099] (1) Obtaining of Fused Segment

[0100] The genome of Zymomonas mobilis was used as a template to synthesize a kdpG gene. The genome of Bacillus subtilis 168 was used as a template, and a yclG gene, a P.sub.hbs promotor sequence and a gerkA gene were amplified separately. A lox71-zeo-lox66 cassette sequence (with the sequence shown in SEQ ID NO. 2) was artificially synthesized. Then overlap extension PCR was performed on the five segments: the yclG, the lox71-zeo-lox66 cassette, the P.sub.hbs promoter sequence, the kdpG, and the gerkA to obtain a fused gene segment yclG-lox71-zeo-lox66-P.sub.hbs-kdpG-gerkA.

[0101] (2) Homologous Recombination

[0102] The fused segment obtained in step (1) was transformed into the competent cells of BS10. Then, through the Cre/lox recombination system, the bleomycin resistance gene zeo in the strain was knocked out to finally construct a strain Bacillus subtilis 168 P.sub.43-menF P.sub.43-menB P.sub.hbs-menE P.sub.43-entC ΔdhbB P.sub.hbs-tkt P.sub.43-ppsA ΔptsG P.sub.hbs-aroG.sup.fbr::lox72 P.sub.43-aroK P.sub.hbs-ispA P.sub.43-hepS/T P.sub.hbs-kdpG, named BS11.

EXAMPLE 12

Construction of Recombinant Strain BS12

[0103] On the basis of the strain BS11 obtained in Example 11, by using the method similar to that in Example 1, the natural promoter of a 1-deoxy-D-xylulose-5-phosphate reductoisomerase (dxr, genebank ID: 939636) gene on the chromosome of Bacillus subtilis was replaced with a P.sub.43 promoter. The specific construction process was as follows:

[0104] (1) Obtaining of Fused Segment

[0105] The genome of Bacillus subtilis 168 was used as a template, and the upstream homologous arm sequence dxr-up and the dxr gene segment of the dxr gene, and the P.sub.43 promoter sequence are amplified separately. A lox71-zeo-lox66 cassette sequence (with the sequence shown in SEQ ID NO. 2) was artificially synthesized. Then overlap extension PCR was performed on the four segments: the dxr-up, the lox71-zeo-lox66 cassette, the P.sub.43 promoter sequence, and the dxr gene segment to obtain a fused gene segment dxr.sub.up-lox71-zeo-lox66-P.sub.43-cbcr.

[0106] (2) Homologous Recombination

[0107] The fused segment obtained in step (1) was transformed into the competent cells of BS11. Then, through the Cre/lox recombination system, the bleomycin resistance gene zeo in the strain was knocked out to obtain a strain Bacillus subtilis 168 P.sub.43-menF P.sub.43-menB P.sub.hbs-menE P.sub.43-entC ΔdhbB P.sub.hbs-tkt P.sub.43-ppsA ΔptsG P.sub.hbs-aroG.sup.fbr P.sub.43-aroK P.sub.hbs-ispA P.sub.43-hepS/T P.sub.hbs-kdpG P.sub.43-dxr, named BS12.

EXAMPLE 13

Construction of Recombinant Strain BS13

[0108] On the basis of the strain BS12 obtained in Example 12, by using the method similar to that in Example 1, the natural promoter of a 1-deoxyxylulose-5-phosphate synthase (dxs, genebank ID: 938609) gene in Bacillus subtilis 168 was replaced with a P.sub.43 promoter. The specific construction process was as follows:

[0109] (1) Obtaining of Fused Segment

[0110] The genome of Bacillus subtilis 168 was used as a template, and the upstream homologous arm sequence dxs-up and the dxs gene segment of the dxs gene, and the P.sub.43 promoter sequence are amplified separately. A lox71-zeo-lox66 cassette sequence (with the sequence shown in SEQ ID NO. 2) was artificially synthesized. Then overlap extension PCR was performed on the four segments: the dxs-up, the lox71-zeo-lox66 cassette, the P.sub.43 promoter sequence, and the dxs gene segment to obtain a fused gene segment dxs .sub.up-lox71-zeo-lox66-P.sub.43-dxs.

[0111] (2) Homologous Recombination

[0112] The fused segment obtained in step (1) was transformed into the competent cells of BS12. Then, through the Cre/lox recombination system, the bleomycin resistance gene zeo in the strain was knocked out to obtain a strain Bacillus subtilis 168 P.sub.43-menF P.sub.43-menB P.sub.hbs-menE P.sub.43-entC ΔdhbB P.sub.hbs-tkt P.sub.43-ppsA ΔptsG P.sub.hbs-aroG.sup.fbr P.sub.43-aroK P.sub.hbs-ispA P.sub.43-hepS/T P.sub.hbs-kdpG P.sub.43-dxr P.sub.43-dxs, named BS13.

EXAMPLE 14

Construction of Recombinant Strain BS14

[0113] On the basis of the strain BS13 obtained in Example 13, by using the method similar to that in Example 1, the natural promoter of an isopentenyl diphosphate isomerase (typell) (fni, genebank ID: 938985) gene on the chromosome of Bacillus subtilis was replaced with a P.sub.43 promoter. The specific construction process was as follows:

[0114] (1) Obtaining of Fused Segment

[0115] The genome of Bacillus subtilis 168 was used as a template, and the upstream homologous arm sequence fni-up and the fni gene segment of the fni gene, and the P.sub.43 promoter sequence are amplified separately. A lox71-zeo-lox66 cassette sequence (with the sequence shown in SEQ ID NO. 2) was artificially synthesized. Then overlap extension PCR was performed on the four segments: the fni-up, the lox71-zeo-lox66 cassette, the P.sub.43 promoter sequence, and the fni gene segment to obtain a fused gene segment fni.sub.up-lox71-zeo-lox66-P.sub.43-fni.

[0116] (2) Homologous Recombination

[0117] The fused segment obtained in step (1) was transformed into the competent cells of BS13. Then, through the Cre/lox recombination system, the bleomycin resistance gene zeo in the strain was knocked out to construct a strain Bacillus subtilis 168 P.sub.43-menF P.sub.43-menB P.sub.hbs-menE P.sub.43-entC ΔdhbB P.sub.hbs-tkt P.sub.43-ppsA ΔptsG P.sub.hbs-aroG.sup.fbr P.sub.43-aroK P.sub.hbs-ispA P.sub.43-hepS/T P.sub.hbs-kdpG P.sub.43-dxr P.sub.43-dxs P.sub.43-fni, named BS14.

EXAMPLE 15

Production of MK-7 by Strain Fermentation

[0118] Formula of a seed medium (in mass percentage): tryptone 1%, yeast extract 0.5%, and sodium chloride 1%.

[0119] Formula of a fermentation medium (in mass percentage): soy peptone 5%, glucose 5%, sucrose 5%, and KH.sub.2PO.sub.3 0.06%.

[0120] (1) Preparation of Seed Solution

[0121] The seed medium was inoculated with the wild-type strain Bacillus subtilis 168 and the recombinant strains BS1-14 constructed in Examples 1-14 were respectively, and culturing was performed at 37° C. and 220 rpm for 12 h to obtain the Bacillus subtilis seed solutions.

[0122] (2) Fermentation Culture

[0123] The seed solutions obtained in step (1) were transferred to the fermentation medium at an inoculum concentration of 15%. After 6 days of culture at 41° C. and 220 rpm, the fermentation broth was taken to determine the content of MK-7 (see Table 4).

TABLE-US-00004 TABLE 4 Production of MK-7 by strain fermentation Yield of MK-7 Relative content Strain (mg/L) of MK-7 BS168 (Original strain) 9.5 1 BS1 9.1 0.96 BS2 9.5 1 BS3 9.2 0.97 BS4 9.6 1.01 BS5 9.2 0.97 BS6 15.1 1.59 BS7 16.2 1.71 BS8 17.4 1.83 BS9 19.6 2.06 BS10 21.2 2.23 BS11 24.2 2.55 BS12 26.4 2.78 BS13 28.2 2.97 BS14 33.5 3.53

[0124] Although the present disclosure has been disclosed as above in preferred examples, it is not intended to limit the present disclosure. Anyone in this art can make various changes and modifications without departing from the spirit and scope of the present disclosure. Therefore, the protection scope of the present disclosure should be defined by the claims.