Mutant Mouse-Derived Pancreatic Organoid and Method for Evaluating Standardized Drug for Efficacy
20210282378 · 2021-09-16
Inventors
Cpc classification
C12Y207/07049
CHEMISTRY; METALLURGY
C12N2533/90
CHEMISTRY; METALLURGY
C12N5/0677
CHEMISTRY; METALLURGY
C12N2503/04
CHEMISTRY; METALLURGY
C12N9/1276
CHEMISTRY; METALLURGY
A01K2217/072
HUMAN NECESSITIES
International classification
Abstract
Provided are three-dimensional pancreatic organoids derived from the pancreas of a genetically mutated mouse, a method for producing the three-dimensional pancreatic organoids, the use of the three-dimensional pancreatic organoids for drug effect verification and/or drug screening, and a universally applicable standardized drug effect evaluation method/drug screening method.
Claims
1. A cancer animal model with deletion of telomerase.
2. The cancer animal model of claim 1, wherein the deletion of telomerase is induced by knockout of telomerase RNA component.
3. The cancer animal model of claim 1, wherein a BRCA2 gene in the cancer animal model is mutated.
4. The cancer animal model of claim 1, wherein the cancer is pancreatic cancer.
5. Cancer organoids produced from the animal model of claim 1.
6. The cancer organoids of claim 5, which are pancreatic cancer organoids.
7. A method for producing cancer organoids, the method comprising steps of: (a) isolating tissue from the animal model of claim 1; and (b) mixing cells, isolated from the tissue, with Matrigel, and culturing the mixed cells to form pre-organoids.
8. The method of claim 7, wherein the tissue is pancreatic tissue.
9. The method of claim 7, further comprising, after step (b), (c) dissociating the pre-organoids with a mechanical stress of 50 to 500 Pa, and (d) re-culturing the dissociated organoids.
10. The method of claim 9, wherein the cancer organoids have a diameter of 100 to 200 μM.
11. A method for verifying an effect of a candidate drug for cancer treatment, the method comprising steps of: (a) producing cancer organoids by the method of claim 7; (b) treating the organoids with the candidate drug for cancer treatment; and (c) measuring a viability of the organoids.
12. The method of claim 11, wherein the cancer is pancreatic cancer.
13. The method of claim 11, wherein the drug is any one or more selected from the group consisting of histone deacetylase inhibitors (HDACi), PARP-1 (poly[ADP-ribose]polymerase 1) inhibitors, and plk1 (polo-like kinase 1) inhibitors.
14. A method for verifying responsiveness to a candidate drug for cancer treatment, the method comprising steps of: (a) producing cancer organoids by the method of claim 7; (b) treating the organoids with the candidate drug for cancer treatment; and (c) identifying expression of a biomarker that binds specifically to either a nucleic acid encoding the tumor suppressor gene p53, or a protein synthesized therefrom.
15. The method of claim 14, wherein the cancer is pancreatic cancer.
16. The method of claim 14, wherein the drug is any one or more selected from the group consisting of histone deacetylase inhibitors (HDACi), PARP-1 (poly[ADP-ribose]polymerase 1) inhibitors, and plk1 (polo-like kinase 1) inhibitors.
17. A method for verifying responsiveness to a candidate drug for cancer treatment, the method comprising steps of: (a) providing cancer organoids according to claim 5; (b) treating the organoids with the candidate drug for cancer treatment; and (c) identifying expression of a biomarker that binds specifically to either a nucleic acid encoding the tumor suppressor gene p53, or a protein synthesized therefrom.
18. A method for verifying an effect of a candidate drug for cancer treatment, the method comprising steps of: (a) providing cancer organoids according to claim 5; (b) treating the organoids with the candidate drug for cancer treatment; and (c) measuring a viability of the organoids.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
[0105]
[0106]
[0107]
[0108]
[0109]
[0110]
[0111]
[0112]
[0113]
[0114]
[0115]
[0116]
BEST MODE FOR CARRYING OUT THE INVENTION
[0117] Conventional two-dimensional cell culture methods have a limitation in that information on derived cancer cell tissue does not accurately reflect an in vivo situation, and conventional organoid drug responsiveness test methods have a technical limitation in that uniform drug treatment is not achieved, resulting in poor accuracy in verifying drug effect. The present disclosure have been made in order to overcome these limitations and is intended to perform anticancer therapeutic research more efficiently and furthermore, to verify drug effect in a uniform and accurate manner. The present disclosure is intended to model cancer closely to in vivo cancer using organoids obtained from normal tissue and cancer tissue of a genetically mutated mouse, and to provide a method of producing uniform organoids from pre-organoids through a post-treatment process in order to usefully apply these organoids to the verification of drug efficacy depending on genetic mutation.
MODE FOR CARRYING OUT THE INVENTION
[0118] The present disclosure will be described in more detail below with reference to examples, but these examples are for illustrative purposes only and are not intended to limit the scope of the present disclosure. It will be obvious to those skilled in the art that the examples described below may be modified without departing from the essential subject matter of the present disclosure.
Example 1: Generation of Pancreatic Organoids Derived from Genetically Mutated Mice
[0119] The following mice were prepared: mice (Brca2.sup.F11/F11; exon 11 deletion) in which BRCA2 gene exon 11 is flanked by loxP through Cre-loxP recombination using bacteriophage P1 and induction of conditional BRCA2 deletion using CreER recombinase is possible (Jos Jonkers, Ralph Meuwissen, Hanneke van der Gulden, Hans Peterse, Martin van der Valk and Anton Berns. 2001. Synergistic tumor suppressor activity of BRCA2 and p53 in a conditional mouse model for breast cancer. Nature Genetics. Vol. 29, pages 418-425); mice (mTR.sup.−/−) lacking telomerase activity due to knockout of telomerase RNA component (TERC) gene; and CMV-Cre mice (CreER™) with a CMV promoter.
[0120] 1.1. Construction of BRCA2 Exon 11-Targeting Vector
[0121] To target the BRCA2 locus, a 13.5-kb λ phage clone including mouse BRCA2 gene (NM_001081001.2) exons 8 to 12 was isolated from a genomic 129/Sv library (Agilent technologies). The phage insert was excised with NotI and subcloned in pGEM5 (Promega). Then, a loxP-PGKneor-PGKtk-loxP dual selection cassette (Thermo Fisher Scientific) was inserted into an AvrII site in mouse BRCA2 gene intron 11, and a single loxP site was inserted into a NspV site in mouse BRCA2 gene intron 10 in a direct orientation relative to the floxed selection cassette.
[0122] 1.2. Construction of Telomerase RNA Component (TERC) Gene-Targeting Vector
[0123] Mice with a complete deletion of telomerase RNA component (TERC) gene (GenBank Accession No. NR_001579.1) were obtained from Jackson Lab (Stock No: 004132, B6.Cg-Terctm1Rdp/J) and used in the following experiment.
[0124] 1.3. Generation of Mice (Brca2.sup.F11/F11; CreER™) with Deletion of BRCA2 Exon 11
[0125] The vector prepared in Example 1.1 above was separated, purified, and electroporated into 129/Ola-derived mouse ES cells of the E14 subclone IB10 (The Netherlands Cancer Institute). Colonies were screened by Southern blot analysis for correct insertion of the floxed selection marker and the single loxP site. The embryonic stem cells were electroporated with a mixture of the Cre expression plasmid pOG231 (Addgene) and PGKpuro (Addgene) in a molar ratio of 10:1 to induce transient Cre recombinase activity and resistance to puromycin. 20 hours after electroporation, puromycin (1.8 μg/ml) was added to medium and incubated for 48 hours. Then, dead cells were removed and surviving embryonic stem cells were cultured for additional 10 days in nonselective medium. The resulting embryonic stem cell clones were analyzed by Southern blotting to detect successful deletion of the floxed marker, insertion of a single loxP site and generation of the conditional allele.
[0126] Germline chimeras were generated by injecting 12 to 15 mutant 129/Ola embryonic stem cells obtained as described above into C57Bl/6 blastocysts and were crossed with FVB/N mice (Jackson Laboratory) to produce outbred heterozygous offspring (BRCA2 conditional mutant). The obtained BRCA2 conditional mutants were crossed with Cre mice (CMV-Cre mice (CreER™) with a CMV promoter; Jackson Laboratory, Stock No. 004847), and Cre-mediated deletion of foxed alleles in the germline was performed to generate BRCA2 conditional deletion mice (Brca2.sup.F11/F11; CreER™ or Brca2.sup.F11/F11; indicated by mTR.sup.+/+; CreER™).
[0127] 1.4. Generation of BRCA2 exon 11-deleted and TERC gene-knockout mice (Brca2.sup.F11/F11; CreER™)
[0128] As described in Example 1.3 above, Brca2.sup.F11/F11; CreER™ mice were obtained from offspring produced by crossing Brca2.sup.F11/F11 mice with CreER™ mice, and Brca2.sup.F11/F11; CreER™; mTR.sup.−/− mice were obtained from offspring produced by crossing the Brca2.sup.F11/F11; CreER™ mice with mTR.sup.−/− mice (Example 1.2), and these mice were crossed to obtain Brca2.sup.F11/F11; CreER™; mTR.sup.−/− mice with Mendelian probability.
[0129] 1.5. Generation of Mice (BubR1.sup.K243R/+) into which BubR1 Gene with K243R Mutation has been Inserted
[0130] Through site-directed mutagenesis, the BubR1 gene mutated by inducing lysine (K)-to-arginine (R) (K243R) at position 243 of BubR1 (GenBank NP_033903.2; coding gene: NM_009773.3) was inserted into 129/Sv embryonic stem cells (Agilent Technologies) using a pBluescript KS(+) vector (Addgene), and the cells were injected into C57BL/6 mouse blastocysts to obtain heterozygous mutant mice (BubR1.sup.K243R/+) into which a mutant gene encoding BubR1 with K243R mutation has been inserted (see Inai Park et al. 2013. Loss of BubR1 acetylation causes defects in spindle assembly checkpoint signaling and promotes tumor formation. Journal of Cell Biology. 202 (2):295).
Example 2: Generation of Pancreatic Organoids Derived from Mutant Mice with Deletion of BRCA2 and/or TERC Gene
[0131] From each of the mutant mice generated in Example 1.3 and Example 1.4, pancreatic organoids were generated in the following manner.
[0132] Each mouse was euthanized and then dissected to obtain pancreatic tissue. As a dissociation solution, a mixture of 3 to 5 mml of HBSS (Hank's Balanced Salt Solution; GIBCO®), 1 mg/ml of collagenase P (Roche) and 0.1 mg/ml of DNase 1 (Sigma Aldrich) was prepared by warming in a water bath at 37° C. The obtained entire mouse pancreatic tissue (Vpan=1.08 mg/mm.sup.3) was transferred into a 100-mm Petri dish. Then, 100 μl of the prepared dissociation solution was added thereto, and the tissue was finely cut 5 to 10 times using scissors or a knife. The finely cut pancreatic tissue (Vpan=1.08 mg/mm.sup.3) was transferred into a 50-ml conical tube, and 3 to 5 ml of the dissolution solution was added thereto. The tube was incubated in a shaking incubator at 230 rpm and 37° C. After 10 to 15 minutes, the tube was taken out and 10 to 15 ml of cold FBS was added thereto. The obtained dissociated pancreatic tissue was passed through a cell strainer having a pore size of 100 μm and washed 2 to 3 times with HBSS. The pancreatic tissue, which did not pass through the cell strainer, was observed under a microscope, and ductal cells were picked and selected. A process of centrifuging the selected ductal cells at 1500 rpm for 10 minutes to collect pellets and then washing the pellets with HBSS was repeated twice.
[0133] The obtained cell pellets and 200 μl of Matrigel (Corning) were mixed together so that a volume ratio of the cell pellets and the Matrigel was 1:5, and then the mixture was seeded into a 12-well or 24-well plate in an amount of 100 to 150 μl per well in the case of the 12-well plate. About one hour after cell seeding, when the Matrigel hardened, a medium was added to the 12-well plate in an amount of 1 ml or to the 24-well plate in an amount of 500 and incubated in an incubator at 37° C. under 10% CO.sub.2 for 48 to 72 hours or longer. The medium used at this time had the following composition: A mixture of DMEM/F-12 (Dulbecco's Modified Eagle Medium/Ham's F-12; Thermo Fisher Scientific) with 1% (vol/vol) penicillin/streptomycin, 10 mM HEPES, 1% GlutaMAX, 1:50 B27 supplement (Gibco), 1 mM N-acetylcysteine, 5% (vol/vol) Rspo 1-conditioned medium (Hans Clevers lab), 10 mM nicotinamide, 10 nM recombinant human [Leu15]-gastrin I (Sigma Aldrich), 50 ng/ml of recombinant mouse EGF (Peptron), 100 ng/ml of recombinant human FGF10 (Peptron), and 25 ng/ml of recombinant human Noggin (Peptron) or 5% (vol/vol) Noggin-conditioned medium (Hans Clevers lab).
[0134] In order to induce deletion of the BRCA2 gene and/or the TERC gene, the organoids were treated with 4-hydroxytamoxifen (4-OHT). Specifically, 4-hydroxytamoxifen (4-OHT) was dissolved in the organoid culture at 400 nM and incubated for 3 weeks or longer, starting from a time point, at which 24 to 48 hours lapsed after the pancreas was initially isolated from the mice and then culture thereof into organoid was constructed, until immediately before a time point at which a drug-treatment experiment was performed for drug screening as described below (see Examples 4 and 5).
[0135] The results of observing the above-described pancreatic organoid culture with an inverted microscope (Zeiss) are shown in
[0136] The genotype of the organoids was identified by performing genomic PCR DNA gel electrophoresis on the genomic DNA extracted by lysis of the obtained pancreatic organoids. Specifically, PCR was performed for 30 cycles, each consisting of denaturation at 95° C. for 1 min, annealing at 55° C. for 30 sec, and elongation at 72° C. for 1 min. For electrophoresis, 5 μl of the PCR product was mixed with 5 μl of bromophenol blue or xylene on 1% (w/v) agarose gel and electrophoresed at 100 mV. The primers used in the PCR are as follows:
TABLE-US-00001 TABLE 1 SEQ ID Primer Nucleic acid sequence (5′.fwdarw.3′) NO Brca2-11F CTCATCATTTGTTGCCTCACTTC 1 Brca2-11R TGTTGGATACAAGGCATGTAC 2 mTR-WT GCACTCCTTACAAGGGACGA 3 mTR-common CTTCAATTTCCTTGGCTTCG 4 mTR-mutant ATTTGTCACGTCCTGCACGACG 5 CRE-3F CGGCATGGTGCAAGTTGAAT 6 CRE-3R CGGTGCTAACCAGCGTTTTC 7 CRE-internal-F CTAGGCCACAGAATTGAAAGATCT 8 CRE-internal-R GTAGGTGGAAATTCTAGCATCATCC 9
[0137] The obtained results are shown in
[0138]
[0139]
Example 3: Generation of Pancreatic Organoids Derived from Heterologous Mutant Mice into which BubR1 Gene with K243R Mutation has been Inserted
[0140] With reference to the method of Example 2, pancreatic organoids were produced from the heterozygous mutant mice (BubR1.sup.K243R/+) which were produced in Example 1.5 above and in which the mutant BubR1 gene with induced K243R mutation has been knocked in. For comparison, pancreatic organoids derived from wild-type mice were generated with reference to Example 2.
[0141] The results of observing the obtained pancreatic organoids with an inverted microscope (Zeiss) are shown in
[0142] The genotype of the organoids was identified by performing genomic PCR DNA gel electrophoresis on the genomic DNA extracted by lysis of the obtained pancreatic organoids. Specifically, PCR was performed for 30 cycles, each consisting of denaturation at 95° C. for 1 min, annealing at 55° C. for 30 sec, and elongation at 72° C. for 1 min. For electrophoresis, 5 μl of the PCR product was mixed with 5 μl of bromophenol blue or xylene on 1% (w/v) agarose gel and electrophoresed at 100 mV. The primers used in the PCR were as follows:
TABLE-US-00002 TABLE 2 SEQ ID Primer Nucleic acid sequence (5′.fwdarw.3′) NO BubR1K243R/+F GAGGTAAAGGCAGGGGAATC 10 BubR1K243R/+R GAGAAAGCGGGGGTCATTAT 11
[0143] The obtained results are shown in
[0144]
Example 4: Test for Drug Responsiveness of Pancreatic Organoids Derived from Mutant Mice
[0145] With reference to the method of Example 2 above, pancreatic organoids derived from BRCA2 gene-deleted mice (Brca2.sup.F11/F11; CreER™) were prepared. To induce a partial deletion of BRCA2 gene (deletion of exon 11 of BRCA2 gene), 4-hydroxytamoxifen (4-OHT) was added to the organoids in an amount of 400 nM, and the resulting organoids were cultured for 3 weeks or more (see Example 2). For comparison, organoids not treated with 4-OHT (in which BRCA2 gene is normal) were also prepared.
[0146] Organoids having normal BRCA2 gene (not treated with 4-OHT) and organoids with a partial deletion of BRCA2 (exon 11 deletion) were seeded in equal amounts into 24-well plates. On the day after seeding, the organoids were treated with a mixture of the anticancer agent histone deacetylase inhibitor (HDACi) and a culture medium (see Example 2). The types and treatment concentrations of HDACi used at this time are shown in Table 3 below:
TABLE-US-00003 TABLE 3 Treatment Type of HDACi concentration Trichostatin A (TSA) 1 μM Suberoylanilide hydroxamic acid (SAHA) 17 μM LMK-235 3 μM FK-228, Romidepsin 10 μM
[0147] At this time, treatment with HDACi and treatment with 4-OHT were not performed simultaneously for pancreatic organoids in which BRCA2 had already been knocked out.
[0148] 3 days after treatment (first treatment) with HDACi, the culture medium was replaced with a fresh medium, and treatment (second treatment) with each HDACi was performed again at the concentration shown in Table 3. Here, the primary treatment with HDACi was performed about 24 to 48 hours after seeding of the organoids, and 3 days after that, the second treatment was performed. On 6 days after the first treatment with HDACi, the state of the organoids treated with HDACi was observed using an inverted microscope.
[0149] The obtained results are shown in
[0150] In addition, using the above-described method, the state of the organoids treated with the PARP-1 inhibitor Olaparib (10 μM) or the plk 1 inhibitor BI2536 (10 nM) alone or in combination with HDACi (200 nM TSA) was observed, and the results are shown in
[0151]
Example 5. Construction of Telomerase Knockout Cancer Model (TKCM) by Continuous Culture of Brca2.SUP.F11/F11.; mTR.SUP.−/−.; Cre-ER™ Mice Pancreatic Organoids
[0152] Using the pancreatic organoids from Brca2.sup.F11/F11; mTR.sup.−/−; Cre-ER™ generation 3 (G3) mice obtained through three generations by crossing of Brca2.sup.F11/F11; mTR.sup.−/−; Cre-ER™ mice, a telomerase-knockout cancer model (TKCM) was constructed, which continues to divide by maintaining the telomere length even in the absence of telomerase. In order to overcome the disadvantages of two-dimensionally cultured carcinogenic cell lines used in conventional carcinogenesis inducing mechanism studies, that is, disadvantages that genomic mutations have already accumulated and all in vivo environmental characteristics are not reflected, TKCM mice (G3) were generated through three-way crossing of Brca2.sup.F11/F11; mTR−/−; Cre-ER™ mice. In addition, pancreas-derived organoids were generated, which can simulate an in-vivo environment of the organ in the mice of interest and allows direct identification of whether growth is inhibited, and it was confirmed that actual cancer was induced.
[0153] More specifically, for generation of the mouse pancreatic organoid cancer model, with reference to Example 2, pancreatic organoids were generated from Brca2.sup.F11/F11; mTR.sup.−/−; Cre-ER™ mice obtained through three generations (G3) by crossing. Then, the organoids were treated or not treated with tamoxifen (4-OHT) so that Brca2 deficiency was induced or not induced. The treatment concentration of 4-OHT was set to 400 nM. The pancreatic organoids were treated with 4-OHT once every 2 days during a time period ranging from one day after seeding of the pancreatic organoids into plates to before treatment with a drug. Then, the organoids were observed with an inverted microscope (Zeiss) once every three days, and the results are shown in
[0154] In [I], it was confirmed that the organoids (+4-OHT) deficient in both BRCA2 and TERC exhibited somewhat slower growth than the organoids (−4-OHT) deficient in only TERC.
[0155] In [II] (comparison of the degree of growth of organoids mechanically separated from organoids of [I]), it was confirmed that the growth of the organoids (−4-OHT) deficient in only TERC was inhibited compared to that at the previous passage, and that the growth of the organoids (+4-OHT) deficient in both BRCA2 and TERC was slower than that at the previous passage.
[0156] In [III] (comparison of the degree of growth of organoids mechanically separated from organoids of [II]), it was confirmed that the growth of the organoids (−4-OHT) deficient in only TERC was greatly inhibited so that sustainable culture was no longer possible, whereas the organoids (+4-OHT) deficient in both BRCA2 and TERC were in a state where sustainable culture was possible. These results confirm that organoids were cultured in which the carcinogenic mechanism was activated and carcinogenesis proceeded.
Example 6. Imaging of BubR1.SUP.K243R/+ Mouse Pancreatic Organoids Through Immunofluorescence Assay (IFA)
[0157] With reference to Examples 2 and 3, the BubR1.sup.K243R/+ mouse pancreatic organoids were cultured, and then stained with DAPI (blue), Tubulin (green) and BubR1 (red). As a result, it was confirmed that the generated organoids can be utilized as a new model to study genome instability.
[0158] First, the cultured organoids were transferred into a 15-ml conical tube, the tube was filled with cold PBS up to 15 ml, and the content in the tube was centrifuged at 1200 rpm for 5 minutes and washed with PBS. This process was repeated three times to remove Matrigel. The cells were fixed with 4% (w/v) paraformaldehyde (PFA), incubated for 30 minutes, and then washed three times with PBS. Triton X-100 solution (in PBS; concentration: 1% (v/v)) was added to the cell sample and incubated for 1 hour, and then Triton X-100 solution (in PBS; concentration: 2% (v/v)) was added thereto, followed by washing twice. Then, blocking buffer (0.279 g of BSA, 450 μl of goat serum, 180 μl of Triton X-100, 450 μl of PBS 20×, 7,920 μl of DW) was added thereto, followed by incubation for 30 minutes. The resulting cells were treated with BubR1 antibody (BD Biosciences) and incubated for 16 hours. Then, the cells were washed three times with 0.2% (v/v) PBS-T (Triton X-100 solution in PBS) for 20 minutes each time. Then, the cells were incubated with HRP-tagged secondary antibody (Thermo Fisher Scientific) for 16 hours. Then, the cells were washed three times with 0.2% (v/v) PBS-T for 20 minutes each time, treated with FITC-conjugated tubulin antibody (Abcam) at 1:1000, and incubated for 2 days. The cells were washed three times with 0.2% (v/v) PBS-T for 20 minutes each time, and then incubated with DAPI for one day. After the supernatant was removed, the cells were transferred into a 8-well chamber and fluorescence images thereof were observed using a confocal microscope.
[0159] The observed fluorescence images are shown in
Example 7. Test for Drug Responsiveness of BubR1.SUP.K243R/+ Mouse Pancreatic Organoids
[0160] With reference to Examples 2 and 3, BubR1.sup.K243R/+ mouse pancreatic organoids were cultured, and then the drug responsiveness thereof was tested through the following steps:
[0161] Pancreatic tissue isolated from BubR1.sup.K243R/+ mice was dissociated, and cell pellets containing ductal cells were collected from the dissociated pancreatic tissue. The collected cell pellets were grown with a biomatrix in a cell incubator at 37° C. under 5% CO.sub.2 (see Examples 2 and 3). The obtained organoids were mechanically dissociated in consideration of the diameter of the end of the pipette, the volume of the culture medium, and the number of pressure applications. The mechanical stress is preferably 3 to 30,000 Pa, more preferably 3 to 3,000 Pa, even more preferably 50 to 3,000 Pa, most preferably 50 to 500 Pa. For example, when a pipette having an end diameter of 9 mm is used, the organoids are preferably pipetted 15 times with 1 ml of medium. Thereafter, the organoids were resuspended in Matrigel, seeded, and grown in an organoid culture medium to reach an organoid size of 100 to 200 μm. Thereafter, large organoids having a size of 200 μm or more were filtered out, and the remaining organoids were treated with a drug diluted in an organoid culture medium. The morphology of the organoids was observed with an inverted microscope and the viability thereof was measured through various assays.
[0162] The organoid culture medium had the following composition: A mixture of DMEM/F-12 (Dulbecco's Modified Eagle Medium/Ham's F-12; Thermo Fisher Scientific) with 1% (vol/vol) penicillin/streptomycin, 10 mM HEPES, 1% GlutaMAX, 1:50 B27 supplement (Gibco), 1 mM N-acetylcysteine, 5% (vol/vol) Rspo 1-conditioned medium (Hans Clevers lab), 10 mM nicotinamide, 10 nM recombinant human [Leu15]-gastrin I (Sigma Aldrich), 50 ng/ml of recombinant mouse EGF (Peptron), 100 ng/ml of recombinant human FGF10 (Peptron), and 25 ng/ml of recombinant human Noggin (Peptron) or 5% (vol/vol) Noggin-conditioned medium (Hans Clevers lab).
[0163] The organoids were treated with 5 μM of each of the panHDAC inhibitor AR-42 (N-hydroxy-4-[[(2S)-3-methyl-2-phenylbutanoyl]amino]benzamide; CAS No. 935881-37-1) and the HDAC6 inhibitor ACY-241 (Citarinostat; CAS No. 1316215-12-9) as drugs, and observed with an inverted microscope (Zeiss) on day3, and photographs obtained by the observation are shown in
Example 8. Development of Standardized Drug Treatment Method
[0164] Pancreatic tissue isolated from the genetically mutated mice described in Examples 1 to 7 above was dissociated. Cell pellets containing ductal cells were collected from the dissociated pancreatic tissue. The collected cell pellets were grown with a biomatrix in a cell incubator at 37° C. under 5% CO.sub.2. Thereafter, the produced organoids were grown in an organoid culture medium until 75% or more thereof grew to a diameter of 200 to 500 μm. The grown organoids were mechanically dissociated with a mechanical stress of 50 to 500 Pa, and were grown with a biomatrix on a chip or plate in a cell incubator for one day at 37° C. under 5% CO.sub.2 so that 90% or more thereof had a diameter of 100 to 200 μm. The organoids were treated with a drug diluted in an organoid culture medium. After these procedures, the morphology of the organoids was observed with an inverted microscope and the viability thereof was measured by an MTT assay. As a result of the measurement, it could be confirmed that, when the above-described drug treatment method was used, it was possible to track the drug responsiveness of each organoid, which was a limitation of a conventional drug screening method using organoids, and drug treatment in a uniform size state was possible.
Example 9. Observation of Responsiveness of Genetically Mutated Kras.SUP.G12D .Mouse Organoids after Drug Treatment
[0165] With reference to Example 8, pancreatic organoids with a uniform size were prepared from K-ras.sup.G12D mutant mice and wild-type mice, and the organoids were treated with 100 μM, 200 μM or 500 μM of Resveratrone drug. On day 5 after drug treatment, the organoids were observed with an inverted microscope (Zeiss), and images of observation are shown in
Example 10. Optimization of Method of Measuring Viability of Genetically Mutated Kras.SUP.G12D .Mouse Organoids after Drug Treatment
[0166] The TUNEL method is a method in which dying cells become fluorescent. As described in Example 9, with reference to Example 8, the pancreatic organoids from Kras.sup.G12D mutant mice were treated with Resveratrone drug. The drug exhibits green fluorescence when cells are dying. The organoids were treated with 0 μM, 200 μM or 500 μM of the drug, followed by analysis of GFP (see
[0167] The results of measuring the viability of the organoids by the TUNEL method and the MTT method were compared. When the viability of the organoids was measured by the TUNEL method, there was no difference between those treated with the drug and those not treated with the drug (see
Example 11. Verification of Drug Responsiveness of Pancreatic Organoids by Analysis of Expression Level of Specific Marker Using Western Blot Technique
[0168] The mouse-derived organoids described in Examples 1 to 7 or patient-derived organoids were primarily treated with a drug, and after 72 hours, secondarily treated with the drug. As the drug, Resveratrone used in Examples 9 and 10 was used. On day 2 after the secondary drug treatment (day 5 after the primary drug treatment), the cell culture medium was removed, and then the cells were washed with 1 ml of PBS. After removal of PBS, the cells were mechanically dissociated with 500 μl of a recovery solution. The cell solution was agitated at 50 to 70 rpm at 4° C. for 1 hour, transferred into a microtube, and then centrifuged at 1200 rpm for 5 minutes, followed by removal of the supernatant. The remaining pellet was lysed with NETN buffer, and then sonicated using a sonicator for 1 minute with an output of 2 to 3 and centrifuged at 12,000 rpm for 20 to 30 minutes, and the supernatant was collected. The supernatant was quantified to 100 to 120 μg using Bradford assay, and then loaded onto a 10% polyacrylamide gel, followed by SD S-PAGE (Sodium Dodecyl Sulfate-Polyacrylamide gel electrophoresis) gel running. Then, the gel was transferred to a nitrocellulose membrane, and the transferred membrane was blocked with 5% skim milk while stirring at 50 rpm for 1 hour at RT. Using a Western blot technique, the membrane was treated with anti-p53 antibody at 4° C. for 18 hours, and then treated with secondary antibody at RT for 3 hours, and then visualized using a film.
[0169] It is known that the tumor suppressor gene p53 inhibits abnormal proliferation of cells by regulating the cell cycle and induces apoptosis of cells such as cancer cells. Usually, p53 is inactivated in cancer cells, and referring to
[0170] Although the present disclosure has been described in detail with reference to the specific features, it will be apparent to those skilled in the art that this description is only of a preferred embodiment thereof, and does not limit the scope of the present disclosure. Thus, the substantial scope of the present disclosure will be defined by the appended claims and equivalents thereto.
INDUSTRIAL APPLICABILITY
[0171] Conventional organoid drug responsiveness test methods have a technical limitation in that uniform drug treatment is not achieved, resulting in poor accuracy. The present disclosure overcomes this limitation, and is directed to more effective three-dimensional pancreatic organoids derived from cancer gene mutant mice and to a standardized method for evaluating drug effect. In order to provide personalized medicine to actual patients, it is required to develop a technology capable of efficiently verifying more uniform drug responsiveness. This experimental technique using the organoids according to the present disclosure provides a method of accurately verifying the effect of a candidate drug for cancer treatment by efficiently increasing the responsiveness of the organoids to the candidate drug. Therefore, applied research using these three-dimensional organoids will be a foothold that provides personalized medicine to actual patients.
TABLE-US-00004 Sequence List Free Text SEQ ID NO 1: CTCATCATTTGTTGCCTCACTTC SEQ ID NO 2: TGTTGGATACAAGGCATGTAC SEQ ID NO 3: GCACTCCTTACAAGGGACGA SEQ ID NO 4: CTTCAATTTCCTTGGCTTCG SEQ ID NO 5: ATTTGTCACGTCCTGCACGACG SEQ ID NO 6: CGGCATGGTGCAAGTTGAAT SEQ ID NO 7: CGGTGCTAACCAGCGTTTTC SEQ ID NO 8: CTAGGCCACAGAATTGAAAGATCT SEQ ID NO 9: GTAGGTGGAAATTCTAGCATCATCC SEQ ID NO 10: GAGGTAAAGGCAGGGGAATC SEQ ID NO 11: GAGAAAGCGGGGGTCATTAT