Use of regulatory T cell-specific surface protein LRIG-1

11091538 · 2021-08-17

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to a novel use of regulatory T cell-specific surface protein Lrig-1, and more specifically to an immunosuppressive agent comprising siRNA which inhibits the expression of surface protein Lrig-1. In addition, the invention relates to a method for screening an immunosuppressive agent which inhibits proteins of Lrig-1 or genes encoding the proteins. As a result, an immunosuppressive agent with low side effects and high specificity can be developed.

Claims

1. A method for screening an agent for Lrig (leucine-rich repeats and immunoglobulin-like domain) down-regulating activity comprising: (a) contacting the agent with a regulatory T cell expressing Lrig protein; (b) measuring an expression level of the Lrig expressed by the regulatory T cell; and (c) determining that the agent has Lrig down-regulating activity when the expression level of Lrig of the regulatory T cell is down-regulated.

2. The method of claim 1, wherein the Lrig protein is any one selected from the group consisting of Lrig1, Lrig2 or Lrig3.

3. The method of claim 1, wherein the Lrig protein is set forth in SEQ ID NO: 11.

4. The method of claim 1, wherein the expression level of Lrig by the regulatory T cell is determined by reverse transcription polymerase chain reaction (RT-PCR) or fluorescence-activated cell sorting (FACS).

Description

DESCRIPTION OF DRAWINGS

(1) FIG. 1 shows a comparison of the expression levels of Lrig1 in non-contacted T cells, Th1, Th2, Th17, iTreg and nTreg through Micro array.

(2) FIG. 2 shows the difference of the expression level of the regulatory T cell-specific Foxp3 gene as a positive control.

(3) FIG. 3 shows a comparison of the expression level of Lrig1 in non-contacted T cells (CD44.sup.low, CD62L.sup.high) and memory T cells (CD44.sup.high, CD62L.sup.low) with the expression level of Foxp3+ regulatory T cells through RT-PCRn (two times tests).

(4) FIG. 4 shows a relative comparison of mRNA expression level of Lrig1 in T cells.

(5) FIG. 5(a) confirms the expression of Lrig 1 in CD4.sup.+CD25.sup.high cells, CD4.sup.+CD25.sup.low cells and CD4.sup.+Foxp3.sup.+ cells through Western blot, and (b) when CD4.sup.+CD25.sup.high cells and CD4.sup.+CD25.sup.low cells were compartmented into only CD4 positive cells, compares these cells with the control antibody in each cell group, analyses the expression level of LRIG1 with FACS and shows the difference (%). It can be seen that the expression of Lrig1 is increased in the natural regulatory T cells (nTreg) (from 0% to 6.24%).

(6) FIG. 6(a) confirms the expression reduction of LRIG1 by the reverse transcription polymerase chain reaction after delivering control siRNA and Lrig1-specific siRNA to proliferated CD4.sup.+Foxp3.sup.+, and (b) it can be seen that the regulatory T cells with reduced expression of LRIG1 does not greatly increase its number upon expansion. Here, the blue shows that expansion (proliferation) of Treg cells is not increased when Treg cells (CD4.sup.+CD25.sup.high) were treated with Lrig1-specific siRNA and that the non-treated Treg cells (red) were normally expanded. The blue is indicated as (siRNA+CD4.sup.+CD25.sup.high) and the red is indicated as (CD4.sup.+CD25.sup.high).

(7) FIG. 7 shows that, when naive T cells (CD.sup.+CD25.sup.low) stimulated with anti-CD3+anti-CD28mAb was cultured as in Treg cells (CD4.sup.+CD25.sup.high), the proliferation of activated T cells was effectively inhibited in Treg cells with high Lrig-1 expression in mixed lymphocyte reaction, but Treg cells with lowered Lrig-1 expression by treatment of Lrig 1-specific siRNA did not inhibit the expansion of cells. As such, this shows the relationship between the expression and immunosuppressive activity of LRIG1 in CD4.sup.+CD25.sup.high cells (A). By re-confirming the study result of (A) using CFSE dilution reaction method, the expression LRIG1 in CD4.sup.+CD25.sup.high cells is proven to be important in the immunosuppressive activity of Treg cells.

(8) FIG. 8 shows RT-PCR test result using LRIG1-specific primer wherein B cells, CD8+T cells, naive CD4+T cells, effector CD4+T cells and Treg cells were isolated in mouse to isolate mRNA and then they are used as a template. It can be seen from the test result that LRIG1 is specifically much expressed in the regulatory T cells.

(9) FIG. 9 shows RT-PCR test result using LRIG1-specific primer wherein naive CD4+T cells, effector CD4+T cells and Treg cells were isolated in mouse to isolate mRNA and then an activation signal is given to the cells by anti-CD3+anti-CD28 mAb stimulation, mRNA is separated from each cell and they are used as a template. It can be seed from the test result that LRIG1 is specifically much expressed in the regulatory T cells and that the expression in the activated regulatory T cells is highly induced.

(10) FIG. 10 and FIG. 11 are about the result wherein the proteins of several stimulated cells are subjected to Western blotting with mAb to LRIG1d, and the cell colonies through their FACS.

MODE FOR INVENTION

(11) Advantages and features of the present invention and methods of accomplishing the same will be apparent with reference to the examples set forth in detail below. However, the present invention is not intended to be limited to the examples set forth herein, and it may be implemented in many different forms. These examples are only provided to complete the disclosure of the present invention and to sufficiently define the scope of the invention to a person with ordinary skill in the technical field to which the present invention pertains. The present invention will be only defined by the appended claims.

EXAMPLE 1

(12) Isolation and Culture of T Cells

(13) C57BL6 (H-2.sup.b) wild-type mice and Foxp3-GFP transgenic mice were used. All mice were bred in a clean condition (SPF) where the temperature and humidity were properly adjusted, and was used at the period of 8-12 week age in accordance with the animal experiment protocol approved by the Animal Experiment Commission of Yonsei University in Seoul.

(14) The spleen cells of C57BL/6 rats were isolated to which the antibodies attached with anti-CD4-magnetic bead was added and passed through a magnetic activated cell analyzer (MACS) (MiltenyiBiotec), thus isolating CD4+cells (90-95%). Nest, in order to conduct MicroArray, the CD4+cells were stained with anti-CD4-antibody (Clone RM4-5, BD bioscience), anti-CD25-antibody (Clone 7D4, BD bioscience), anti-CD44-antibody (Clone IM7, BD bioscience) and anti-CD62L-antibody (Clone MEL-14, BD bioscience), and then non-contacted T cells (Naive T cells), CD4.sup.+CD62L.sup.+CD44.sup.−CD25.sup.−, natural regulatory T cells (nTreg), CD4.sup.+CD25.sup.high cells and CD4.sup.+CD25.sup.low cells were isolated through the flow cytometry (FACS, BD FACSAria™II).

(15) The T cells were removed through non-contacted T cells, anti-Thy1.2 antibody and rabbit complement (Cedarlance Laboratories Limited) to which Antigen-Presenting Cells (APCs) isolated by radiation of 30 Gy (3000 rad) were added at a ratio of 1:5 and stimulated with anti-CD3 antibody 1 μg/mcustom character (clone 145-2C11, BD bioscience) and anti-CD28 antibody 3 μg/mcustom character (clone 37.51, BD bioscience). Next, the antibody differentiating into each group of the T cells was added with cytokines and the cells were cultured for 72 hours. IL-2 (100 U/mcustom character) was added to the remaining cell group except for iTreg and further cultured for 4 days. The type and amount of antibodies for each group of cells were as follows:

(16) Th1-anti-IL-4 (10 μg/Mcustom character), IL-12 (10 ng/Mcustom character), IL-2 (100 U/Mcustom character)

(17) Th2-anti-IFN-g (10 μg/Mcustom character), anti-IL-12 (10 ng/Mcustom character), IL-4 (5000 U/Mcustom character) and IL-2 (100 U/Mcustom character)

(18) Th17-anti-IL-4 (10 μg/Mcustom character), anti-IFN-λ(10 μg/Mcustom character), anti-IL-12 (10 μg/Mcustom character), TGF-β(5 ng/Mcustom character), IL-6 (10 ng/Mcustom character), IL-1β(10 ng/Mcustom character)

(19) iTreg-anti-IL-4 (10 μg/Mcustom character), anti-IFN-λ(10 μg/Mcustom character), anti-IL-12 (10 μg/Mcustom character), TGF-β(5 ng/Mcustom character), IL-2 (100 U/Mcustom character)

(20) In order to conduct a reverse transcription polymerase chain reaction (RT-PCR, Reverse transcription-PCR), the total RNA was extracted using kit (Allprep DNA/RNA Mini Kit™ Qiagen) in CD4.sup.+CD25.sup.low cells and CD4.sup.+CD25.sup.high cells and then the complementary DNA (cDNAs) were synthesized using kit (Transcriptor High Fidelity cDNA Synthesis kit™ Roche). The polymerase chain reaction was carried out using oligonucleotide primers and PCR composition (master mix, Qiagen) where the purified complementary DNBA was directly designed. The transcription factor foxp3 and gamma actin 1 (ACTG1) of the regulatory T cells (Treg) were used as a control group. Each primer sequence is as follows:

(21) TABLE-US-00001 TABLE 1 Primers for protein amplification SEQ Protein ID NO Sequence Direction LRIG1 1 ACCACCGTAGGCATCTTCAC Forward 2 GAGCCACTGTGTGCTGTTGT Reverse FOXP3 3 CCCTTGGCCCATCCCCAGGA Forward 4 CCGAGCGTGGGAAGGTGCAG Reverse ACTG1 5 GGCGTCATGGTGGGCATGGG Forward 6 ATGGCGTGGGGAAGGGCGTA Reverse

EXAMPLE 2

(22) Identification of Lrig-1 Surface Protein Specifically Expressing to CD4.sup.+CD25.sup.−nTreg

(23) Cells isolated from Example 1, i.e., CD4.sup.+CD25.sup.high cells, CD4.sup.+CD25.sup.low cells and CD4.sup.+Foxp3.sup.+ cells were dissolved with RIPA cytolysis buffer (Sigma). The same amount of cell suspension was then subjected to electrophoresis through SDS PAGE gel and moved into the membrane. Western blot was conducted using anti-LRIG1-antibody (SantaCruz), anti-Foxp3-antibody (ebioscience), and anti-beta actin (Cell Signaling).

(24) To the cells isolated with a flow cytometry through a surface protein staining, i.e., CD4.sup.+CD25.sup.high cells and CD4.sup.+CD25.sup.low cells, anti-LRIG-antibody (R&D systems) and control antibody (Goat-IgG control, R&D systems) were added to compare the expression level of LRIG, reacted at a temperature of 4° C. for 30 minutes and then washed with FACS buffer (0.05% sodium azide, 0.5% BSA/PBS). The flow cytometric analysis was conducted with the flow cytometry (FACSCalibur, BD Bioscience).

EXAMPLE 3

(25) Identification of the Relationship Between Lrig-1 Expression in Treg and Treg Proliferation

(26) Mouse Lrig1-specific siRNAs (Thermo Fisher Scientific) was prepared into a liposome-siRNA complex (Lipofectamin 2000™ Invitrogen) and the amount of final siRNA was made as 5˜50 pmol and then transfected in proliferated CD4.sup.+Foxp3.sup.+ T cells 1×10.sup.5/2 mcustom character cell culture solution. After 24 hours, the reduction of expression was confirmed through the reverse transcription polymerase chain reaction. The Lrig1-specific siRNAs sequences used are as follows:

(27) TABLE-US-00002 TABLE 2 siRNA for expression inhibition SEQ ID NO Name Sequence  7 SMARTpool siRNA CCGAACGGCCUGCGUAUAA J-046693-09  8 SMARTpool siRNA GGAGCCAGCUGAAGUCGUA J-046693-10  9 SMARTpool siRNA GGUCUGUAGUUGAGGACGA J-046693-11 10 SMARTpool siRNA CCUGGAAGGUGACGGAGAA J-046693-12

EXAMPLE 4

(28) Identification of Relationship Between the Expression Reduction of Lrig-1 in Treg and the Suppressive Activity of Treg

(29) <Method for Suppressing a Mixed Lymphocyte Culture Reaction>

(30) 2.5×10.sup.5 of C57BL/6 mouse-derived CD4.sup.+CD25.sup.low T cells per each well were introduced in the 96-well plate immobilized with anti-CD3 antibody (clone 145-2C11) (5 μg/mcustom character) to which anti-CD28 antibody (clone 37.51) (2.5 μg/mcustom character) in an aqueous solution state was added and stimulated. The stepwise diluted nTreg and siRNA were added thereto. After one day, nTreg was added and subjected to mixed reaction in 5% CO.sub.2 incubator at 37° C. for 72 hours. Before the final 6 hours, 1 μci of [.sup.3H]-thymidine (185 GBq/mmol, Amersham Biosciences) per well was added. The cells were collected on filter paper using a cell harvester. The amount of [.sup.3H]-thymidine incorporated within the cells was measured by TopCount NXT beta counter (PerkinElmer). Hence, it can be seen that the expression of LRIG1 in CD4.sup.+CD25.sup.high cells is important in the immunosuppressive activity through the incorporation of [.sup.3H]-thymidine after a mixed lymphocyte culture reaction (see FIG. 7(a)).

(31) <CFSE Dilution Reaction (Carboxyfluorescein Succinimidylester)>

(32) The CD4.sup.+CD25.sup.low cells were pre-labeled with 104 CFSE (Sigma), and then 1×10.sup.6 cells per well were introduced in 96-well plates immobilized with anti-CD3 antibody (clone 145-2C11) (5 μg/mcustom character) and then stimulated in a CO.sub.2 incubator at 37° C. for 48 or 96 hours. Also, anti-CD28-antibody (clone 37.51) (2.5 μg/mcustom character) in an aqueous solution state was added and stimulated. The stepwise diluted nTreg and siRNA were added thereto. After one day, nTreg was added and subjected to mixed reaction in 5% CO.sub.2 incubator at 37° C. for 72 hours. The anti-CD3 antibody (clone 4-5, BD bioscience) was added, reacted at a temperature of 4° C. for 30 minutes, washed with FACS buffer (0.05% sodium azide, 0.5% BSA/PBS). Before 10 minutes of the analysis, 7-AAD (ebioscience) was added, thus analyzing only the living cell. The CFSE dilution in CD4.sup.+ cells was measured through FACSCalibur (BD Bioscience) to investigate the cell frequency and the proliferation times where the cell proliferation occurs. As a result, CD4.sup.+CD25.sup.low cells stained with CFSE were subjected to mixed lymphocyte reaction. It can be seen that the expression of LRIG1 in CD4.sup.+CD25.sup.high cells is important in the immunosuppressive activity through the CFSE dilution degree (see FIG. 7(b)).

EXAMPLE 5

(33) Identification of Human Treg Cell-Specific Expression

(34) Cells stimulated with anti-CD3+anti-CD28 mAb by isolation of human naive T cells, cells differentiated with iTreg by the treatment of anti-CD3+anti-CD28 mAb+TGFb+IL-2, cells treated with Rapamycin or Everolimus (inhibitors to inhibit proliferation of cells induced protein functions of mTOR and the derivatives thereof) known to induce the proliferation of Treg with the treatment of anti-CD3+anti-CD28 mAb+TGFb+IL-2, Jurkat human T cells, and naive human CD4+T cells were stimulated with anti-CD3+ anti-CD28 mAb to isolate activated cells. The protein was prepared from each of these cells. Western blotting was conducted with mAb to LRIG1d. As a result, it can be seen that LRIG1d was specifically expressed only on iTreg and that the expression level is markedly increased in the activation and proliferation of Treg and proliferated iTreg. It has been shown that LRIG1 was greatly expressed even in the regulatory T cells of rats as well as in the regulatory T cells of human, particularly, the expression was increased in the activated or proliferated regulatory T cells (see FIG. 10 and FIG. 11).