DESIGN OF ALCOHOL DEHYDROGENASE 2 (ADH2) PROMOTER VARIANTS BY PROMOTER ENGINEERING

20210309990 · 2021-10-07

Assignee

Inventors

Cpc classification

International classification

Abstract

Pichia pastoris alcohol dehydrogenase 2 (ADH2) promoter variants include at least one of the specified modifications on wild-type Pichia pastoris ADH2 promoter (SEQ ID NO: 1). The modification includes one of the following mutations: integration of a Cat8 transcription factor binding site (TFBS), particularly integration of SEQ ID NO: 3 or other gene sequences that show at least 80% similarity with this sequence, at any positions within nucleotides a) 647 to 660; b) 739 to 752; c) 1 to 948; and d) mutations specified with SEQ ID NO: 2 within nucleotides 15 to 848 separately and combinations thereof.

Claims

1. A Pichia pastoris alcohol dehydrogenase 2 (ADH2) promoter variant, comprising at least one mutation within nucleotides 1 to 948 of a nucleic acid sequence of a wild-type P. pastoris ADH2 promoter, wherein the nucleic acid sequence of the wild type P. pastoris ADH2 promoter is set forth by SEQ ID NO: 1 and the ADH2 promoter variant is induced under ethanol and methanol induction conditions

2. The Pichia pastoris ADH2 promoter variant of claim 1, wherein the mutation is selected from the group consisting of: integration of a Cat8 transcription factor binding site (TFBS) at any positions within nucleotides 647 to 660; 739 to 752; 100 to 1000 of SEQ ID NO: 1, wherein the Cat8 TFBS is set forth by SEQ ID NO: 3 or a nucleic acid sequence having at least 80% similarity to SEQ ID NO: 3; and mutations set forth by SEQ ID NO: 2 within nucleotides 15 to 848 of SEQ ID NO: 1 and combinations thereof.

3. The Pichia pastoris ADH2 promoter variant according to claim 2, wherein in the mutation, nucleotides are mutated by deletion, substitution, insertion and/or inversion.

4. An expression cassette comprising at least one of the Pichia pastoris ADH2 promoter variant according to claim 1; and at least a nucleic acid molecule encoding a recombinant protein, a peptide or a functional nucleotide, wherein the Pichia pastoris ADH2 promoter variant and the nucleic acid molecule form a single- or multi-copy expression cassette.

5. The expression cassette according to claim 4, wherein the Pichia pastoris ADH2 promoter variant and the nucleic acid molecule are operably linked together.

6. A vector, comprising the Pichia pastoris alcohol dehydrogenase 2 (ADH2) promoter variant according to claim 1 and at least a nucleic acid molecule encoding a recombinant protein, a peptide or a functional nucleotide.

7. A cell, comprising at least one of the Pichia pastoris alcohol dehydrogenase 2 (ADH2) promoter variant according to claim 1 and an expression cassette or a vector, wherein the expression cassette comprises at least one of the Pichia pastoris ADH2 promoter variant and at least a nucleic acid molecule encoding a recombinant protein, a peptide or a functional nucleotide, and the vector comprises the Pichia pastoris ADH2 promoter variant and at least the nucleic acid molecule encoding the recombinant protein, the peptide or the functional nucleotide.

8. The cell according to claim 7, wherein the cell is an eukaryotic cell, wherein the eukaryotic cell is a methylotrophic yeast cell, wherein the methylotrophic yeast cell is selected from the group consisting of Pichia, Candida, Hansenula and Toruplosis.

9. An expression method of a recombinant protein, a peptide or a functional nucleic acid, comprising the following steps of: providing an expression cassette or a vector, wherein the expression cassette comprises at least one of the Pichia pastoris ADH2 promoter variant according to claim 1 and at least a nucleic acid molecule encoding the recombinant protein, the peptide or the functional nucleic acid, wherein the Pichia pastoris ADH2 promoter variant and the nucleic acid molecule form a single- or multi-copy expression cassette; the vector comprises the Pichia pastoris ADH2 promoter variant and at least the nucleic acid molecule; transforming a cell with the vector or the expression cassette to obtain a transformed cell, wherein the transformed cell comprises at least one of the Pichia pastoris alcohol dehydrogenase 2 (ADH2) promoter variant and the expression cassette or the vector; culturing the transformed cell in a suitable medium, inducing an expression of the recombinant protein, the peptide or the functional nucleic acid, isolating the recombinant protein, the peptide or the functional nucleic acid.

10. The expression method according to claim 9, wherein the cell is an eukaryotic cell, and the eukaryotic cell is a methylotrophic yeast cell selected from the group consisting of Pichia, Candida, Hansenula and Toruplosis.

11. (canceled)

12. The expression cassette according to claim 4, wherein in the Pichia pastoris ADH2 promoter variant, the mutation is selected from the group consisting of: integration of a Cat8 transcription factor binding site (TFBS) at any positions within nucleotides 647 to 660; 739 to 752; 100 to 1000 of SEQ ID NO: 1, wherein the Cat8 TFBS is set forth by SEQ ID NO: 3 or a nucleic acid sequence having at least 80% similarity to SEQ ID NO: 3; and mutations set forth by SEQ ID NO: 2 within nucleotides 15 to 848 of SEQ ID NO: 1 and combinations thereof.

13. The expression cassette according to claim 12, wherein in the mutation, nucleotides are mutated by deletion, substitution, insertion and/or inversion.

14. The vector according to claim 6, wherein in the Pichia pastoris ADH2 promoter variant, the mutation is selected from the group consisting of: integration of a Cat8 transcription factor binding site (TFBS) at any positions within nucleotides 647 to 660; 739 to 752; 100 to 1000 of SEQ ID NO: 1, wherein the Cat8 TFBS is set forth by SEQ ID NO: 3 or a nucleic acid sequence having at least 80% similarity to SEQ ID NO: 3; and mutations set forth by SEQ ID NO: 2 within nucleotides 15 to 848 of SEQ ID NO: 1 and combinations thereof.

15. The vector according to claim 14, wherein in the mutation, nucleotides are mutated by deletion, substitution, insertion and/or inversion.

16. The cell according to claim 7, wherein in the Pichia pastoris ADH2 promoter variant, the mutation is selected from the group consisting of: integration of a Cat8 transcription factor binding site (TFBS) at any positions within nucleotides 647 to 660; 739 to 752; 100 to 1000 of SEQ ID NO: 1, wherein the Cat8 TFBS is set forth by SEQ ID NO: 3 or a nucleic acid sequence having at least 80% similarity to SEQ ID NO: 3; and mutations set forth by SEQ ID NO: 2 within nucleotides 15 to 848 of SEQ ID NO: 1 and combinations thereof.

17. The cell according to claim 16, wherein in the mutation, nucleotides are mutated by deletion, substitution, insertion and/or inversion.

18. The expression method according to claim 9, wherein in the Pichia pastoris ADH2 promoter variant, the mutation is selected from the group consisting of: integration of a Cat8 transcription factor binding site (TFBS) at any positions within nucleotides 647 to 660; 739 to 752; 100 to 1000 of SEQ ID NO: 1, wherein the Cat8 TFBS is set forth by SEQ ID NO: 3 or a nucleic acid sequence having at least 80% similarity to SEQ ID NO: 3; and mutations set forth by SEQ ID NO: 2 within nucleotides 15 to 848 of SEQ ID NO: 1 and combinations thereof.

19. The expression method according to claim 18, wherein in the mutation, nucleotides are mutated by deletion, substitution, insertion and/or inversion.

20. The expression method according to claim 9, wherein in the expression cassette, the Pichia pastoris ADH2 promoter variant and the nucleic acid molecule are operably linked together.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0017] FIG. 1 shows normalized eGFP expressions of P. pastoris strains—with respect to eGFP expression in the cells constructed with P.sub.ADH2-wt (%).sub.E1, constructed with the ADH2 promoter variants, in different carbon sources.

[0018] FIG. 2 shows normalized eGFP expressions of P. pastoris strains—with respect to eGFP expression in the cells constructed with P.sub.ADH2-wt (%).sub.E1, constructed with the ADH2 promoter variants, with different ethanol and methanol concentrations.

[0019] FIG. 3 shows normalized eGFP expressions of P. pastoris strains—with respect to eGFP expression in the cells constructed with P.sub.ADH2-wt (%).sub.E2, constructed with the ADH2 promoter variants, with different ethanol and methanol concentrations.

[0020] FIG. 4 shows the nucleic acid sequence of P.sub.ADH2-wt (SEQ ID NO: 1).

[0021] FIG. 5 shows the nucleic acid sequence of P.sub.ADH2-NucOpt (SEQ ID NO: 2) with identification of the modified positions.

DETAILED DESCRIPTION OF THE EMBODIMENTS

[0022] The productivity of a production process is an important criteria in industrial biotechnology applications. The capacity of the host microorganism to be able to produce the desired recombinant protein is dependent on the promoter architecture. The ideal recombinant protein production system is a system that carries out high yield production in a controlled manner under a strong and regulated promoter gene. The regulated promoters enable the cell growth phase and the recombinant protein production phases to be separated from each other, thereby enhancing the control potential of the process. Moreover the negative effects of the accumulation of recombinant protein in the bioreactor on the growth of cells and their viability is also prevented by separating the two phases.

[0023] In P. pastoris, the AOX1 promoter, P.sub.AOX1, system is commonly used. When P.sub.AOX1 is used, the need to feed toxic alcohol methanol into the bioreactor creates risks. The possibility that there may remain methanol residue in recombinant proteins that have been produced for the food and pharmaceutical industry limits the usage of this method. The prevalent usage of crude enzymes that have not high purity levels in the food industry limits the usage of methanol due to the increasing purification costs in recombinant protein products that are to be used in the food industry. Ethanol is one of the first traditional biotechnological products that have been produced in history of humanity. While the threshold limit value (TLV) permitted for methanol in the working environment of the National Institute for Occupational Safety and Health (NIOSH), USA is 200 ppm, this value for ethanol is 1000 ppm. Moreover while the lethal dose of methanol is 0.3-1 g/kg, the lethal dose of ethanol is 7.060 g/kg. Ethanol is one of the first traditional biotechnological products produced in the history of humanity; and it is known to be safe as it has been used for many years in the chemical, pharmaceutical and food industries and it does not necessitate special precuations in terms of safe process applications.

[0024] As the inducing agent of the ADH2 promoter variants subject to the present invention is ethanol, this increases the industrial significance of the variants subject to the present invention as ethanol is both cheap and has a nontoxic and non-hazardous nature. By using the induction and repression properties of the promoter, bioreactor feeding strategies which can be regulated under the ADH2 promoter variants can be developed. In the first phase of the bioreactor operation, by feeding glucose or glycerol that repress the promoter, thereby stopping the recombinant protein production results in high cell density cultures; in the second phase feeding ethanol in increasing concentrations can provide significant promoter induction and effective process control for high cell density recombinant protein production process. Providing an effective process control mechanism and separating the production phase from the cell growth phase have significant advantages in specific cases depending on the features of the heterologous protein to be produced. These advantages are obtaining high protein yield at the end of the process, enhanced product stability, and recombinant protein production in cases where the protein to be expressed is toxic.

[0025] The novel and important features of the promoter variants subject to the present invention is that they are stronger than P. pastoris wild-type ADH2 promoter (P.sub.ADH2-wt) and commonly used methanol inducible AOX1 promoter, thus they can produce recombinant proteins in higher amounts compared to commonly used promoter systems. The main aim in recombinant protein production is to develop a high yield production process, and a strong promoter is the most important genetic tool to achieve this aim.

[0026] The present invention is related to Pichia pastoris alcohol dehydrogenase 2 (ADH2) promoter variants including at least one mutation within nucleotides 1 to 948 (−1047 to −100) of the wild-type P. pastoris ADH2 promoter (SEQ ID NO: 1), under ethanol and methanol induction conditions that have stronger expression capacity than wild-type ADH2 promoter.

[0027] The present invention includes designed P. pastoris ADH2 promoter variants gene sequences comprising S. cerevisiae Cat8 TFBS integrated to the specific locations by nucleotide substitutions mentioned below, and the gene sequence of the nucleosome optimized ADH2 promoter variant designed by modifying 100 nucleotides on the wild-type ADH2 promoter. The present invention allows to design original-novel-strategic bioreactor operation conditions for recombinant protein production processes. High cell density recombinant protein production processes by P. pastoris can be developed with the promoter variants subject to the present invention: using glucose and glycerol provides high cell concentration and then protein production can be performed with induction under increased ethanol concentrations.

[0028] The method of designing promoter variant's pastoris ADH2 promoter includes a mutation consisting of integration of a Cat8 transcription factor binding site (TFBS), particularly integration of the “TTCCGTTCGTCCGA” gene sequence (SEQ ID NO: 3) or other gene sequences that show at least 80% similarity with this sequence, at any positions within nucleotides 647 to 660 (−401 to −388); 739 to 752 (−309 to −296); 100 to 1000 (−948 to −48); and mutations specified with SEQ ID NO: 2 within nucleotides 15 to 848 (−1033 to −200) and combinations thereof.

[0029] Promoter variant construction is performed by nucleotide mutations which are deletion, substitution, insertion and or inversion.

[0030] In the design of ADH2 promoter variants subject to the present invention, the gene sequences that are not naturally occurring on P. pastoris wild-type ADH2 promoter have been integrated by substitution to the functionally determined regions of ADH2 promoter. In this study, for the design of promoter variants, Cat8 TFBS, which is optimized for S. cerevisiae (Roth et al. 2004), was used for the promoter engineering study of P. Pastoris which is a different host. In the design of promoter variant P.sub.ADH2-NucOpt, a P. pastoris promoter has been modified for the first time by nucleosome optimization strategy.

[0031] The fundamental advantage of the designed promoter variants is that they are strong and regulated systems; and that they can be induced with nonhazardous ethanol for the food and pharmaceutical industries. Ethanol provides important advantages for the food and pharmaceutical industries as it is a cheap carbon source and it does not create toxicity risks against those working in production processes. Providing efficient process control by means of regulating active (on) and inactive (off) states of promoters with different carbon sources, enables to provide process requirements such as high product yield, product stability and production of toxic proteins to the cell. Production applications that can be conducted with efficient process control provide higher yield and have the potential to provide advantages both in terms of cost and time. The promoter variants subject to the present invention can provide significantly higher recombinant protein production in comparison to the P. pastoris wild-type ADH2 promoter gene under ethanol induction condition. Among ADH2 promoter variants, P.sub.ADH2-Cat2 (P.sub.ADH2-Cat8-L2) can perform higher production capacities in comparison to the commonly used however toxic-alcohol methanol induced P. pastoris alcohol oxidase 1 (AOX1) promoter.

[0032] The promoter variants subject to the present invention consist of 1047 nucleotide sequence. When the positions of nucleotides are counted from the first nucleotide at the 5′ end, the position of a nucleotide is expressed with a positive number value. However, nucleotides on the promoter can also be determined based on the start of a coding sequence which locates at the end of the promoter, in such a case the first nucleotide (in our case nucleotide A) at the 3′ end of the promoter is positioned at “−1”, and the nucleotide positions continue to decrease towards the 5′ end of the promoter gene, and the first nucleotide (in our case nucleotide T) at the 5′ end of the gene is located at −1047 base pair (bp) position.

[0033] The nucleotide sequences of the ADH2 promoter variants subject to the present invention have been provided below.

TABLE-US-00001 Promoter variant-1: P.sub.ADH2-Cat1 (P.sub.ADH2-Cat8-L1) (SEQ ID NO: 4) TCCTTTTTACCACCCAAGTGCGAGTGAAACACCCCATGGCTGCTCTCCGA TTGCCCCTCTACAGGCATAAGGGTGTGACTTTGTGGGCTTGAATTTTACA CCCCCTCCAACTTTTCTCGCATCAATTGATCCTGTTACCAATATTGCATG CCCGGAGGAGACTTGCCCCCTAATTTCGCGGCGTCGTCCCGGATCGCAGG GTGAGACTGTAGAGACCCCACATAGTGACAATGATTATGTAAGAAGAGGG GGGTGATTCGGCCGGCTATCGAACTCTAACAACTAGGGGGGTGAACAATG CCCAGCAGTCCTCCCCACTCTTTGACAAATCAGTATCACCGATTAACACC CCAAATCTTATTCTCAACGGTCCCTCATCCTTGCACCCCTCTTTGGACAA ATGGCAGTTAGCATTGGTGCACTGACTGACTGCCCAACCTTAAACCCAAA TTTCTTAGAAGGGGCCCATCTAGTTAGCGAGGGGTGAAAAATTCCTCCAT CGGAGATGTATTGACCGTAAGTTGCTGCTTAAAAAAAATCAGTTCAGATA GCGAGACTTTTTTGATTTCGCAACGGGAGTGCCTGTTCCATTCGATTGCA ATTCTCACCCCTTCTGCCCAGTCCTGCCAATTGCCCATGAATCTGCTTCC GTTCGTCCGACCCACCCCCCTTTCCAACTCCACAAATTGTCCAATCTCGT TTTCCATTTGGGAGAATCTGCATGTCGACTACATAAAGCGACCGGTGTCC GAAAAGATCTGTGTAGTTTTCAACATTTTGTGCTCCCCCCGCTTTGAAAA CGGGGGTGAGCGCTCTCCGGGGTGCGAATTCGTGCCCAATTCCTTTCACC CTGCCTATTGTAGACGTCAACCCGCATCTGGTGCGAATATAGCGCACCCC CAATGATCACACCAACAATTGGTCCACCCCTCCCCAATCTCTAATATTCA CAATTCACCTCACTATAAATACCCCTGTCCTGCTCCCAAATTCTTTTTTC CTTCTTCCATCAGCTACTAGCTTTTATCTTATTTACTTTACGAAA

[0034] The 13 nucleotides marked in the P.sub.ADH2-Cat1 (P.sub.ADH2-Cat8-L1) sequence, are not naturally occurring on P. pastoris wild-type ADH2 promoter. By means of the 13 nucleotide substitutions, the promoter variant P.sub.ADH2-Cat1 (P.sub.ADH2-Cat8-L1) has reached a significantly higher recombinant protein production capacity in comparison to the wild-type P. pastoris P.sub.ADH2 promoter.

TABLE-US-00002 Promoter variant-2: P.sub.ADH2-Cat2 (P.sub.ADH2-Cat8-L2) (SEQ ID NO: 5) TCCTTTTTACCACCCAAGTGCGAGTGAAACACCCCATGGCTGCTCTCCGA TTGCCCCTCTACAGGCATAAGGGTGTGACTTTGTGGGCTTGAATTTTACA CCCCCTCCAACTTTTCTCGCATCAATTGATCCTGTTACCAATATTGCATG CCCGGAGGAGACTTGCCCCCTAATTTCGCGGCGTCGTCCCGGATCGCAGG GTGAGACTGTAGAGACCCCACATAGTGACAATGATTATGTAAGAAGAGGG GGGTGATTCGGCCGGCTATCGAACTCTAACAACTAGGGGGGTGAACAATG CCCAGCAGTCCTCCCCACTCTTTGACAAATCAGTATCACCGATTAACACC CCAAATCTTATTCTCAACGGTCCCTCATCCTTGCACCCCTCTTTGGACAA ATGGCAGTTAGCATTGGTGCACTGACTGACTGCCCAACCTTAAACCCAAA TTTCTTAGAAGGGGCCCATCTAGTTAGCGAGGGGTGAAAAATTCCTCCAT CGGAGATGTATTGACCGTAAGTTGCTGCTTAAAAAAAATCAGTTCAGATA GCGAGACTTTTTTGATTTCGCAACGGGAGTGCCTGTTCCATTCGATTGCA ATTCTCACCCCTTCTGCCCAGTCCTGCCAATTGCCCATGAATCTGCTAAT TTCGTTGATTCCCACCCCCCTTTCCAACTCCACAAATTGTCCAATCTCGT TTTCCATTTGGGAGAATCTGCATGTCGACTACATAAAGTTCCGTTCGTCC GAAAAGATCTGTGTAGTTTTCAACATTTTGTGCTCCCCCCGCTGTTTGAA AACGGGGGTGAGCGCTCTCCGGGGTGCGAATTCGTGCCCAATTCCTTTCA CCCTGCCTATTGTAGACGTCAACCCGCATCTGGTGCGAATATAGCGCACC CCCAATGATCACACCAACAATTGGTCCACCCCTCCCCAATCTCTAATATT CACAATTCACCTCACTATAAATACCCCTGTCCTGCTCCCAAATTCTTTTT TCCTTCTTCCATCAGCTACTAGCTTTTATCTTATTTACTTTACGAAA

[0035] The 7 nucleotides marked in the P.sub.ADH2-Cat2 (P.sub.ADH2-Cat8-L2) variant, are not naturally occurring on the wild-type P. pastoris ADH2 promoter. The ADH2 promoter variant P.sub.ADH2-Cat2 (P.sub.ADH2-Cat8-L2) has reached a significantly higher recombinant protein production capacity in comparison to the wild-type P. pastoris promoter by means of the specified seven nucleotide substitutions in the sequence.

TABLE-US-00003 Promoter variant-3: P.sub.ADH2-NucOpt (SEQ ID NO: 2) TCCTTTTTACCACCTAAGTGCGAGTGAAACACCCTATGGCTGCTCTCCGA TTGCCCCTCTACAGGCATAAGGGTGTGATTTTTTTTTTTTTAATTTTACA CCCCCTCCAACTTTTTTCGCGTAAATTGATCCTGTTACCAATATTGCATG CCCGGAGGAGACTTGCCCCCTAATTTCGCGGCGTCGTCCCGGATCGCAGG GTAAAAATATATAGACCCCACAAAAAAAAAATGATTATGTAAGAAGAGGG GGGTGATTCGGCCGGCTATCGAACTCTAACAACTAGGGGGGTGAAAAATG CCCAGCTTTTTTCCCTATTCTTTGACAAATCAGTATCACTTATTAACACC CCAAATTTTTTTCTCAACGGTCCCTCATCCTTGCACCCCTTTGGACAAAT GGCAGTTAGTATTAGTGCACTGACTGACTGCCTAACCTTAAACCCTAATT TCTTAGAAGGGGCCCATATAGTTAGCGAGGGGTGAAAAATTCCTCCATCG GAGATGTATTAACCGTAATTTTTTTTTTAAAAAAAAAAAATTCAGATAGC GAAATTTTTTTGATTTCGCGACGCGCGTTTTTTTTTTTTTTTTTTTTTTT TCTCACCCCTTCTGCCCAGTTCTGCCAATTGCCCATGAATCTACTAATTT CGTTGATTCCCACCCCCCTTTCCAACTCCAAAAATTTTTTAATTTTTTTT TTTTTTTGGGAGAATCTGAATGTATATTACATAAAGCGACCGGTGTCCGA AAAAATTTTTTTTTTTTTTAATTTTTTTTTTTTCCCCCGCTTTTTAAAAA CGGGGGTAAGCGCTCTCCGGGGTGCGAATTCGCGCCCTATTCCTTTCACC CTGCCTATTGTAGACGTCAACCCGCATCTGGTGCGAATATAGCGCACCCC CAATGATCACACCAACAATTGGTCCACCCCTCCCCAATCTCTAATATTCA CAATTCACCTCACTATAAATACCCCTGTCCTGCTCCCAAATTCTTTTTTC CTTCTTCCATCAGCTACTAGCTTTTATCTTATTTACTTTACGAAA

[0036] The third ADH2 promoter variant subject to the present invention is the nucleosome optimized P.sub.ADH2-NucOpt gene. The nucleotides marked in the P.sub.ADH2-NucOpt variant sequence are not naturally occurring on the P. pastoris wild-type ADH2 promoter.

[0037] The technique presented within the scope of the patent numbered U.S. Pat. No. 8,222,386B2 discloses the induction of ADH2 wild-type promoter (P.sub.ADH2-wt) by glycerol, ethanol or the mixture of these two carbon sources and said that the promoter gene is repressed with glucose and methanol. However, the ADH2 promoter variants subject to the present invention are induced with ethanol and are repressed with glycerol. The regulation of the developed ADH2 promoter variants are differentiated with the below mentioned characteristics according to the prior art: [0038] All designed and constructed ADH2 promoter variants are repressed with glycerol. [0039] The developed ADH2 promoter variants can carry out significantly higher production yield under ethanol induction in comparison to the wild-type ADH2 promoter. [0040] The developed ADH2 promoter variants can be induced with methanol at a medium strength.

[0041] The designed ADH2 promoter variants can be induced strongly in the presence of ethanol. Also the developed ADH2 promoter variants are induced in the presence of methanol at medium strength. In production medium where limited glucose, excess glucose, and excess glycerol carbon sources are used, recombinant protein production is repressed. As the designed promoter variants are regulated that can be both induced and repressed, this feature is especially important for the production of toxic proteins to the host cell. Moreover, as it can be induced with non-toxic ethanol, it provides safe-clean-green recombinant protein production conditions.

[0042] The ADH2-Cat2 promoter variant is significantly important as it is remarkably strong and it can be strictly regulated with carbon sources. It can even perform more protein production than the most commonly used strong and tightly regulated P. pastoris AOX1 promoter. This situation shows that production yield can be directly increased if potential recombinant protein production (for example production of human growth hormone, serum albumin, insulin and food industry enzymes) is carried out with ADH2-Cat2 (ADH2-Cat8-L2) promoter variant instead of AOX1 promoter. Besides this, significant advantage is provided as the mentioned high efficiency production levels can be achieved with ethanol instead of using toxic methanol for induction of AOX1.

[0043] It has been proved by the variants subject to the present invention that S. cerevisiae Cat8 binding site which is not naturally occurring on the wild-type ADH2 promoter gene has an important effect in increasing the expression strength of ADH2 promoter variants. The activating gene modules in yeast promoters are located in the upstream activating sequence site of the promoter. Considering our findings and the yeast promoter architecture, S. cerevisiae Cat8 binding site can be integrated into any position between the 1 to 948 nucleotides of the promoter gene to increase the strength.

[0044] The structure of chromatin is one of the most important parameters that regulate gene expression by determining the binding of transcription factors and initiation and elongation of transcription (Li et al. 2007). Nucleosome positioning determines the location and position of nucleosome structures in the genomic DNA sequence (Struhl and Segal, 2013). Nucleosome positioning at genome level, are determined by ATP-dependent nucleosome remodeling enzymes and transcription factors. The nucleosome optimization of P. pastoris wild-type P.sub.ADH2 gene has been conducted with NuPop and MATLAB software (Xi et al. 2010; Curran et al. 2014). For reliable nucleosome affinity prediction, upstream and downstream gene sequences of P.sub.ADH2 in the P. pastoris genome has been obtained from the P. pastoris genome database (online access: http://pichiagenome-ext.boku.ac.at:8080/apex/f?p=100:1). Input data for P.sub.ADH2 was designed starting from 200 bp upstream of the promoter until 100 bp downstream (enhanced green fluorescent protein (eGFP) gene's first 100 nucleotides, since it was used as a reporter protein) of the sequence for more reliable prediction of nucleosome affinity using NuPop. Throughout optimization process, yeast stress responsive elements, carbon source responsive elements, TFBSs related with non-optimal carbon source utilization, core promoter region and originally nucleosome depleted regions were protected from any mutation by defining them as forbidden sites to the optimization algorithm. Also creation or destruction of any known TFBSs were provided throughout optimization process.

EXAMPLES

Example 1

Material and Method

Example 1.1

[0045] Designing P.sub.ADH2-Cat1 (P.sub.ADH2-Cat8-L1) and P.sub.ADH2-Cat2 (P.sub.ADH2-Cat8-L2) Promoter Variants and Cloning with the Reporter Protein

[0046] Two-step overlap extension polymerase chain reaction (OE-PCR) method was used to integrate Cat8 TFBS to the ADH2 promoter gene and the designed mutagenic primers (Forward_PADH2_Cat1, Reverse_PADH2_Cat1, Forward_PADH2_Cat2, Reverse_PADH2_Cat2, Forward_PADH2 and Reverse_PADH2) given below the table have been used to construct P.sub.ADH2-Cat1 (P.sub.ADH2-Cat8-L1) and P.sub.ADH2-Cat2 (P.sub.ADH2-Cat8-L2) promoter variants.

TABLE-US-00004 TABLE 1 Designed primer nucleotide sequences used for the integration of Cat8 TFBS to the designed promoter variants and cloning the promoter variants with eGFP. SEQ Name of  ID Primer Primer Nucleotide Sequence NO: Forward_ CCTGCCAATTGCCCATGAATCTGCTTCCGTTCGT 6 PADH2_Cat1 CCGACCCACCCCCCTTTCCAACTCCACAA Reverse_ TTGTGGAGTTGGAAAGGGGGGTGGGTCGGACGAA 7 PADH2_Cat1 CGGAAGCAGATTCATGGGCAATTGGCAGG Forward GTCGACTACATAAAGTTCCGTTCGTCCGAAAAGA 8 PADH2-Cat2 TCTG Reverse_ CAGATCTTTTCGGACGAACGGAACTTTATGTAGT 9 PADH2_Cat2 CGAC Forward_ GTCGGATCCCTGCAGTCCTTTTTAC 10 PADH2 Reverse_ GCCCTTGCTCACCATTTTCGTAAAGTAAATAAGA 11 PADH2 TAAAAGCTAG Forward_ CAAAAAACAACTAATTATTCGAAACGAATGGTGA 12 eGFP GCAAGGGC Reverse_ CGAGGTACCTTACTTGTACAGCTCGTCC 13 eGFP

[0047] The enhanced green fluorescent protein (eGFP) gene has been used as a reporter for determining the gene expression level under the ADH2 promoter variant. The eGFP gene and ADH2 promoter variants gene were amplified by OE-PCR method using the primers (Forward_PADH2, Reverse_PADH2, Forward_eGFP and Reverse_eGFP) given in the table above. Any nucleotide addition between promoter and eGFP gene sequences were prevented. Amplified promoter variant and eGFP gene fragments were digested by using suitable restriction enzymes and were cloned with ligation reaction to the vector which carries a Zeocin™ resistance gene and an AOX1 transcription terminator module. Constructed plasmids were transformed to the chemically competent Escherichia coli DH5a cells that have been prepared with the calcium chloride method (Sambrook and Russell, 2001). Putative positive clones were selected using Zeocin™ containing selective LB agar media and following plasmid isolation, constructed recombinant vectors were verified by gene sequencing analysis.

Example 1.2

[0048] Transformation of the Yeast Pichia pastoris with Recombinant Vectors Carrying Promoter Variants and the Evaluation of the Expression Capacities of Promoter Variants

[0049] The recombinant vectors containing the ADH2 promoter variant and the eGFP reporter genes were linearized with the BglII restriction enzyme according to the suggestions of the manufacturer and the competent P. pastoris X33 cells prepared with the lithium chloride method were transfected with linearized gene fragments (Invitrogen, 2000). After regeneration, the transformants were inoculated into selective Zeocin™ containing YPD Agar medium. Following transformation, putative clones carrying the expression cassette comprising the promoter variant gene and the eGFP reporter gene was verified with colony PCR and at least 10 individuals were selected from each strain and used to evaluate the production capacities of promoter variants.

[0050] The expression cassette comprises at least one ADH2 promoter variant and at least a nucleic acid molecule encoding a protein (peptide) or functional nucleotide, said promoter variant and nucleic acid molecule form single- or multi-copy expression cassette. These Nucleic acid molecule and promoter are operably linked together.

[0051] The vector carrying the Zeocin™ resistance gene and an AOX1 transcription terminator module, comprises Pichia pastoris alcohol dehyrogenase 2 (ADH2) promoter variant and at least a nucleic acid molecule in the expression cassette.

[0052] Pichia pastoris cells were precultivated in YP medium (10 g/L yeast extract, 20 g/L peptone) for 20 hours at 25° C. at 280 rpm before being transferred to the production medium. At the end of the precultivation, cells were harvested by centrifugation and transferred to the production medium. In order to evaluate the expression capacities of the promoter variants a minimal medium (6.3 g/L (NH.sub.4).sub.2HPO.sub.4; 0.8 g/L (NH.sub.4).sub.2SO.sub.4; 0.49 g/L MgSO.sub.4*7H.sub.2O; 2.64 g/L KCl; 0.0535 g/L CaCl.sub.2*2H.sub.2O; 22 g/L citric acid monohydrate; 1.47 ml/L PTM1; 2 ml/L biotin (0.2 g/L); 20 ml NH.sub.4OH (25%)) including 5 different carbon sources separately was used. Different substrates used and the production parameters applied in the production trial were given in the table below. A production medium including m2p kit polysaccharide 25% (v/v) and 0.7% (v/v) enzyme (m2p-labs GmbH, Germany) mixture was used for limited glucose condition.

TABLE-US-00005 TABLE 2 Production test parameters applied in order to compare the eGFP production capacities of promoter variants with Pichia pastoris. Initial Production Production Condition ID Value OD.sub.600 Substrate Time Excess glycerol G 0.1 2 g/L glycerol 20 hours Excess glucose D 0.1 2 g/L glycerol 20 hours Limited glucose X 1 Limited glucose 20 hours concentration Methanol 1M 1 1% (v/v) 20 hours methanol Ethanol 0.5E 1 0.5% (v/v) 20 hours ethanol Ethanol 1E 1 1% (v/v) ethanol 20 hours Ethanol 2E 1 2% (v/v) ethanol 20 hours

[0053] Production tests having different ethanol and methanol concentrations mentioned below, have been carried out in order to compare the production potentials of promoter variants to commonly used promoters with increasing alcohol concentrations. The substrate that was used in production media was supplied at t=0 hour which is the initiation of the production and at the end of the 20th hour eGFP production amounts of the cells were analyzed.

TABLE-US-00006 TABLE 3 Production test parameters applied in order to compare the eGFP production capacity of promoter variants with different ethanol and methanol concentrations with Pichia pastoris. Initial Production Production Condition ID Value OD.sub.600 Substrate Time Ethanol 0.5 0.5 E 1 0.5% (v/v) ethanol 20 hours Ethanol 1 1 E 1 1% v/v ethanol 20 hours Ethanol 2 2 E 1 2% v/v ethanol 20 hours Ethanol 5 5 E 1 5% (v/v) ethanol 20 hours Methanol 1 1 M 1 1% v/v methanol 20 hours Methanol 2 2 M 1 2% v/v methanol 20 hours Methanol 5 5 M 1 5% (v/v) methanol 20 hours

[0054] The cells were cultured in 2 ml production media including different carbon source in 24 deep-well-plates (24 deep-well-plate, Whatman, UK) for 20 hours at a mixing speed of 280 rpm and at a temperature of 25° C. At the end of the 20th hour, Pichia pastoris cells were diluted in a phosphate-buffered saline solution to the OD.sub.600 value of 0.4.

[0055] Intracellular eGFP production values were determined by measuring average eGFP fluorescence per unit cell using Guava easyCyte™ (MilliPore) flow cytometry. In flow cytometry eGFP was stimulated at 488 nm and the emission value was collected at 525 nm. Fluorescence signal from 10,000 cells were taken into account in each measurement, using FSC and SSC values, cells which define the yeast cluster in the graphic were selected and the cells that show linear regression in terms of FSC-H and FSC-A values were gated to select singlets. Fluorescence intensity based on the cell volume and geometric mean of the gated population were used in eGFP fluorescence calculations for determination of the specific eGFP synthesis levels of the cells. Relative eGFP expression levels were calculated compared to eGFP expression under wild-type ADH2 promoter.

[0056] These cells comprise least one Pichia pastoris alcohol dehydrogenase 2 (ADH2) promoter variant at least an expression cassette and at least a vector. Said cell is a eukaryotic cell, particularly a yeast cell, preferably a methylotrophic yeast cell, preferably a yeast cell selected from the group consisting of Pichia, Candida, Hansenula and Toruplosis, especially a Pichia pastoris cell.

[0057] Recombinant proteins, peptide or functional nucleic acid are expressed by the following steps: [0058] Production of ADH2 promoter variants, [0059] Production of expression cassette with the addition of eGFP reporter gene, [0060] Production of recombinant vector promoter variants, [0061] Transformation of eukaryotic cells especially yeast cell, preferably a methylotrophic yeast cell, preferably a yeast cell selected from the group consisting of Pichia, Candida, Hansenula and Toruplosis, especially a Pichia pastoris cell with the recombinant vector and culturing the transformed cells in a suitable medium, [0062] Preferably inducible expression of said protein, peptide or functional nucleic acid molecule, [0063] Isolation of the produced protein, peptide or functional nucleic acid molecule.

Example 2

[0064] Results

[0065] The recombinant protein (eGFP) production under the promoter variants subject to the present invention were tested with shake flask bioreactor experiments. Production capacities of the designed promoter variants were compared with commonly used P. pastoris inducible AOX1 and constitutive GAP promoters, and the results are given in Table 4. Effect of different carbon sources on the activity of the promoter variants and thus efficiency of recombinant protein production were evaluated. Productivities of promoter variants are given in the Table 4, eGFP production by wt-ADH2 promoter under 1% (v/v) ethanol induction was determined as 100 unit and productivities of variants were related to this value.

TABLE-US-00007 TABLE 4 eGFP production capacities of the designed P A.sub.DH2 variants in yeast P. pastoris with different carbon sources Promoter 0.5 E 1 E 1 M X G D Wt-ADH2  65% 100%  32% 12%  6% 14% ADH2-Cat1 162% 221%  59% 16% 11% 15% (ADH2-Cat8-L1) ADH2-Cat2 370% 475% 119% 21% 12% 21% (ADH2-Cat8-L2) ADH2-NucOpt 136% 192%  67% 14% 13%  6% AOX1  15%  16% 178% 23%  3%  4% GAP 106%  56%  74% 22% 10%  4%

[0066] According to the results in Table 4, increasing ethanol concentrations from 0.5% to 1% (v/v) has increased the eGFP expression level of P.sub.ADH2-wt and promoter variants around 28-53%. When P. pastoris cells are induced with 1% (v/v) ethanol, eGFP production capacity of P.sub.ADH2-Cat1 (P.sub.ADH2-Cat8-L1), P.sub.ADH2-Cat2 (P.sub.ADH2-Cat8-L2), and P.sub.ADH2-NucOpt was respectively, 2.21-, 4.75-, and 1.92-fold higher than that of wt-ADH2 promoter. Even though productivities of ADH2 promoter variants are lower under 1% (v/v) methanol induction in comparison to ethanol induction, they can still perform medium strength productivity. The activities of promoter variants are severely reduced under limited glucose, excess glycerol and excess glucose conditions; in other words, the promoter variants are repressed under such conditions.

[0067] The effect of different ethanol and methanol concentrations on recombinant protein production by P.sub.ADH2 variants were evaluated with shake flask bioreactor experiments and the eGFP production results are presented in Table 5.

TABLE-US-00008 TABLE 5 eGFP production capacities of the designed P.sub.ADH2 variants in yeast P. pastoris with different ethanol and methanol concentrations Promoter 1 E 2 E 5 E 1 M 2 M 5 M Wt-ADH2 100% 121% 203%  27%  35%  62% ADH2-Cat1 (ADH2-Cat8-L1) 178% 260% 339%  51%  62% 149% ADH2-Cat2 (ADH2-Cat8-L2) 427% 498% 514% 118% 161% 261% ADH2-NucOpt 158% 230% 300%  67%  84% 128% AOX1  13%  17%  30% 206% 206% 149% GAP  25%  44% 121%  64%  82% 130%

[0068] According to the results presented in Table 5, in increasing ethanol concentration up to 5%, the production capacity of P.sub.ADH2-wt and promoter variants continues to increase. However, the production capacity of the AOX1 promoter which is the most commonly used P. pastoris promoter does not increase with increasing methanol concentrations under the tested conditions, and besides this, the growth of P. pastoris cells that have been induced with 5% (v/v) methanol is hampered and the cells start to die. The resistance of P. pastoris against high concentrations of ethanol is higher in comparison to methanol. This result shows that the designed promoter variants can be used for high yield recombinant protein production processes in fully controlled bioreactors using high concentrations of ethanol.

[0069] Production experiments using different carbon sources were performed with 3 biological replicas of each P. pastoris strain comprising each promoter variant and the results are presented in Table 6.

TABLE-US-00009 TABLE 6 eGFP production capacities of designed P.sub.ADH2 variants in P. pastoris with different carbon sources Promoter 2 E 1 M X G D wt-ADH2 100 ± 10 25 ± 1 5 ± 1  6 ± 1 7 ± 0 ADH2-Cat1 236 ± 27 44 ± 2 7 ± 1  9 ± 1 10 ± 0 ADH2-Cat2 476 ± 11 95 ± 2 10 ± 1  11 ± 1 12 ± 1 ADH2-NucOpt 150 ± 10  80 ± 33 8 ± 2 18 ± 7 18 ± 5

[0070] Under 2% (v/v) ethanol induction condition, P.sub.ADH2-Cat1 (P.sub.ADH2-Cat8-L1),P.sub.ADH2-Cat2 (P.sub.ADH2-Cat8-L2), and P.sub.ADH2-NucOpt performed respectively 2.36-, 4.76-, and 1.50-fold higher eGFP production in comparison to that of wt-ADH2 promoter. The designed promoter variants have reached significantly higher production capacities under ethanol and methanol induction condition in comparison to P.sub.ADH2-wt while they still maintain their regulated nature by being repressed in the presence of limited glucose, excess glycerol and excess glucose.

REFERENCES

[0071] Ahmad, M., Hirz, M., Pichler, H., & Schwab, H. (2014). Protein expression in Pichia pastoris: recent achievements and perspectives for heterologous protein production. Applied microbiology and biotechnology, 98(12), 5301-5317.

[0072] Curran, K. A., Crook, N. C., Karim, A. S., Gupta, A., Wagman, A. M., & Alper, H. S. (2014). Design of synthetic yeast promoters via tuning of nucleosome architecture. Nature communications, 5.

[0073] Hartner, F. S., Ruth, C., Langenegger, D., Johnson, S. N., Hyka, P., vd. (2008). Promoter library designed for fine-tuned gene expression in Pichia pastoris. Nucleic acids research, 36(12), e76-e76.

[0074] Invitrogen (2010), EasySelect™ Pichia Expression Kit For Expression of Recombinant Proteins Using pPICZ and PPICZα in Pichia pastoris

[0075] Li, B., Carey, M. and Workman, J. L. (2007). The role of chromatin during transcription. Cell 128: 707-719.

[0076] Roth, S., Kumme, J., and Schuller, H. J. (2004). Transcriptional activators Cat8 and Sip4 discriminate between sequence variants of the carbon source-responsive promoter element in the yeast Saccharomyces cerevisiae. Current genetics, 45(3), 121-128.

[0077] Sambrook, J., Russell, D. W. (2001) “Molecular cloning: a library manual”, 3rdedn., Cold Spring Harbor Library Press, Cold Spring Harbor, N.Y.

[0078] Struhl, K., and Segal, E. (2013). Determinants of nucleosome positioning. Nature structural and molecular biology, 20(3), 267-273.

[0079] Xi, L., Fondufe-Mittendorf, Y., Xia, L., Flatow, J., Widom, J., & Wang, J. P. (2010). Predicting nucleosome positioning using a duration Hidden Markov Model. BMC bioinformatics, 11(1), 1.