Homologous Recombination Reporter Construct and Uses Thereof
20210277421 · 2021-09-09
Assignee
Inventors
- Christopher E. Hopkins (Murray, UT, US)
- Trisha Brock (Eugene, OR, US)
- Thomas Marshall (Eugene, OR, US)
- Mary Colasanto (Eugene, OR, US)
- Zachary Stevenson (Eugene, OR, US)
Cpc classification
C12N15/8212
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C12N15/8509
CHEMISTRY; METALLURGY
C07K2319/60
CHEMISTRY; METALLURGY
C12N2800/80
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
International classification
C12N15/90
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
C12N15/82
CHEMISTRY; METALLURGY
Abstract
The present disclosure provides homologous recombination reporter nucleic acid construct reagents for increasing the likelihood of detecting successful modification of a specific sequence in chromosomal DNA of a host cell via homologous recombination. The homologous recombination reporter constructs contain a sequence element inserted within the coding sequence for a reporter gene resulting in a mutated reporter gene. The sequence element is removed via homologous recombination based on the presence of two homology regions present in the reporter construct.
Claims
1. A nucleic acid construct comprising a gene for a mutated fluorescent protein, wherein the gene comprises; a sequence element that disrupts expression of a functional fluorescent protein and wherein the sequence element is removed with successful homologous recombination in a host cell restoring the functional fluorescent protein, wherein the sequence element comprises; a B segment and an A′ segment, wherein the B segment comprises an expression disruption site; and, the A′ segment comprises a direct repeat of an A segment immediately upstream of the B segment, wherein the A segment comprises a portion of a coding sequence of the fluorescent protein from 15 base pairs to 3000 base pairs in length.
2. The construct of claim 1, wherein a translated sequence of the mutated fluorescent protein comprising the sequence element is truncated, destabilized, inactive, or produces a fluorescent signal quantitatively distinguished from a translated sequence of the functional fluorescent protein that does not comprise the sequence element.
3. The construct of claim 2, wherein quantitatively distinguished signal comprises intensity of signal or emission signal wavelength.
4. The construct of claim 1, wherein the A and A′ segments are 20 base pairs to 1000 base pairs in length.
5. The construct of claim 1, further comprising one or more nuclease cleavage sites at or flanking the sequence element site.
6. The construct of claim 5, wherein the nuclease cleavage site is recognized by nucleases selected from Cas9, Cpf1, TALen, Zinc-finger, I-Sce I, Endo.sce, HO, I-Ceu I, I-Chu I, I-Cre I, I-Csm I, I-Dir I, I-DMO I, I-Flmu I, I-Flmu II, I-Ppo I, I-Sce III, I-Sce IV, I-Tev I, I-Tev II, I-Tev III, PI-Mle I, PI-Mtu I, PI-Psp I, PI-Tli I, PI-Tli II or PI-Sce V.
7. The construct of claim 1, further comprising two nuclease cleavage sites, one located at or near an interface between the A segment and B segment, and a second located at or near an interface between the B segment and A′ segment.
8. The construct of claim 1, further comprising one or more specific guide RNA (sgRNA) recognition sequences.
9. The construct of claim 8, wherein at least one of the sgRNA recognition sequences is located at or near the interface between the A segment and B segment.
10. The construct of claim 8, further comprising a second sgRNA recognition sequence located at or near the interface between the B segment and A′ segment.
11. The construct of claim 5, wherein the nuclease cleave site is recognized by an RNA-guided endonuclease.
12. The construct of claim 1, further comprising one of more homology regions, wherein the regions are homologous with a region of a genome of the host cell for integration of the mutated fluorescent protein coding sequence into the genome of the host cell.
13. The construct of claim 1, wherein the construct is not integrated into a genome of the host cell and does not comprise one or more homology regions that are homologous with a region of the genome of the host cell.
14. The construct of claim 1, further comprising a genomic insertion sequence operably linked to the gene that expresses the mutated fluorescent protein, wherein the genomic insertion sequence and gene are located between two homology regions that are homologous with a region of a genome of the host cell.
15. The construct of claim 14, wherein the genomic insertion sequence is an ortholog gene, or fragment thereof, of the host cell.
16. The construct of claim 14, wherein the genomic insertion sequence, when the construct is added to the host cell, provides site directed mutagenesis of a host cell gene.
17. The construct of claim 14, wherein the genomic insertion sequence, when the construct is added to the host cell, replaces a host ortholog at a native locus.
18. The construct of claim 14, wherein genomic insertion sequence, when the construct is added to the host cell, disrupts expression of a host cell gene.
19. The construct of claim 1, wherein the expression disruption site comprises a stop codon, frameshift codon, one or more point mutations, one or more destabilizing codons, protease site, sequence-encoded degradation signal, or a self cleaving peptide sequence.
20. The construct of claim 1, wherein the B segment comprises a heterologous sequence that is stuffer nucleic acid, coding sequence for a fluorescent protein, or a non-coding sequence.
21. The construct of claim 1, wherein the sequence element comprises one or more sgRNA sequences, an A′ segment 20 base pairs to 600 base pairs in length, a B segment comprising a stop codon, and an endonuclease cleavage at an interface between the A and B segments.
22. The construct of claim 1, wherein the host cell is an embryo cell.
23. The construct of claim 1, wherein the host cell is an embryo cell of a mammal, a zebrafish, a livestock animal, a farm animal, a nematode, or an avian.
24. The construct of claim 1, wherein the host cell is a plant cell, a bacterial cell, or a yeast cell.
25. The construct of claim 24, wherein the plant cell is a food crop plant or an agriculture plant crop.
26. A method of increasing likelihood of detecting successful modification of a specific sequence in chromosomal DNA of a host cell via homologous recombination, comprising: introducing a construct of claim 1 into the host cell; introducing gene editing reagents into the host cell comprising a donor target sequence; and, observing a desired detectable marker expressed from the construct in those host cells with successful homologous recombination gene editing.
27. The method of claim 26, wherein the gene editing reagents comprise one of Cas9, Cpf1, TALen, Zinc-finger, I-Sce I, Endo.sce, HO, I-Ceu I, I-Chu I, I-Cre I, I-Csm I, I-Dir I, I-DMO I, I-Flmu I, I-Flmu II, I-Ppo I, I-Sce III, I-Sce IV, I-Tev I, I-Tev II, I-Tev III, PI-Mle I, PI-Mtu I, PI-Psp I, PI-Tli I, PI-Tli II or PI-Sce V nucleases.
28. The method of claim 26, wherein the sequence element of the construct comprises all or part of at least one sgRNA recognition sequence.
29. The method of claim 26, wherein the gene editing reagents comprise a genomic integration sequence flanked by homology regions, wherein the regions are homologous with a region of a genome of the host cell and an endonuclease.
30. The method of claim 26, wherein the gene editing reagents comprises a sgRNA/Cas9 complex wherein the sgRNA recognizes a sgRNA recognition site on the construct.
31. The method of claim 26, wherein the fluorescent protein coding sequence is codon optimized for the host cell.
32. A method of increasing likelihood of detecting successful modification of a specific sequence in chromosomal DNA of a host cell via homologous recombination, comprising: introducing a construct of claim 1 into the host cell; introducing gene editing reagents into the host cell comprising: Cas9 complexed with a sgRNA that binds a sgRNA recognition site on the construct; Cas9 complexed with a sgRNA that binds a sgRNA recognition site on the chromosomal DNA; and, a genomic insertion sequence located between two homology regions that are homologous with a region of the chromosomal DNA of the host cell; and, observing a desired detectable marker expressed from the construct in those host cells with successful homologous recombination gene editing.
33. An expression plasmid comprising SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3 or SEQ ID NO 4.
34. Use of a promoter for expression of a gene in a zebrafish embryo, comprising contacting the zebrafish embryo with an expression vector comprising the promotor rpl13a.
35. A method of identifying test compounds that increase homologous recombination in a host cell, comprising: introducing a construct of claim 1 into the host cell; introducing gene editing reagents into the host cell; introducing a test compound into the host cell; observing a desired detectable marker expressed from the construct in those host cells with successful homologous recombination gene editing; and, comparing the desired detectable signal to a control wherein the control is a host cell without a test compound and selecting those test compounds that produced an increased detectable signal in a host cell as compared to the control.
36. The method of claim 35, wherein the gene editing reagents further comprise a donor target sequence.
37. The method of claim 35, wherein the gene editing reagents induce double strand DNA breaks.
38. The method of claim 35, wherein test compounds are selected from a therapeutic agent, a drug, a drug candidate, a nutritional supplemental, vitamin or food stuff.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0024] The accompanying drawings, which are incorporated into and constitute a part of this specification, illustrate one or more embodiments of the present disclosure and, together with the detailed description and examples sections, serve to explain the principles and implementations of the disclosure.
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
DETAILED DESCRIPTION OF THE INVENTION
[0036] Introduction
[0037] The present invention provides methods and compositions for increasing the likelihood of detecting successful modification of a specific sequence in chromosomal DNA of a cell via homologous recombination. In embodiments, the present compositions, which undergo homologous recombination to provide an observable fluorescent signal, are surrogates (or correlate) for a second (also referred to herein as the “genomic insertion sequence”) homologous recombination event that modifies a specific sequence in chromosomal DNA of a cell. In embodiments, the present compositions comprise nucleic acid constructs comprising a sequence for a fluorescent protein that has been mutated by insertion of a sequence element disrupting expression of the fluorescent protein. Those constructs are also referred to herein as homologous recombination (HR) reporter constructs. The present HR reporters or reporter constructs, upon successful homologous recombination, are restored to their non-mutated form, yielding a desired detectable signal, and thus allowing for early detection of successful gene-editing of the chromosomal DNA gene.
[0038] In embodiments, the compositions comprise nucleic acid plasmid constructs that comprise a gene (e.g. coding sequence) of a fluorescent protein that has been mutated by the insertion of a sequence element, wherein translation of that mutated fluorescent protein results in a protein that is either inactive (e.g., little to no detectable fluorescent signal) or qualitatively different (e.g., different color (the emission wavelength is shifted)) as compared to the non-mutated fluorescent protein. The present constructs are configured to restore the activity of the non-mutated fluorescent protein following successful homologous recombination. Constructs were configured and prepared wherein a sequence element was inserted into the coding sequence of the fluorescent protein, and which served both to disrupt expression of the fluorescent protein and enable homologous recombination to remove the sequence element. See
[0039] The present sequence element comprises a B segment and an A′ segment. The A′ segment is a direct repeat of an A segment in the fluorescent protein coding sequence. The B segment and A′ segment are synthesized as the sequence element and inserted directly downstream of the A segment providing a construct comprising an A-B-A′ sequence configuration. The B segment comprises at least one expression disruption site, such as a stop codon, that results in truncated translation of the mutated fluorescent protein. When added to cells, along with homologous recombination reagents, the sequence element is removed via successful homologous recombination (HR) restoring the fluorescent protein to the non-mutated form. The resulting observable signal indicates homologous recombination and is a surrogate or correlate for a second (genomic insertion sequence) homologous recombination event for a successful modification of a specific sequence in chromosomal DNA of a cell via homologous recombination.
[0040] In embodiments, the homologous recombination is endonuclease mediated. In certain embodiments, homologous recombination utilizes CRISPR based gene editing reagents, such as Cas9/sgRNA. In that instance, the present HR reporter constructs comprise one or more sgRNA recognition sites. In exemplary embodiments, those sgRNA recognition sites are located near or overlapping the flanking sequence of the A and B interface, or the B and A′ interface, wherein the endonuclease cleaves the sequence between those segments, or one to a few base pairs into those segments. See
[0041] In the context of gene editing, high quality injections occur only at a frequency of 1 or 2 in 200 injections. In other words, the rate of successful homologous recombination following injection of reagents is very low (e.g., 1% or less). Traditionally, confirmation of successful injections (e.g., activation of homologous recombination) requires tissue biopsy performed at a stable post-birth state near adulthood. This creates a high level of expense when 200 animals must be raised and screened to find the one or two animals that contain the desired genome edit. An immense amount of effort is wasted chasing low-quality injections that ultimately do not yield the desired result. In contrast, the use of the present compositions, which are an easily observable surrogate for the genome edit, can reduce the husbandry and screening burden by 20× or more. The data described herein indicates use of the present HR reporter constructs is capable of enriching successful transgenesis injections by 7-fold or more. See
[0042] In embodiments, the present HR reporter constructs are configured to restore fluorescence when homologous recombination repair mechanisms have been activated in an embryo and successful gene-editing has occurred. In embodiments, a present HR reporter construct (e.g., those of
[0043] In embodiments, various disrupted detectable marker genes and/or protein can be used for preparation of the present HR reporter constructs. One example of a disrupted detectable marker is a gene encoding a fluorescent protein that is modified so that the full-length protein is not produced. In certain embodiments, the HR reporter plasmid may be configured wherein, the sequence element comprising a stop codon, a degron signal, rare codon, an RNA splice donor signal, a self-cleaving peptide site, or inactivating point mutations, resulting in a translated fluorescent protein that is truncated producing little to no observable fluorescence. In certain other embodiments, the HR reporter plasmid is configured to comprise a second coding sequence for a fluorescent protein nested between the A segment and A′ segment. See pNU751g of
[0044] The activity of the disrupted detectable marker can be restored following injection into a cell if a successful gene editing event occurs when used in conjunction with appropriate reagents (e.g. Cas9/sgRNA complex). In certain embodiments, the present HR reporter construct also comprises one or more CRISPR sgRNA sites. The present HR constructs further comprise an appropriate promoter to drive expression of the construct upon introduction to a target cell (e.g., embryo) and a termination signal (3′ UTR).
[0045] Definitions
[0046] As used herein, the terms “a” or “an” are used, as is common in patent documents, to include one or more than one, independent of any other instances or usages of “at least one” or “one or more.”
[0047] As used herein, the term “or” is used to refer to a nonexclusive or, such that “A or B” includes “A but not B,” “B but not A,” and “A and B,” unless otherwise indicated.
[0048] As used herein, the term “about” is used to refer to an amount that is approximately, nearly, almost, or in the vicinity of being equal to or is equal to a stated amount, e.g., the state amount plus/minus about 5%, about 4%, about 3%, about 2% or about 1%.
[0049] “Clustered Regularly Interspaced Short Palindromic Repeats” and “CRISPRs”, as used interchangeably herein refers to loci containing multiple short direct repeats that are found in the genomes of approximately 40% of sequenced bacteria and 90% of sequenced archaea.
[0050] As used herein, the term “homology driven recombination” or “homology directed repair” or “HDR” is used to refer to a homologous recombination event that is initiated by the presence of double strand breaks (DSBs) in DNA (Liang et al. 1998); and the specificity of HDR can be controlled when combined with any genome editing technique known to create highly efficient and targeted double strand breaks and allows for precise editing of the genome of the targeted cell; e.g. the CRISPR/Cas9 system (Findlay et al. 2014; Mali et al. February 2014; and Ran et al. 2013).
[0051] “Coding sequence” or “encoding nucleic acid” as used herein means the nucleic acids (RNA or DNA molecule) that comprise a nucleotide sequence which encodes a protein. The coding sequence can further include initiation and termination signals operably linked to regulatory elements including a promoter and polyadenylation signal capable of directing expression in the cells of an individual or mammal to which the nucleic acid is administered. The coding sequence may be codon optimized.
[0052] As used herein, the term “polynucleotide” refers to a heteropolymer of nucleotides or the sequence of these nucleotides from the 5′ to 3′ end of a nucleic acid molecule and includes DNA or RNA molecules, including cDNA, a DNA fragment or portion, genomic DNA, synthetic (e.g., chemically synthesized) DNA, plasmid DNA as DNA construct, mRNA, and anti-sense RNA, any of which can be single stranded or double stranded. The terms “polynucleotide,” “nucleotide sequence” “nucleic acid,” “nucleic acid molecule,” and “oligonucleotide” are also used interchangeably herein to refer to a heteropolymer of nucleotides. Except as otherwise indicated, nucleic acid molecules and/or polynucleotides provided herein are presented herein in the 5′ to 3′ direction, from left to right and are represented using the standard code for representing the nucleotide characters as set forth in the U.S. sequence rules, 37 CFR §§ 1.821-1.825 and the World Intellectual Property Organization (WIPO) Standard ST.25.
[0053] The terms “transformation,” “transfection,” and “transduction” as used interchangeably herein refer to the introduction of a heterologous nucleic acid into a cell. Such introduction into a cell may be stable or transient. Thus, in some embodiments, a host cell or host organism is stably transformed with a polynucleotide of the invention. In other embodiments, a host cell or host organism is transiently transformed with a polynucleotide of the invention. “Transient transformation” in the context of a polynucleotide means that a polynucleotide is introduced into the cell and does not integrate into the genome of the cell. By “stably introducing” or “stably introduced” in the context of a polynucleotide introduced into a cell is intended that the introduced polynucleotide is stably incorporated into the genome of the cell, and thus the cell is stably transformed with the polynucleotide. “Stable transformation” or “stably transformed” as used herein means that a nucleic acid molecule is introduced into a cell and integrates into the genome of the cell. As such, the integrated nucleic acid molecule is capable of being inherited by the progeny thereof, more particularly, by the progeny of multiple successive generations. “Genome” as used herein also includes the nuclear, the plasmid and the plastid genome, and therefore includes integration of the nucleic acid construct into, for example, the chloroplast or mitochondrial genome. Stable transformation as used herein can also refer to a transgene that is maintained extrachromasomally, for example, as a mini-chromosome or a plasmid. In certain embodiments, the nucleotide sequences, constructs, expression cassettes can be expressed transiently and/or they can be stably incorporated into the genome of the host organism, such as in a native, non-native locus or safe harbor location.
[0054] As used herein, the term “nematode” refers to an organism that is a member of the phylum Nematoda, commonly referred to as roundworms. Nematodes include free-living species (such as the soil nematode C. elegans) and parasitic species. Species parasitic on humans include ascarids, filarias, hookworms, pinworms, and whipworms. It is estimated that more than two billion people worldwide are infected with at least one nematode species. Parasitic nematodes also infect companion animals and livestock, including dogs and cats (e.g., Dirofilaria immitis; heartworm), pigs (Trichinella spiralis), and sheep (e.g., Haemonchus contortus). There are also nematode species which are parasitic on insects and plants.
[0055] As used herein, the term “surrogate” refers to a homologous recombination event (i.e., HR reporter construct) that produces an observable signal correlated to a second homologous recombination event of genomic DNA that does not produce an observable signal.
[0056] All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety for all purposes. In case of conflict, the present specification, including explanations of terms, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
[0057] Homologous Recombination Reporter Constructs
[0058] Provided herein are compositions and methods that provide a visual indicator of successful modification of a specific sequence in chromosomal DNA of a cell via homologous recombination. The methods utilize a present homologous recombination (HR) reporter construct and a donor homology template (e.g., genome insertion sequence) for incorporation of a gene edit into the chromosomal DNA. The HR reporter construct is visualized when the construct comprising a mutated reporter gene is repaired via homologous recombination. Activating homologous recombination repair mechanisms of a cell, wherein the reporter construct is activated, increases the likelihood that the donor homology template was also repaired via homologous recombination resulting in modification of a specific sequence in the chromosomal DNA of a cell. The present HR reporter construct is a surrogate for a successful modification of a specific sequence in chromosomal DNA of a cell via homologous recombination and in certain embodiments, is used as a separate reagent, but in combination with, transfection reagents comprising target donor sequences.
[0059] In embodiments, identification of successful targeted genome editing via homologous recombination is increased using the present HR reporter constructs. In certain embodiments, increased likelihood that repair of the mutated fluorescent protein of the HR report construct correlates to successful targeted genome editing via homologous recombination of the host cell chromosomal DNA is at least 2×, at least 3×, at least 4×, at least 5×, at least 6×, at least 7×, at least 8×, at least 9×, at least 10×, at least 12×, at least 14×, at least 16×, at least 18×, at least 20×, at least 25× or at least 30×. In embodiments, observation of a fluorescent signal (e.g., use of a present HR reporter construct following successful homologous recombination) indicates a likelihood of a successful second homologous recombination event (e.g. modification of a specific sequence in chromosomal DNA of a host cell) is between 5× and 20×.
[0060] In exemplary embodiments, the donor homology template is provided as a separate construct from the HR reporter construct, wherein the reporter protein following homologous recombination to remove the sequence element, is expressed epigenetically. In that instance it is understood the HR reporter construct comprises an appropriate promoter to drive expression and a stop codon. Various promoters can be used in the HR reporter constructs, wherein selection is based on the host animal, development stage and/or tissue expression. Exemplified promoters for the present HR reporter construct include eft-3p for C. elegans and rpl13a for zebrafish. See
[0061] In certain embodiments, the present HR reporter construct and use thereof find utility in embryos for the preparation of transgenic organisms. In embodiments, the host cell (site of homologous recombination) is an embryonic cell of a fish (e.g., zebrafish, medaka, salmon, carp, gar), a mammal (e.g., mice, rat, hamster, rabbit, chicken, pig, cow, horse, primates, human, sheep), a worm (e.g., nematode, including both standard and parasites), a fly (e.g., drosophila), or an insect (e.g., bees, carnivorous beetles, weevils, mosquito, etc.).
[0062] In certain embodiments, the present HR reporter construct and use thereof find utility in screening or identifying compounds that improve or increase HR. In that instance, compounds are identified that can be developed for enhancement of the body's natural repair mechanism, potentially reducing DNA damage that leads to cancer or other diseases.
[0063] In embodiments, a genetically encoded reporter specifically activated by homologous recombination (HR reporter construct) can express in an archaeal cell, a bacterial cell, a eukaryotic cell, a eukaryotic single-cell organism, a somatic cell, a germ cell, a stem cell, a plant cell, an algal cell, an animal cell, an invertebrate cell, a vertebrate cell, a fish cell, a frog cell, a bird cell, a mammalian cell, a pig cell, a cow cell, a goat cell, a sheep cell, a rodent cell, a rat cell, a mouse cell, a non-human primate cell, or a human cell. In certain embodiments, a HR reporter construct is genomically integrated (e.g. germline), wherein the genetically-encoded reporter specifically activated by homologous recombination can express in an organism selected from the group consisting of: an archaea, a bacterium, a eukaryotic single-cell organism, an algae, a plant, an animal, an invertebrate, a fly, a worm, a cnidarian, a vertebrate, a fish, a frog, a bird, a mammal, an ungulate, a rodent, a rat, a mouse, and a non-human primate. In certain embodiments, transiently-expressed, genetically-encoded reporter specifically activated by HR (HR reporter construct) can express in an organism selected from the group consisting of: an archaea, a bacterium, a eukaryotic single-cell organism, an algae, a plant, an animal, an invertebrate, a fly, a worm, a cnidarian, a vertebrate, a fish, a frog, a bird, a mammal, an ungulate, a rodent, a rat, a mouse, and a non-human primate.
[0064] In embodiments are provided nucleic acid constructs comprising a gene for a mutated fluorescent protein, wherein the gene comprises; a sequence element that disrupts expression of a functional fluorescent protein and wherein the sequence element is removed with successful homologous recombination in a host cell resulting in a functional fluorescent protein. In embodiments, the sequence element comprises a B segment and an A′ segment, wherein the B segment comprises an expression disruption site; and, the A′ segment comprises a direct repeat of an A segment immediately upstream of the B segment, wherein the A segment comprises a portion of a coding sequence of the fluorescent protein from 15 base pairs to 3000 base pairs in length. See
[0065] In embodiments, the sequence element is removed via homologous recombination in a host cell providing a functional fluorescent protein with a desired detectable signal. In embodiments, the reporter protein gene encodes a protein that can be detected spectrophotometrically or visually. In certain embodiments, the desired detectible signal is a qualitative signal, wherein a control produces little or no signal and a successful recombination resulting in a functional fluorescent protein providing a desired detectable signal is qualitatively more than the control signal. In embodiments, any fluorescent signal above, or more than, background (e.g. control) is deemed a desired detectable signal. In embodiments, the desired detectable signal is X1, X2, X3, X5, X10, X15, X20 above background or a negative control. In certain embodiments, the coding sequence for the reporter protein is codon optimized for the host cell. In exemplary embodiments, the host cell is a nematode or zebrafish cell.
[0066] In embodiments, the present HR reporter construct comprises a coding sequence for green fluorescent protein (GFP), cyan fluorescent protein (CFP), or red fluorescent protein (RFP) (e.g., mCherry, Tag-RFP, etc.). In alternative embodiments, the HR reporter construct comprises a coding sequence for a detectable reporter such as luciferase, a luminescent reporter (e.g., Ranella, Firefly, etc.). See e.g., Pollock et al., Trends in Cell Biology 9:57 (1999). In embodiments, the coding sequence may code for wild type protein, spectral variants of those proteins which retain the ability to be expressed and fluoresce, fluorescent protein fused to a tag, e.g., his-GFP or his-RFP, which is histone H2B fused to the indicated fluorescent protein.
[0067] In embodiments, present HR reporter constructs comprises a coding sequence selected from AcGFP, AcGFP1, AmCyan, AmCyan1, AQ143, AsRed2, Azami Green, Azurite, BFP, Cerulean, CFP, CGFP, Citrine, copGFP, CyPet, dKeima-Tandem, DsRed, dsRed-Express, DsRed-Monomer, DsRed2, dTomato, dTomato-Tandem, EBFP, EBFP2, ECFP, EGFP, Emerald, EosFP, EYFP, GFP, HcRed-Tandem, HcRedl, JRed, Katuska, Kusabira Orange, Kusabira Orange2, mApple, mBanana, mCerulean, mCFP, mCherry, mCitrine, mECFP, mEmerald, mGrape1, mGrape2, mHoneydew, Midori-Ishi Cyan, mKeima, mKO, mOrange, mOrange2, mPlum, mRaspberry, mRFP1, mRuby, mStrawberry, mTagBFP, mTangerine, mTeal, mTomato, mTurquoise, mWasabi, PhiYFP, ReAsH, Sapphire, Superfolder GFP, T-Sapphire, TagCFP, TagGFP, TagRFP, TagRFP-T, TagYFP, tdTomato, Topaz, TurboGFP, Venus, YFP, YPet, ZsGreen, or ZsYellow1, which are described in the literature or otherwise commercially available; hRFP and hsRFP are RFP's fused to e.g., a histone protein like H2B from C. elegans.
[0068] In embodiments, the coding sequence for any of the disclosed reporter genes herein may be mutated by insertion of a sequence element within the coding sequence of the reporter. See
[0069] To ensure the reporter gene mutated with the sequence element is not expressed as a functional fluorescent protein, the sequence element comprises an expression disruption site. In embodiments, the expression disruption site is present in the B segment of the sequence element. In embodiments, the expression disruption site comprises a stop codon, frame shift, a degron signal, an RNA splice donor signal, a self-cleaving peptide or a codon that destabilizes expression. In exemplary embodiments, the B segment comprises a stop codon. In certain embodiments, the expression disruption site may be present anywhere within the B segment. In other certain embodiments, the expression disruption site is present at the 3′ end of the B segment at or near the B segment and A′ segment interface.
[0070] The A and A′ segments are the homology arms for homologous recombination, which may be initiated via endonuclease cleavage, or independent of an endonuclease. The A and A′ homology segments may be from 15 base pairs to 3000 base pairs in length, or from 20 base pairs to 1000 base pairs in length. In exemplary embodiments, the A and A′ homology segments are from about 20 base pairs to about 550 base pairs in length.
[0071] In certain embodiments, the HR reporter construct comprises one or more nuclease cleavage sites. In embodiments, the nuclease cleavage site is at, or near, the interface between the A and B segments. In other embodiments, the nuclease cleavage site is at, or near, the interface between the B and A′ segments. In exemplary embodiments, the HR reporter construct comprises two nuclease cleavage sites, one located at, or near, the interface between the A and B segments, and a second site at, or near, the interface between the B and A′ segments. The cut site may be one or a few nucleotides within the A segment, provided expression of the reporter protein is restored via removal of the sequence element.
[0072] In embodiments, the nuclease cleavage site is recognized by nucleases selected from Cas9, Cas12a, Cpf1, TALen, Zinc-finger, I-Sce I, Endo.sce, HO, I-Ceu I, I-Chu I, I-Cre I, I-Csm I, I-Dir I, I-DMO I, I-Flmu I, I-Flmu II, I-Ppo I, I-Sce III, I-Sce IV, I-Tev I, I-Tev II, I-Tev III, PI-Mle I, PI-Mtu I, PI-Psp I, PI-Tli I, PI-Tli II or PI-Sce V. In certain embodiments, the nuclease is a CRISPR Cas nuclease. In exemplary embodiments, the nuclease is Cas9 complexed with sgRNA, wherein the HR reporter construct comprises one or more sgRNA recognition sites. In embodiments, the sgRNA recognition site is at, or near, the interface between the A and B segments of the HR reporter construct. In other embodiments, the sgRNA recognition site is at, or near, the interface between the B and A′ segments of the HR reporter construct. In exemplary embodiments, the HR reporter construct comprises two sgRNA recognition sites, one located at, or near, the interface between the A and B segments, and a second site at, or near, the interface between the B and A′ segments. The cut site may be present at the repeat sequence junction (e.g. A and B segment junction, or B and A′ segment junction) or occur a few nucleotides within the A segment or A′ segment, provided expression of the reporter protein is restored via removal of the sequence element. See
[0073] In one embodiment, a HR reporter construct that fluoresces after recombining from one side is provided. According to this embodiment, the HR reporter construct comprises a promoter, a mutated gene encoding a detectable marker (e.g., fluorescent protein) comprising a sequence element, a nuclease cleavage site, and 3′UTR or termination signal, wherein the nuclease cleavage site occurs at or near the interface between the A and B segments of the HR reporter construct. In other embodiments, a HR reporter construct that fluoresces after recombining from either side is provided. According to this embodiment, the HR reporter construct comprises a promoter, a mutated gene encoding a detectable marker (e.g., fluorescent protein) comprising a sequence element, a pair of nuclease cleavage sites, and 3′UTR or termination signal, wherein each nuclease cleavage sites occur in tandem at, or near, the interface been the A and B segments and at, or near, the interface between the B and A′ segments.
[0074] In an embodiment, a HR reporter construct that expresses a protein that folds properly yet is fluorescent-inactive then fluoresces after recombining is provided. In another embodiment, a HR reporter construct that expresses a protein that fluoresces red upon recombination and concomitantly loses green fluorescence is provided. In another embodiment, a HR reporter construct comprising sequence synonymous to genome (e.g., CRISPR targeting site) is provided. In another embodiment, a HR reporter construct comprising sequence non-synonymous to genome (e.g., CRISPR targeting site) is provided. This allows for tuning of the efficiency of cutting. In one embodiment, a HR reporter construct that uses Cas9 (or another nuclease including other CRISPR nucleases) cutting of genome to activate repair is provided. In one embodiment, a HR reporter construct that uses Cas9 (or another nuclease) cutting of plasmid to activate repair is provided. In one embodiment, a HR reporter construct that is integrated in a genome is provided.
[0075] In embodiments, the HR reporter construct comprises a promoter driving expression of the mutated reporter gene that comprises the two homology regions (A and A′ segments) and a B segment resulting in a non-functional or inactivated fluorescent protein. In embodiments, the HR reporter construct would not express a functional reporter protein (e.g., fluorescent protein) under normal circumstances (e.g., when the desired genome editing event does not occur after injection or transfection). When co-injected (or transfected) with an endonuclease (e.g., Cas9 and the appropriate sgRNA) the HR reporter construct would recombine and create a gene encoding a functioning reporter protein (e.g., functional fluorescent protein coding sequence). The construct, in certain aspects, can also have one or more other functional genes (e.g., encoding other fluorescent protein marker) that are functional when not-recombined. In certain embodiments, the HR reporter construct can be used to co-inject or co-transfect for monitoring CRISPR genome editing events, wherein the HR reporter construct comprises one or more sgRNA recognition sites.
[0076] In exemplary embodiments, a HR reporter construct that is transiently expressed epigenetically is provided. An advantage of transient expression is that the HR reporter construct will be lost over time if it is not incorporated in the genome. This implementation can be useful for certain genomic edits, such as KI (knock-in) of fluorescent proteins, wherein the HR reporter construct signal would not interfere over time with the KI signal.
[0077] In embodiments, a HR reporter construct is provided for use in injections to detect embryos activated for homologous recombination repair. In embodiments, a HR reporter construct is provided for use in injections to detect animals with successful modification of a specific sequence in chromosomal DNA via homologous recombination. In embodiments, a HR reporter construct is provided for use in injections to detect plants with successful modification of a specific sequence in chromosomal DNA via homologous recombination. In embodiments, a HR reporter construct is provided for use in injections to detect cells with successful modification of a specific sequence in chromosomal DNA via homologous recombination. In embodiments, a HR reporter construct is provided as an integrated cell line to monitor HR frequency in an animal. In certain embodiments, the cell line has an integrated HR reporter construct that is non-fluorescent without recombination. After the genome is cut or edited, the HR reporter construct cell line reports that homologous recombination occurred.
[0078] In embodiments, a HR reporter construct is provided as an integrated line to monitor HR frequency in an animal after drug treatment. In certain embodiments, a HR reporter construct comprising ratiometric green fluorescent protein to red fluorescent protein and Cas9 are integrated in the genome. In certain embodiments, Cas9 expression is via an inducible promoter and the sgRNA are provided by feeding. Without induction of Cas9 and sgRNA feeding, and hence endonuclease mediated homologous recombination, the integrated HR report construct expresses a green fluorescent protein (the red fluorescent protein is only expressed following repair via HR). With induction of Cas9 and sgRNA feeding (both are needed) animals will become red, wherein the mutated red fluorescent protein of the HR reporter construct is repaired excising out the green fluorescent protein coding sequence. Measurement of the ratio of green to red signal, is the baseline. Subsequently a drug candidate is added to the system. If there is a change in the ratio of green to red signal the drug candidate has affected the ability of HR repair. HR repair is the error-free native system, while NHEJ is error prone. In certain embodiments, other reporter proteins can be used instead of the red and green fluorescent protein.
[0079] In embodiments, a HR reporter construct is provided that is transiently expressed comprising ratiometric green fluorescent protein (GFP) to red fluorescent protein (RFP), wherein the coding sequence for the GFP is nested within the RFP between an A segment and A′ segment of the sequence element. In this instance, an appropriate nuclease (e.g. Cas9 complexed with sgRNA) is added to a host cell along with the HR reporter construct and a drug candidate to be screened. Drug candidates with little to no impact on homologous recombination, or even those that increase homologous recombination mediated repair, will provide a host cell that fluoresces red. In other words, the coding sequence for the GFP is removed via homologous recombination. Alternatively, drug candidates that shift repair away from homologous recombination to error prone NHEJ repair will provide a host cell that fluoresces green. In other words, the coding sequence for the RFP was not removed via homologous recombination and is expressed.
[0080] In embodiments, a HR reporter construct acts as a surrogate for Cas9 sgRNA cutting and efficiency; creates a tool to see efficiency of a specific locus sgRNA site. In embodiments, a HR reporter construct is provided for use in injections to detect embryo activated for single strand repair. In another embodiment, a HR reporter construct is provided for use in injections to detect embryo activated for NHEJ repair. In another embodiment, a HR reporter construct is provided for use in injections to detect embryos activated for microhomology repair. In one embodiment a HR reporter construct for highest fluorescence signal correlation with a precise knock-in transgenesis is provided for direct injection into embryos (e.g., eukaryotic).
[0081] In exemplary embodiments, a zebrafish-optimized HR reporter construct is provided having a promoter, codon optimized gene encoding a fluorescent protein and intron composition that is capable of providing high fluorescence which correlates with a target edit.
[0082] In one embodiment, the HR reporter construct comprises introns sufficient to increase expression (e.g., over constructs without introns). In embodiments, the introns are selected so as to not have cryptic splice junctions or alternatively, prevent designed introns from splicing. In embodiments, the HR reporter constructs comprising of codon-optimized coding sequence for the reporter protein have 3 pairs of introns inserted at between appropriate NAG-GTN coding positions. In embodiments, the introns are selected as the shortest native introns from highly-expressed embryonic genes e.g., ribosomal long and short proteins, tubulins and actins. In embodiments, the sgRNA sites utilize target sequences not present in the target genome but closely matching the consensus sequence for the most optimal cutting.
[0083] In embodiments, the HR reporter construct comprises a strong promoter for embryonic expression to drive expression of the reporter gene. The HR reporter constructs when co-injected with appropriate sgRNA and Cas9 nuclease, may provide a detectable reporter signal. In embodiments, the detectable reporter is visible within 1, 2, 3, 4, or 5 days (e.g., less than 48 hr, 36 hr, 24 hr, 18 hr or 12 hr).
[0084] In embodiments, the HR reporter construct indicates the likelihood (e.g., via fluorescence) which embryos are receiving the desired targeted chromosomal mutagenesis via homologous recombination. In embodiments, the methods comprise introducing a present HR reporter construct into a host cell; introducing gene editing reagents into the host cell comprising a donor target sequence; and, observing a detectable marker in those host cells with successful gene editing.
[0085] In embodiments, the gene editing reagents comprise an endonuclease. In embodiments, the donor target sequence comprises a genomic insertion sequence flanked by homology regions, wherein the regions are homologous with a region of a genome of the host cell. In exemplary embodiments, the gene editing reagents comprise a sgRNA/Cas9 complex wherein the sgRNA binds a sgRNA recognition site on the HR reporter construct. In certain embodiments, the gene editing reagents comprise a sgRNA/Cas9 complex wherein the sgRNA binds a sgRNA recognition site on the chromosomal DNA of the host cell.
[0086] In certain embodiments is provided a method of increasing likelihood of detecting successful modification of a specific sequence in chromosomal DNA of a host cell via homologous recombination using CRISPR editing reagents. In embodiments, the methods comprise introducing a present HR reporter construct into a host cell, introducing gene editing reagents into the host cell comprising: Cas9 complexed with a sgRNA that binds a sgRNA recognition site on the construct; Cas9 complexed with a sgRNA that binds a sgRNA recognition site on the chromosomal DNA; and, a genomic insertion sequence located between two homology regions that are homologous with a region of the chromosomal DNA of the host cell; and, observing a desired detectable marker expressed from the construct in those host cells with successful homologous recombination gene editing.
[0087] In embodiments, the present HR reporter can be a biosensor in screening for drugs that modulate NHEJ vs HDR activities. It has been demonstrated that knock down NHEJ pathway leads to activation of HDR activity (Aksoy et al., Chemical reprogramming enhances homology-directed genome editing in zebrafish embryos. Commun Biol. 2019 May 23; 2:198. doi: 10.1038/s42003-019-0444-0. eCollection 2019). As a result, the HR reporter can be used with a combination of drugs/compounds that knock down NHEJ pathways and their drug activity is detected as higher HDR activity. The system can be use in transient and integrated modes in a variety of animal models. In the transient mode, the HR reporter doesn't integrate, making the construct useful across a number of systems and organisms without the need to tailor for each organism, for example as a reporter in a variety of biological systems (cell culture, mouse, fish, fly, worm, etc.). Geisinger & Stearns (CRISPR/Cas9 Treatment Causes Extended TP53-Dependent Cell Cycle Arrest in Human Cells. bioRxiv. Posted Apr. 10, 2019 doi: 6045382019) teach that CRISPR/Cas9-mediated cutting induces TP53-dependent cell cycle arrest, which is reminiscent of p53-mediated cell death associated with morpholino technologies (Robu et al., p53 Activation by Knockdown Technologies. PLoS Genet. 2007 May 25; 3(5):e78. Epub 2007 Apr. 10.). This result suggests that it should be possible to create transient knock-down of TP53 using morpholino in zebrafish and enhance germline editing with CRISPR locus-specific targeting.
EXAMPLES
[0088] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to use the embodiments provided herein and are not intended to limit the scope of the disclosure nor are they intended to represent that the Examples below are all of the experiments or the only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used (e.g. amounts, temperature, etc.) but some experimental errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by volume, and temperature is in degrees Centigrade. It should be understood that variations in the methods as described can be made without changing the fundamental aspects that the Examples are meant to illustrate.
Example 1
Preparation of Present Nucleic Acid Construct for Use in C. elegans
[0089] Provided herein are exemplary configurations of the present nucleic acid construct comprising a mutant fluorescent protein. See
TABLE-US-00001 SEQ ID NO. 1 ATGGTCTCCAAGGGAGAGGAGGACAACATGGCCATCATCAAGGAGTTCAT GCGTTTCAAGGTCCACATGGAGGGATCCGTCAACGGACACGAGTTCGAGA TCGAGGGAGAGGGAGAGGGACGTCCATACGAGGGAACCCAAACCGCCAAG CTCAAGGTCACCAAGGTAAGTTTAAACATATATATACTAACTAAGGAGGC CCTGATTATTTAAATTTTCAGGGAGGACCCCTCCCTTTTGCTTGGGATAT TCTTTCCCCCCAATTCATGTACGGATCTAAAGCCTACGTCAAGCACCCAG CCGACATCCCAGACTACCTCAAGCTCTCCTTCCCAGAGGGATTCAAGTGG GAGCGTGTCATGAACTTCGAGGACGGAGGAGTCGTCACCGTCACCCAAGA CTCCTCCCTCCAAGACGGAGAGTTCATCTATAAGGTAAGTTTAAACAGTT CGGCGCGCCCTAACCATACATATTTAAATTTTCAGGTCAAGCTCCGTGGA ACCAACTTCCCATCCGACGGACCAGTCATGCAAAAGAAGACCATGGGATG GGAGGCCTCCTCCGAGCGTATGTACCCAGAGGACGGAGCCCTCAAGGGAG AGATCAAGCAACGTCTCAAGCTCAAGGTAAGTTTAAACATGATTTTACTA ACTAACTAATCTGATTTAAATTTTCAGGACGGAGGACACTACGACGCCGA GGTCAAGACCACCTACAAGGCCAAGAAGCCAGTCCAACTCCCAGGAGCCT ACAACGTCAACATCAAGCTCGACATCACCTCCCACAACGAGGACTACACC ATCGTCGAGCAATACGAGCGTGCCGAGGGACGTCACTCCACCGGAGGAAT GGACGAGCTCTACAAGTAA SEQ ID NO. 2 tgtttctgttaaattaatgaatttttcataaaataaagacattatacaat ataaaaatgaagaatttattgaaaataaactgccagagagaaaaagtatg caacactcccgccgagagtgtttgaaatggtgtacggtacattttcgtgc taggagttagatgtgcaggcagcaacgagagggggagagatttttttggg ccttgtgaaattaacgtgagttttctggtcatctgactaatcatgttggt tttttgttggtttattttgtttttatctttgtttttatccagattaggaa atttaaattttatgaatttataatgaggtcaaacattcagtcccagcgtt tttcctgttctcactgtttagtcgaatttttattttaggctttcaacaaa tgttctaactgtcttatttgtgacctcactttttatatttttttaatttt taaaaatattagaagtttctaggataattttttcgacttttattctctct accgtccgcactcttcttacttttaaattaaattgtttttttttcagttg ggaaacactttgctcactccgta
Example 2
Method of Increasing Likelihood of Detecting Successful Modification of a Specific Sequence in Chromosomal DNA of C. elegans Using CRISPR/Cas9
[0090] Nucleic acid constructs were prepared according to Example 1 and used in methods for detecting successful homologous recombination of a target sequence in C. elegans embryos. A mixture comprising a construct of
[0091] Three HR-reporter construct configurations were tested. An important measure of performance is the enrichment ratio, which we defined as:
[0092] An enrichment ratio greater than 1 means that fluorescent embryos were more likely to contain target site edits than the general population of embryos. As shown in
[0093] Another important measure of performance is the capture efficiency, which we defined as:
[0094] A capture efficiency of 100% means that no target edits were lost in discarding non-fluorescent embryos. A high capture efficiency may be desired in instances where the target editing events are very rare. The higher capture efficiencies were observed by selecting fluorescent embryos at a later timepoint (i.e., 4 days). When control injections were performed with and without Cas9 nuclease for injection mixes containing either PNU751g or pNU924, only pNU924 showed absolute dependence on the presence of Cas9 nuclease. As a result, the pNU924 construct was found to be superior for avoiding autoactivation and providing the highest level of target site enrichment. In regard to reducing the number of animals in a screen, the pNU924 configuration gave the best early response at 24 hours after injection in C. elegans. The pNU924 plasmid accurately forecast the targeted edit in 4 out of 5 red embryos. While there was a decrease in co-correlation between day 1 and day 5, observations at day 5 increased the total number of edits identified. The pNU924 plasmid identified 4 of the 8 total R108C edits (50%) with red embryos at day 1. However, all of the R108C edits were identified as red embryos at day 5, demonstrating a 100% capture efficiency. Screening at day 1 for red embryos results in a greater enrichment for target site edits than screening at day 5. In contrast, screening at day 5 for red embryos results in greater capture of all the target site edits made. Depending on the difficulty of the genome edit, different screening methods may need to be applied. For instance, late screening might allow one to identify a difficult to generate target site mutation.
[0095] The pNU924 HR-reporter construct was further validated by comparing against no reporter, and the pNU344 control reporter. See
[0096] The dpy-10 phenotype observed could be due to random mutagenesis in the dpy-10 or specific repair mediated by homologous recombination. Either of these would result in the dpy-10 Rol phenotype that was observed. Sequencing of the dpy-10 gene was performed to determine the molecular nature of the mutagenesis. See
[0097] The results show a genetically encoded reporter whose fluorescence activity is triggered when recombination repair (HR) machinery is activated in the cell. Using the concept of co-CRISPR transgenesis a genome edit that creates a strong dominant phenotype is used to identify the subset of injections that are enriched for an edit at a second “target” site. Tracking the dominant roller phenotype in a co-CRISPR experiment enabled a 20-fold reduction in the number of animals that needed to be screened before finding the target edit.
[0098] The present nucleic acid constructs of
Example 3
Enrichment for Bi-Allelic Conversion with the HR-Reporter
[0099] Nucleic acid constructs of Example 1 may be used in methods for detecting successful homologous recombination of a second target sequence in both chromosomes in C. elegans embryos. A mixture comprising a construct of
TABLE-US-00002 TABLE 1 Use of the constructs developed in Example 1 and methods of Example 2 as Compared to Published co-CRISPR methods for detecting homologous recombination (HR) dpy-10 Present methods co-CRISPR and constructs Total nematodes injected 30 30 Plates screened at 5 days 30 6 Nematodes isolated at 5 days 90 15 PCR assays performed 90 15 F1 nematodes with target mutation 3 3 Homozygous mutant F1 animals 1 3
Example 4
Preparation of Present Nucleic Acid Construct for Use in Zebrafish
[0100] Nucleic acid constructs were prepared according to Example 1, except eft-3 promoter was exchanged for a zebrafish promoter, rpl3a. See
TABLE-US-00003 TABLE 2 Expression time course of mCherry under early embryo promoters in Zebrafish embryos. Red fluorescent signal was observed at 8hpi (8 hours post injection); 12 hpi and 24 hpi. Promoter Plasmid Number Plasmid build 8 hpi 12 hpi 24 hpi tubb4b pNU1275 complete no no no tuba81 pNU1276 complete + + + tuba71 pNU1277 complete no no no rpl21 pNU1278 No n/a n/a n/a rpl13a pNU1279 complete + ++ +++ rpla10a pNU1280 complete no no no eeflg pNU1197 complete no + no tuba1a pNU1196 complete no no no
[0101] Promoters and their potential regulatory regions were amplified from zebrafish genomic DNA and cloned into a zebrafish mCherry expression vector as segments of 1000 bp in front of the gene's start codon. From the ten planned promoters, construction success was achieved for eight. After sequence confirmation, each of the 8 plasmids was injected into over 200 embryos. Fluorescent expression was monitored at 2, 4, 8 and 24 hours. Three promoters showed expression of mCherry within 24 hours after injection: the tuba8I promoter, the rpl13a promoter, and the eef1g promoter. The rpl13a promoter had the strongest expression. See
[0102] Example promoter and promoter sequence for rpl13a-mCherry construct (pNU1279) is provided
TABLE-US-00004 SEQ ID No. 3: Zebrafish codon optimized coding sequence for mCherry ATGGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCAT GCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGA TCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAG CTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTC CCCTCAGTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACA TCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGC GTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTC CCTGCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACT TCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCC TCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAA GCAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAAGA CCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTC AACATCAAGTTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGA ACAGTACGAACGCGCCGAGGGCCGCCaCTCCACCGGCGGCATGGACGAGC TGTACAAG SEQ ID NO. 4: rpl13a promoter sequence ggtgcatttggcaagaaacaggccgctgaggaggagatgtacttcaagtg agtggttttgcttgagctgataattatgtaattgcttatacttgatatct actggccattagctgagtattattgaaaaaataactgaatgtaaagcaac ctaaaccgttacttcatgacctattctgtcattgtatttccttcacagga gaaaagagcaagaacagctgtctgctctgagaagacaccaccaggaagag attgaccatcacaagaaggaaatcgagagattacagcatgagatcacccg ccacgagagcaaaatcaagaaactcaaacatgatgactgaggcattaaga cagaaaatacaacacatgaattgtgaaactgctgaatatttgtaattgct tatttactaaacagtgaactctgtgattatactattataaaagcatgtta taatacagatatggttatataactgaaacaacacattgtgtattaaccca gtgcattttccctcttttgacaataaacaagaaattgtctcgaatgtaaa agtgtgtcttggtatcaatacgtttggtgaaagctaactattagctaaac taactaaagctaactattggtttgagagctaaatgtatcttaactgttac tttcagtcatataaataggttatgtcatctgaccagacaattaaaggttc tgacaccaatgaatgacccaatattgtataaatatgagatatattaaaat atgccgtaatgctgggtttcaggatcagattgagaaacactgctttagaa aatgttcgagacaacacttctttattattatatttttaatattttaaagg cgttgtagctcattggagcccagctgatggcagtagacataaataacagg cattacaaacgtcctctgaagaacagctaatcctaacgtcatttccgatg acgcgaaagctccgccctcgcccctgtcttttacgccaggcggccccgcg tgtctttcttttcccacatc
[0103] To create a zebrafish HR-reporter plasmid, an A segment to be used as a direct repeat with an inserted A′ segment was selected in the zebrafish codon-optimized sequence for mCherry. The plasmid pNU1455 was created by inserting an A′ segment 23 bp in length as a direct repeat of the identified A segment into pNU1279, wherein the B segment between the direct repeat A and A′ segments comprise a sgRNA recognition site predicted to be an efficient guide for Cas9 cutting but non-native to zebrafish. See
Example 5
Method of Increasing Likelihood of Detecting Successful Modification of a Specific Sequence in Chromosomal DNA of Zebrafish Using CRISPR/Cas9
[0104] Similar to Example 2, except in Zebrafish, nucleic acid constructs were prepared according to Example 4 and used in methods for detecting successful homologous recombination of a target sequence in Zebrafish embryos. The pNU1455 plasmid construct, along with sgRNA, and Cas9 were injected into zebrafish embryos and the embryos were screened for presence of fluorescence. Red fluorescence was observed in a small subset of cells at 18 and 24 hours after injection. See
[0105] Nucleic acid constructs were prepared according to Example 4 and used in methods for detecting successful homologous recombination of a target sequence in Zebrafish embryos. A mixture comprising the a pNU1455 construct of
[0106] Because the pNU1455 HR-reporter was too weak for practical utilization, two other configurations of the reporter as disclosed in Example 4 (pNU1579 and pNU1902) were created and tested for capacity to be reporters of high fluorescence capacity. The pNU1579 plasmid construct was capable of exhibiting high levels of fluorescence signal. See
TABLE-US-00005 TABLE 3 Correlation capacity in zebrafish Observed Expected tyr tyr Category test 1 test 2 test 3 edit edit POSITIVE 7/18 6/36 17/51 30/105 21/105 NEGATIVE 3/16 2/32 0/22 5/70 14/70 Chi Squared = 9.643 (1DF) p = 0.0019 Fold enrichment = 4×
Example 6
Method of Increasing Likelihood of Detecting Successful Germline Genetic Modification of a Specific Sequence in Chromosomal DNA of Zebrafish
[0107] To demonstrate germline integration events are indicated by the HR-reporter, a nucleic acid reporter construct pNU1902 was prepared according to Example 4 and used to detect homologous recombination repair of a target sequence in the germline of Zebrafish. Two independent co-CRISPR injections were performed targeting two different genomic regions. Data not shown for the second genomic region but results were similar. Injection mix components for the first genomic region target are disclosed in Table 4.
TABLE-US-00006 TABLE 4 Reagents for germline correlation capacity in zebrafish Injection mix 1: STXBP1 S42P target edit Final Component Sequence Concentrations target TAGTGGACCAGCTCAGCA 1.5 pmol/ul ng/ul sgRNA TG (SEQ ID NO: 5) repair GCCCTCTGTCATGATATC 25 ng/ul DNA AGTCATTTTGCAGCAGGA AGGCAGCATGCGCATGCT GAGCTGGTCCACTATCAA AGCCTACAGAGAGAA (SEQ ID NO: 6) HR GCTACCATAGGCACCACG 1.5 pmol/ul reporter AG sgRNA (SEQ ID NO: 7) HR pNU1902 50 ng/ul reporter plasmid Cas9 375 ug/ml protein Phenol red 0.025%
[0108] Zebrafish embryos were injected using standard techniques with 1-2 nl of injection mix 1 to target the S42P locus of the stxbp1a gene. The injection mix was made as follows: 1.5 ul Cas9 (5 mg/ml stock solution), 1.0 ul target sgRNA (30 uM stock solution), 1 ul target repair DNA template (500 ng/ul stock solution), 1.0 ul HR reporter sgRNA (30 uM stock solution), 1 ul HR reporter plasmid pNU1902 (50 ng/ul final concentration), 1 ul 0.5% phenol red, and 13.5 ul H.sub.2O. Injections were performed using pulled glass capillaries loaded with the injection mix. Embryos were collected after fertilization and injected immediately (within 45 minutes post fertilization). 250-300 embryos were injected.
[0109] After injection, reporter signal categorization was made. Embryos were determined to be either reporter positive (bright or medium signal) or negative (dim signal) based on red fluorescence signal. See
TABLE-US-00007 TABLE 5 Germline correlation capacity in zebrafish stxbp1a S42P stxbp1a S42P HR-reporter HR-reporter negative positive Zebrafish screened 15 28 AS-PCR positive hits 1 4
[0110] Of the fifteen HR-reporter negative Zebrafish tested, only 1 contained an AS-PCR positive hit indicating a genome edited line. However, of the 28 HR-reporter positive Zebrafish tested, 4 contained an AS-PCR positive hit indicating a genome edited line. This represents a two-fold enrichment for germline edits in the HR-reporter positive embryos (14%) vs the HR-reporter negative embryos (7%). This increase in genome edited germlines indicate that the HR-reporter measured in the embryo after injection can be a useful tool for identifying those embryos where genome editing of the germline is likely.
Example 7
Methods of Identifying Compounds that Increase Homologous Recombination Using Present HR Reporter Constructs
[0111] The HR reporter pNU1902 (See
TABLE-US-00008 TABLE 5 Injection mixes demonstrating the use of the HR-reporter in identifying compounds that increase homologous recombination. Injection mix 1 Injection mix 2 Injection mix 3 Component Sequence concentration concentration concentration target TTGCAGTTGAACGAAGAAGG 1.5 uM 1.5 uM sgRNA #1 (SEQ ID NO: 8) target ATGACAGAATTAAGGAGCTG 1.5 uM 1.5 uM sgRNA #2 (SEQ ID NO: 9) repair DNA AATGTCTCGtttttttttCA 25 ng/ul 25 ng/ul TCCTTGCAGTTGAACGAAGA AGACGATTCAACAtCAACGA TAGGATCAAAGAACTGGGGA CTTTAATTCCCAAGTCAAA TGATCCGTAAGTTT (SEQ ID NO: 10) HR GCTACCATAGGCACCACGAG 1.5 uM 1.5 uM 1.5 uM reporter (SEQ ID NO: 7) sgRNA HR pNU1902 25 ng/ul 25 ng/ul 25 ng/ul reporter plasmid Cas9 375 ug/ml 375 ug/ml 375 ug/ml protein p53 0.1 mM 0.1 mM morpholino Dextran 2.5 mg/ml 2.5 mg/ml 2.5 mg/ml fluorescein
[0112] Injections were performed using pulled glass capillaries loaded with one of the three injection mixes. Embryos were collected after fertilization and injected immediately (within 45 minutes post fertilization). 250-300 embryos were injected per injection mix.
[0113] After injection, embryos from all three injection mixes were analyzed using red fluorescence. Embryos were categorized as “strong”, “weak”, and “negative” based on the red fluorescence signal, See
[0114] The first test condition (Injection Mix 1) was composed of reporter reagents (HR reporter sgRNA, HR reporter plasmid, and Cas9) with p53 morpholino. This test condition lacks the nacre target reagents (nacre repair DNA and nacre sgRNAs). The lack of nacre sgRNA precludes genomic cutting and HR reporter activity is highly attenuated. The capacity to generate bright puncta (“strong”) is very limited and very few embryos generate bright puncta. See
TABLE-US-00009 TABLE 6 Quantified results for p53 knockdown induction of HR reporter activity HR # of # of % of reporter experimental normal embryos normal Strength group embryos observed embryos strong Injection 250 2 0.8 weak mix 79 31.6 negative 1 169 67.6 strong Injection 203 18 8.9 weak mix 110 54.2 negative 2 75 36.9 strong Injection 255 57 22.4 weak mix 164 64.3 negative 3 34 13.3
[0115] In the second and third test conditions the levels of “strong” reporter category increase. In test condition 2 (Injection Mix 2) the reagents for cutting the target locus (nacre repair DNA and nacre sgRNAs) are present but the p53 morpholino is absent. In this test condition, many more bright puncta are generated in the “strong” category (8.9%) compared with Injection Mix 1 (0.8%). The activity in the “weak” category has marginally increased from 31.6% to 54.2%. In the third test condition (Injection Mix 3), reagents for cutting the target locus and the p53 morpholino for knocking down in p53 expression are both present. The bright puncta of the “strong” category are now significantly higher (22.4%) and the “weak” category has increased to 64.3%.
[0116] Comparison of test 1 to test 3 shows the effect of cutting genomic DNA on activation of the HR reporter. The bright puncta of the “strong” category have increased 28× and the faint puncta of the “weak” category have increased 2×. These results indicate the cutting of genomic DNA is a strong activator of homologous recombination activity in the embryo.
[0117] Comparison of test 2 to test 3 measures the effect of down regulation of NHEJ activity on the activation of the HR reporter. The inclusion of p53 morpholino leads to an enhancement of the HR reporter activity. The bright puncta of the “strong” category have increased 2.5× and the faint puncta of the “weak” category have increased 1.7×. These results indicate the disruption of NHEJ by p53 morpholino is an effective activator of homologous recombination activity in the embryo. Activity of the HR reporter was linked to genome editing of the cells by observing the repair of the nacre locus by homologous recombination and the rescue of the nacre pigment loss phenotype. In the embryos with “strong” reporter signal observed, 1.5% of the embryos had nacre phenotype rescue (homologous recombination in the genome) when the p53 morpholino was not used. This is in contrast with 4.7% of the embryos with nacre phenotype rescue (homologous recombination in the genome) in the “strong” reporter signal when the p53 morpholino was used. More genome homologous recombination was observed with the use of the p53 morpholino which matched with an increase in the HR-reporter signal. Further, this result indicates that the HR-reporter can be used to identify compounds that increase homologous recombination.
[0118] The HR-reporter is used to screen for compounds causing induction of native homologous repair processes. Embryos are injected with the compound and the HR-reporter. Alternatively, a stable line containing genome integration of the reporter is used along with incubating the embryos in the compounds. Observation of an increased fluorescence signal in the embryo is an indication that the compound has an effect on inducing homologous recombination.