Method for in vitro diagnosis or prognosis of testicular cancer

11085091 · 2021-08-10

Assignee

Inventors

Cpc classification

International classification

Abstract

The invention relates to a method for in vitro diagnosis or prognosis of testicular cancer which comprises a step of detecting the presence or absence of at least one expression product from at least one nucleic acid sequence selected from the sequences identified in SEQ ID NOS: 1 to 6 or from the sequences which exhibit at least 99% identity with one of the sequences identified in SEQ ID NOS: 1 to 6, to isolated nucleic acid sequences and to the use thereof as a testicular cancer marker.

Claims

1. A method of diagnosing and treating testicular cancer, comprising: obtaining a testicular sample that is collected from a person suspected of suffering from testicular cancer; assaying the testicular sample to detect whether one or more HERV-W mRNA transcripts are overexpressed; and diagnosing the person with testicular cancer when there is overexpression of the one or more HERV-W mRNA, transcripts; and treating the person with testicular cancer by performing any of orchidectomy, radiotherapy, or chemotherapy, wherein overexpression is detected when expression of the respective HERV-W mRNA transcript is increased as compared to expression of the respective HERV-W mRNA transcript in a healthy testicular sample and the one or more HERV-W mRNA transcripts are expressed from a genomic sequence having at least 99% sequence identity with any of SEQ ID NOS: 1-6.

2. The method of claim 1, wherein overexpression of the one or more HERV-W mRNA transcripts is detected by detecting cDNA obtained from the one or more HERV-W mRNA transcripts.

3. The method of claim 1, wherein the person has a hard and irregular swelling of a testicle.

4. The method of claim 1, comprising assaying the testicular sample to detect whether an HERV-W mRNA transcript is overexpressed from a genomic sequence having at least 99% sequence identity with SEQ ID NO: 1.

5. The method of claim 1, comprising assaying the testicular sample to detect whether an HERV-W mRNA transcript is overexpressed from a genomic sequence having at least 99% sequence identity with SEQ ID NO: 2.

6. The method of claim 1, comprising assaying the testicular sample to detect whether an HERV-W mRNA transcript is overexpressed from a genomic sequence having at least 99% sequence identity with SEQ ID NO: 3.

7. The method of claim 1, comprising assaying the testicular sample to detect whether an HERV-W mRNA transcript is overexpressed from a genomic sequence having at least 99% sequence identity with SEQ ID NO: 4.

8. The method of claim 1, comprising assaying the testicular sample to detect whether an HERV-W mRNA transcript is overexpressed from a genomic sequence having at least 99% sequence identity with SEQ ID NO: 5.

9. The method of claim 1, comprising assaying the testicular sample to detect whether an HERV-W mRNA transcript is overexpressed from a genomic sequence having at least 99% sequence identity with SEQ ID NO: 6.

10. The method of claim 1, comprising assaying the testicular sample to detect whether an HERV-W mRNA transcript is overexpressed from each of: (i) a first genomic sequence having at least 99% sequence identity with SEQ ID NO: 1; (ii) a second genomic sequence having at least 99% sequence identity with SEQ ID NO: 2; (iii) a third genomic sequence having at least 99% sequence identity with SEQ ID NO: 3; (iv) a fourth genomic sequence having at least 99% sequence identity with SEQ ID NO: 4; (v) a fifth genomic sequence having at least 99% sequence identity with SEQ ID NO: 5; and (vi) a sixth genomic sequence having at least 99% sequence identity with SEQ ID NO: 6.

11. The method of claim 1, wherein expression of the one or more HERV-W mRNA transcripts is individually detected.

12. The method of claim 1, wherein expression of the one or more HERV-W mRNA transcripts is detected without performing hybridization on a chip.

13. A method of diagnosing and treating testicular cancer, comprising: obtaining a testicular sample that is collected from a person suspected of suffering from testicular cancer; assaying the testicular sample to detect whether one or more HERV-W mRNA transcripts are overexpressed; and diagnosing the person with testicular cancer when there is overexpression of the one or more HERV-W mRNA transcripts, transcripts; and treating the person with testicular cancer by performing any of orchidectomy, radiotherapy, or chemotherapy, wherein overexpression is detected when expression of the respective HERV-W mRNA transcript is increased as compared to expression of the respective HERV-W mRNA transcript in a healthy testicular sample and the one or more HERV-W mRNA transcripts have at least 99% sequence identity with any of SEQ ID NOS: 7-12.

14. The method of claim 13, comprising assaying the testicular sample to detect whether an HERV-W mRNA transcript having at least 99% sequence identity with SEQ ID NO: 7 is overexpressed.

15. The method of claim 13, comprising assaying the testicular sample to detect whether an HERV-W mRNA transcript having at least 99% sequence identity with SEQ ID NO: 8 is overexpressed.

16. The method of claim 13, comprising assaying the testicular sample to detect whether an HERV-W mRNA transcript having at least 99% sequence identity with SEQ ID NO: 9 is overexpressed.

17. The method of claim 13, comprising assaying the testicular sample to detect whether an HERV-W mRNA transcript having at least 99% sequence identity with SEQ ID NO: 10 is overexpressed.

18. The method of claim 13, comprising assaying the testicular sample to detect whether an HERV-W mRNA transcript having at least 99% sequence identity with SEQ ID NO: 11 is overexpressed.

19. The method of claim 13, comprising assaying the testicular sample to detect whether an HERV-W mRNA transcript having at least 99% sequence identity with SEQ ID NO: 12 is overexpressed.

20. The method of claim 13, comprising assaying the testicular sample to detect whether each of the following is overexpressed: (i) a first HERV-W mRNA transcript having at least 99% sequence identity with SEQ ID NO: 7; (ii) a second HERV-W mRNA transcript having at least 99% sequence identity with SEQ ID NO: 8; (iii) a third HERV-W mRNA transcript having at least 99% sequence identity with SEQ ID NO: 9; (iv) a fourth HERV-W mRNA transcript having at least 99% sequence identity with SEQ ID NO: 10; (v) a fifth HERV-W mRNA transcript having at least 99% sequence identity with SEQ ID NO: 11; and (vi) a sixth HERV-W mRNA transcript having at least 99% sequence identity with SEQ ID NO: 12.

21. The method of claim 13, wherein the person has a hard and irregular swelling of a testicle.

22. The method of claim 13, wherein expression of the one or more HERV-W mRNA transcripts is individually detected.

23. The method of claim 13, wherein expression of the one or more HERV-W mRNA transcripts is detected without performing hybridization on a chip.

Description

EXAMPLES

Example 1: Identification of HERV-W Loci Expressed in Cancerous Tissues

(1) Method:

(2) The identification of expressed HERV-W loci is based on the design of a high-density DNA chip in the GeneChip format proposed by the company Affymetrix. It is a specially developed, custom-made chip, the probes of which correspond to HERV-W loci. The sequences of the HERV-W family were identified from the GenBank nucleic databank using the Blast algorithm (Altschul et al., 1990) with the sequence of the ERVWE1 locus, located on chromosome 7 at 7q21.2 and encoding the protein called syncytin. The sequences homologous to HERV-W were compared to a library containing reference sequences of the HERV-W family (ERVWE1) cut up into functional regions (LTR, gag, pol and env), using the RepeatMasker software (A. F. A. Smit and P. Green). These elements constitute the HERVgDB bank.

(3) The probes making up the high-density chip were defined on a criterion of uniqueness of their sequences in the HERVgDB bank. The HERV-W proviral and solitary LTRs contained in the HERVgDB bank were extracted. Each of these sequences was broken down into a set of sequences of 25 nucleotides (25-mers) constituting it, i.e. as many potential probes. The evaluation of the uniqueness of each probe was carried out by means of a similarity search with all the 25-mers generated for all the LTRs of the family under consideration. This made it possible to identify all the 25-mers of unique occurrence for each family of HERV. Next, some of these 25-mers were retained as probes. For each U3 or U5 target region, a set of probes was formed on the basis of the probes identified as unique.

(4) The samples analyzed using the HERV high-density chip correspond to RNAs extracted from tumors and to RNAs extracted from the healthy tissues adjacent to these tumors. The tissues analyzed are: uterus, colon, lung, breast, testicle, prostate and ovary. Placental RNAs (health tissue only) were also analyzed. For each sample, 400 ng of total RNA were amplified by means of an unbiased transcriptional method known as WTA. The principle of WTA amplification is the following: primers (RP-T7) comprising a random sequence and a T7 promoter sequence are hybridized to the transcripts; double-standard cDNAs are synthesized and serve as a template for transcriptional amplification by the T7 RNA polymerase; the antisense RNAs generated are converted to double-stranded cDNAs which are then fragmented and labeled by introducing biotinylated nucleotide analogs at the 3′OH ends using terminal transferase (TdT) (cf. FIG. 1).

(5) For each sample, 16 μg of biotin-labeled amplification products were hybridized to a DNA chip according to the protocol recommended by the company Affymetrix. The chips were then washed and labeled, according to the recommended protocol. Finally, the chips were read by a scanner in order to acquire the image of their fluorescence. The image analysis carried out using the GCOS software makes it possible to obtain numerical values of fluorescence intensity which are preprocessed according to the RMA method (cf.: FIG. 2) before being able to carry out a statistical analysis in order to identify the HERV loci specifically expressed in certain samples.

(6) Comparison of the means of more than two classes of samples was carried out by the SAM procedure applied to a Fisher test.

(7) Results:

(8) The processing of the data generated by the analysis on DNA chip using this method made it possible to identify six sets of probes corresponding to an overexpression in just one sample: the tumoral testicle. These five sets of probes are specific for six precise loci referenced HW4TT, HW2TT, HW13TT, HWXTT, HW21TT and ERVWE1 (cf.: FIG. 3). These six loci therefore represent markers for testicular cancer. Their nucleotide sequences are respectively identified in SEQ ID Nos. 1 to 6 in the sequence listing and the nucleotide sequences of their respective transcripts are identified in SEQ ID Nos. 7 to 12 in the sequence listing.

(9) The information relating to the abovementioned six loci are summarized in Table 1 below.

(10) TABLE-US-00001 TABLE 1 Locus SEQ ID No: Chromosome Position* HW4TT 1 4 41982184:41989670 HW2TT 2 2 17383689:17391462 HW13TT 3 13 68693759:68699228 HWXTT 4 X 113026618:113027400 HW21TT 5 21 27148627:27156168 ERVWE1 6 7 91935221:91945670 *Position relative to ensemble version No. 39 (June 2006) (NCBI No. 36) http: //www.ensembl.org/Homo.sub.—sapiens/index.html

(11) The HW13TT locus is a chimeric provirus of HERV-W/L type resulting from the recombination of an HERV-W provirus and an HERV-L provirus. This chimera is such that the 5′ region made up of the sequence starting from the beginning of the 5′ LTR to the end of the determined gag fragment is of W type and the 3′ region made up of the sequence starting from the subsequent pol fragment to the end of the 3′ LTR (U3-R only) is of L type. This results in a fusion of the 3′ gag W-5′ pol L regions.

(12) A search of open reading frames (ORFs) of at least 150 bases, using the Mac Vector 9.5.2 software, based on the identification of a start codon and of a stop codon, was carried out and the corresponding polypeptides identified.

(13) The ORF1 of HW4TT identified in SEQ ID No. 13 encodes a Gag protein identified in SEQ ID No. 14 and the ORF 2 of HW4TT (SEQ ID No. 15) encodes a protease (SEQ ID No. 16),

(14) the ORF1 of HW2TT identified in SEQ ID No. 17 encodes a Gag protein identified in SEQ ID No. 18 and the ORF 2 of HW2TT (SEQ ID No. 19) encodes a protein identified in SEQ ID No. 20,

(15) the ORF of HW13TT identified in SEQ ID No. 21 encodes a Gag protein identified in SEQ ID No. 22,

(16) the ORF of HW21TT identified in SEQ ID No. 23 encodes a Gag protein identified in SEQ ID No. 24,

(17) the ORF of ERVWE1 identified in SEQ ID No. 25 encodes an Env protein identified in SEQ ID No. 26.

Example 2: Validation of the Loci Overexpressed in the Tumoral Testicle and Determination of the Associated Induction Factor

(18) Principle:

(19) Five of the six loci identified as overexpressed in the tumoral testicle by means of the high-density HERV chip were validated by real-time RT-PCR on three pairs of testicular samples. The specificity of this overexpression is evaluated by analyzing samples originating from other tissues. To this end, specific amplification systems were developed and used for the loci identified, as described in Table 2 below.

(20) TABLE-US-00002 TABLE 2 Locus Sense primer (SEQ ID No:) Antisense primer (SEQ ID No:) G6PD gene TGCAGATGCTGTGTCTGG (27) CGTACTGGCCCAGGACC (28) HW4TT GGTTCGTGCTAATTGAGCTG (29) ATGGTGGCAAGCTTCTTGTT (30) HW2TT TGAGCTTTCCCTCACTGTCC (31) TGTTCGGCTTGATTAGGATG (32) HW13TT CATGGCCCAATATTCCATTC (33) GGTCCTTGTTCACAGAACTCC (34) HWXTT CCGCTCCTGATTGGACTAAA (35) CGTGGGTCAAGGAAGAGAAC (36) HW21TT ATGACCCGCAGCTTCTAACAG (37) CTCCGCTCACAGAGCTCCTA (38)

(21) The expression of these loci is standardized with respect to that of a suitable housekeeping gene: G6PD. This quantification of expression was carried out using an Mx3005P real-time RT-PCR machine, marketed by the company Stratagene.

(22) Results:

(23) The study of the three pairs of testicular samples indicates that the five loci identified, with the exception of HWXTT, the expression of which could not be quantified in the second testicular RNA pair, are overexpressed in the tumoral testicle compared with the health tissue (cf.: FIG. 4). The very marked nature of the overexpression, i.e. a low or even absent transcriptional expression in the healthy testicle and a high expression in the tumoral testicle, reveals the possibility of an epigenic method of regulation of transcription of these loci.

(24) The analysis of pairs of samples originating from other tissues (colon, uterus, breast, ovary, lung and prostate) shows that the overexpression phenomenon is restricted to the tumoral testicle. Consequently, the expression of the identified loci assumes the nature of a marker specific for testicular cancer.

Example 3: Epigenetic Control of Transcription

(25) Principle:

(26) DNA methylation is an epigenetic modification which takes place, in eukaryotics, by the addition of a methyl group to the cytosines of 5′-CpG dinucleotides, and results in transcriptional repression when this modification occurs within the nucleotide sequence of a promoter. Apart from a few exceptions, human endogenous sequences of retroviral origin are restricted, owing to this methylation process, to a silent transcriptional state in the cells of the organism under physiological conditions.

(27) In order to analyze the methylation status of the unique LTR or of the 5′ LTR of the five loci, the “bisulfite sequencing PCR” method was used. This method makes it possible, on the basis of sequencing a representative sample of the population, to identify the methylation state of each CG dinucleotide on each of the sequences within the tissue studied.

(28) Since the methylation information is lost during the amplification steps, it is advisable to translate the methylation information actually within the nucleotide sequence by means of the method of treating the genomic DNA with sodium bisulfite. The action of the bisulfite (sulfonation), followed by hydrolytic deamination and then alkaline desulfonation, in fact makes it possible to modify all the cytosines contained in the genomic DNA, into uracil. The speed of deamination of sulfonated cytosines (C) is, however, much higher than that of the sulfonated 5-methyl-Cs. It is therefore possible, by limiting the reaction time to 16 hours, to convert strictly the non-methylated cytosines to uracil (U), while at the same time preserving the cytosines which have a methyl group. After the sodium bisulfite treatment, the sequence of interest is amplified from the genomic DNA derived from the tumoral testicular section and from that derived from the adjacent healthy testicular section, by polymerase chain reaction (PCR) in two stages. The first PCR enables a specific selection of the sequence of interest, the second, “nested”, PCR makes it possible to amplify this sequence.

(29) Since the DNA sequence had been modified by the bisulfite, the design of the primers took into account the code change (C to U), and the primers were selected so as to hybridize to a region containing no CpG (their methylation state, and therefore their conversion state, being a priori unknown).

(30) The sequences of the primers used are described in Tables 3 to 8 below.

(31) TABLE-US-00003 TABLE 3 HW4TT locus Sense primer 5′.fwdarw.3′ Antisense primer 5′.fwdarw.3′ Amplification (SEQ ID No.:) (SEQ ID No.:) First PCR CCAACATCACTAACACAACCT (39) GGGAGTTAGTAAGGGGTTTG (40) Nested PCR CAACCTATTAAACAAAACTAAATT (41) AGATTTAATAGAGTGAAAATAGAGTTT (42)

(32) TABLE-US-00004 TABLE 4 HW2TT locus Sense primer 5′.fwdarw.3′ Antisense primer 5′.fwdarw.3′ Amplification (SEQ ID No.:) (SEQ ID No.:) First PCR TTATTAGTTTAGGGGATAGTTG (43) ACACAATAAACAACCTACTAAAT (44) Nested PCR GAGGGTAAGTGGTGATAAA (45) AACCTACTAAATCCAAAAAAA (46)

(33) TABLE-US-00005 TABLE 5 HW13TT locus Sense primer 5′.fwdarw.3′ Antisense primer 5′.fwdarw.3′ Amplification (SEQ ID No.:) (SEQ ID No.:) First PCR TAGGATTTTAGGTTTATTGTTA (47) AAAAATAAAATATTAAACC (48) Nested PCR ATATGTGGGAGTGAGAGATA (49) CAACAACAAACAATAATAATAA (50)

(34) TABLE-US-00006 TABLE 6 HWXTT locus Sense primer 5′.fwdarw.3′ Antisense primer 5′.fwdarw.3′ Amplification (SEQ ID No.:) (SEQ ID No.:) First PCR TTGAGTTTTTTTATTGATAGTG (51) TCTAAATCCTATTTTCCTACT (52) Nested PCR GTTTTTTTATTGATAGTGAGAGAT (53) TAACAAACCTTTAATCCAAT (54)

(35) TABLE-US-00007 TABLE 7 HW21TT locus Sense primer 5′.fwdarw.3′ Antisense primer 5′.fwdarw.3′ Amplification (SEQ ID No.:) (SEQ ID No.:) First PCR TTTAGTGAGGATGATGTAATAT (55) CAACTTAATAAAAATAAACCCA (56) Nested PCR ATAATGTTTTAGTAAGTGTTGGAT (57) ACAATTACAAACCTTTAACC (58)

(36) TABLE-US-00008 TABLE 8 ERVWE1 locus Sense primer 5′.fwdarw.3′ Antisense primer 5′.fwdarw.3′ Amplification (SEQ ID No.:) (SEQ ID No.:) First PCR AATTCATTCAACATCCATTC (59) GGTTTAATATTATTTATTATTTTGGA (60) Nested PCR CTCTTACCTTCCTATACTCTCTAAA (61) AGAGTGTAGTTGTAAGATTTAATAGAGT (62)

(37) After extraction on a gel and purification, the amplicons are cloned into plasmids, and the latter are used to transform competent bacteria. About twelve plasmid DNA mini preparations are carried out using the transformed bacteria and the amplicons contained in the plasmids are sequenced. The sequences obtained are then analyzed (cf.: FIGS. 5 to 10).

(38) Results:

(39) The analysis of the 5′ region of the transcripts of the loci identified was carried out by means of the 5′ Race technique. It in particular made it possible to show that the transcription is started at the beginning of the R region of the proviral 5′ LTR. This reflects the existence of a promoter role for the U3 region of the proviral 5′ LTR.

(40) 1. Methylation State of the U3 Sequences of the 5′ LTR of the HW4TT Locus:

(41) The U3 sequence of the 5′ LTR of the HW4TT locus of reference contains 5 CpG sites:

(42) a) in the sample of healthy testicular tissue: out of 12 sequences analyzed, 9 are completely methylated. The other 3 each time exhibit 1 CpG nonmethylated out of the 5 contained in the U3 region. This therefore represents an overall methylation of the U3 region of the 5′ LTR of the HW4TT locus amounting to 95% in the healthy testicular sample;

(43) b) in the sample of tumoral testicular tissue: out of 12 sequences analyzed, 5 (i.e. 41.66% of the sequences) are completely demethylated, 3 sequences have 4 CpGs out of 5 nonmethylated, 2 sequences have 2 CpGs out of 5 nonmethylated, 1 sequence has 1 CpG out of 5 nonmethylated, and 1 sequence remains completely methylated. This therefore represents an overall methylation of the U3 region of the 5′ LTR of the HW4TT locus amounting to 30% in the tumoral testicular sample.

(44) 2. Methylation State of the U3 Sequences of the 5′ LTR of the HW2TT Locus:

(45) The U3 sequence of the 5′ LTR of the HW2TT locus of reference contains 5 CpG sites:

(46) a) in the sample of healthy testicular tissue: out of 12 sequences analyzed, 9 are completely methylated, 1 has its 2nd CpG nonmethylated, 1 has the CpG at position 4 nonmethylated, 1 has the CpGs at positions 4 and 5 nonmethylated, and 3 sequences have point mutations on one or two CpGs (one in position 3, one in position 5 and one in positions 4 and 5), very probably reflecting PCR artifacts. This therefore represents an overall methylation of the U3 region of the 5′ LTR of the HW2TT locus amounting to 92.9% in the healthy testicular sample;

(47) b) in the sample of tumoral testicular tissue: out of 12 sequences analyzed, 6 are completely demethylated, 5 sequences have one or two methylated CpG(s) (1 at position 1, 1 other at position 5, 1 on positions 1 and 5, 2 at positions 4 and 5 and 1 at position 3). Finally, one sequence has 4 CpGs methylated out of 5 (positions 1, 2, 4 and 5). This corresponds to an overall methylation of the U3 region of the 5′ LTR of the HW2TT locus amounting to 20% in the tumoral testicular sample.

(48) 3. Methylation State of the U3 Sequences of the 5′ LTR of the HW13TT Locus:

(49) The U3 sequence of the 5′ LTR of the HW13TT locus of reference contains 3 CpG sites:

(50) a) in the sample of healthy testicular tissue: an additional CpG, compared with the reference sequence, is found in 4 of the 10 clones studied for this locus. It is located between CpGs 2 and 3 and is methylated. In the other 6 clones, this site is mutated compared with the reference sequence. The other 3 CpGs of the U3 region are methylated in the 10 sequences analyzed. This therefore represents an overall methylation of the U3 region of the 5′ LTR of the HW13TT locus amounting to 100% in the healthy testicular sample;

(51) b) in the sample of tumoral testicular tissue: the additional CpG indicated above is also found. It is demethylated in 4 of the 10 sequences analyzed, mutated in 3 other sequences, and its methylation state is indeterminate in the last 3 sequences. 7 sequences out of 10 are completely demethylated and the other 3 are methylated on the 2.sup.nd and on the 3.sup.rd CpG. This corresponds to an overall methylation of the U3 region of the 5′ LTR of the HW13TT locus amounting to 20% in the tumoral testicular sample.

(52) 4. Methylation State of the U3 Sequences of the Solitary LTR of the HWXTT Locus:

(53) The U3 sequence of the 5′ LTR of the HWXTT locus of reference contains 6 CpG sites:

(54) a) in the sample of healthy testicular tissue: the 8 sequences analyzed are completely methylated, which corresponds to a methylation percentage of 100% in the healthy testicular sample;

(55) b) in the sample of tumoral testicular tissue: the 9 sequences analyzed 6 are completely demethylated, which corresponds to a methylation percentage of 0%.

(56) 5. Methylation State of the U3 Sequences of the 5′ LTR of the HW21TT Locus:

(57) The U3 sequence of the 5′ LTR of the HW21TT locus of reference contains 7 CpG sites:

(58) a) in the sample of healthy testicular tissue: the 10 sequences analyzed all have 6 CpGs methylated out of 7; for 6 of the sequences, the 1.sup.st CpG is nonmethylated and for the other 4 sequences, the 4.sup.th CpG is nonmethylated. This therefore represents an overall methylation of the U3 region of the 5′ LTR of the HW21TT locus amounting to 85.7% in the healthy testicular sample;

(59) b) in the sample of tumoral testicular tissue: out of 8 sequences analyzed, 6 are completely demethylated, 2 others exhibit a profile identical to one of those found in the healthy testicular tissue, namely 6 CpGs methylated and the 1.sup.st CpG nonmethylated. This corresponds to an overall methylation of the U3 region of the 5′ LTR of the HW21TT locus amounting to 21.4% in the tumoral testicular sample.

(60) 6. Methylation State of the Sequences of the Activator of the U3 of the 5′ LTR of the ERVWE1 Locus:

(61) The ERVWE1 locus comprises, in addition to its U3 promoter region, a known activator located directly upstream of the 5′ LTR, and which contains two CpG sites (CpG 1 and 2). The U3 sequence of the 5′ LTR of the ERVWE1 locus of reference contains, for its part, 5 CpG sites (CpGs 3 to 7):

(62) a) in the sample of healthy testicular tissue: out of 10 sequences analyzed, 5 sequences have CpGs 1 and 2 (activator) and 5 (U3) nonmethylated, 1 sequence has CpGs 2 and 5 nonmethylated, 2 sequences have CpGs 1 (activator) and 7 (U3) nonmethylated, 1 sequence has CpG 7 only nonmethylated and, finally, 1 is completely methylated for the 7 CpGs. In total, this corresponds to a methylation percentage of 68.57% in the healthy testicular sample;

(63) b) in the sample of tumoral testicular tissue: out of the 10 sequences analyzed, only 3 sequences exhibit, for each one, a unique methylated CpG (CpG 4 or CpG5 or CpG6), the other 7 sequences are completely demethylated, which corresponds to a methylation percentage of 4.29%.

(64) The very high level of methylation of the U3 retroviral promoters of the loci considered, in the healthy tissue, is correlated with the low, or even absent, transcription expression of the U5 regions which correspond to the loci considered, indicating a repression of the transcriptional expression by an epigenetic mechanism. On the other hand, the low level of methylation of these same promoters in the tumoral tissue reflects a lifting of transcriptional inhibition, the result of which is the significantly higher expression demonstrated by means of the high-density HERV DNA chip and by means of the real-time RT-PCR.

LITERATURE REFERENCES

(65) [1] Nickerson D. A. et al., DNA sequence diversity in a 9.7-kb region of the human lipoprotein lipase gene, Nature Genetics, Vol. 19, pp 233-240 (1998). [2] Cottrell S. E., Molecular diagnostic applications of DNA methylation technology, Clinical Biochemistry 37, pp 595-604 (2004).