DEVELOPMENT OF RECOMBINANT CHICKEN IGY MONOCLONAL ANTIBODY AND SCFV ANTIBODIES RAISED AGAINST HUMAN TYMIDINE KINASE 1 EXPRESSED IN MAMMALIAN CELLS AND USE THEREOF

Abstract

Disclosed are the development of a recombinant chicken IgY monoclonal antibody and a recombinant chicken IgY single-chain variable fragment (scFv) antibody raised against human thymidine kinase 1 in mammalian cells and a preparation method and use thereof. A light chain of the scFv antibody includes an amino acid sequence shown in SEQ ID NO: 1, and a heavy chain of the scFv antibody includes an amino acid sequence shown in SEQ ID NO: 2.

Claims

1. A recombinant chicken IgY scFv antibody raised against human thymidine kinase 1, wherein a light chain of the scFv antibody includes an amino acid sequence shown in SEQ ID NO: 1, and a heavy chain of the scFv antibody includes an amino acid sequence shown in SEQ ID NO: 2.

2. The recombinant chicken IgY scFv antibody raised against human thymidine kinase 1 of claim 1, wherein the scFv antibody further includes: a linkage peptide including an amino acid sequence shown in SEQ ID NO: 3.

3. The recombinant chicken IgY scFv antibody raised against human thymidine kinase 1 of claim 1, wherein the scFv antibody further includes at least one of the following expression elements: a signal peptide including an amino acid sequence shown in SEQ ID NO: 4; and a tag including an amino acid sequence shown in SEQ ID NO: 5.

4. The recombinant chicken IgY scFv antibody raised against human thymidine kinase 1 of claim 1, wherein the scFv antibody includes an amino acid sequence shown in SEQ ID NO: 6.

5. A recombinant chicken IgY monoclonal antibody raised against human thymidine kinase 1, wherein a light chain of the monoclonal antibody includes an amino acid sequence shown in SEQ ID NO: 1, and a heavy chain of the monoclonal antibody includes an amino acid sequence shown in SEQ ID NO: 2.

6. The recombinant chicken IgY monoclonal antibody raised against human thymidine kinase 1 of claim 5, wherein the monoclonal antibody further includes: a linkage peptide including an amino acid sequence shown in SEQ ID NO: 3.

7. The recombinant chicken IgY monoclonal antibody raised against human thymidine kinase 1 of claim 5, wherein the monoclonal antibody further includes at least one of the following expression elements: a signal peptide including an amino acid sequence shown in SEQ ID NO: 4; and a tag including an amino acid sequence shown in SEQ ID NO: 5.

8. The recombinant chicken IgY monoclonal antibody raised against human thymidine kinase 1 of claim 5, wherein the monoclonal antibody includes an amino acid sequence shown in SEQ ID NO: 6.

9. A nucleic acid, wherein the nucleic acid encodes the scFv antibody of claim 1.

10. The nucleic acid of claim 9, wherein the nucleic acid further includes at least one of the following expression elements: a KOZAK sequence including a nucleotide sequence shown in SEQ ID NO: 7; a signal peptide including a nucleotide sequence shown in SEQ ID NO: 8; and a tag including a nucleotide sequence shown in SEQ ID NO: 9.

11. The nucleic acid of claim 9, wherein the nucleic acid includes a nucleotide sequence shown in SEQ ID NO: 10.

12. A vector comprising the nucleic acid of claim 9.

13. The vector of claim 12, wherein the vector is an expression vector encoding recombinant antibody, and the expression vector is pIRES2-EGFP vector.

14. Host expression cells comprising the expression vector of claim 13.

15. An immunoconjugate, comprising: the scFv antibody of claim 1; and a conjugate moiety selected from a group consisting of drugs, toxins, cytokines, radionuclides or enzymes.

16. An immunoconjugate, comprising: the monoclonal antibody of claim 5; and a conjugate moiety selected from a group consisting of drugs, toxins, cytokines, radionuclides or enzymes.

17. A test strip or test kit, comprising the scFv antibody of claim 1, the monoclonal antibody of claim 5, or the immunoconjugate of claim 15 or 16, or a combination thereof with a detectable marker.

18. A use of the scFv antibody of claim 1, the monoclonal antibody of claim 5, the immunoconjugate of claim 15 or 16 or the test strip or test kit of claim 17 in detecting abnormal cell proliferation.

19. The use of claim 18, wherein the abnormal cell proliferation includes pregnancy, tissue hyperplasia and tumors.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0041] The above and/or additional aspects and advantages of the present disclosure will become obvious and easy to understand from the description of the embodiments in combination with the following drawings.

[0042] FIG. 1 shows a schematic diagram of a PCR identification result of scFv antibody according to an embodiment of the present disclosure.

[0043] FIG. 2 shows a schematic diagram of a result of double digestion agarose electrophoresis according to an embodiment of the present disclosure.

[0044] FIG. 3 shows a schematic diagram of fluorescence microscopic observation of CHO cells transfected with scFv antibody gene eukaryotic expression vector according to an embodiment of the present disclosure.

DETAILED DESCRIPTION OF THE EMBODIMENTS

[0045] The embodiments of the present disclosure are described in detail below, and examples of the embodiments are shown in the accompanying drawings. The same or similar reference numerals indicate the same or similar elements or elements with the same or similar functions. The embodiments described below with reference to the drawings are exemplary, and are only used to explain the present disclosure, but should not be construed as limiting the present disclosure.

[0046] The present disclosure will be described below with reference to specific embodiments. It should be noted that these embodiments are merely illustrative and should not be understood as limiting the present disclosure.

[0047] The solution of the present disclosure will be explained below in combination with examples. Those skilled in the art will understand that the following embodiments are only used to illustrate the present disclosure and should not be regarded as limiting the scope of the present disclosure. Where specific techniques or conditions are not indicated in the embodiments, the procedures shall be carried out in accordance with the techniques or conditions described in the literature (for example, “Molecular Cloning Experiment Guide” by J. Sam brook et al., translated by Huang Pelting et al., third edition, Science Press) in the field or in accordance with the product specification. The reagents or instruments used without the manufacturer's indication are all conventional products that can be purchased commercially, for example, purchased from Sigma.

Embodiment 1

[0048] A method for expressing an anti-hTK1 scFv antibody provided by the embodiment of the present disclosure is as follows:

[0049] 1. Constructing Mammalian Cell Expression System:

[0050] 1.1 Designing a Primer

[0051] According to a regulatory element required for eukaryotic expression and an scFv antibody gene sequence with prokaryotic activity, upstream and downstream primer sequences for amplifying chicken IgY antibody variable region genes from the scFv antibody gene library are designed:

TABLE-US-00008 HTK1 SCFVHVFP (SEQ ID NO: 11) 5′:GAAGATCTGCCACCATGGGCAGGATGCAACTCCTGTCTTGCATTGCA CTAAGTCTTGCACTTGTCACAAACAGTGCGCTGACTCAGCCGTCCTC-3′ HTK1 SCFVLVRP (SEQ ID NO: 12) 5′:CGGGATCCTTAAGCGTAGTCTGGGACGTCGTATGGGTAAGAGGAGAC GATGACTTCGG-3′

[0052] 1.2 Gene Cloning

[0053] The phage display system screened the scFv antibody gene with activity against the C-terminal 31 peptide of human molecule hTK1 as a template, and applied a pair of designed primers to amplify the sequence suitable for eukaryotic expression vector construction according to the following procedures. Human thymidine kinase 1 (hTK1) molecular gene is 702 bp in length, encoding 234 amino acids, and the C-terminal 31 peptide is located at positions 195-225aa of the full-length protein molecule.

[0054] Amplification system: PCR reaction system: 10*PCR buffer

TABLE-US-00009 dNTP (2.5 μM) 4 μl HTK1 SCFVHVFP primer (20 μM) 2 μl HTK1 SCFVLVRP primer (20 μM) 2 μl scab-pMoPac-hck-SBP plasmid template 0.5 μl ddH.sub.2O 36.25 μl Taq enzyme 0.25 μl

[0055] Amplification Parameters:

TABLE-US-00010 Temperature/ Time Note 94° C. 2 min 30 cycle 94° C. 45 min 65° C. 45 min 72° C. 1 min 72° C. 5 min 4° C. ∞

[0056] The amplified sequence contains the restriction sites required for construction, the kozak sequence GCCACCATGG required for eukaryotic expression, the N-terminal signal peptide MGRMQLLSCIALSLALVTNS sequence required for animal cells secretion and expression, the linker sequence GGGSGGGGSGGGGSGGGS linking the heavy and light chain variable regions, and the tag sequence for detection and purification (human influenza virus hemagglutinin 9 peptide, YPYDVPDYA sequence).

[0057] The PCR amplified product was identified by agarose electrophoresis, and the target fragment was recovered.

[0058] 1.3 Linking Expression Vector and Target Gene

[0059] The fragments purified by electrophoresis and the expression vector pIRSE2-EGFP were digested with BglII and SacII respectively. After digestion, the scFv antibody fragments and the linearized vector fragments are recovered by electrophoresis to remove the small fragments and enzyme protein molecules at both ends of the excision. The two recovered fragments are mixed in an equal molar ratio and ligated with T4 ligase to obtain an expression vector ligated with the target gene.

[0060] 1.3.1 BglII Digestion

[0061] Pires2-EGFP plasmid 2 ug, scfv gene PCR amplification product 1 ug, 10*NEB Buffer 5 μl, BglII enzyme 1 μl, sterilized deionized water to 50 μl, digestion overnight (14 h) at 37° C., the product is purified and recovered by ethanol/sodium acetate precipitation method.

[0062] 1.3.2 SacII Digestion

[0063] The product was recovered by digestion with Bgl II, 10*cutsmart Buffer 5 μl, Sac II enzyme 1 sterilized deionized water to 50 μl, 37° C. for 1 h, and the product was purified and recovered by electrophoresis Qiagen gel recovery kit.

[0064] 1.3.3 Enzyme Linking and Conversion

[0065] Take the double digestion product of Pires2-EGFP and the double digestion product of scAB-pMoPac PCR amplification product (vector: the molar ratio of insert fragment is about 1:3). The vector is about 200 ng, 2*enzyme link buffer 10 μl, T4 ligase 1 μl, water to 20 μl, overnight at 16° C., the product was purified and recovered by ethanol/sodium acetate precipitation method (20 μl). Take 1 μl of the recovered product and add 40 μl DH5α competent cells to stand on ice for 2 minutes, add to a pre-cooled 1 mm electroporation cup, 1.8 KV, 5 mm electroporation, immediately add 1 ml SOC medium, incubate at 200 r/min for 1 h, remove and add to the SOB plate containing 50 ug/ml kana resistance, and cultivate overnight at 37° C.

[0066] 1.4 Identification of Expression Vector

[0067] Direct heat shock transformation or electrotransformation of the ligation product into DH5α competent cells (Solarbio, C1100). After transformation, spread all the transformed bacteria on an agar plate containing kanamycin and invert it at 37° C. for 16-20 hours. From the bacterial colonies grown on the plate, after overnight at 37° C., pick 5-10 colonies and place them in 5 milliliters of LB medium containing kanamycin for 16 hours to extract plasmids. After purification of the plasmid, double enzyme digestion with BglII and SacII can be used to cut a clone of 800 bp fragment (as shown in FIG. 1), perform sequence determination, and determine the target gene again. The determined sequence was analyzed with DNAMANV6, and the determined sequence was exactly the same as the designed optimized sequence. The transformant was subjected to PCR amplification of scFv antibody gene, and the transformant colony was amplified and cultured, and the plasmid DNA was extracted, and then double-enzyme digestion with BglII and SacII was performed. The results are shown in FIG. 2, and the results show that DNA fragments of the same size can be generated from scFv antibody genes. The plasmid DNA with the correct size is sent to GenScript Biotechnology Company for sequence determination, and the determined sequence is exactly the same as the designed optimized sequence.

[0068] 2. Transfection of Mammalian Cells CHO

[0069] Chinese Hamster Ovary (CHO) cells were isolated from an adult female hamster ovary by Dr. Theodore T. Puck in Colorado in 1957. They are epithelial adherent cells and are a widely used cell line in bioengineering. The cell is immortal and can be passaged for more than one hundred generations. In addition, CHO cells have an advantage in genetic engineering. These cells are fibroblast, which are non-secretory cells, and rarely secrete CHO endogenous proteins, so they are very beneficial for the separation and purification of target proteins. CHO cells can form active dimers with glycosylation function, and are ideal hosts for the expression of complex biological macromolecules. The antibody protein obtained has biological characteristics completely similar to those naturally produced by humans. In this example, the expression vectors for host mammalian cells, such as CHO cells.

[0070] 2.1 Cell Preparation

[0071] Choose a 24-well cell culture plate in each well, pass the CHO cells 24 hours before transfection, the cells will reach 70% to 90% abundance on the day of transfection. When the abundance is 70% to 90%, the suspension cells should be in the logarithmic growth phase during transfection.

[0072] 2.2 Vector DNA Preparation

[0073] After diluting 1 μg of the vector DNA constructed in “Step 1” in 100 μL/well of serum-free DMEM or other serum-free growth medium, mix each 1 μg DNA: 2 μL the transfection agent TurboFect, and the transfection efficiency is high. Vortex to mix well, and add 2 μL/well to the diluted vector DNA.

[0074] Transform into Host Cells Instantaneously

[0075] Incubate the mixed vector DNA and transfection agent TurboFect at room temperature for 15-20 minutes, and add 100 μL of the transfection reagent/DNA mixture to the culture medium for incubation. During the incubation, do not remove the medium, shake the plate gently to achieve an even distribution of the complex. Incubate in a carbon dioxide incubator at 37° C. to obtain transfected cells.

[0076] 2.4 Expression Detection

[0077] 2.4.1 Fluorescence Microscopy

[0078] After 48 hours of transfection, by observing the expression of cellular fluorescent protein, the result is shown in FIG. 3, the cells showing green fluorescence accounted for more than 75% of the total number of cells. Since the green fluorescent selective marker protein is in the same expression regulatory sequence as the scFv antibody gene, the various regulatory elements on the surface work normally.

[0079] 2.4.2 Indirect ELISA Detection

[0080] The recombinant IgY scFv antibody contains not only the hypervariable region that binds to hTK1, but also the highly conserved framework region (FR). In this embodiment, the HA 9-peptide tag of human influenza hemagglutinin was added. Therefore, when detecting recombinant single-chain antibodies by indirect ELISA, biotin-labeled anti-full-length IgY secondary antibody and horseradish peroxidase-labeled anti-human influenza hemagglutinin HA 9-peptide monoclonal antibodies were used as labeled antibodies, to detect recombinant anti-hTK1 single-chain antibody expressed in CHO cells. The supernatant of the transfected cells was collected and the expression level of recombinant scFv antibody was detected by ELISA experiment. The specific method is as follows:

[0081] (1) Dilute the recombinant hTK1 protein with 1× coating solution to a concentration of 0.5 ug/ml, 100 μl per well, and coat overnight at 4° C.

[0082] (2) Wash the ELISA plate once with 400 μl/well of the plate washer, add 200 μl/well of blocking solution, and block at 37° C. for 1 hour.

[0083] (3) Wash the ELISA plate once with 400 μl/well of the plate washer, add 100 μl/well of transfected cell supernatant, normal CHO cell blank supernatant and diluted IgY positive control, and react at 37° C. for 1 hour.

[0084] (4) Wash the ELISA plate 3 times with 400 μl/well of the plate washer, add 1:20,000 diluted HRP-labeled goat anti-mouse IgG secondary antibody, biotin-labeled anti-full-length IgY secondary antibody and horseradish peroxidase-labeled streptavidin, 100 μl/well.

[0085] (5) React at 37° C. for 1 hour. Wash the ELISA plate 3 times with 400 μl/well of the plate washer, and add 100 μl/well of single-component TMB color developing solution VII, and react at 37° C. for 10-15 minutes.

[0086] (6) Add stop solution 50 μl/well to stop the reaction, put the ELISA plate into the microplate reader, and measure the absorbance at 450 nm wavelength with 620 nm as the reference wavelength.

TABLE-US-00011 donkey IgG antibody labeled with anti-HA mouse monoclonal antibody anti-full-length IgY biotin labeled with HRP coating Transfected CHO CHO Transfected CHO CHO antigen supernatant supernatant IgY supernatant supernatant HTK1, 1.623 0.245 2.985 0.867 0.334 50 ng/well coating 0.235 0.221 0.243 0.302 0.362 solution

[0087] The results showed that the donkey IgG antibody labeled with anti-full-length IgY biotin was used as the labeled antibody. The OD value of the CHO cell supernatant transfected with the scFv antibody gene is 6.6 times that of the CHO cell supernatant not transfected, and the ratio of the recombinant hTK1 antigen to the negative antigen control is 6.9. The results of the detection of recombinant scFv antibody detected by the monoclonal antibody against the 9 peptide of HA of human influenza hemagglutinin as the labeled antibody showed that the OD value of the CHO cell supernatant transfected with the scFv antibody gene was 2.6 times that of the untransfected CHO cell supernatant, and the ratio of the recombinant hTK1 antigen to the negative antigen control was 0.287. Therefore, the application of the two label detections proved that the transfected scFv antibody gene showed obvious expression in CHO cells.

[0088] In the description of this Specification, description with reference to the terms “an embodiment”, “some embodiments”, “examples”, “specific examples”, or “some examples” etc. mean that the specific features, structures, materials or characteristics described in combination with the embodiment or example are included in at least one embodiment or example of the present disclosure. In this Specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the described specific features, structures, materials or characteristics may be combined in any one or more embodiments or examples in a suitable manner.

[0089] Although the embodiments of the present disclosure have been shown and described, those of ordinary skill in the art can understand various changes, modifications, substitutions and modifications can be made to these embodiments without departing from the principle and purpose of the present disclosure. The scope of the present disclosure is defined by the claims and their equivalents.