ENZYMETIC PREPARATION OF GLUCOSAMINE

Abstract

A method for preparing glucosamine includes the steps of converting fructose-6-phosphate (F6P) and an ammonium salt to glucosamine-6-phosphate (GlcN6P) under the catalysis of glucosamine-6-phosphate deaminase (EC 3.5.99.6, GlmD); and producing glucosamine (GlcN) by the dephosphorylation of GlcN6P under the catalysis of an enzyme capable of catalyzing the dephosphorylation. Such a method can be used to prepare glucosamine by in vitro enzymatic biosystem.

Claims

1. A method for preparing glucosamine by using an in vitro enzymatic reaction comprising: converting fructose-6-phosphate (F6P) and an ammonium salt to glucosamine-6-phosphate (GlcN6P) under the catalysis of a glucosamine-6-phosphate deaminase (EC 3.5.99.6, GlmD); and producing glucosamine (GlcN) by the dephosphorylation of GlcN6P under the catalysis of an enzyme capable of catalyzing the dephosphorylation; preferably, the ammonium salt is one selected from the group consisting of ammonium sulfate, ammonium chloride, ammonium bisulfate, ammonium nitrate, ammonium carbonate, and ammonium bicarbonate, or any mixture of two or more selected from the group.

2. The method according to claim 1, wherein the method further comprises a reaction step of converting glucose-6-phosphate (G6P) to F6P, which is catalyzed by a phosphoglucose isomerase (EC 5.3.1.9, PGI); preferably, the method further comprises a reaction step of converting glucose-1-phosphate (G1P) to G6P, which is catalyzed by a phosphoglucomutase (EC 5.4.2.2, PGM); preferably, the method further comprises a reaction step of converting a substrate and a phosphate to G1P, wherein the substrate is a disaccharide or polysaccharide containing D-glucose units, or any mixture of the disaccharide and polysaccharide; and in this step, an enzyme capable of converting the substrate and phosphate to G1P is used for catalysis; preferably, the phosphate is one selected from the group consisting of potassium dihydrogen phosphate, dipotassium hydrogen phosphate, sodium dihydrogen phosphate, and disodium hydrogen phosphate, or any mixture of two or more selected from the group; preferably, the disaccharide containing D-glucose units is sucrose, and a sucrose phosphorylase (EC 2.4.1.7, SP) is used to catalyze the conversion of sucrose and a phosphate to G1P; preferably, the polysaccharide containing D-glucose units is selected from starch, starch derivatives or any mixture thereof, and an α-glucan phosphorylase (EC 2.4.1.1, αGP) is used to catalyze the conversion of the polysaccharide containing D-glucose units and a phosphate to G1P; preferably, the polysaccharide containing D-glucose units is also selected from cellulose, cellulose derivatives or any mixture thereof; preferably, the cellulose derivative is a product of cellulose after acid or enzyme pretreatment; preferably, when the polysaccharide containing D-glucose units comprises cellulose and/or cellodextrin, a cellodextrin phosphorylase (EC 2.4.1.49, CDP) is used to catalyze the conversion of the polysaccharide containing D-glucose units and a phosphate to G1P; preferably, a cellobiose phosphorylase (EC 2.4.1.20, CBP) is further used to catalyze the conversion of cellobiose produced by the degradation of cellulose and/or cellodextrin and a phosphate to G1P; preferably, when the polysaccharide containing D-glucose units comprises cellobiose, a cellobiose phosphorylase (EC 2.4.1.20, CBP) is used to catalyze the conversion of the polysaccharide containing D-glucose units and a phosphate to G1P.

3. The method according to claim 1, wherein the glucosamine-6-phosphate deaminase is derived from Escherichia coli (UniProt No. P0A759), Bacillus subtilis (UniProt No. 035000), Giardia lamblia (UniProt No. V6TL01), or Thermococcus kodakarensis (UniProt No. Q5JDU3); preferably, the enzyme capable of catalyzing the dephosphorylation is a glucosamine-6-phosphate phosphatase (GlmP); preferably, the glucosamine-6-phosphate phosphatase is derived from Escherichia coli (UniProt Nos. P77475, P27848, P0AE22, etc.), or Bacteroides thetaiotaomicron (UniProt No. Q8A759); preferably, the enzyme capable of catalyzing the dephosphorylation is encoded by a nucleotide, and the nucleotide comprises a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99% or 100% sequence identity with SEQ ID NO: 1; preferably, the enzyme capable of catalyzing the dephosphorylation comprises an amino acid sequence having at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99% or 100% sequence identity with SEQ ID NO: 2; preferably, the enzyme capable of catalyzing the dephosphorylation is a sugar phosphatase derived from Thermococcus kodakarensis (UniProt No. Q5JJ45); preferably, the α-glucan phosphorylase is derived from Escherichia coli (Uniprot No. A0A0A0HB49), Thermotoga maritima (Uniprot No. G4FEH8), or Clostridium thermocellum (Uniprot No. A3DCB6); preferably, the sucrose phosphorylase is derived from Bifidobacterium adolescentis (Uniprot No. A0ZZH6), or Thermoanaerobacterium thermosaccharolyticum (UniProt No. D9TT09); preferably, the cellodextrin phosphorylase is derived from Clostridium thermocellum (UniProt No. A3DJQ6), or Clostridium stercorarium (UniProt No. P77846); preferably, the cellobiose phosphorylase is derived from Clostridium thermocellum (UniProt No. A3DC35), or Thermotoga neapolitana (UniProt No. B9K7M6); preferably, the phosphoglucomutase is derived from Clostridium thermocellum (Uniprot No. A3DEW8), or Thermococcus kodakarensis (UniProt No. Q68BJ6); preferably, the phosphoglucose isomerase is derived from Clostridium thermocellum (Uniprot No. A3DBX9), or Thermus thermophilus (Uniprot No. Q5SLL6).

4. The method according to claim 1, wherein the catalytic reaction is carried out at a temperature of 30-70° C., more preferably 30-50° C., most preferably 37° C.; preferably, the pH of the catalytic reaction is 5.0-8.0, more preferably 6.0-7.5, and most preferably 7.0; preferably, when the above-mentioned steps are carried out simultaneously, the catalytic reaction time is 1-48 h, further preferably 8-36 h, more preferably 10-24 h, and most preferably 20 h; preferably, when the above-mentioned steps are carried out step by step, the catalytic reaction time in each step is independently 0.5-10 h, further preferably 1-3 h, and most preferably 2 h; preferably, the concentration of the substrate in the reaction system is 1-200 g/L, further preferably 5-50 g/L, more preferably 8-20 g/L, and most preferably 10 g/L; preferably, the concentration of the enzyme capable of converting a substrate to G1P is 0.1-10 U/mL, further preferably 0.2-5 U/mL, more preferably 1-3 U/mL, and most preferably 2 U/mL; preferably, the concentration of the phosphoglucomutase is 0.1-10 U/mL, further preferably 0.2-5 U/mL, more preferably 1-3 U/mL, and most preferably 2 U/mL; preferably, the concentration of the phosphoglucose isomerase is 0.1-10 U/mL, more preferably 1-5 U/mL, and most preferably 3 U/mL; preferably, the concentration of the glucosamine-6-phosphate deaminase is 0.1-10 U/mL, further preferably 0.2-5 U/mL, more preferably 1-3 U/mL, and most preferably 2 U/mL; preferably, the concentration of the enzyme capable of catalyzing the dephosphorylation is 0.1-10 U/mL, further preferably 0.2-5 U/mL, more preferably 1-3 U/mL, and most preferably 2 U/mL; preferably, the concentration of the ammonium salt is 50-500 mM, more preferably 100-300 mM, and most preferably 200 mM; preferably, the concentration of the phosphate in the reaction system is 1-150 mM, further preferably 2-50 mM, more preferably 10-30 mM, and most preferably 20 mM; preferably, the reaction system further comprises a magnesium salt; preferably, the magnesium salt is magnesium chloride and/or magnesium sulfate; preferably, the concentration of the magnesium salt in the reaction system is 1-20 mM, further preferably 2-15 mM, and most preferably 10 mM; preferably, the reaction system further comprises a buffer; preferably, the buffer is selected from HEPES buffer, Tris-HCl buffer, MOPS buffer, citrate buffer; preferably, the buffer is HEPES buffer; preferably, the concentration of the buffer is 20-300 mM, preferably 50-200 mM, and most preferably 100 mM.

5. The method according to claim 1, wherein when the starch, starch derivatives or any mixture thereof contains α-1,6-glycosidic bonds, the method also comprises a reaction step of hydrolyzing the α-1,6-glycosidic bonds in the substrate by using an isoamylase (EC 3.2.1.68, IA); preferably, the isoamylase is derived from Sulfolobus tokodaii (UniProt No. Q973H3), or Flavobacterium sp. (UniProt No. 032611); preferably, the concentration of the isoamylase in the reaction system is 0.1-10 U/mL, more preferably 0.5-2 U/mL, and most preferably 1 U/mL; preferably, the reaction step of hydrolyzing the α-1,6-glycosidic bonds in the substrate by using isoamylase is carried out before the reaction step of converting the substrate and phosphate to G1P; preferably, the concentration of the substrate in the reaction system is 1-300 g/L, further preferably 10-200 g/L, more preferably 50-150 g/L, and most preferably 100 g/L; preferably, the concentration of the isoamylase is 0.1-10 U/mL, more preferably 0.5-2 U/mL, and most preferably 1 U/mL; preferably, the pH of the catalytic reaction is 4-8, more preferably 4.5-6.5, and most preferably 5.5; preferably, the reaction is carried out at a temperature of 10-99° C. for 0.5-72 h, further preferably at a temperature of 30-95° C. for 1-48 h, more preferably at a temperature of 50-90° C. for 6-24 h, and most preferably at 85° C. for 12 h; preferably, the reaction system further comprises a magnesium salt; preferably, the magnesium salt is magnesium chloride and/or magnesium sulfate; preferably, the concentration of the magnesium salt in the reaction system is 0.01-10 mM, further preferably 0.1-5 mM, more preferably 0.2-1 mM, and most preferably 0.5 mM; preferably, the reaction system further comprises a buffer; preferably, the buffer is selected from sodium acetate buffer, HEPES buffer, citrate buffer; preferably, the concentration of the buffer is 1-50 mM, further preferably 2-20 mM, more preferably 3-10 mM, and most preferably 5 mM.

6. The method according to claim 1, wherein, when the substrate is starch, starch derivatives or any mixture thereof, the method also comprises a reaction step catalyzed by a 4-α-glucanotransferase (EC 2.4.1.25, 4GT); preferably, the 4-α-glucanotransferases is derived from Thermococcus litoralis (UniProt No. 032462), Bacillus subtilis (UniProt No. L8AG91), or Clostridium butyricum (UniProt No. Q59266); preferably, the concentration of the 4-α-glucanotransferase in the reaction system is 0.1-10 U/mL, further preferably 0.2-5 U/mL, more preferably 0.5-2 U/mL, and most preferably 1 U /mL; preferably, the reaction step catalyzed by a 4-α-glucanotransferase is carried out after the reaction of converting the substrate and phosphate to G1P has been carried out for a period of time; preferably, the 4-α-glucanotransferase is added to the reaction system after the reaction of converting the substrate and phosphate to G1P has been carried out for 0.5-30 h, preferably 5-20 h, and most preferably 10 h.

7. The method according to claim 1, wherein, 10 g/L isoamylase-treated soluble starch is taken as the substrate, 10 mM magnesium chloride, 20 mM potassium dihydrogen phosphate, 200 mM ammonium chloride, 100 mM HEPES buffer (pH 7.0), 2 U/mL α-glucan phosphorylase, 2 U/mL phosphoglucomutase, 3 U/mL phosphoglucose isomerase, 2 U/mL glucosamine-6-phosphate deaminase, and 2 U/mL an enzyme capable of catalyzing the dephosphorylation are added, and the reaction mixture goes through a catalytic reaction at 37° C. for 30 h to obtain glucosamine; preferably, the enzyme capable of catalyzing the dephosphorylation is a glucosamine-6-phosphate phosphatase; preferably, 1 U/mL 4-α-glucanotransferase is further added to the reaction system after the reaction has been carried out for 10 h.

8. Use of a glucosamine-6-phosphate deaminase and an enzyme capable of catalyzing the dephosphorylation in the preparation of glucosamine, preferably the use in catalyzing F6P to produce glucosamine; preferably, the enzyme capable of catalyzing the dephosphorylation is a glucosamine-6-phosphate phosphatase.

9. Use of an enzyme in the preparation of glucosamine, preferably the use in catalyzing glucosamine-6-phosphate (GlcN6P) to produce glucosamine (GlcN), wherein the enzyme is encoded by a nucleotide comprising a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99% or 100% sequence identity with SEQ ID NO: 1; preferably, the nucleotide is a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99% or 100% sequence identity with SEQ ID NO: 1; preferably, the enzyme comprises an amino acid sequence having at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99% or 100% sequence identity with SEQ ID NO: 2; preferably, the enzyme has an amino acid sequence having at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99% or 100% sequence identity with SEQ ID NO: 2; preferably, the enzyme is a sugar phosphatase derived from Thermococcus kodakarensis (UniProt No. Q51145).

10. Glucosamine as prepared by the method according to claim 1.

Description

BRIEF DESCRIPTION OF THE FIGURES

[0054] FIG. 1 is a schematic diagram of the in vitro enzymatic pathway for the preparation of glucosamine with starch as the substrate, wherein αGP represents α-glucan phosphorylase, PGM represents phosphoglucomutase, PGI represents phosphoglucose isomerase, GlmD represents glucosamine-6-phosphate deaminase, and GlmP represents glucosamine-6-phosphate phosphatase.

[0055] FIG. 2 shows the Gibbs energy change among the intermediates in the in vitro enzymatic pathway for the preparation of glucosamine with starch as the substrate.

[0056] FIG. 3 shows the SD S-PAGE detection of the key enzymes for preparing glucosamine with starch as the substrate. M: Marker.

[0057] FIG. 4 shows the HPLC analysis results of glucosamine. 4A shows the HPLC peak graph of the glucosamine standard; and 4B shows the concentration of glucosamine as quantitatively analyzed by HPLC, wherein the concentration of the obtained glucosamine was quantified according to the intensity of the glucosamine peak.

[0058] FIG. 5 shows the HPLC analysis of the in vitro enzymatic preparation of glucosamine from soluble starch in which glucosamine-6-phosphate deaminase is involved. 5A shows the HPLC analysis results of the in vitro enzymatic preparation of glucosamine from soluble starch; and 5B shows the reaction process curve of the in vitro enzymatic preparation of glucosamine from soluble starch.

[0059] FIG. 6 shows the reaction process curve of the in vitro enzymatic preparation of glucosamine from IA-treated soluble starch.

[0060] FIG. 7 shows the reaction process curve of the in vitro enzymatic preparation of glucosamine from IA-treated soluble starch after optimizing the enzyme concentration.

[0061] FIG. 8 shows the reaction process curve of the in vitro enzymatic conversion of sucrose to glucosamine.

[0062] FIG. 9 shows the reaction process curve of the in vitro enzymatic conversion of cellodextrin to glucosamine.

DETAILED DESCRIPTION OF THE INVENTION

[0063] The technical solutions of the present invention will be further described in detail with reference to the following specific examples. It should be understood that the following examples are only intended to exemplarily illustrate and explain the present invention and should not be construed as limiting the scope of the present invention. All the technical solutions realized based on the above-mentioned contents of the present invention are covered in the protection scope of the present invention.

[0064] Unless otherwise specified, the raw materials and reagents used in the following examples are all commercially available products, or can be prepared by known methods.

[0065] The information of some materials used in the examples of the present invention is as follows:

[0066] Soluble starch, manufactured by ACROS Co., product No.: 424490020;

[0067] pET20b vector, Novagen, Madison, Wis.;

[0068] Escherichia coli BL21 (DE3), Invitrogen, Carlsbad, Calif.

Example 1 Determination of Enzyme Activity in the Enzymatic Preparation of Glucosamine

[0069] The catalytic pathway of converting starch to glucosamine in an in vitro enzymatic system is shown in FIG. 1, wherein the enzyme capable of catalyzing the dephosphorylation takes glucosamine-6-phosphate phosphatase as an example. FIG. 2 shows the Gibbs energy change among the intermediates in the enzymatic pathway of converting starch to glucosamine. In this example, (1) α-glucan phosphorylase is derived from Escherichia coli (Uniprot No. A0A0A0HB49); (2) phosphoglucomutase is derived from Clostridium thermocellum (Uniprot No. A3DEW8); (3) phosphoglucose isomerase is derived from Clostridium thermocellum (Uniprot No. A3DBX9); (4) glucosamine-6-phosphate deaminase is derived from Bacillus subtilis (Uniprot No. 035000); (5) the enzyme capable of catalyzing the dephosphorylation is glucosamine-6-phosphate phosphatase derived from Bacteroides thetaiotaomicron (Uniprot No. Q8A759). The genomic DNAs are available from the official website of ATCC (www.atcc.org). Through the method of Simple Cloning (You C, Zhang X Z, Zhang Y-H P. 2012. Simple cloning via direct transformation of PCR product (DNA Multimer) to Escherichia coli and Bacillus subtilis. Appl. Environ. Microbiol. 78(5):1593-5.), the above-mentioned genes were cloned into pET20b vector (Novagen, Madison, Wis.), to obtain the corresponding expression vectors pET20b-EcaGP, pET20b-CtPGM, pET20b-CtPGI, pET20b-BsGlmD, and pET20b-BtGlmP, respectively. The recombinant protein was expressed in Escherichia coli BL21 (DE3), and purified. The result of the protein purification is shown in FIG. 3.

[0070] The enzyme activity of the phosphoglucomutase derived from Clostridium thermocellum was measured in 100 mM HEPES buffer (pH 7.0) containing 10 mM magnesium chloride. With 10 mM glucose-1-phosphate as the substrate, the reaction was carried out at 37° C. for 10 min, and the amount of glucose-6-phosphate (G6P) produced was determined. The method for detecting the amount of G6P was as follows: 40 μl of sample solution containing G6P was taken, 200 μl of 100 mM HEPES buffer (pH 7.0) containing 2 mM magnesium chloride, 0.15 mM NAD.sup.+ and 0.5 U/mL glucose 6-phosphate dehydrogenase (G6PDH) was added, the reaction was carried out at 37° C. for 30 min, the absorbance at 340 nm was measured, and the amount of the NADH produced was calculated. The experimental result showed that the specific activity of the phosphoglucomutase derived from Clostridium thermocellum at 37° C. was 20 U/mg.

[0071] The enzyme activity of the α-glucan phosphorylase derived from E. coli was measured in 100 mM HEPES buffer (pH 7.0) containing 10 mM magnesium chloride and 1 U/mL phosphoglucomutase. 5 g/L soluble starch was taken as the substrate, the reaction was carried out at 37° C. for 10 min, and the amount of the glucose-6-phosphate produced was determined. The experimental result showed that the specific activity of the α-glucan phosphorylase derived from E. coli at 37° C. was 5.6 U/mg.

[0072] The enzyme activity of the phosphoglucose isomerase derived from Clostridium thermocellum was measured in 100 mM HEPES buffer (pH 7.0) containing 10 mM magnesium chloride. 10 mM fructose-6-phosphate was taken as the substrate, the reaction was carried out at 37° C. for 10 min, and the amount of the glucose-6-phosphate produced was determined. The experimental result showed that the specific activity of the phosphoglucose isomerase derived from Clostridium thermocellum at 37° C. was 396 U/mg.

[0073] The enzyme activity of the glucosamine-6-phosphate deaminase derived from B. subtilis was measured in 100 mM HEPES buffer (pH 7.0) containing 10 mM magnesium chloride. 10 mM fructose-6-phosphate and 100 mM ammonium chloride were taken as the substrate, the reaction was carried out at 37° C. for 10 min, and the amount of the glucosamine-6-phosphate (GlcN6P) produced was determined. The method for detecting the amount of GlcN6P was as follows: 50 μl of sample solution containing GlcN6P was taken, 100 μl of acetylacetone reagent (which was prepared by dissolving 1.5 mL of acetylacetone in 50 mL of 1.25 mol/L sodium carbonate solution) was added; the resulting solution was boiled for 20 min, then cooled to room temperature, 1 mL of 96% (v/v) ethanol was slowly added, and then 100 μl of p-dimethylaminobenzaldehyde (DMAB) reagent (which was prepared by dissolving 1.6 g of DMAB in 30 mL of concentrated hydrochloric acid and 30 mL of 96% ethanol); the resulting solution was mixed uniformly, and allowed to stand at room temperature for 30 min; the absorbance at 530 nm was measured, and the amount of GlcN6P was calculated according to the standard curve. The experimental result showed that the specific activity of the glucosamine-6-phosphate deaminase derived from B. subtilis at 37° C. was 10 U/mg.

[0074] In this reaction pathway, an enzyme capable of catalyzing the dephosphorylation with specific dephosphorization activity for GlcN6P is one of the key points of the present invention. In 100 mM HEPES buffer (pH 7.0) containing 10 mM magnesium chloride, the dephosphorization activity of the above-mentioned enzyme capable of catalyzing the dephosphorylation on G1P, G6P, F6P and GlcN6P was measured. The experimental results were shown in Table 1. The glucosamine-6-phosphate phosphatase derived from Bacteroides thetaiotaomicron had higher specific activity for GlcN6P, and exhibited specific dephosphorization activity for GlcN6P. The sugar phosphatase (HAD superfamily) derived from Thermococcus kodakarensis had a dephosphorization activity of 0.011 U/mg for GlcN6P substrate at 70° C.

TABLE-US-00001 TABLE 1 Dephosphorization activity of two enzymes capable of catalyzing the dephosphorylation for different substrates Specific activity (U/mg) Sugar phosphatase Bacteroides derived from thetaiotaomicron Thermococcus Substrate GlmP .sup.a kodakarensis .sup.b G1P 0 0 G6P 0.3 0 F6P 0.03 0.006 GlcN6P 3 0.011 .sup.a specific activity measured at 37° C.; .sup.b specific activity measured at 70° C.

Example 2 In Vitro Enzymatic Preparation of Glucosamine from Soluble Starch

[0075] This example prepared glucosamine from soluble starch by in vitro enzymatic biosystem. First, five enzymes were recombinantly expressed: αGP from Escherichia coli, PGM from Clostridium thermocellum, PGI from Clostridium thermocellum, GlmD from Bacillus subtilis, and GlmP from Bacteroides thetaiotaomicron (Table 2).

TABLE-US-00002 TABLE 2 Information of enzymes used for the in vitro enzymatic preparation of glucosamine Specific activity Enzyme at 37° C. Enzyme No. Source (U/mg) α-glucan 2.4.1.1 E. coli 5.6 phosphorylase (αGP) phosphoglucomutase 5.4.2.2 C. thermocellum 20 (PGM) phosphoglucose 5.3.1.9 C. thermocellum 396 isomerase (PGI) glucosamine-6-phosphate 3.5.99.6 B. subtilis 10 deaminase (GlmD) glucosamine-6-phosphate — B. 3 phosphatase (GlmP) thetaiotaomicron

[0076] Glucosamine was quantitatively analyzed by high performance liquid chromatography (HPLC). The chromatographic column used was an amino column, the mobile phase was 80% acetonitrile aqueous solution, the flow rate was 1 mL/min, the column temperature was 40° C., and the detector used was a differential refractive index detector. The detection of the standard sample was shown in FIG. 4A, and the retention time of glucosamine was about 9.6 min. The concentration of glucosamine was directly proportional to the response intensity of the HPLC characteristic peak of glucosamine, and the standard curve was shown in FIG. 4B.

[0077] 0.5 mL of a reaction mixture containing 10 g/L soluble starch, 10 mM magnesium chloride, 20 mM potassium dihydrogen phosphate, 200 mM ammonium chloride, 100 mM HEPES buffer (pH 7.0), 1 U/mL αGP, 1 U/mL PGM, 1 U/mL PGI, 1 U/mL GlmD, 1 U/mL GlmP was reacted at 37° C. for 30 h. After completion of the reaction, an equal volume of acetonitrile was added to the reaction system to terminate the reaction, followed by centrifugation at 12,000 rpm for 10 min, and then the supernatant was taken to determine the concentration of glucosamine in the reaction solution by HPLC (FIG. 5A). When the reaction was carried out for 20 h, the concentration of glucosamine was 2.4 g/L, and the conversion rate was 24% (FIG. 5B).

[0078] The conversion rate of the product is calculated by the following formula:

[00001]$\mathrm{conversion}\mathrm{rate}\left(\%\right)=\frac{\mathrm{concentration}\mathrm{of}\mathrm{glucosamine}\mathrm{produced}\left(g\text{/}L\right)}{\mathrm{concentration}\mathrm{of}\mathrm{soluble}\mathrm{starch}\mathrm{initially}\mathrm{added}\left(g\text{/}L\right)}\times 100\%$

Example 3 In Vitro Enzymatic Preparation of Glucosamine from IA-Treated Soluble Starch

[0079] Starch is polysaccharide having α-1,4 and α-1,6 mixed bonding, and thus cannot be completely hydrolyzed by α-glucan phosphorylase. Isoamylase (IA, EC 3.2.1.68) can hydrolyze the α-1,6 glycosidic bond in starch, and thus contributes the phosphorylation of the substrate by the α-glucan phosphorylase and increases the yield of glucosamine.

[0080] In this example, the isoamylase was derived from Sulfolobus tokodaii (UniProt No. Q973H3). The expression vector pET20b-StIA reported in the literature (Cheng, K. et al. Doubling Power Output of Starch Biobattery Treated by the Most Thermostable Isoamylase from an Archaeon Sulfolobus tokodaii. Sci. Rep. 5: 13184) was introduced into E. coli BL21 (DE3), to perform protein expression and purification.

[0081] To a 5 mM sodium acetate buffer (pH 5.5) containing 100 g/L soluble starch, 0.5 mM magnesium chloride and 1 U/mL isoamylase were added, and the mixture was allowed to react at 85° C. for 12 h.

[0082] 0.5 mL of a reaction mixture containing 10 g/L isoamylase-treated soluble starch, 10 mM magnesium chloride, 20 mM potassium dihydrogen phosphate, 200 mM ammonium chloride, 100 mM HEPES buffer (pH 7.0), 1 U/mL αGP, 1 U/mL PGM, 1 U/mL PGI, 1 U/mL GlmD, and 1 U/mL GlmP was incubated at 37° C. for 20 h. Samples were taken at different times. An equal volume of acetonitrile was added to terminate the reaction, followed by centrifugation at 12,000 rpm for 10 min, and then the supernatant was taken to determine the concentration of glucosamine by HPLC. When the reaction was carried out for 10 h, the concentration of glucosamine was 3.5 g/L, and the conversion rate was 35% (FIG. 6).

Example 4 In Vitro Enzymatic Preparation of Glucosamine from IA-Treated Soluble Starch after the Enzyme Concentration was Optimized

[0083] 0.5 mL of a reaction mixture containing 10 g/L isoamylase-treated soluble starch, 10 mM magnesium chloride, 20 mM potassium dihydrogen phosphate, 200 mM ammonium chloride, 100 mM HEPES buffer (pH 7.0), 2 U/mL αGP, 2 U/mL PGM, 3 U/mL PGI, 2 U/mL GlmD, and 2 U/mL GlmP was incubated at 37° C. for 30 h. Samples were taken at different times. An equal volume of acetonitrile was added to terminate the reaction, followed by centrifugation at 12,000 rpm for 10 min, and then the supernatant was taken to determine the concentration of glucosamine by HPLC. When the reaction was carried out for 20 h, the concentration of glucosamine was 7.12 g/L, and the conversion rate was 71.2% (FIG. 7, solid line).

Example 5 Increasing the Yield of Glucosamine Through the Addition of 4-α-Glucanotransferase

[0084] The isoamylase-treated soluble starch was phosphorylated by α-glucan phosphorylase, and the final remaining substrate was maltotriose and maltose. 4-α-Glucanotransferase (4GT, EC 2.4.1.25) can extend the sugar chain of short-chain malto-oligosaccharide, which can be further utilized by α-glucan phosphorylase and then converted to glucosamine, thereby increasing the yield of the product.

[0085] In this example, the 4-α-glucanotransferase was derived from Thermococcus litoralis, UniProt No. 032462. By using primers F2: TGTTTAACTTTAAGAAGGAGATATA ATGGAAAGAATAAACTTCATATTTG, R2: CAGTGGTGGTGGTGGTGGTGC TCGAGTCAAAGCTCCCTGAACCTTACCGTG, the gene of the 4-α-glucanotransferase was cloned into the pET20b vector through Simple Cloning method, to obtain the corresponding expression vector pET20b-St4GT. The expression vector was then introduced into E. coli BL21 (DE3), to perform protein expression and purification.

[0086] 0.5 mL of a reaction mixture containing 10 g/L isoamylase-treated soluble starch, 10 mM magnesium chloride, 20 mM potassium dihydrogen phosphate, 200 mM ammonium chloride, 100 mM HEPES buffer (pH 7.0), 2 U/mL αGP, 2 U/mL PGM, 3 U/mL PGI, 2 U/mL GlmD, and 2 U/mL GlmP was incubated at 37° C. for 10 h. Then, 4GT was added to a final concentration of 1 U/mL, and the reaction was continued at 37° C. for 30 h. Samples were taken at different times. An equal volume of acetonitrile was added to terminate the reaction, followed by centrifugation at 12,000 rpm for 10 min, and then the supernatant was taken to determine the concentration of glucosamine in the reaction solution by HPLC. When the reaction was carried out for 20 h, the concentration of glucosamine was 7.93 g/L, and the conversion rate was 79.3% (FIG. 7, dashed line).

Example 6 In Vitro Enzymatic Conversion of Sucrose to Glucosamine

[0087] 0.5 mL of a reaction mixture containing 10 g/L sucrose, 10 mM magnesium chloride, 20 mM potassium dihydrogen phosphate, 200 mM ammonium chloride, 100 mM HEPES buffer (pH 7.0), 2 U/mL SP, 2 U/mL PGM, 3 U/mL PGI, 2 U/mL GlmD, and 2 U/mL GlmP was incubated at 37° C. for 20 h. Samples were taken at different times. An equal volume of acetonitrile was added to terminate the reaction, followed by centrifugation at 12,000 rpm for 10 min, and then the supernatant was taken to determine the concentration of glucosamine in the reaction solution by HPLC. When the reaction was carried out for 10 h, the concentration of glucosamine was 4.1 g/L, and the conversion rate was 41% (FIG. 8).

Example 7 In Vitro Enzymatic Conversion of Cellodextrin to Glucosamine

[0088] 0.5 mL of a reaction mixture containing 10 g/L cellodextrin (average degree of polymerization: 4.4), 10 mM magnesium chloride, 20 mM potassium dihydrogen phosphate, 200 mM ammonium chloride, 100 mM HEPES buffer (pH 7.0), 1 U/mL CDP, 1 U/mL CBP, 2 U/mL PGM, 3 U/mL PGI, 3 U/mL GlmD, and 2 U/mL GlmP was incubated at 37° C. for 20 h. Samples were taken at different times. An equal volume of acetonitrile was added to terminate the reaction, followed by centrifugation at 12,000 rpm for 10 min, and then the supernatant was taken to determine the concentration of glucosamine in the reaction solution by HPLC. When the reaction was carried out for 10 h, the concentration of glucosamine was 3.44 g/L, and the conversion rate was 34.4% (FIG. 9).

Example 8 In Vitro Enzymatic Conversion of Fructose-6-Phosphate to Glucosamine

[0089] 0.5 mL of a reaction mixture containing 50 mM fructose-6-phosphate, 10 mM magnesium chloride, 200 mM ammonium chloride, 100 mM HEPES buffer (pH 7.0), 1 U/mL GlmD, and 1 U/mL GlmP was incubated at 37° C. for 10 h. Samples were taken at different times. An equal volume of acetonitrile was added to terminate the reaction, followed by centrifugation at 12,000 rpm for 10 min, and then the supernatant was taken to determine the concentration of glucosamine in the reaction solution by HPLC. When the reaction was carried out for 4 h, the concentration of glucosamine was 43.9 mM, and the conversion rate was 87.8%.

[0090] The embodiments of the present invention have been described above. However, the present invention is not limited to the above embodiments. Any modification, equivalent replacement, improvement and the like made without departing from the spirit and principle of the present invention shall fall within the protection scope of the present invention.