1. Patent Search
  2. Details

METHOD FOR DIAGNOSING INFECTION WITH HELICOBACTER SUIS

20210292375 · 2021-09-23

    Inventors

    Cpc classification

    International classification

    Abstract

    Described herein is a newly found outer membrane protein gene specific for Helicobacter suis and a gene product thereof. Also described herein is a method for determining infection of a subject with Helicobacter suis and a method for treatment using an antibody against the gene product.

    Claims

    1.-24. (canceled)

    25. A protein consisting of the amino acid sequences set forth in SEQ ID NO: 2, or a protein consisted of the amino acids of positions 28-2992 in the amino acid sequences set forth in SEQ ID NO: 2.

    26. A method for determining infection of a subject with H. suis, comprising: detecting the HsvA protein or the fragment thereof in a sample derived from the subject, determining that H. suis is present in the sample in which the HsvA protein or the fragment thereof have been detected, and determining the subject is infected with H. suis, when the sample derived from whom is determined that H. suis is present by the method; or detecting an antibody that binds to an HsvA antigen peptide in a blood sample derived from the subject; and determining the subject is infected with H. suis when the antibody that binds to the peptide has been detected.

    27. The method for determining infection of claim 26, comprising: contacting the sample derived from the subject with an antibody or an immunoreactive fragment thereof, that specifically binds to HsvA antigen peptide derived from H. suis; detecting the HsvA protein in the sample bound with the antibody or the immunoreactive fragment thereof; and determining that H. suis is present in the sample when the HsvA protein bound with the antibody or the immunoreactive fragment thereof has been detected.

    28. The method for determining infection of claim 26, wherein the HsvA protein consists of an amino acid sequence that is specific to H. suis, and that does not exist in H. pylori.

    29. The method for determining infection with H. suis of claim 26, comprising: contacting the blood sample derived from the subject with the peptide selected from a group consisting of: the HsvA antigen peptide having a sequence comprising 5 to 50 amino acids contained in any one of the amino acid sequences set forth in SEQ ID NO: 2, SEQ ID NO: 28, SEQ ID NO: 30, or SEQ ID NOs: 78 to 83 or any one of the sequences: TABLE-US-00010 (peptide No. 11: SEQ ID NO: 24) EKX1AVX2X3X4X5NSNX6X7; (peptide No. 11: SEQ ID NO: 3) EKKAVQQMENSNPD, (peptide No. 11 (TKY): SEQ ID NO: 4) EKKAVEQMENSNPD, (peptide No. 11 (SH8): SEQ ID NO: 5) EKDAVTSLKNSNSG, (peptide No. 11 (SH10): SEQ ID NO: 6) EKDAVTSLENSNSG, (peptide No. 19: SEQ ID NO: 25) NQGTLEFLSNDVSX8; (peptide No. 19: SEQ ID NO: 7) NQGTLEFLSNDVSN, (peptide No. 19 (TKY): SEQ ID NO:8) NQGTLEFLSNDVST, (peptide No. 33: SEQ ID NO: 26) X9SX10KLQX11X12LKSX13X14X15; (peptide No. 33: SEQ ID NO: 9) LSNKLQGQLKSMGL, (peptide No. 33 (TKY): SEQ ID NO: 10) LSNKLQDQLKSMGL, (peptide No. 33 (SH10): SEQ ID NO: 11) FSDKLQNMLKSLNM, (peptide No. 16: SEQ ID NO: 12) TNGQEVSASIDYNK; (peptide No. 23: SEQ ID NO: 13) AKLSNFASNDALPD; (peptide No. 10: SEQ ID NO: 14) PTTSSGASPDSSNP; (peptide No. 21: SEQ ID NO: 15) GLGRDLFVHSMGDK; (peptide No. 15: SEQ ID NO: 16) QIGKIKLSDVLSAS; (peptide No. 34: SEQ ID NO: 17) YGAIDKFLHFSGGK; (peptide No. 20: SEQ ID NO: 18) NVDNILNMPSTTSG; (peptide No. 22: SEQ ID NO: 19) GNLKGVYYPKSSTT; (peptide No. 14: SEQ ID NO: 20) ITEKIQSGKLTITI; (peptide No. 26: SEQ ID NO: 21) FHDFLVSLKGKKFA; (peptide No. 31: SEQ ID NO: 22) TTGGEVRLFRSFYV; (peptide No. 35: SEQ ID NO: 23) IGARFGLDYQDINI; (peptide No. 8: SEQ ID NO: 86) KQLPQPKRSELKPK; (peptide No. 31N: SEQ ID NO: 87) TNIKQYMQNNHRSQ; (peptide No. 81: SEQ ID NO: 88) TLTLEGTETFAQNS; (peptide No. 63: SEQ ID NO: 89) EAYAKNQGDIWSTI; (peptide No. 73: SEQ ID NO: 90) VIGSKSSITLNSAN; and (peptide No. 61: SEQ ID NO: 91) ADIQSSQTTFANSV, wherein X1 is K or D; X2 is Q, E or T; X3 is Q or S; X4 is M or L; X5 is E or K; X6 is P or S; X7 is D or G; X8 is N or T; X9 is L or F; X10 is N or D; X11 is G, D or N; X12 is Q or M; X13 is M or L; X14 is G or N; and X15 is L or M; detecting an antibody that binds to said peptide in the blood sample; and determining the subject is infected with H. suis when the antibody that binds to the peptide has been detected.

    30. A method for treatment of H. suis infection comprising: administering any one selected from a group consisting of: the HsvA antigen peptide derived from H. suis having a sequence consisting of 5 to 50 amino acids contained in any one of the amino acid sequences set forth in SEQ ID NO: 2, SEQ ID NO: 28, SEQ ID NO: 30, or SEQ ID NOs: 78 to 83; a nucleic acid molecule consisting of 5 to 40 nucleotides, wherein the nucleic acid molecule is capable of binding to an hsvA gene under stringent conditions; and an antibody or an immunoreactive fragment thereof, that specifically binds to the HsvA antigen peptide derived from H. suis having a sequence consisting of 5 to 50 amino acids contained in any one of the amino acid sequences set forth in SEQ ID NO: 2, SEQ ID NO: 28, SEQ ID NO: 30, or SEQ ID NOs: 78 to 83.

    31. The method of claim 30 for treatment or prevention of gastritis, gastric ulcer, duodenal ulcer, stomach cancer, chronic gastritis, gastric MALT lymphoma, nodular gastritis, idiopathic thrombocytopenic purpura, functional dyspepsia, or diffuse large B-cell lymphoma.

    32. The method of claim 26, wherein the antibody is an antibody that specifically binds to the HsvA antigen peptide derived from H. suis having a sequence consisting of 5 to 50 amino acids contained in any one of the amino acid sequences set forth in SEQ ID NO: 2, SEQ ID NO: 28, SEQ ID NO: 30, or SEQ ID NOs: 78 to 83.

    33. The method for determining infection of claim 26, wherein H. pylori infection is not detected by the method, and/or, wherein the HsvA antigen peptide is the peptide having a sequence consisting of 5 to 50 amino acids contained in any one of the amino acid sequences set forth in SEQ ID NO: 2, SEQ ID NO: 28, SEQ ID NO: 30, or SEQ ID NOs: 78 to 83.

    34. The method for determining infection of claim 33, wherein the HsvA antigen peptide has any one of amino acid sequence selected from a group consisting of: TABLE-US-00011 (peptide No. 11: SEQ ID NO: 24) EKX1AVX2X3X4X5NSNX6X7; (peptide No. 19: SEQ ID NO: 25) NQGTLEFLSNDVSX8; (peptide No. 33: SEQ ID NO: 26) X9SX10KLQX11X12LKSX13X14X15; (peptide No. 16: SEQ ID NO: 12) TNGQEVSASIDYNK; (peptide No. 23: SEQ ID NO: 13) AKLSNFASNDALPD; (peptide No. 10: SEQ ID NO: 14) PTTSSGASPDSSNP; (peptide No. 21: SEQ ID NO: 15) GLGRDLFVHSMGDK; (peptide No. 15: SEQ ID NO: 16) QIGKIKLSDVLSAS; (peptide No. 34: SEQ ID NO: 17) YGAIDKFLHFSGGK; (peptide No. 20: SEQ ID NO: 18) NVDNILNMPSTTSG; (peptide No. 22: SEQ ID NO: 19) GNLKGVYYPKSSTT; (peptide No. 14: SEQ ID NO: 20) ITEKIQSGKILTITI; (peptide No. 26: SEQ ID NO: 21) FHDFLVSLKGKKFA; (peptide No. 31: SEQ ID NO: 22) TTGGEVRLFRSFYV; (peptide No. 35: SEQ ID NO: 23) IGARFGLDYQDINI; (peptide No. 8: SEQ ID NO: 86) KQLPQPKRSELKPK; (peptide No. 31N: SEQ ID NO: 87) TNIKQYMQNNHRSQ; (peptide No. 81: SEQ ID NO: 88) TLTLEGTETFAQNS; (peptide No. 63: SEQ ID NO: 89) EAYAKNQGDIWSTI; (peptide No. 73: SEQ ID NO: 90) VIGSKSSITLNSAN; and (peptide No. 61: SEQ ID NO: 91) ADIQSSQTTFANSV; wherein X1 is K or D; X2 is Q, E or T; X3 is Q or S; X4 is M or L; X5 is E or K; X6 is P or S; X7 is D or G; X8 is N or T; X9 is L or F; X10 is N or D; X11 is G, D or N; X12 is Q or M; X13 is M or L; X14 is G or N; and X15 is L or M.

    35. The method for determining infection of claim 33, wherein the HsvA antigen peptide has any one of amino acid sequence selected from a group consisting of: TABLE-US-00012 (peptide No. 11: SEQ ID NO: 3) EKKAVQQMENSNPD, (peptide No. 11 (TKY): SEQ ID NO: 4) EKKAVEQMENSNPD, (peptide No. 11 (SH8): SEQ ID NO: 5) EKDAVTSLKNSNSG, (peptide No. 11 (SH10): SEQ ID NO: 6) EKDAVTSLENSNSG, (peptide No. 19: SEQ ID NO: 25) NQGTLEFLSNDVSX8; (peptide No. 19: SEQ ID NO: 7) NQGTLEFLSNDVSN, (peptide No. 19 (TKY): SEQ ID NO:8) NQGTLEFLSNDVST, (peptide No. 33: SEQ ID NO: 9) LSNKLQGQLKSMGL, (peptide No. 33 (TKY): SEQ ID NO: 10) LSNKLQDQLKSMGL, (peptide No. 33 (SH10): SEQ ID NO: 11) FSDKLQNMLKSLNM, (peptide No. 16: SEQ ID NO: 12) TNGQEVSASIDYNK; (peptide No. 23: SEQ ID NO: 13) AKLSNFASNDALPD; (peptide No. 10: SEQ ID NO: 14) PTTSSGASPDSSNP; (peptide No. 21: SEQ ID NO: 15) GLGRDLFVHSMGDK; (peptide No. 15: SEQ ID NO: 16) QIGKIKLSDVLSAS; (peptide No. 34: SEQ ID NO: 17) YGAIDKFLHFSGGK; (peptide No. 20: SEQ ID NO: 18) NVDNILNMPSTTSG; (peptide No. 22: SEQ ID NO: 19) GNLKGVYYPKSSTT; (peptide No. 14: SEQ ID NO: 20) ITEKIQSGKLTITI; (peptide No. 26: SEQ ID NO: 21) FHDFLVSLKGKKFA; (peptide No. 31: SEQ ID NO: 22) TTGGEVRLFRSFYV; (peptide No. 35: SEQ ID NO: 23) IGARFGLDYQDINI; (peptide No. 8: SEQ ID NO: 86) KQLPQPKRSELKPK; (peptide No. 31N: SEQ ID NO: 87) TNIKQYMQNNHRSQ; (peptide No. 81: SEQ ID NO: 88) TLTLEGTETFAQNS; (peptide No. 63: SEQ ID NO: 89) EAYAKNQGDIWSTI; (peptide No. 73: SEQ ID NO: 90) VIGSKSSITLNSAN;  and (peptide No. 61: SEQ ID NO: 91) ADIQSSQTTFANSV.

    36. The method for determining infection of claim 33, wherein the HsvA antigen peptide has any one of amino acid sequence selected from a group consisting of: TABLE-US-00013 (peptide No. 11: SEQ ID NO: 3) EKKAVQQMENSNPD, (peptide No. 11 (TKY): SEQ ID NO: 4) EKKAVEQMENSNPD, (peptide No. 11 (SH8): SEQ ID NO: 5) EKDAVTSLKNSNSG, (peptide No. 11 (SH10): SEQ ID NO: 6) EKDAVTSLENSNSG, and (peptide No. 16: SEQ ID NO: 12) TNGQEVSASIDYNK.

    37. The method for determining infection of claim 33, wherein the HsvA antigen peptide has an amino acid sequence of EKKAVQQMENSNPD (peptide No. 11: SEQ ID NO: 3) or TNGQEVSASIDYNK (peptide No. 16: SEQ ID NO: 12).

    Description

    BRIEF DESCRIPTION OF DRAWINGS

    [0080] FIG. 1 is a schematic view of an hsvA gene-specific nucleic acid molecule.

    [0081] FIG. 2A shows the sequences of hsvA gene and HsvA protein derived from an SNTW101 strain of H. suis. FIGS. 2A to 2N show the consecutive sequences of one gene and a protein encoded thereby.

    [0082] FIG. 2B shows the sequences of the hsvA gene and the HsvA protein derived from an SNTW101 strain of H. suis.

    [0083] FIG. 2C shows the sequences of the hsvA gene and the HsvA protein derived from an SNTW101 strain of H. suis.

    [0084] FIG. 2D shows the sequences of the hsvA gene and the HsvA protein derived from an SNTW101 strain of H. suis.

    [0085] FIG. 2E shows the sequences of the hsvA gene and the HsvA protein derived from an SNTW101 strain of H. suis.

    [0086] FIG. 2F shows the sequences of the hsvA gene and the HsvA protein derived from an SNTW101 strain of H. suis.

    [0087] FIG. 2G shows the sequences of the hsvA gene and the HsvA protein derived from an SNTW101 strain of H. suis.

    [0088] FIG. 2H shows the sequences of the hsvA gene and the HsvA protein derived from an SNTW101 strain of H. suis.

    [0089] FIG. 2I shows the sequences of the hsvA gene and the HsvA protein derived from an SNTW101 strain of H. suis.

    [0090] FIG. 2J shows the sequences of the hsvA gene and the HsvA protein derived from an SNTW101 strain of H. suis.

    [0091] FIG. 2K shows the sequences of the hsvA gene and the HsvA protein derived from an SNTW101 strain of H. suis.

    [0092] FIG. 2L shows the sequences of the hsvA gene and the HsvA protein derived from an SNTW101 strain of H. suis.

    [0093] FIG. 2M shows the sequences of the hsvA gene and the HsvA protein derived from an SNTW101 strain of H. suis.

    [0094] FIG. 2N shows the sequences of the hsvA gene and the HsvA protein derived from an SNTW101 strain of H. suis.

    [0095] FIG. 3 is a diagram comparing the amino acid sequences of regions including peptide Nos. 11, 33, and 19 of SNTW101 (SEQ ID NO: 78), HS1 (SEQ ID NO: 79), HS5 (SEQ ID NO: 80), TKY (SEQ ID NO: 81), SH8 (SEQ ID NO: 82) and SH10 (SEQ ID NO: 83) strains of H. suis.

    [0096] FIG. 4 is a diagram comparing the amino acid sequences of regions corresponding to peptide Nos. 11, 33, and 19 of SNTW101, HS1, HS5, TKY, SH8 and SH10 strains of H. suis (SEQ ID NOs: 3 to 11).

    [0097] FIG. 5 shows the determination of H. suis by PCR. In photographs for H. pylori (SS1, TN2GF4, NCTC11637, ATCC43579, and RC-1 strains) and H. suis (SNTW101 and TKY strains), DNA was amplified by PCR using designed forward primer FW2, FW3, FW5, or VAC3624F (Non Patent Literature 7 described above) and reverse primer RV1, RV3, RV4, or VAC4041R (Non Patent Literature 7 described above), and the amplification product was confirmed by electrophoresis. Each lane depicts templated DNA prepared from 1) H. suis TKY, 2) H. suis SNTW101, 3) H. pylori SS1, 4) H. pylori TN2GF4, 5) H. pylori NCTC11637, 6) H. pylori ATCC43579, and 7) H. pylori RC-1 strains. The primer set used is shown below each photograph. For all the primer sets of the forward primer FW2, FW3, or FW5 and the reverse primer RV1, RV3, or RV4, the amplification product was confirmed only from DNA prepared from the gastric mucosa of an H. suis-infected mouse.

    [0098] FIG. 6 is a graph showing results of measuring the binding titers of antibodies in serum obtained from A, an H. suis-infected human, B, an H. pylori-infected human, and C, a non-infected human against various peptides by ELISA. The abscissa depicts Nos of the peptides. The ordinate depicts absorbance at 450 nm. A mean from the experiment conducted in duplicate is shown. Synthesized 15 HsvA antigen peptides (Nos. 10 (SEQ ID NO: 14), 11 (SEQ ID NO: 3), 14 (SEQ ID NO: 20), 15 (SEQ ID NO: 16), 16 (SEQ ID NO: 12), 19 (SEQ ID NO: 7), 20 (SEQ ID NO: 18), 21 (SEQ ID NO: 15), 22 (SEQ ID NO: 19), 23 (SEQ ID NO: 13), 26 (SEQ ID NO: 21), 31 (SEQ ID NO: 22), 33 (SEQ ID NO: 9), 34 (SEQ ID NO: 17), and 35 (SEQ ID NO: 23)) specifically reacted with the serum of the subject infected with H. suis.

    [0099] FIG. 7 is a graph showing results of measuring the binding titers of antibodies in the serum of 5 subjects against No. 11 peptide (SEQ ID NO: 3), No. 19 peptide (SEQ ID NO: 7), and No. 33 peptide (SEQ ID NO: 9) by ELISA. A and B show data from the serum of different H. suis-infected subjects, respectively. C and D show data from the serum of different H. pylori-infected subjects, respectively. E shows data from the serum of a non-infected subject. The abscissa depicts SEQ ID NOs of the antigen peptides and dilution ratios of the serum. The ordinate depicts absorbance at 450 nm. A mean from the experiment conducted in triplicate and standard deviation are shown. All the peptides strongly reacted with the H. suis-infected serum and weakly reacted with the H. pylori-infected or non-infected serum.

    [0100] FIG. 8 is a graph showing results of measuring the binding titers of antibodies in the serum of 6 subjects (two H. suis-infected subjects, three H. pylori-infected subjects, and one non-infected subject) against No. 11 peptide (SEQ ID NOs: 3, 4, 5, 6, and 24), No. 19 peptide (SEQ ID NOs: 7, 8, and 25) and No. 33 peptide (SEQ ID NOs: 9, 10, 11, and 26) by ELISA. A and B show data from the serum of different H. suis-infected subjects, respectively. C, D and E show data from the serum of different H. pylori-infected subjects, respectively. F shows data from the serum of a non-infected subject. The abscissa depicts SEQ ID NOs of the antigen peptides and dilution ratios of the serum. The ordinate depicts absorbance at 450 nm. A mean from the experiment conducted in duplicate is shown. All the peptides strongly reacted with the H. suis-infected serum and weakly reacted with the H. pylori-infected or non-infected serum.

    [0101] FIG. 9 is a graph showing results of measuring the binding titers of antibodies in the serum of 8 subjects (three H. suis-infected subjects, three H. pylori-infected subjects, and two non-infected subjects) against whole cells of an H. pylori TN2GF4 strain by ELISA. A and B show results obtained from serum diluted 600-fold and 1800-fold, respectively. The ordinate depicts absorbance at 450 nm. A mean from the experiment conducted in duplicate is shown. Only the H. pylori-infected serum strongly reacted with the bacterial cells of H. pylori.

    [0102] FIG. 10 is a graph showing results of measuring the binding titers of the serum of mice infected with an H. suis TKY or H. suis SNTW101 strain against No. 11 peptide (SEQ ID NOs: 3, 4, 5, 6, and 24), No. 19 peptide (SEQ ID NOs: 7, 8, and 25), No. 33 peptide (SEQ ID NOs: 9, 10, 11, and 26) and whole cells of H. pylori TN2GF4 and SS1 strains by ELISA. The abscissa depicts the types of the peptides or the bacterial cells used in ELISA. A, B and C show data from the serum of different H. suis TKY strain-infected mice, respectively. D, E and F show data from the serum of different H. suis SNTW101 strain-infected mice, respectively. A and D show results obtained from serum diluted 20-fold. B and E show results obtained from serum diluted 100-fold. C and F show results obtained from serum diluted 400-fold. The abscissa depicts SEQ ID NOs of the antigen peptides and dilution ratios of the serum. The ordinate depicts absorbance at 450 nm. A mean from the experiment conducted in duplicate is shown. The H. suis-infected mouse serum strongly reacted with the H. pylori whole cells, but also strongly reacted with all the peptides of Nos. 11, 19, and 33.

    [0103] FIG. 11 is a graph showing results of measuring the serum of mice infected with an H. suis TKY or H. pylori SS1 strain by sandwich ELISA. The abscissa depicts the types of peptides or bacterial cells used in sandwich ELISA. The peptides and the bacterial cells used are as follows: SEQ ID NO: 3 (peptide No. 11 (SNTW101; HS1; HS5), SEQ ID NO: 7 (peptide No. 19 (SNTW101; HS1; H55, SH8), and SEQ ID NO: 9 (peptide No. 33 (SNTW101; HS1; HS5). The ordinate depicts absorbance at 450 nm. A mean from the experiment conducted in triplicate and standard deviation are shown. Only the H. suis-infected mouse serum strongly reacted with all the peptides of Nos. 11, 19, and 33.

    [0104] FIG. 12 is a graph showing results of ELISA about the binding of each rabbit antibody to various antigens (HsvA-derived peptides or H. pylori whole cells). The abscissa depicts various antigens (represented by the same numbers as in FIG. 10) immobilized on a solid phase. The ordinate depicts absorbance at 450 nm. A shows the results obtained using a rabbit antibody against No. 11 peptide (SEQ ID NO: 3) prepared in Example 2. B shows the results obtained using a rabbit antibody against No. 33 peptide (SEQ ID NO: 9) prepared in Example 2. C shows the results obtained using a rabbit antibody against No. 19 peptide (SEQ ID NO: 7) prepared in Example 2. A mean from the experiment conducted in triplicate and standard deviation are shown. The antibody against each peptide strongly reacted with the peptide, but weakly reacted with the H. pylori whole cells.

    [0105] FIG. 13 shows immunohistochemical photographs obtained using a polyclonal antibody obtained by immunizing a rabbit with No. 11 peptide. A gastric tissue section of an H. suis-infected patient was reacted with a rabbit antibody against No. 11 peptide adjusted to 2 μg/mL with phosphate-buffered saline and then reacted with Alexa-Flour 488 anti-rabbit IgG diluted 400-fold with phosphate-buffered saline, and photographed under Leica confocal laser fluorescence microscope (TCS-SP5). Alexa-Flour 568 diluted 400-fold with phosphate-buffered saline was used in counterstaining. A is a photograph taken at a 200× magnification. B is a photograph of the boxed portion of A magnified 760 times. The arrows depict bacterial cells of H. suis.

    [0106] FIG. 14 is a graph showing results of measuring the binding activity of antibodies in serum collected from patients infected with H. suis or H. pylori against each peptide or bacterial cells by ELISA. The values are indicated by mean±standard deviation (SD). A shows the binding of antibodies in serum collected from H. suis-infected patients (n=4) to each peptide. The ordinate depicts absorbance at 450 nm. The abscissa depicts SEQ ID NOs of peptides used in immobilization on a solid phase. B shows the binding of antibodies in serum collected from H. pylori-infected patients (n=5) to each peptide. The ordinate depicts absorbance at 450 nm. The abscissa depicts SEQ ID NOs of peptides used in immobilization on a solid phase. C shows the binding of antibodies in serum obtained from non-infected patients (n=3) to each peptide. The ordinate depicts absorbance at 450 nm. The abscissa depicts SEQ ID NOs of peptides used in immobilization on a solid phase. D shows the binding of antibodies contained in H. suis-infected patient-derived serum, H. pylori-infected patient-derived serum, and non-infected patient-derived serum diluted 600-fold or 1800-fold to H. pylori TN2GF4 (filled marks) or SS1 (open marks). The ordinate depicts absorbance at 450 nm. The abscissa depicts the attributions of the patients from which the serum used was derived (H. suis: H. suis-infected patient, H. pylori: H. pylori-infected patient, none: non-infected patient). 1:600 shown in the upper part represents that the patient serum was diluted 600-fold and used as a sample. 1:1800 represents that the patient serum was diluted 1800-fold and used as a sample. In both “1:600” and “1:1800”, the results indicated by filled marks on the left side depict binding to H. pylori TN2GF4, and the results indicated by open marks on the right side depict binding to H. pylori SS1. ***P<0.0001 (H. suis-infected serum vs. H. pylori-infected serum or non-infected serum).

    [0107] FIG. 15 is a graph showing results of examining the specificity of an antibody against each of peptides of Nos. 61, 11, 33, 19, 10, and 16 for the corresponding antigen peptide. The upper part of each graph describes the type of the peptide as an antigen with which the antibody measured in this graph was obtained (e.g., “Ab. against SEQ ID NO: 91” means the antibody obtained with the peptide of SEQ ID NO: 91 as an antigen). The ordinate depicts absorbance at 450 nm. The abscissa depicts SEQ ID NOs of the peptides used in immobilization on a solid phase. The values are indicated by mean±standard deviation (SD).

    [0108] FIG. 16 is a graph showing results of measuring the binding activity of anti-peptide rabbit polyclonal antibodies obtained in Example 2 against bacterial cells of each Helicobacter species by ELISA. The upper part of each graph describes the type of the peptide as an antigen with which the antibody measured in this graph was obtained (e.g., “Ab. against SEQ ID NO: 91” means the antibody obtained with the peptide of SEQ ID NO: 91 as an antigen). The ordinate depicts absorbance at 450 nm. The abscissa depicts Helicobacter strains used in immobilization on a solid phase. The values are indicated by mean±standard deviation (SD).

    [0109] FIG. 17 shows photographs showing results of immunohistochemically staining (A) an H. suis SNTW101-infected mouse gastric section, (B) an enlarged view of the boxed portion of (A), and (C) a non-infected mouse gastric section using an anti-No. 16 peptide (SEQ ID NO: 12) antibody. The arrows depict stained bacterial cells.

    DESCRIPTION OF EMBODIMENTS

    [0110] In one aspect, the present invention relates to a method for determining the presence of H. suis in a sample, comprising detecting hsvA gene or a portion thereof, HsvA protein or a portion thereof, or an antibody against the HsvA protein in the sample. Particularly, the present invention relates to a method for determining infection of a subject with H. suis, comprising detecting hsvA gene or a portion thereof, HsvA protein or a portion thereof, or an antibody against the HsvA protein in a sample derived from the subject. In the present method, the sample or the subject in which the hsvA gene or a portion thereof, the HsvA protein or a portion thereof, or the antibody against the HsvA protein has been detected is determined to have H. suis or to be infected with H. suis.

    [0111] When the method of the present invention is performed by measuring the binding of a polynucleotide, a protein or a portion thereof, or an antibody or a portion thereof in the sample to a test reagent, whether or not to “have been detected” in the determination does not require the absolute presence or absence of detection and may be determined by comparison with other samples. Specifically, the presence or absence of detection may be determined from measurement values, rather than being based on ±detection results. Specifically, in the method of the present invention, the “detecting” step is interchangeable, if necessary, with “measuring”, and whether or not to “have been detected” may be determined by comparison with a negative control based on a measurement value of an intended substance. For example, even when the substance of interest is detected in a negative control, i.e., a sample containing no H. suis or a sample derived from a subject evidently having no H. suis infection, the substance detected in a very small amount is regarded as “having not been detected” in the method of the present invention as long as the measurement value of the subject is equivalent to that of the negative control. Thus, the sample or the subject is determined to have no H. suis or to be not infected with H. suis. On the other hand, when the measurement value of the subject is higher than that of the negative control, the substance is regarded as “having been detected”. Thus, the sample or the subject is determined to have H. suis or to be infected with H. suis. Accordingly, in the method of the present invention, slight measurement value found in a negative control is acceptable by the present invention.

    [0112] Preferably, the method for determining the presence of H. suis or the method for determining infection of a subject with H. suis according to the present invention employs at least one member selected from the group consisting of (i) a nucleic acid molecule capable of specifically binding to hsvA gene, (ii) an HsvA antigen peptide, and (iii) an anti-HsvA antibody or an immunoreactive fragment thereof in a sample derived from the subject.

    [0113] (Method Using Nucleic Acid Molecule Having hsvA Gene-Specific Nucleotide Sequence)

    [0114] Whether or not a subject is infected with H. suis can be determined as the presence or absence of the infection by detecting hsvA gene present in a sample of the subject. The detection of H. suis using the nucleic acid molecule capable of specifically binding to hsvA gene can be performed by a method using hybridization; a method using FOR; or a method known as Invader® assay (see, for example, Kwiatkowski, R. W. et al., Mol. Diagn. (1999) 4: 353-364).

    [0115] Examples of the method using hybridization can include methods such as Southern hybridization, Northern hybridization, dot hybridization, fluorescence in situ hybridization (FISH), DNA microarrays, and ASO. The method for determining the presence of H. suis in a sample according to the present invention may comprise, for example:

    (a) contacting the sample with at least one nucleic acid molecule capable of specifically binding to hsvA gene;
    (b) detecting binding of a polynucleotide in the sample to the nucleic acid molecule capable of specifically binding to hsvA gene; and
    (c) determining the sample in which the binding has been detected, as a sample having H. suis, and determining the sample in which the binding has not been detected, as a sample having no H. suis, and thereby determining the presence of H. suis.

    [0116] The method of the present invention may be, for example, a method for determining infection of a subject with H. suis, comprising:

    (a) contacting a sample derived from the subject with at least one nucleic acid molecule capable of specifically binding to hsvA gene;
    (b) detecting binding of a polynucleotide in the sample to the nucleic acid molecule capable of specifically binding to hsvA gene; and
    (c) determining the subject from which the sample in which the binding has been detected is derived, to be infected with H. suis, and/or determining the sample in which the binding has not been measured or detected, as a sample having no H. suis.

    [0117] The binding of a polynucleotide in the sample to the nucleic acid molecule capable of specifically binding to hsvA gene can be detected, for example, by labeling in advance the nucleic acid molecule capable of specifically binding to hsvA gene, contacting a sample derived from the subject with the nucleic acid molecule capable of specifically binding to hsvA gene, then performing washing, and detecting or measuring the label on the remaining nucleic acid molecule capable of specifically binding to hsvA gene. In this case, preferably, the sample derived from the subject is immobilized on a solid phase.

    [0118] Examples of the method using PCR can include methods such as ARMS (amplification refractory mutation system), RT-PCR (reverse transcription-PCR), and nested PCR. The method for determining the presence of H. suis according to the present invention may comprise, for example, the step of:

    (a) amplifying a portion of hsvA gene in a sample using a nucleic acid molecule capable of specifically binding to hsvA gene as a primer;
    (b) detecting the amplified nucleic acid molecule; and
    (c) determining the sample in which the amplified nucleic acid molecule has been detected, as a sample having H. suis, and determining the sample in which the amplified nucleic acid molecule has not been detected, as a sample having no H. suis, and thereby determining the presence of H. suis.

    [0119] The present invention also relates to a method for determining H. suis infection, comprising:

    (a) amplifying a portion of hsvA gene in a sample derived from a subject using a nucleic acid molecule capable of specifically binding to hsvA gene as a primer;
    (b) detecting the amplified nucleic acid molecule; and
    (c) determining the subject from which the sample in which the amplified nucleic acid molecule has been detected is derived, to be infected with H. suis, and determining the subject from which the sample in which the amplified nucleic acid molecule has not been detected is derived, to be not infected with H. suis.

    [0120] In another aspect, the present invention relates to a method for determining H. suis infection, comprising:

    (a) amplifying a portion of hsvA gene in a sample derived from a subject using a hsvA gene-specific nucleic acid molecule or the like as a primer;
    (b) measuring a level of the amplified nucleic acid molecule; and
    (c) determining the subject to be infected with H. suis when the measured level of the nucleic acid molecule is higher than that of the nucleic acid molecule measured for a negative control by a similar method, and determining the subject to be not infected with H. suis when the measured level of the nucleic acid molecule is equivalent to or lower than that of the nucleic acid molecule measured for a negative control by a similar method.

    [0121] The amplification of a portion of the hsvA gene in the sample derived from the subject can be carried out through PCR reaction or the like using the sample derived from the subject as a template.

    [0122] The amplified nucleic acid can be determined by dot blot hybridization, surface plasmon resonance (SPR) method, PCR-RFLP, in situ RT-PCR, PCR-SSO (sequence specific oligonucleotide), PCR-SSP, AMPFLP (amplifiable fragment length polymorphism), MVR-PCR, or PCR-SSCP (single strand conformation polymorphism).

    [0123] The method for determining the presence of H. suis using the method known as Invader® assay may comprise, for example, the steps of:

    (a) contacting a specimen with the following nucleic acids (i) and (ii) to form a triplex of DNA complementary to an allele probe:

    [0124] (i) an allele-specific probe having an hsvA gene-specific nucleotide sequence or a sequence complementary to the sequence and a sequence complementary to a portion of a quenching probe (flap), and/or an allele-specific probe having an hsvA-specific nucleotide sequence or a sequence complementary to the sequence and a sequence complementary to a portion of a quenching probe (flap), and

    [0125] (ii) an Invader probe having the hsvA gene-specific nucleotide sequence;

    (b) contacting triplex-specific DNase with the nucleic acid specimen obtained by the step (a) to liberate the flap from the nucleic acid triplex;
    (c) contacting the liberated flap with fluorescently labeled universal probes each having a sequence complementary to the flap and the quenching probe;
    (d) contacting triplex-specific DNase with the nucleic acid specimen obtained by the step (c) to liberate the fluorescent label so that fluorescence is emitted;
    (e) detecting the emitted fluorescence and thereby detecting the hsvA gene, wherein the sample in which the fluorescence emission has been detected is determined as a sample having H. suis, and the sample in which the fluorescence emission has not been detected is determined as a sample having no H. suis, thereby determining the presence of H. suis.

    [0126] (Method Using Detection of HsvA Protein-Specific Antibody)

    [0127] Whether or not a subject is infected with H. suis can be determined by confirming the presence of an antibody against an H. suis-derived protein (particularly, HsvA protein) produced by the own immune system of the subject. The detection of H. suis using the HsvA antigen peptide, or the anti-HsvA antibody or the immunoreactive fragment thereof can be performed by, for example, labeled immunoassay such as enzyme immunoassay (EIA), simple EIA, enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), or fluorescence immunoassay (FIA); immunoblotting such as Western blotting; immunochromatography such as metal colloid agglutination method; chromatography such as ion-exchange chromatography or affinity chromatography; turbidimetric immunoassay (TIA); nanofluidic proteomic immunoassay (NIA); colorimetric method; latex immunoassay (LIA); counting immunoassay (CIA); chemiluminescent (enzyme) immunoassay (CLIA and CLEIA); precipitation reaction method; surface plasmon resonance (SPR) method; resonant mirror detector (RMD) method; or comparison interferometry.

    [0128] In one aspect, the present invention relates to a method for determining H. suis infection, comprising:

    (a) contacting a sample derived from a subject with the HsvA antigen of the present invention;
    (b) detecting an antibody bound with the peptide, in the blood sample; and
    (c) determining the subject in which the antibody bound with the peptide has been detected, to be infected with H. suis, and determining the subject in which the antibody bound with the peptide has not been detected, to be not infected with H. suis.

    [0129] In another aspect, the present invention relates to a method for determining H. suis infection, comprising:

    (a) contacting a sample derived from a subject with the HsvA antigen peptide of the present invention;
    (b) measuring a level of an antibody bound with the peptide, in the blood sample; and
    (c) determining the subject to be infected with H. suis when the measured level of the antibody is higher than that of the antibody measured for a negative control by a similar method, and determining the subject to be not infected with H. suis when the measured level of the antibody is equivalent to or lower than that of the antibody measured for a negative control by a similar method.

    [0130] Whether or not the antibody in the sample derived from the subject is bound with the peptide can be confirmed, for example, by contacting the sample derived from the subject with the HsvA antigen peptide of the present invention, then washing the reaction solution to remove an unbound antibody, contacting a labeled anti-Ig antibody therewith so that a subject-derived antibody bound with the HsvA antigen peptide binds to the anti-Ig antibody, washing the reaction solution to remove an unbound antibody, then detecting the label on the anti-Ig antibody, and determining binding between the peptide and the antibody in the sample derived from the subject when the label on the anti-Ig antibody is detected. The binding level between the peptide and the antibody in the sample derived from the subject may be measured by measuring the label level of the anti-Ig antibody. In using the binding level, the amount of the antibody can be calculated from a measurement value by preparing a calibration curve using a standard solution having an abundance known in advance. Alternatively, the binding between the peptide and the antibody in the sample derived from the subject may be detected or measured using a surface plasmon resonance sensor.

    [0131] (Diagnosis of H. suis Infection Using Detection of HsvA Antigen Peptide)

    [0132] Whether or not a subject is infected with H. suis can be determined by confirming the presence of an H. suis-derived protein (particularly, HsvA protein) in a sample derived from the subject. The detection of H. suis using the HsvA protein can be performed by a method similar to the aforementioned method using the detection of the HsvA protein-specific antibody.

    [0133] The method for determining the presence of H. suis of the present invention may comprise, for example:

    (a) contacting a sample with a labeled anti-HsvA antibody or immunoreactive fragment thereof;
    (b) detecting the label on a bound antibody; and
    (c) determining the sample in which the label has been detected, as a sample having H. suis, and determining the sample in which the binding has not been detected, as a sample having no H. suis, and thereby determining the presence of H. suis.

    [0134] The method for determining infection of a subject with H. suis of the present invention may comprise, for example:

    (a) contacting a sample derived from the subject with a labeled anti-HsvA antibody or immunoreactive fragment thereof;
    (b) detecting the label on a bound antibody; and
    (c) determining the subject from which the sample in which the label has been detected is derived, to be infected with H. suis, and/or determining the subject from which the sample in which the label has not been detected is derived, to be not infected with H. suis.

    [0135] Alternatively, the method for determining the presence of H. suis of the present invention may comprise, for example:

    (a) contacting a sample with an anti-HsvA antibody or an immunoreactive fragment thereof;
    (b) contacting the sample obtained by the step (a) with a labeled anti-HsvA antibody or immunoreactive fragment thereof which is different from said anti-HsvA antibody or said immunoreactive fragment thereof;
    (c) measuring or detecting the label on a bound antibody; and
    (d) determining the sample in which the binding has been measured or detected, as a sample having H. suis, and determining the sample in which the binding has not been measured or detected, as a sample having no H. suis, and thereby determining the presence of H. suis.

    [0136] The method for determining infection of a subject with H. suis of the present invention may comprise, for example:

    (a) contacting a sample derived from the subject with an anti-HsvA antibody or an immunoreactive fragment thereof;
    (b) contacting the sample obtained by the step (a) with a labeled anti-HsvA antibody or immunoreactive fragment thereof which is different from said anti-HsvA antibody or said immunoreactive fragment thereof;
    (c) measuring or detecting the label on a bound antibody; and
    (d) determining the subject from which the sample in which the binding has been measured or detected is derived, to be infected with H. suis, and/or determining the subject from which the sample in which the binding has not been measured or detected is derived, to be not infected with H. suis.

    [0137] The labeling of the antibody or the fragment thereof can be performed by a general method in the art. For example, in fluorescently labeling a protein or a peptide, the protein or the peptide is washed with a phosphate buffer solution. Then, a dye prepared with DMSO, a buffer solution, or the like is added thereto and mixed. Then, the mixture can be left standing at room temperature for 10 minutes for binding. Alternatively, the labeling may be performed using a commercially available labeling kit such as a biotin labeling kit (Biotin Labeling Kit-NH2 or Biotin Labeling Kit-SH; Dojindo Laboratories), an alkaline phosphatase labeling kit (Alkaline Phosphatase Labeling Kit-NH2 or Alkaline Phosphatase Labeling Kit-SH; Dojindo Laboratories), a peroxidase labeling kit (Peroxidase Labeling Kit-NH2 or Peroxidase Labeling Kit-NH2; Dojindo Laboratories), a phycobiliprotein labeling kit (Allophycocyanin Labeling Kit-NH2, Allophycocyanin Labeling Kit-SH, B-Phycoerythrin Labeling Kit-NH2, B-Phycoerythrin Labeling Kit-SH, R-Phycoerythrin Labeling Kit-NH2, or R-Phycoerythrin Labeling Kit-SH; Dojindo Laboratories), a fluorescent labeling kit (Fluorescein Labeling Kit-NH2, HiLyte Fluor® 555 Labeling Kit-NH2, or HiLyte Fluor® 647 Labeling Kit-NH2; Dojindo Laboratories), DyLight 547, DyLight 647 (Techno Chemical Corp.), Zenon® Alexa Fluor® antibody labeling kit or Qdot® antibody labeling kit (Invitrogen Corp.), EZ-Label Protein Labeling Kit (Funakoshi Co., Ltd.). The labeled antibody or fragment thereof can be appropriately detected using an instrument suitable for the label.

    [0138] H. suis infects a wide range of mammals. Therefore, the subject in the method for determining the presence of H. suis and the method for determining infection with H. suis described herein can be a mammal such as a human, a monkey, a pig, a cat, a dog, a rabbit, or sheep and is preferably a human, more preferably a human patient with gastritis, chronic gastritis, nodular gastritis, gastric MALT lymphoma, diffuse large B-cell lymphoma, stomach cancer, gastric or duodenal ulcer, idiopathic thrombocytopenic purpura, or functional dyspepsia. The method of the present invention can be performed qualitatively, quantitatively or semi-quantitatively.

    [0139] For example, a tissue specimen collected from a subject by biopsy or a liquid collected from a subject can be used as the sample in the method for determining the presence of H. suis described herein. The sample is not particularly limited as long as the sample can be targeted by the method of the present invention. Examples thereof can include tissues, blood, plasma, serum, lymph, urine, feces, serous fluid, spinal fluid, joint fluid, aqueous humor, tears, saliva and fractionated or treated products thereof. When a nucleic acid is to be detected in the method for determining the presence of H. suis described herein, the sample is preferably a tissue (particularly, a gastric tissue (gastric biopsy sample)) or feces. When an antibody is to be detected in the method for determining the presence of H. suis described herein, the sample is preferably blood, plasma, serum, lymph, or urine.

    [0140] The peptide, the nucleic acid molecule, and the antibody or the immunoreactive fragment thereof of the present invention can be appropriately prepared by methods well known to those skilled in the art with reference to the disclosure herein. The composition and the kit of the present invention can be appropriately produced by methods well known in the technical field.

    [0141] The nucleic acid molecule and the antibody or the immunoreactive fragment thereof of the present invention specifically binds to H. suis. Therefore, for example, siRNA, antisense DNA or RNA, a neutralizing antibody or an immunoreactive fragment thereof, or a non-neutralizing antibody can be selected and thereby used as a pharmaceutical composition for removing H. suis from the body of a subject infected with H. suis, or for defending against H. suis infection. For example, the nucleic acid molecule and the antibody or the immunoreactive fragment thereof of the present invention can be purified, if necessary, then formulated according to a routine method, and thereby used as a pharmaceutical composition for treatment or prevention of a disease or disorder involving H. suis infection contributing to its development or exacerbation. The present invention also includes use of the nucleic acid molecule and the antibody or the immunoreactive fragment thereof of the present invention for producing an H. suis removing agent, or a therapeutic drug or a prophylactic drug for a disease or disorder involving H. suis infection contributing to its development or exacerbation. Alternatively, the present invention includes use of the nucleic acid molecule and the antibody or the immunoreactive fragment thereof of the present invention for removal of an H. suis, or a treatment or prevention of a disease or disorder involving H. suis infection contributing to its development or exacerbation. The present invention further relates to a method for removing H. suis, or a method for treating or preventing a disease or disorder involving H. suis infection contributing to its development or exacerbation, comprising administering the antibody of the present invention or the immunoreactive fragment thereof. The disease or the disorder involving H. suis infection contributing to its development or exacerbation herein includes gastritis, chronic gastritis, nodular gastritis, gastric MALT lymphoma, diffuse large B-cell lymphoma, stomach cancer, gastric or duodenal ulcer, idiopathic thrombocytopenic purpura, and functional dyspepsia. In the description above, “removal of H. suis” means that H. suis is removed from the body of a subject infected with H. suis. For use as a pharmaceutical composition, preferably, the antibody is humanized or a complete human antibody.

    [0142] The pharmaceutical composition of the present invention may adopt any oral or parenteral preparation as long as the preparation can be administered to a patient. Examples of the composition for parenteral administration can include eye drops, injections, nasal drops, suppositories, patches, and ointments. An injection is preferred. Examples of the dosage form of the pharmaceutical composition of the present invention can include liquid preparations and freeze-dried preparations. For use as an injection, the pharmaceutical composition of the present invention can be supplemented, if necessary, with additives including solubilizers such as propylene glycol and ethylenediamine, buffers such as phosphate, tonicity agents such as sodium chloride and glycerin, stabilizers such as sulfite, preservatives such as phenol, and soothing agents such as lidocaine (see “Japanese Pharmaceutical Excipients Directory” Yakuji Nippo, Ltd. and “Handbook of Pharmaceutical Excipients Fifth Edition” APhA Publications). For use of the pharmaceutical composition of the present invention as an injection, examples of the storage container can include ampules, vials, prefilled syringes, pen-shaped cartridges for syringes, and bags for intravenous drips.

    [0143] The pharmaceutical composition (therapeutic drug or prophylactic drug) of the present invention can be used as, for example, an injection which encompasses dosage forms such as intravenous injections, subcutaneous injections, intracutaneous injections, intramuscular injections, intravitreal injections, and drip injections. Such an injection can be prepared according to a known method, for example, by dissolving, suspending or emulsifying the antibody, etc. in a sterile aqueous or oily liquid usually used in injections. For example, physiological saline or an isotonic liquid containing glucose, sucrose, mannitol, or other pharmaceutical adjuvants can be used as the injectable aqueous liquid and can be used in combination with an appropriate solubilizer, for example, an alcohol (e.g., ethanol), a polyalcohol (e.g., propylene glycol and polyethylene glycol), or a nonionic surfactant [e.g., polysorbate 80, polysorbate 20, and HCO-50 (polyoxyethylene (50 mol) adduct of hydrogenated castor oil)]. For example, sesame oil or soybean oil can be used as the oily liquid and can be used in combination with a solubilizer such as benzyl benzoate or benzyl alcohol. The prepared injection liquid is filled into an appropriate ampule, vial, or syringe. Alternatively, an appropriate excipient may be added to the antibody of the present invention or the immunoreactive fragment thereof to prepare a freeze-dried preparation, which can be dissolved in injectable water, physiological saline, or the like in use and formulated as an injection liquid. In general, the oral administration of a protein such as an antibody is difficult because the protein is degraded by a digestive organ. However, the oral administration may be possible by making the best use of an antibody fragment or a modified antibody fragment and a dosage form. Examples of the preparation for oral administration can include capsules, tablets, syrups, and granules.

    [0144] The pharmaceutical composition of the present invention is suitably prepared into a dosage form in a dosage unit adaptable to the amount of the active component administered. Examples of such a dosage form in a dosage unit include injections (ampules, vials, and prefilled syringes). Usually, 5 to 500 mg, 5 to 100 mg, or 10 to 250 mg of the antibody of the present invention or the immunoreactive fragment thereof may be contained per dosage unit of the dosage form.

    [0145] The pharmaceutical composition (therapeutic drug or prophylactic drug) of the present invention may be administered locally or systemically. The administration method is not particularly limited, and the pharmaceutical composition is administered parenterally or orally as mentioned above.

    [0146] Examples of the parenteral administration route include intraocular administration, subcutaneous administration, intraperitoneal administration, injection or intravenous drips into blood (intravenous or intraarterial) or spinal fluid. Administration into blood is preferred. The pharmaceutical composition (therapeutic drug or prophylactic drug) of the present invention may be temporarily administered or may be continuously or intermittently administered. The administration may be, for example, continuous administration for 1 minute to 2 weeks.

    [0147] The amount of the pharmaceutical composition of the present invention administered is not particularly limited as long as the amount produces the desired therapeutic effect or prophylactic effect. The amount of the pharmaceutical composition administered can be appropriately determined depending on symptoms, sex, age, etc. For example, the amount of the pharmaceutical composition of the present invention administered can be determined using, as an index, a therapeutic effect or a prophylactic effect on the disease or the disorder involving cAMP contributing to its development or exacerbation. For use in, for example, prevention and/or treatment of a patient with the disease or the disorder involving cAMP contributing to its development or exacerbation, the pharmaceutical composition of the present invention is conveniently administered approximately one to ten times a month, preferably approximately one to five times a month, by intravenous injection at usually approximately 0.01 to 20 mg/kg body weight, preferably approximately 0.1 to 10 mg/kg body weight, more preferably approximately 0.1 to 5 mg/kg body weight, in terms of a single dose of the active ingredient. For other parenteral administration and oral administration approaches, an amount conforming thereto can be administered. Particularly, for severe symptoms, the amount or the number of doses may be increased according to the symptoms.

    EXAMPLES

    [0148] Hereinafter, the present invention will be specifically described with reference to Examples. However, the present invention is not limited thereby. All literatures cited herein are incorporated herein by reference in their entirety.

    (Example 1) Detection by PCR

    [0149] (1) Preparation of DNA

    [0150] (1)-1. H. pylori

    [0151] Eleven strains (SS1, TN2GF4, RC-1, ATCC43579, NCTC11637, TK1029, TK1081, TY1289, and TY281) were used as H. pylori. A bacterial liquid preserved at −80° C. was applied to Nissui Plate/Helicobacter Agar medium (Nissui Pharmaceutical Co., Ltd., Tokyo, Japan) and cultured at 37° C. for 3 days under microaerophilic conditions (5% 02, 10% CO.sub.2, 85% N.sub.2, humidity of 100%). The resulting colonies were suspended in sterile distilled water, treated at 95° C. for 5 minutes, and then centrifuged. The supernatant was used as crude purified chromosomal DNA. The crude purified chromosomal DNA was extracted with an equal amount of phenol:chloroform:isoamyl alcohol (25:24:1), then purified by ethanol precipitation, and dissolved in a small amount of sterile distilled water. The DNA concentration of the final product was determined according to the following expression by the measurement of absorbance at 260 nm (A260).


    DNA concentration (μg/mL)=A260×50 (optical path length: 10 mm)

    [0152] (1)-2. H. suis

    [0153] Two strains (TKY and SNTW101) were used as H. suis. A female C57BL/6 mouse (Charles River Laboratories Japan, Inc., Yokohama, Japan) infected with H. suis was anatomized, and the greater curvature of the stomach was cut open. The contents were washed with PBS, and the mucosa was scraped using a glass slide. The mucosa was rubbed between opaque glass portions of two glass slides to prepare a suspension. DNA of the mouse gastric mucosa containing the bacterium was prepared using DNeasy Blood & Tissue kit (Qiagen N.V., Hilden, Germany). The DNA concentration of the final product was determined according to the following expression by the measurement of absorbance at 260 nm (A260).


    DNA concentration (μg/mL)=A260×50 (optical path length: 10 mm)

    [0154] (1)-3. H. felis, H. mustelae, H. Heilmannii s.s. (H. heilmannii Sensu Stricto), H. baculiformis, H. Bizzozeronii, H. Cynogastricus, and H. salmonis

    [0155] A bacterial liquid preserved at −80° C. was suspended in sterile distilled water, treated at 95° C. for 5 minutes, and then centrifuged. The supernatant was used as crude purified chromosomal DNA. The crude purified chromosomal DNA was extracted with an equal amount of phenol:chloroform:isoamyl alcohol (25:24:1), then purified by ethanol precipitation, and dissolved in a small amount of sterile distilled water.

    [0156] (2) PCR

    [0157] (2)-1. PCR

    [0158] A reaction solution (254 in total) having the following composition was subjected to PCR reaction in duplicate using Dream Taq DNA Polymerase (Thermo Fisher Scientific Inc.): 2.54 of a 10×buffer solution, 0.54 of 10 mM dNTP mix, 14 of a forward (FW) primer (5 μM), 14 of a reverse (RV) primer, 1 μL of template DNA (1 ng and 10 ng of each H. pylori (SS1, TN2GF4, RC-1, ATCC43579, NCTC11637, TK1029, TK1081, TY1289, and TY281 strains) DNA, and 10.sup.−3 ng, 10.sup.−2 ng, 10.sup.−1 ng, 1 ng, 10 ng, and 100 ng of each DNA prepared from the gastric biopsy of H. suis (SNTW101 and TKY strains)-infected mice), 0.25 μL of DNA polymerase, and 16.75 μL of sterile distilled water. The PCR reaction conditions was holding at 95° C. for 1 minute, then 35 cycles of 95° C. for 30 seconds, 55° C. for 30 seconds and 72° C. for 1 minute, and then keeping at 72° C. for 5 minutes.

    [0159] Primers were designed from regions having high identity among H. suis strains and lacking identity to other bacterial species by comparing the H. suis hsvA gene with an autotransporter protein similar to VacA present in H. felis, H. bizzozeronii, and H. pylori. The designed primers were as follows.

    TABLE-US-00006 (Forward primer) (SEQ ID NO: 51) HSVANOFW-2: AGAAACGAGATTACAGGAAG (SEQ ID NO: 52) HSVANOFW-3: AGGAGCAAGTTTTGTAGCAG (SEQ ID NO: 53) HSVANOFW-5: AAAATGCGACTGATTGGATG (Reverse primer) (SEQ ID NO: 72) HSVANORV-1: ATCGAAATAAGCGAACCTCA (SEQ ID NO: 73) HSVANORV-3: TTGAAAGCTTAGCTAAACGG (SEQ ID NO: 74) HSVANORV4: TGGTATTGCTGGTTAAGAGG

    [0160] The following primers were used as primers amplifying the H. pylori vacA gene (Matsui H et al., Helicobacter. (2014) 19 (4): 260-71).

    TABLE-US-00007 (SEQ ID NO: 84) VAC3624F (forward): GAGCGAGCTATGGTTATGAC (SEQ ID NO: 85) VAC4041R (reverse): CATTCCTAAATTGGAAGCGAA

    [0161] 104 of each obtained amplification product was electrophoresed on 1.5% agarose gel and stained with ethidium bromide to confirm an amplified band.

    [0162] (2)-2. Real-Time PCR

    [0163] A double quencher probe (PrimeTime® qPCR Probes) having the sequence given below was synthesized by outsourcing to Integrated DNA Technologies, Inc. (IDT). Since the primers FW5 and RW3 mentioned above have high identity among H. suis strains, new primers were designed from the same regions.

    TABLE-US-00008 Probe: (SEQ ID NO: 75) FAM/TGTACACAC/ZEN/CAAACAGATGAGCCGT/3IABkFQ Forward: (SEQ ID NO: 47) GATGGGCGCTTCTGGTTTA Reverse: (SEQ ID NO: 65) CTGGTAATGCATCATTAGAAGCAAA

    [0164] PCR reaction was performed under the following conditions using the probe (final concentration: 0.25 μM), the primers (final concentration: 0.5 μM), and PCR master mix: PrimeTime Gene Expression Master Mix (Integrated DNA Technologies, Inc. (IDT)) as well as QuantStudio (Applied Biosystems, Inc.) according to the IDT attached protocol.

    95° C. for 3 minutes, 1 cycle
    95° C. for 15 seconds—60° C. for 1 minute, 40 cycles

    [0165] (3) Results

    [0166] A calibration curve was prepared beforehand using plasmids into which a target region was cloned. As a result, favorable amplification efficiency and quantitativeness were exhibited from 10.sup.2 copies to 10.sup.7 copies (not shown). Results of PCR using H. pylori DNA and gastric biopsied tissue DNA of H. suis-infected mouse are shown in FIG. 5. All the combinations of designed primers HSVANOFW-2/HSVANORV-4, HSVANOFW-3/HSVANORV-4, and HSVANOFW-5/HSVANORV-4 specifically amplified H. suis DNA and did not amplify H. pylori DNA. On the other hand, primers designed for H. pylori vacA amplified only H. pylori DNA and did not amplify H. suis DNA.

    [0167] Results of quantitative PCR using gastric biopsied tissue DNA of an H. suis-infected mouse showed favorable amplification efficiency in amounts of DNA from 100 ng to 10.sup.−2 ng (not shown). 6.9×10.sup.5 copies per 10 ng of DNA from the H. suis SNTW101 strain, 3.7×10.sup.5 copies per 10 ng of DNA from the H. suis TKY strain, 1.5×10.sup.3 copies per 10 ng of DNA from the H. suis SH8 strain, and 4.2×10.sup.3 copies per 10 ng of DNA from the H. suis SH10 strain were obtained. On the other hand, no amplification was observed in H. pylori DNA (SS1, TN2GF4, RC-1, ATCC43579, NCTC11637, TK1029, TK1081, TY1289, and TY281 strains). Likewise, H. felis, H. mustelae, H. heilmannii s.s. ASB1.4, H. baculiformis, H. bizzozeronii, H. cynogastricus, or H. salmonis chromosomal DNA used as a template was not amplified. No amplification was found for H. pylori (SS1, TN2GF4, NCTC11637, ATCC43579, RC-1, TK1029, TK1081, TY1289, and TY281 strains), H. felis, H. mustelae, H. heilmannii sensu stricto (H. heilmannii s.s. ASB1.4), H. baculiformis, H. bizzozeronii, H. cynogastricus, and H. salmonis. Only the H. suis-infected mouse-derived gastric mucosa DNA was amplified.

    [0168] These results demonstrated that all the designed primer sets enable H. suis infection to be diagnosed by discrimination from H. pylori, H. felis, H. mustelae, H. heilmannii s.s. ASB1.4, H. baculiformis, H. bizzozeronii, H. cynogastricus, and H. salmonis.

    (Example 2) Peptide Synthesis and Antibody Preparation

    [0169] H. suis was successfully detected specifically by PCR. Therefore, in consideration of the possibility that HsvA was expressed, a study was conducted on whether to be able to diagnose H. suis infection by targeting HsvA.

    [0170] (1) Peptide Synthesis

    [0171] From the putative amino acid sequence of HsvA (SEQ ID NO: 2; FIG. 2), presumably antigenic peptide sequences were selected and synthesized based on the specificity of the bacterial species and conservation among strains.

    TABLE-US-00009 (SEQ ID NO: 3) No. 11: EKKAVQQMENSNPD (SEQ ID NO: 4) No. 11 (TKY): EKKAVEQMENSNPD (SEQ ID NO: 5) No. 11 (SH8): EKDAVTSLKNSNSG (SEQ ID NO: 6) No. 11 (SH10): EKDAVTSLENSNSG (SEQ ID NO: 7) No. 19: NQGTLEFLSNDVSN (SEQ ID NO: 8) No. 19 (TKY): NQGTLEFLSNDVST (SEQ ID NO: 9) No. 33: LSNKLQGQLKSMGL (SEQ ID NO: 10) No. 33 (TKY): LSNKLQDQLKSMGL (SEQ ID NO: 11) No. 33 (SH10): FSDKLQNMLKSLNM (SEQ ID NO: 12) No. 16: TNGQEVSASIDYNK (SEQ ID NO: 13) No. 23: AKLSNFASNDALPD (SEQ ID NO: 14) No. 10: PTTSSGASPDSSNP (SEQ ID NO: 15) No. 21: GLGRDLFVHSMGDK (SEQ ID NO: 16) No. 15: QIGKIKLSDVLSAS (SEQ ID NO: 17) No. 34: YGAIDKELHFSGGK (SEQ ID NO: 18) No. 20: NVDNILNMPSTTSG (SEQ ID NO: 19) No. 22: GNLKGVYYPKSSTT (SEQ ID NO: 20) No. 14: ITEKIQSGKLTITI (SEQ ID NO: 21) No. 26: FHDFLVSLKGKKFA (SEQ ID NO: 22) No. 31: TTGGEVRLFRSFYV (SEQ ID NO: 23) No. 35: IGARFGLDYQDINI (SEQ ID NO: 86) No. 8: KQLPQPKRSELKPK (SEQ ID NO: 87) No. 31N: TNIKQYMQNNHRSQ (SEQ ID NO: 88) No. 81: TLTLEGTETFAQNS (SEQ ID NO: 89) No. 63: EAYAKNQGDIWSTI (SEQ ID NO: 90) No. 73: VIGSKSSITLNSAN (SEQ ID NO: 91) No. 61: ADIQSSQTTFANSV

    [0172] (2) Antibody Preparation

    [0173] Cysteine (C) was added to the amino terminus of each 14-mer peptide of No. 10, No. 11, No. 16, No. 19, No. 33, or No. 61 among the sequences selected above to synthesize peptides. A rabbit (New Zealand White) was immunized with using keyhole limpet hemocyanin (KLH) as a carrier to obtain an ELISA titer of 1:512,000 or more. The immunized rabbit serum was purified through an affinity column bound with Protein G. A recovered IgG fraction was used as an anti-peptide rabbit antibody (polyclonal antibody) in the following experiment.

    [0174] (4) Preparation of H. pylori Antigen for ELISA

    [0175] H. pylori was shake-cultured at a temperature of 37° C. and a humidity of 100% for 48 hours under microaerophilic conditions (5% 02, 10% CO.sub.2, 85% N.sub.2) in brucella broth containing 10% fetal calf serum (FCS). Then, the culture solution was centrifuged to collect bacterial cells. The bacterial cells were washed three times with sterilized distilled water to remove lipopolysaccharide components. A small amount of the bacterial cells was suspended in sterilized distilled water.

    [0176] (5) Quantification of Protein

    [0177] Proteins were quantified using Bio-Rad protein assay kit and a 96-well plate. Bovine serum albumin (BSA) was used as a standard protein in calibration curve preparation.

    (Example 3) Measurement of Anti-H. suis Antibody Titer in Infected Subject (Human) Using ELISA (Enzyme-Linked Immunosorbent Assay; Enzyme Immunoassay)

    [0178] Each peptide dissolved in a 0.2 M carbonate-bicarbonate buffer solution (pH 9.4) or the H. pylori whole cells (4 μg/mL) prepared in Example 2(4) were added dropwise at 100 μL/well to 96-well NUNC-Immuno Plate #439454 and left overnight at 4° C. On the next day, the peptide solution was discarded, and the plate was washed three times with 200 μL/well of PBS-T (phosphate-buffered saline containing 0.05% (V/V) Tween 20, pH 7.4). Nacalai Tesque blocking solution (PBS-based, pH 7.2) diluted 5-fold with sterile distilled water was added dropwise at 200 μL/well and left at 37° C. for 1 hour. The blocking solution was discarded, and the plate was washed three times with 200 μL/well of PBS-T (phosphate-buffered saline containing 0.05% (V/V) Tween 20, pH 7.4).

    [0179] Serum was collected from each of subjects infected with H. pylori and subjects infected with H. suis. Also, serum was collected as a control from uninfected healthy persons (non-infected). Each human serum diluted using Nacalai Tesque blocking solution (PBS-based, pH 7.2) diluted 10-fold with sterile distilled water was added dropwise at 100 μL/well and left at 37° C. for 1 hour. The serum solution was discarded, and the plate was washed three times with 200 μL/well of PBS-T (phosphate-buffered saline containing 0.05% (V/V) Tween 20, pH 7.4). A horseradish peroxidase-labeled secondary antibody (Goat anti-Human IgG, Jackson ImmunoResearch Inc.) diluted 100,000-fold using Nacalai Tesque blocking solution (PBS-based, pH 7.2) diluted 10-fold with sterile distilled water was added dropwise at 100 μL/well and left at 37° C. for 1 hour. The secondary antibody solution was discarded, and the plate was washed three times with 200 μL/well of PBS-T (phosphate-buffered saline containing 0.05% (V/V) Tween 20, pH 7.4). SuperBlue TMB Microwell Peroxidase Substrate (1-Component) from Kirkegaard & Perry Laboratories, Inc. (KPL) was added dropwise at 100 μL/well for development of blue color, which was then turned into yellow color by the dropwise addition of 1 N hydrochloric acid at 100 μL/well. Absorbance at 450 nm was measured using a plate reader.

    [0180] The results of ELISA using the human serum are shown in FIGS. 6 to 9. The H. suis-positive subjects had high antibody titers against the HsvA antigen peptide, whereas the subjects infected with H. pylori and non-infected subjects without H. suis infection had low antibody titers against the HsvA antigen peptide. The antibody titers against the H. pylori whole cells were high in the subjects infected with H. pylori and were low in the subjects infected with H. suis and the non-infected subjects. This showed for the first time that: H. suis expresses the hsvA gene in the human body; and an antibody against the HsvA protein is produced in the blood of a human infected with H. suis. This demonstrated that use of the HsvA antigen peptide enables H. suis infection to be diagnosed by discrimination from H. pylori infection in humans.

    (Example 4) Measurement of Anti-H. suis Antibody Titer in Infected Mouse Using Sandwich ELISA

    [0181] The antibody against each peptide of Nos. 11, 19, and 33 (1 μg/mL) dissolved in a 0.2 M carbonate-bicarbonate buffer solution (pH 9.4) was added dropwise at 100 μL/well to 96-well NUNC-Immuno Plate #439454 and left overnight at 4° C. On the next day, the antibody solution was discarded, and the plate was washed three times with 200 μL/well of PBS-T (phosphate-buffered saline containing 0.05% (V/V) Tween 20, pH 7.4). Nacalai Tesque blocking solution (phosphate buffer solution-based, pH 7.2) diluted 5-fold with sterile distilled water was added dropwise at 200 μL/well and left at 37° C. for 1 hour. The blocking solution was discarded, and the plate was washed three times with 200 μL/well of PBS-T (phosphate-buffered saline containing 0.05% (V/V) Tween 20, pH 7.4). Each peptide of Nos. 11, 19, and 33 (4 μg/mL) diluted using Nacalai Tesque blocking solution (phosphate buffer solution-based, pH 7.2) diluted 10-fold with sterile distilled water was added dropwise at 100 μL/well and left at 37° C. for 1 hour. The peptide solution was discarded, and the plate was washed three times with 200 μL/well of PBS-T (phosphate-buffered saline containing 0.05% (V/V) Tween 20, pH 7.4). Mouse serum diluted using Nacalai Tesque blocking solution (PBS-based, pH 7.2) diluted 10-fold with exchange water was added dropwise at 100 μL/well and left at 37° C. for 1 hour. The serum solution was discarded, and the plate was washed three times with 200 μL/well of PBS-T (phosphate-buffered saline containing 0.05% (V/V) Tween 20, pH 7.4). A horseradish peroxidase-labeled secondary antibody (Donkey Anti-Mouse IgG, Jackson ImmunoResearch Inc.) diluted 100,000-fold using Nacalai Tesque blocking solution (phosphate buffer solution-based, pH 7.2) diluted 10-fold with sterile distilled water was added dropwise at 100 μL/well and left at 37° C. for 1 hour. The secondary antibody solution was discarded, and the plate was washed three times with 200 μL/well of PBS-T (phosphate-buffered saline containing 0.05% (V/V) Tween 20, pH 7.4). SuperBlue TMB Microwell Peroxidase Substrate (1-Component) from Kirkegaard & Perry Laboratories, Inc. (KPL) was added dropwise at 100 μL/well for development of blue color, which was then turned into yellow color by the dropwise addition of 1 N hydrochloric acid at 100 μL/well. Absorbance at 450 nm was measured using a plate reader.

    [0182] The results of measuring the binding titers of antibodies in the serum of mice infected with an H. suis TKY or H. pylori SS1 strain against the peptides by ELISA and sandwich ELISA are shown in FIGS. 10 and 11, respectively. In both the systems, high antibody titers specific for the HsvA protein-derived peptides were found in the H. suis-infected mouse serum. This showed for the first time that: H. suis expresses the HsvA protein in the mouse body; and an antibody against the HsvA protein is produced in the blood of a mouse infected with H. suis. This demonstrated that use of the HsvA-specific antigen peptide also enables H. suis infection to be diagnosed by discrimination from H. pylori infection in mice.

    (Example 5) Measurement of Specificity of Peptide Antibody Using ELISA (Enzyme-Linked Immunosorbent Assay; Enzyme Immunoassay)

    [0183] Each peptide of Nos. 11, 19 and 33 (4 μg/mL) dissolved in a 0.2 M carbonate-bicarbonate buffer solution (pH 9.4) or H. pylori whole cells were added dropwise at 100 μL/well to 96-well NUNC-Immuno Plate #439454 and left overnight at 4° C. On the next day, the peptide solution was discarded, and the plate was washed three times with 200 μL/well of PBS-T (phosphate-buffered saline containing 0.05% (V/V) Tween 20, pH 7.4). Nacalai Tesque blocking solution (phosphate buffer solution-based, pH 7.2) diluted 5-fold with sterile distilled water was added dropwise at 200 μL/well and left at 37° C. for 1 hour. The blocking solution was discarded, and the plate was washed three times with 200 μL/well of PBS-T (phosphate-buffered saline containing 0.05% (V/V) Tween 20, pH 7.4). Each anti-peptide antibody (1 μg/mL) obtained in Example 2(2) diluted using Nacalai Tesque blocking solution (phosphate buffer solution-based, pH 7.2) diluted 10-fold with exchange water was added dropwise at 100 μL/well and left at 37° C. for 1 hour. The serum solution was discarded, and the plate was washed three times with 200 μL/well of PBS-T (phosphate-buffered saline containing 0.05% (V/V) Tween 20, pH 7.4). A horseradish peroxidase-labeled secondary antibody (Goat anti-Rabbit IgG, Jackson ImmunoResearch Inc.) diluted 100,000-fold using Nacalai Tesque blocking solution (PBS-based, pH 7.2) diluted 10-fold with exchange water was added dropwise at 100 μL/well and left at 37° C. for 1 hour. The secondary antibody solution was discarded, and the plate was washed three times with 200 μL/well of PBS-T (phosphate-buffered saline containing 0.05% (V/V) Tween 20, pH 7.4). SuperBlue TMB Microwell Peroxidase Substrate (1-Component) from Kirkegaard & Perry Laboratories, Inc. (KPL) was added dropwise at 100 μL/well for development of blue color, which was then turned into yellow color by the dropwise addition of 1 N hydrochloric acid at 100 μL/well. Absorbance at 450 nm was measured using a plate reader.

    [0184] The results of measuring the binding of the anti-peptide rabbit antibodies prepared in Example 2 onto wells bound with each antigen (H. suis HsvA antigen peptide (Nos. 11, 19 and 33) or H. pylori whole cells (TN2GF4 and SS1 strains)) are shown in FIG. 12. The antibody against peptide No. 11 (SEQ ID NO: 3), peptide No. 33 (SEQ ID NO: 9), or peptide No. 19 (SEQ ID NO: 7) specifically exhibited strong binding to the peptide used as antigen in the preparation of this antibody, and on the other hand, exhibited only weak binding to the H. pylori whole cells. Particularly, the antibody against No. 11 peptide exhibited low nonspecific binding strength against the H. pylori whole cells.

    (Example 6) Immunostaining Using Anti-No. 11 Peptide Antibody

    [0185] A gastric paraffin section of an H. suis-infected human was deparaffinized by dipping in xylene three times, dehydrated ethanol once, 90% ethanol once, 80% ethanol once, and pure water once (5 minutes each) in order. Phosphate-buffered saline containing 1% (W/V) skimmed milk, pH 7.2 was added dropwise to the deparaffinized glass slide and left at room temperature for 30 minutes for blocking treatment. Subsequently, the glass slide was washed three times with phosphate-buffered saline, pH 7.2 at room temperature for 5 minutes. The anti-No. 11 peptide antibody was diluted into 2 μg/mL with phosphate-buffered saline, pH 7.2, added dropwise to the glass slide, and reacted at room temperature for 3 hours. The antibody solution was removed from the glass slide, which was then washed three times with phosphate-buffered saline, pH 7.2 at room temperature for 5 minutes. Alexa-Fluor 488 anti-rabbit IgG (Thermo Fisher Scientific Inc.) (secondary antibody) diluted 400-fold with phosphate-buffered saline, pH 7.2 was added dropwise to the glass slide and reacted at room temperature for 3 hours. The secondary antibody solution was removed from the glass slide, which was then washed three times with phosphate-buffered saline, pH 7.2 at room temperature for 5 minutes. Alexa-Fluor 568 phalloidin (Thermo Fisher Scientific Inc.) diluted 400-fold with phosphate-buffered saline, pH 7.2 was added dropwise to the glass slide and reacted at room temperature for 30 minutes for counterstaining (F actin staining). The secondary antibody solution was removed from the glass slide, which was then washed three times with phosphate-buffered saline, pH 7.2 at room temperature for 5 minutes. The glass slide was mounted to Permaflow (Therma Fisher Scientific Inc.). The glass slide was observed under confocal laser fluorescence microscope Leica TCS-SP5. Photograph A was taken at a 200× magnification. Photograph B was a photograph of the boxed portion of A magnified 760 times. The arrows depict bacterial cells of H. suis.

    [0186] The results are shown in FIG. 13. The bacterial cells in the gastric tissue section of the H. suis-infected patient were stained with the anti-No. 11 peptide antibody. This demonstrated that H. suis infection can be diagnosed by immunohistochemistry using the anti-No. 11 peptide antibody.

    Example 7

    [0187] Each peptide of peptide Nos. 8, 31N, 81, 63, 73, 61, 11+11 (TKY), 11 (SH8), 11 (SH10), 19+19 (TKY), 33+33 (TKY), 33 (SH10), 16, 23, 10, 21, 20, 22, 31, and 35 prepared in Example 2 or H. pylori TN2GF4 or SS1 whole cells (4 μg/mL) were dissolved in a 0.1 M carbonate-bicarbonate buffer solution (pH 9.4), added dropwise at 100 μL/well to a 96-well plate (NUNC-Immuno plate #439454), and left standing overnight at 4° C. On the next day, the peptide solution was discarded, and the plate was washed three times with 200 μL/well of PBS-T (phosphate-buffered saline containing 0.05% (V/V) Tween 20, pH 7.4). A blocking solution (BSA, 1% (W/V) phosphate buffer solution-based, pH 7.4) was added dropwise at 200 μL/well and left standing at 37° C. for 1 hour. The blocking solution was discarded, and the plate was washed three times with 200 μL/well of PBS-T.

    [0188] The serum samples used were serum obtained from H. suis-infected patients (n=4), serum obtained from H. pylori-infected patients (n=5), and serum obtained from non-infected subjects (n=3). Each serum was diluted 1,800-fold (diluted 600-fold and 1800-fold only for reaction with H. pylori test specimens) using Nacalai Tesque blocking solution (phosphate buffer solution-based, pH 7.2) diluted 10-fold with distilled water, added dropwise at 50 μL/well to the plate prepared by the method mentioned above, and left standing at 37° C. for 1 hour. The serum solution was discarded, and the plate was washed three times with 200 μL/well of PBS-T. A horseradish peroxidase-labeled secondary antibody (Peroxidase-conjugated AffiniPure Goat Anti-Human IgG (H+L), Jackson ImmunoResearch Inc.) diluted 100,000-fold using Nacalai Tesque blocking solution (phosphate buffer solution-based, pH 7.2) diluted 10-fold with distilled water was added dropwise at 50 μL/well and left standing at 37° C. for 1 hour. The secondary antibody solution was discarded, and the plate was washed three times with PBS-T. SuperBlue TMB Microwell Peroxidase Substrate (1-Component) (Kirkegaard & Perry Laboratories, Inc. (KPL)) was added dropwise at 50 μL/well for development of blue color, which was then turned into yellow color by the dropwise addition of 1 N hydrochloric acid at 50 μL/well. Absorbance at 450 nm (reference: 630 nm) was measured using a plate reader.

    [0189] The results are shown in FIG. 14. The present ELISA method was able to discriminate positivity (absorbance: 0.5 or more) from negativity (absorbance: 0.5 or less) as to the human serum (H. suis-positive 4 test specimens (patients 5, 6, 7, and 8); H. pylori-positive 5 test specimens (patients 4, 5, 6, 7, and 8); non-infected 3 test specimens (healthy persons 4, 5, and 6) diluted 1800-fold. Ten peptides of Nos. 81, 61, 20, 11+11 (TKY), 11 (SH8), 11 (SH10), 19+19 (TKY), 10, 16, and 23 were found to have high reactivity with the H. suis-positive patient serum (A). On the other hand, the H. pylori-positive patient serum (B) and the non-infected serum (C) reacted with none of the peptides. The H. pylori-infected serum exhibited strong reactivity with the H. pylori whole cells, whereas the H. suis-infected serum did not exhibit reaction therewith (D). This showed that these peptides are exceedingly specific for antibodies against H. suis without reacting with antibodies against H. pylori. Accordingly, these peptides are useful in specific infection diagnosis using antibodies in serum.

    (Example 8) Specificity of Anti-Peptide Antibody Against Each Peptide of Nos. 61, 11, 33, 19, 10, and 16 for Corresponding Antigen Peptide

    [0190] Each peptide of Nos. 8, 31N, 81, 63, 73, 61, 11+11 (TKY), 11 (SH8), 11 (SH10), 19+19 (TKY), 33+33 (TKY), 33 (SH10), 16, 23, 10, 21, 20, 22, 31, and 35 prepared in Example 2 was dissolved (4 μg/mL) in a 0.1 M carbonate-bicarbonate buffer solution (pH 9.4), added dropwise at 100 μL/well to a 96-well plate (NUNC-Immuno plate #439454), and left standing overnight at 4° C. On the next day, the peptide solution was discarded, and the plate was washed three times with 200 μL/well of PBS-T (phosphate-buffered saline containing 0.05% (V/V) Tween 20, pH 7.4). A blocking solution (BSA, 1% (W/V) phosphate buffer solution-based, pH 7.4) was added dropwise at 200 μL/well and left standing at 37° C. for 1 hour. The blocking solution was discarded, and the plate was washed three times with 200 μL/well of PBS-T. The anti-peptide rabbit polyclonal antibody (IgG, 0.2 μg/mL) of Example 2 diluted using Nacalai Tesque blocking solution (phosphate buffer solution-based, pH 7.2) diluted 10-fold with distilled water was added dropwise at 50 μL/well and left standing at 37° C. for 1 hour (n=2). The serum solution was discarded, and the plate was washed three times with 200 μL/well of PBS-T. A horseradish peroxidase-labeled secondary antibody (Peroxidase-conjugated AffiniPure Goat Anti-Rabbit IgG (H+L), Jackson ImmunoResearch Inc.) diluted 100,000-fold using Nacalai Tesque blocking solution (phosphate buffer solution-based (pH 7.2) diluted 10-fold with distilled water was added dropwise at 50 μL/well and left standing at 37° C. for 1 hour. The secondary antibody solution was discarded, and the plate was washed three times with PBS-T. SuperBlue TMB Microwell Peroxidase Substrate (1-Component) (Kirkegaard & Perry Laboratories, Inc. (KPL)) was added dropwise at 50 μL/well for development of blue color, which was then turned into yellow color by the dropwise addition of 1 N hydrochloric acid at 50 μL/well. Absorbance at 450 nm (reference: 630 nm) was measured using a plate reader.

    [0191] The results are shown in FIG. 15. The antibody against each peptide was shown to specifically react with only the corresponding peptide used as an antigen.

    (Example 9) Specificity of Anti-Peptide Antibody Against Each Peptide of Nos. 61, 11, 33, 19, 10, and 16 for Bacterial Cells

    [0192] H. pylori SS1, H. pylori TN2GF4, H. pylori NCTC11637, H. pylori TY1289, H. pylori RC-1, H. pylori TK1029, H. pylori TY281, H. pylori ATCC43579, H. pylori TK1081, or H. suis SNTW101 (4 μg/mL) dissolved in a 0.1 M carbonate-bicarbonate buffer solution (pH 9.4) was added dropwise at 100 μL/well to a 96-well plate (NUNC-Immuno plate #439454), and left standing overnight at 4° C. On the next day, the peptide solution was discarded, and the plate was washed three times with 200 μL/well of PBS-T (phosphate-buffered saline containing 0.05% (V/V) Tween 20, pH 7.4). A blocking solution (BSA, 1% (W/V) phosphate buffer solution-based, pH 7.4) was added dropwise at 200 μL/well and left standing at 37° C. for 1 hour. The blocking solution was discarded, and the plate was washed three times with 200 μL/well of PBS-T. The anti-peptide rabbit polyclonal antibody (IgG, 0.2 μg/mL) prepared in Example 2 or a polyclonal antibody against H. pylori SS1 (rabbit IgG) (described in Non Patent Literature 4) diluted using Nacalai Tesque blocking solution (phosphate buffer solution-based, pH 7.2) diluted 10-fold with distilled water was added dropwise at 50 μL/well and left standing at 37° C. for 1 hour (n=2 to 4). The serum solution was discarded, and the plate was washed three times with 200 μL/well of PBS-T. A horseradish peroxidase-labeled secondary antibody (Peroxidase-conjugated AffiniPure Goat Anti-Rabbit IgG (H+L), Jackson ImmunoResearch Inc.) diluted 100,000-fold using Nacalai Tesque blocking solution (phosphate buffer solution-based, pH 7.2) diluted 10-fold with distilled water was added dropwise at 50 μL/well and left standing at 37° C. for 1 hour. The secondary antibody solution was discarded, and the plate was washed three times with PBS-T. SuperBlue TMB Microwell Peroxidase Substrate (1-Component) (Kirkegaard & Perry Laboratories, Inc. (KPL)) was added dropwise at 50 μL/well for development of blue color, which was then turned into yellow color by the dropwise addition of 1 N hydrochloric acid at 50 μL/well. Absorbance at 450 nm (reference: 630 nm) was measured using a plate reader.

    [0193] The results are shown in FIG. 16. The anti-peptide antibody did not react with the bacterial cells of H. pylori. On the other hand, the anti-H. pylori polyclonal antibody reacted with the bacterial cells of H. pylori and H. suis.

    (Example 10) Method for Culturing H. suis SNTW101

    [0194] (1) Separation of H. suis SNTW101 from Gastric Mucosa of Infected Mouse and Culture

    [0195] Culture was performed using a modified medium based on the method of Smet A., et al., International Journal of Systematic and Evolutionary Microbiology (2012), 62, 299-306. 0.05% (V/V) hydrochloric acid and 10 mg/L linezolid were added to Brucella agar plate (2 vials/L Skirrow, 10 mg/L vancomycin, 5 mg/L trimethoprim, 2500 IU/L polymyxin B, 2 vials/L vitox, 5 mg/L amphotericin B, 20% (V/V) fetal calf serum). Shake culture was performed for 2 weeks under conditions of 37° C., a humidity of 100%, 12% CO.sub.2, 5% 02, and 83% N.sub.2. 1504 of Brucella broth (2 vials/L Skirrow, 2 vials/L vitox, 5 mg/L linezolid, 20% (V/V) fetal calf serum, pH 5) was added thereto every other day. The culture solution was centrifuged, and the precipitates were washed three times with water and used as bacterial cells of H. suis SNTW101. Proteins were quantified using Bio-Rad protein assay kit. A calibration curve was prepared using bovine serum albumin (BSA) as a standard protein.

    (Example 11) Immunohistochemistry Using Anti-No. 16 Peptide (SEQ ID NO: 12) Antibody

    [0196] The stomach of an H. suis SNTW101-infected C57BL/6 mouse was cut open along the greater curvature. The contents were washed with PBS, and the stomach was excised in the perpendicular direction and fixed in 10% neutral buffered formalin. A gastric tissue was embedded in paraffin, and 4 μm sections were prepared. The sections were deparaffinized, then washed with water, and heat-treated at 95° C. for 20 minutes using a citrate buffer solution (pH 6.0) for antigen retrieval. The sections were washed with water and then reacted with 0.3% hydrogen peroxide water at room temperature for 10 minutes. The sections were washed twice with PBS and then reacted with the anti-No. 16 peptide antibody (2 μg/mL PBS) at room temperature for 1 hour. The sections were washed twice with PBS and then reacted with Histofine Simple Stain Mouse MAX-PO® (Nichirei Corp., Code. 414341) as a secondary antibody at room temperature for 30 minutes. The sections were washed twice with PBS, followed by color development at room temperature for 5 minutes using a DAB (3,3′-diaminobenzidine tetrahydrochloride) solution. The sections were washed twice with PBS, then poststained with hematoxylin, washed with water, dehydrated, immersed, and mounted for microscopic observation.

    [0197] The results are shown in FIG. 17. The antibody against No. 16 peptide (SEQ ID NO: 12) was shown to be able to immunostain bacterial cells of H. suis.