POLYEPITOPE CONSTRUCTS FOR USE IN IMMUNOTHERAPY

20210254098 · 2021-08-19

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to DNA expression vector or a mixture of DNA expression vectors which encodes at least two CD4 epitopes of telomerase reverse transcriptase (TERT) and at least one tumor, viral, bacterial, or parasitic CD8 epitope.

    Claims

    1. A DNA expression vector or a mixture of DNA expression vectors which encodes at least two CD4 epitopes of telomerase reverse transcriptase (TERT) and at least one tumor, viral, bacterial, or parasitic CD8 epitope.

    2. The mixture of DNA expression vectors of claim 1, comprising i) at least a DNA expression vector which encodes said at least two CD4 epitopes of TERT and ii) at least a DNA expression vector which encodes said at least one tumor, viral, bacterial, or parasitic CD8 epitope.

    3. The DNA expression vector of claim 1, which encodes said at least two CD4 epitopes of TERT and said tumor, viral, bacterial, or parasitic CD8 epitope.

    4. The DNA expression vector or a mixture of DNA expression vectors according to any of claims 1 to 3, wherein said TERT is human TERT.

    5. The DNA expression vector or a mixture of DNA expression vectors according to any of claims 1 to 4, wherein said at least two CD4 epitopes of TERT are distinct from each other.

    6. The DNA expression vector or a mixture of DNA expression vectors according to any of claims 1 to 4, wherein said at least two CD4 epitopes of TERT are identical, and repeated.

    7. The DNA expression vector or a mixture of DNA expression vectors according to any of claims 1 to 6, which encodes between 2 and 30, preferably between 2 and 20, 3 and 18, 3 and 15, 3 and 12, 4 and 10, or still preferably between 4 and 8, CD4 epitopes of TERT.

    8. The DNA expression vector or a mixture of DNA expression vectors according to any of claims 1 to 7, wherein at least one of said CD4 epitopes of TERT is selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4, preferably wherein the vector or mixture of vectors encodes a polyepitopic sequence comprising all of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4.

    9. The DNA expression vector or a mixture of DNA expression vectors according to any of claim 8, which encodes a repetition at least two, preferably at least four, epitopes of SEQ ID NO:2.

    10. The DNA expression vector or a mixture of DNA expression vectors according to any of claims 1 to 9, which encode, as said CD8 epitope, all or part of a viral, bacterial or parasitic antigen which comprises MHC class I epitopes, preferably a non-oncogenic mutant of HPV E7 antigen.

    11. A kit comprising a. a first container containing at least a DNA expression vector which encodes said at least two CD4 epitopes of TERT and b. a second container containing at least a DNA expression vector which encodes a tumor, viral, bacterial, or parasitic CD8 epitope.

    12. The kit of claim 11, further comprising at least an additional container containing at least a DNA expression vector which encodes a further distinct tumor, viral, bacterial, or parasitic CD8 epitope.

    13. The DNA expression vector or a mixture of DNA expression vectors according to any of claims 1 to 10, or the kit of claim 12, for use in treating a tumor or an infection in a patient.

    14. The DNA expression vector, mixture of DNA expression vectors according or the kit for use according to claim 13, wherein the tumor is a cancer, such as a cancer selected from the group consisting of chronic lymphocytic leukemia, chronic myeloid leukemia, multiple myeloma, malignant myeloma, Hodgkin's disease, melanoma, brain tumor such as glioblastoma, neuroblastoma and astrocytoma and carcinomas of the bladder, breast, cervix, colon, lung, pancreas, prostate, head and neck, or stomach, preferably wherein the tumor is a cancer induced by a virus.

    15. The DNA expression vector, mixture of DNA expression vectors according or the kit for use according to claim 13 or 14, administrated by intradermal injection, preferably combined with electroporation.

    Description

    DETAILED DESCRIPTION OF THE INVENTION

    [0053] The inventors propose to use DNA constructs encoding multiple TERT CD4 promiscuous T helper epitopes as universal boosters to induce a sustained immune response against poorly immunogenic antigens.

    [0054] The inventors designed two synthetic DNA hTERT-derived CD4 polyepitope constructs, pUCPbasic and pUCP2(4×), encoding either four distinct CD4 epitopes (UCP1, UCP2, UCP3 and UCP4, respectively SEQ ID NO:1 to 4) and the UCP2 immunodominant promiscuous epitope repeated four times, respectively, in order to investigate whether it can provide help for improved E7 CD8 T-cell responses. Intradermal (ID) administration followed by electroporation of these two DNA constructs in HLA-A2/DR1 transgenic mice resulted in a strong hTERT-specific CD4 T-cell response that was preferentially Th1 polarized. When co-injected with a plasmid DNA encoding the poorly immunogenic E7 antigen, the magnitude of the E7-specific CD8 T cell response was dramatically increased.

    [0055] Based on these results, the inventors concluded that (i) CD4 T helper epitopes encoded by hTERT-derived synthetic DNA constructs are efficiently processed and presented in a HLA-DR1 context in HLA-A2/DR1 transgenic mouse model and that (ii) this hTERT CD4 Th1 polarized response can greatly enhance CTL responses against diverse poorly immunogenic cancer/oncoviral antigens or anti-cancer class I polyepitopes.

    Definitions

    [0056] The telomerase complex consists of an RNA template and protein components including a reverse transcriptase, designated “Telomerase Reverse Transcriptase” (TERT), which is the major determinant of telomerase activity. Wild-type human telomerase (or hTERT) is known (GeneBank Accession number NM 198253).

    [0057] Two amino acid sequences are “homologous”, “substantially homologous” or “substantially similar” when one or more amino acid residue are replaced by a biologically similar residue or when greater than 80% of the amino acids are identical, or greater than about 90%, preferably greater than about 95%, are similar (functionally identical). Preferably, the similar or homologous sequences are identified by alignment using, for example, the GCG (Genetics Computer Group, Program Manual for the GCG Package, Version 7, Madison, Wis.) pileup program, or any of the programs known in the art (BLAST, FASTA, etc.). By “substituted” or “modified” the present invention includes those amino acids that have been altered or modified from naturally occurring amino acids.

    [0058] The term “conservative substitution” as used herein denotes the replacement of an amino acid residue by another, without altering the overall conformation and function of the peptide, including, but not limited to, replacement of an amino acid with one having similar properties (such as, for example, polarity, hydrogen bonding potential, acidic, basic, shape, hydrophobic, aromatic, and the like). Amino acids with similar properties are well known in the art. For example, arginine, histidine and lysine are hydrophilic-basic amino acids and may be interchangeable. Similarly, isoleucine, a hydrophobic amino acid, may be replaced with leucine, methionine or valine. Neutral hydrophilic amino acids, which can be substituted for one another, include asparagine, glutamine, serine and threonine.

    [0059] The term “isolated polynucleotide” is defined as a polynucleotide removed from the environment in which it naturally occurs. For example, a naturally-occurring DNA molecule present in the genome of a living bacteria or as part of a gene bank is not isolated, but the same molecule separated from the remaining part of the bacterial genome, as a result of, e.g., a cloning event (amplification), is isolated. Typically, an isolated DNA molecule is free from DNA regions (e. g., coding regions) with which it is immediately contiguous at the 5′ or 3′ end, in the naturally occurring genome. Such isolated polynucleotides may be part of a vector or a composition and still be defined as isolated in that such a vector or composition is not part of the natural environment of such polynucleotide.

    [0060] The term “immunogenic” means that the composition or construct to which it refers is capable of inducing an immune response upon administration “Immune response” in a subject refers to the development of an innate and adaptative immune response, including a humoral immune response, a cellular immune response, or a humoral and a cellular immune response to an antigen. A “humoral immune response” refers to one that is mediated by antibodies. A “cellular immune response” is one mediated by T-lymphocytes. It includes the production of cytokines, chemokines and similar molecules produced by activated T-cells, white blood cells, or both. Immune responses can be determined using standard immunoassays and neutralization assays for detection of the humoral immune response, which are known in the art.

    [0061] In the context of the invention, the immune response preferably encompasses stimulation or proliferation of cytotoxic CD8 T-cells and/or CD4 T-cells and can be determined using immunoassays such as the ELIspot assay, the in vivo cytotoxicity assay or the cytokine secretion binding assay.

    [0062] As used herein, the term “treatment” or “therapy” or “immunotherapy” refers to any of the alleviation, amelioration and/or elimination, reduction and/or stabilization (e.g., failure to progress to more advanced stages) of a symptom, as well as delay in progression of the disease, or of a symptom thereof. The term thus includes achievement of an efficient anti tumoral immune response observed in cancer patients.

    [0063] As used herein, the term “prevention” or “preventing” refers to the alleviation, amelioration and/or elimination, reduction and/or stabilization (e.g., failure to progress to more advanced stages) of a prodrome, i.e. any alteration or early symptom (or set of symptoms) that might indicate the start of a disease before specific symptoms occur.

    [0064] A cell that “overexpresses telomerase” refers to a cell in a subject, which either expresses telomerase, e.g. upon mutation or infection, especially infection by an oncovirus, whereas it does usually not, under normal conditions, or to a cell in a subject which expresses a higher level of telomerase (e.g. upon mutation or infection), when compared to normal conditions. Preferably the cell that overexpresses telomerase shows an increase of expression of at least 5%, at least 10%, at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, or more.

    [0065] The “patient” or “subject” is typically a mammal subject, preferably a human subject, of any age, sex, or severity of the condition. Non-human mammals are encompassed, including cats, dogs, horses, etc.

    The Nucleic Acid Constructs

    [0066] It is herein provided nucleic acid constructs that are designed to allow vaccination in patients. In a first embodiment, a mixture of DNA expression vectors encodes at least two, preferably at least three, CD4 epitopes of telomerase reverse transcriptase (TERT) and at least one tumor, viral, bacterial, or parasitic CD8 epitope. Accordingly, the mixture may comprise at least one DNA expression vector which encodes at least two TERT CD4 epitopes (also designated “polyepitope construct”), along with at least one DNA expression vector which encodes at least one tumor, viral, bacterial, or parasitic CD8 epitope.

    [0067] In another embodiment, a single DNA expression vector encodes at least two CD4 epitopes of TERT and at least one tumor, viral, bacterial, or parasitic CD8 epitope.

    [0068] The DNA constructs of the invention, which are preferably double stranded DNA, are in isolated form. The nucleic acid constructs are not a naturally-occurring genomic nucleic acid, in particular it do not comprise introns.

    The CD4 Epitopes

    [0069] The DNA expression vector or mixture of DNA expression vectors encodes at least 2, preferably at least 3, still preferably at least 4 CD4 epitopes of TERT.

    [0070] TERT is preferably human TERT, or TERT from another species, such as cat TERT, or dog TERT, when the subject to treat is a cat or a dog.

    [0071] However none of the polyepitope constructs of the invention coincides with the coding sequence of the full length TERT, nor with the “shuffle” constructs described in international patent application WO2015/063117. The CD4 epitopes of TERT and the constructs are devoid of telomerase catalytic activity. The constructs of the invention encode less than 70% of the CD4 epitopes of TERT, still preferably less than 60%, less than 50%, less than 40%.

    [0072] In a particular embodiment the polyepitope construct encodes a polypeptide of less than 160, preferably less than 120 amino acids, the sequence of which comprises at least two, preferably three, still preferably at least four different CD4 TERT epitope, wherein said epitopes are optionally separated by an amino acid spacer.

    [0073] The DNA expression vector or mixture of DNA expression vectors encodes between 2 and 30 CD4 epitopes of TERT, preferably between 2 and 20, 3 and 18, 3 and 15, 3 and 12, 4 and 10, or still preferably between 4 and 8, CD4 epitopes of TERT.

    [0074] The term “epitope of TERT” refers to any amino acid fragment of TERT that is an antigenic determinant, i.e. it is recognized by cells of the immune system and is immunogenic, i.e. it can elicit an immune response.

    [0075] The term “CD4 epitope of TERT” refers to a TERT fragment that is capable of binding to HLA class II molecules and being presented to CD4 T cells. The most useful CD4 epitopes of TERT are also referred to as “UCPs” or “Universal cancer peptides”, which means they are expressed in the majority of tumors. The UCPs encoded by the constructs of the invention are able to bind to a broad range of HLA class II alleles, more particularly to HLA-DR allele but also to HLA-DQ and HLA-DP alleles. The peptides are also referred as “HLA class II peptides”. Preferably, it can be recognized, specifically by anti-TERT T-cells. Several immunogenic epitope sequences of TERT have been described. See e.g., international patent application WO2013/135553.

    [0076] The CD4 epitope sequences encoded by the construct of the invention are peptide sequences of 15 to 20 amino acids deriving from TERT. Preferably, the peptides are peptides of 15 to 17 amino acids deriving from TERT.

    [0077] The peptides as defined herein are then capable of being presented as a complex with a plurality of HLA class II molecule on the surface of tumor cells or antigen presenting cells, thereby being useful in a majority of patients.

    [0078] The peptides are capable of generating a CD4 Th cell response, preferably a Th1 cell response, directed against the telomerase protein, and have a helper effect on the cytotoxic activity of CD8 T cells.

    [0079] Four CD4 epitopes are of particular interest: UCP1, UCP2, UCP3 and UCP4. The amino acid sequences are presented in Table below.

    TABLE-US-00007 TABLE 4 UCPs sequences Peptides Sequences UCP1 PAAFRALVAQCLVCV (SEQ ID NO: 1) UCP2 KSVWSKLQSIGIRQH (SEQ ID NO: 2) UCP3 GTAFVQMPAHGLFPW (SEQ ID NO: 3) UCP4 SLCYSILKAKNAGMS (SEQ ID NO: 4)

    [0080] Other CD4 epitopes include substantially homologous peptides deriving from SEQ ID NO: 1, 2, 3 or 4 by one, or more substitutions. Preferably the substitutions are conservative and/or improve the peptide immunogenicity.

    [0081] Advantageously, at least one of said CD4 epitopes of TERT is selected from the group consisting of UCP1, UCP2, UCP3 and UCP4.

    [0082] In a particular embodiment, at least two CD4 epitopes encoded by the DNA expression vector or the mixture of DNA expression vectors are distinct from each other. For instance the vector or mixture of vectors may encode a polyepitope sequence comprising UCP1, UCP2, UCP3 and UCP4.

    [0083] In another particular embodiment at least two CD4 epitopes of TERT encoded by the DNA expression vector or the mixture of DNA expression vectors are identical, and repeated.

    [0084] For instance, the DNA expression vector or a mixture of DNA expression vectors may encode a repetition at least two, preferably at least three, preferably at least four, UCP2 epitopes.

    [0085] The polynucleotide units encoding the multiple epitopes can be arranged in any order, consecutively, i.e., the 3′ end of the first polynucleotide unit is directly linked to the 5′ end of the second polynucleotide unit (and so on), resulting in a polynucleotide encoding a peptide sequence exclusively composed of consecutive epitopes. The multiple epitopes can alternatively be separated by a one-amino acid spacer or a peptide spacer, i.e., meaning that the different polynucleotide units are separated by one or several codon(s) encoding respectively one or several amino acid(s). Typically, the CD4 TERT epitopes can be separated by about four to six Gly amino acids.

    [0086] The order in which the epitopes are arranged can be determined by the man skilled in the art, according to the following criteria: some orders may facilitate either the transcription and/or the translation of the polynucleotide, may facilitate the transport of the resulting expressed polyepitope in the endoplasmic reticulum (ER), especially if the tridimensional conformation impacts the properties, and may facilitate the processing of the polyepitope in several epitopes or analogues and avoid the processing of overlapping epitopes.

    [0087] The Experimental section illustrates the invention using UCP1, UCP2, UCP3 and UCP4 (pUCPbasic) and UCP2 repeated 4 times [pUCP2(4×)] polyepitopes as boosters. However several other hTERT HLA-DR (class II) epitopes, which were identified along the hTERT protein sequence by in silico prediction, are also excellent candidates for enhancing CTL responses (Table 5).

    TABLE-US-00008 TABLE 5 hTERT HLA-DR peptides predicted by NetMHCII algorithm Peptide Sequence DR1 DR3 DR4 DR7 DR11 DR15 DRB3 TERT PAAFRALVAQCLVCV 4.5 5363.4 90.6 11.4 85.6 350 127   44-58 (SEQ ID NO: 1) (UCP1) TERT KSVWSKLQSIGIRQH 7.1 7522.9 381.4 29.0 94.2 119.2 11328.6  578-592 (SEQ ID NO: 2) (UCP2) TERT GTAFVQMPAHGLFPW 3.3 972.7 46.8 28.9 94.8 215.2 1733.2  916-930 (SEQ ID NO: 3) (UCP3) TERT SLCYSILKAKNAGMS 4.8 2485.2 59.7 38.5 12 94.5 17806.4 1041-1055 (SEQ ID NO: 4) (UCP4) SB1 SFLLSSLRPSLTGAR 4.4 36.1 66.8 226 14.7 325.5 2962 (SEQ ID NO: 5) SB2 SRPWMPGTPRRLPRL 9.5 14790 2113 16.1 394 2758 12187 (SEQ ID NO: 6) SB3 RPLFLELLGNHAQCP 3.9 3619 19.6 587.4 67 62.6 101.35 (SEQ ID NO: 7) SB4 AKFLHWLMSVYVVEL 4.2 5383 283.3 12.4 205 27.7 1365 (SEQ ID NO: 8) SB5 VKALFSVLNYERARR 12.0 513 40.4 243 26.8 88 9416 (SEQ ID NO: 9) SB6 ELYFVKVDVTGAYDT 10.5 47.2 25.1 320 124 1132 11.7 (SEQ ID NO: 10) SB7 LQPYMRQFVAHLQET 9.7 1428 40.3 236 150 32.8 1428 (SEQ ID NO: 11) SB8 FLRFMCHHAVRIRGK 9.5 1638 68.8 4.3 18.4 50.1 999 (SEQ ID NO: 12) SB9 AFVQMPAHGLFPWCG 3.6 1512 94.7 64.4 199 471 3307 (SEQ ID NO: 13) SB10 YSSYARTSIRASLTF 9.3 2596 40.3 109 20.5 1020 5395 (SEQ ID NO: 14) SB11 NRGFKAGRNMRRKLF 7.5 105.7 94.8 1642 89.7 461.9 3066 (SEQ ID NO: 15) SB12 NIYKILLLQAYRFHA 5.7 322.2 83 282.6 13.2 4.1 1088.9 (SEQ ID NO: 16) SB13 PTFFLRVISDTASLC 4.9 160.5 10.0 69.8 34.7 208.9 45.7 (SEQ ID NO: 17) SB14 RVTYVPLLGSLRTAQ 6.8 279.3 72.4 1875 41.4 159.4 8867 (SEQ ID NO: 18) SB15 LGSLRTAQTQLSRKL 5.8 285.9 259 172.1 466 2100.1 11885 (SEQ ID NO: 19) SB16 GTTLTALEAAANPAL 7.2 15029 39.1 295.6 962.9 3396 10799 (SEQ ID NO: 20) Strong binder (SB) epitope candidates were predicted using the NetMHCII version 2.2 algorithm (Nielsen and Lund, 2009). Sequences are those of wild type hTERT (Acc. Nr NM_198253). The affinity of strong binders is given in nM. Strong binder threshold /50 nM (in bold). Weak binder threshold /500 nM.

    [0088] According to the present invention, the term “CD4 epitope of TERT” encompasses any of the above sequences.

    The CD8 Epitopes:

    [0089] The CD8 epitope encoded by the vectors of the invention is a peptide that is able to activate a CD8 T cell response against an antigen. Preferably, said CD8 epitope is able to activate a CD8 antitumoral response or a CD8 response against a viral, bacterial or parasitic antigen. In a particular embodiment, the vector(s) encode all or part of a viral, bacterial or parasitic antigen which comprises MHC class I epitopes.

    [0090] The vector(s) which comprise said tumoral, viral, bacterial or parasitic CD8 epitope thus preferably encode a full length, or substantially full, tumoral, viral, bacterial or parasitic CD8 antigen, or CD8 epitope fragments thereof. Most advantageously, the present invention makes use of non-oncogenic mutants of said CD8 antigens. Examples of CD8 epitope peptides derive from the following antigens: tyrosinase, alphafetoprotein, carcinoembryonic antigen (CEA), CA-125, MUC-1, epithelial tumor antigen, Melanoma-associated antigen, NA, MART-1/Melan-A and gp 100/pMe117 as well as tyrosinase-related protein pg75 and MUM-1, HER2/neu, human papillomavirus proteins E6 and E7, survivin, GnT-V, beta-catenin, CDK4, p15, MAGE1, MAGE3, BAGE, GAGE, PSMA, TARP, STEAP, HTLV-1 Tax and WT1.

    [0091] Examples of CD8 epitope peptides include, but are not limited to: gp100.154, NA17-A.nt38, and Melan-A/MART-1.27, CEA.571, Tyrosinase.368-N, p53.65, Her2/neu.369-377, gp100.209, gp100.280, gp100.476, Tyrosinase.368-D, MAGE-3.271, and Her2/neu.654, gp100.457, Melan-A/MART-1.32, p53.149, p53.264, Sur1M2 and HPV E7.86.

    [0092] In a particular embodiment, said CD8 epitope is a non-oncogenic mutant of HPV E7 antigen. This antigen shows several class I epitopes and lacks high affinity epitopes to HLA MHC class II determinants. Hence, DNA vaccine approaches targeting only E7 has always given disappointing results (Chen et al, 2000). The present invention enhances the immune response against this antigen, which is particularly useful in treating a cervix cancer.

    Vectors and Administration

    [0093] The expression vectors used in the present invention can provide for expression in vitro and/or in vivo (e.g. in a suitable host cell, host organism and/or expression system). They typically comprise a polynucleotide sequence as defined above, and regulatory sequences (such as a suitable promoter(s), enhancer(s), terminator(s), etc.) allowing the expression (e.g. transcription and translation) of the protein product in the host cell or host organism.

    [0094] The vectors according to the invention may be in the form of a vector, such as for example a plasmid, cosmid, YAC, a viral vector or transposon.

    [0095] In a preferred but non-limiting aspect, a vector of the invention comprises i) at least one nucleic acid as described above; operably connected to ii) one or more regulatory elements, such as a promoter and optionally a suitable terminator; and optionally also iii) one or more further elements of genetic constructs such as 3′- or 5′-UTR sequences, leader sequences, selection markers, expression markers/reporter genes, and/or elements that may facilitate or increase (the efficiency of) transformation or integration.

    [0096] In particular embodiments, the vector(s) used in the invention may comprise additional inserts encoding molecular adjuvants (cytokines, chemokines or costimulatory molecules), small DNA sequences promoting MHC antigen presentation e.g. IMX313, IMAXIO technology (oligomerization of the antigen), adjuncts that assist antigen to enter specific cell compartment (e.g. LAMP-1) or that may act as adjuvants in stimulating or directing the immune response.

    [0097] In a particular embodiment, the genetic construct can be prepared by digesting the nucleic acid polymer with a restriction endonuclease and cloning into a plasmid containing a promoter such as the SV40 promoter, the cytomegalovirus (CMV) promoter or the Rous sarcoma virus (RSV) promoter.

    [0098] Other vectors include retroviral vectors, lentivirus vectors, adenovirus vectors, vaccinia virus vectors, pox virus vectors, measles virus vectors and adenovirus-associated vectors.

    [0099] In a particular embodiment, a kit is provided, which comprises

    [0100] a. a first container containing at least a DNA expression vector which encodes said at least two CD4 epitopes of TERT and

    [0101] b. a second container containing at least a DNA expression vector which encodes at least one tumor, viral, bacterial, or parasitic CD8 epitope.

    [0102] The kit may further provide at least one additional container containing at least another DNA expression vector which encodes at least a further tumor, viral, bacterial, or parasitic CD8 epitope. Such kits may be particularly useful in a context of a vaccination against a plurality of different tumor, viral, bacterial or parasitic antigens. Such antigens may derive from the same protein, or from different proteins, they may be expressed by the same or different types of tumor, or the same or different viral, bacterial or parasitic agent.

    [0103] The DNA expression vector which encodes said at least two CD4 epitopes of TERT and the DNA expression vector which encodes at least one tumor, viral, bacterial, or parasitic CD8 epitope, if provided in separate containers, are preferably administered simultaneously, or substantially simultaneously. In a particular embodiment, they are injected topically in close vicinity.

    [0104] In a particular embodiment, the containers or species can be mixed extemporaneously, or in advance before administration to the subject.

    [0105] Compositions can be prepared, comprising said vector(s). The compositions are immunogenic. They can comprise a carrier or excipients that are suitable for administration in humans or mammals (i.e. non-toxic, and, if necessary, sterile). Such excipients include liquid, semisolid, or solid diluents that serve as pharmaceutical vehicles, isotonic agents, stabilizers, or any adjuvant. Diluents can include water, saline, dextrose, ethanol, glycerol, and the like. Isotonic agents can include sodium chloride, dextrose, mannitol, sorbitol, and lactose, among others. Stabilizers include albumin, among others. Any adjuvant known in the art may be used in the vaccine composition, including oil-based adjuvants such as Freund's Complete Adjuvant and Freund's Incomplete Adjuvant, mycolate-based adjuvants, bacterial lipopolysaccharide (LPS), peptidoglycans, proteoglycans, aluminum hydroxide, saponin, DEAE-dextran, neutral oils (such as miglyol), vegetable oils (such as arachis oil), Pluronic® polyols.

    [0106] The vectors or composition can be administered directly or they can be packaged in liposomes or coated onto colloidal gold particles prior to administration. Techniques for packaging DNA vaccines into liposomes are known in the art, for example from Murray, 1991. Similarly, techniques for coating naked DNA onto gold particles are taught in Yang, 1992, and techniques for expression of proteins using viral vectors are found in Adolph, 1996.

    [0107] The vaccine compositions are preferably administered intradermally, subcutaneously, intramuscularly, into the tumors or in any types of lymphoid organs and are delivered in an amount effective to stimulate an immune response in the host organism. A variety of techniques are available, such as electroporation (e.g. using Cliniporator, IGEA, BTX, Harvard Apparatus), needle-free approaches, such as particle bombardment (e.g., the Pfizer's PMED device) and high-pressure delivery (e.g. Biojector devices, Bioject Medical Technologies), dermal patches (e.g. DermaVir, Genetic Immunity), formulation of DNA vaccine in microparticles or liposomes (e. g. formulation in the lipid compound Vaxfectin, Vical).

    [0108] In a preferred embodiment of the present invention, administration comprises an electroporation step, also designated herein by the term “electrotransfer”, in addition to the injection step (as described in Mir 2008, Sardesai and Weiner 2011). In a most advantageous embodiment, the electrotransfer protocol is as described in international patent application WO2015/063112.

    [0109] While it will be understood that the amount of material needed will depend on the immunogenicity of each individual construct and cannot be predicted a priori, the process of determining the appropriate dosage for any given construct is straightforward. Specifically, a series of dosages of increasing size, starting at about 5 to 30 μg, or preferably 20-25 μg, up to about 500 μg to about 5 mg, preferably up to 500-1500 μg, 500-1200 μg, or 500-1000 μg, for instance, is administered to the corresponding species and the resulting immune response is observed, for example by detecting the cellular immune response by an IFNγ Elispot assay (as described in the experimental section), by detecting CTL responses using an in vivo lysis assay or a chromium release assay or detecting Th (helper T-cell) response using a cytokine release assay.

    [0110] In a preferred embodiment, the vaccination regimen comprises one to three injections, preferably repeated three or four weeks later.

    [0111] In a particular embodiment, the vaccination schedule can be composed of one or two injections followed three or four weeks later by at least one cycle of three to five injections.

    [0112] In another embodiment, a primer dose consists of one to three injections, followed by at least a booster dose every year, or every two or years for instance.

    [0113] These are examples only, and any other vaccination regimen is herein encompassed.

    Therapeutic Uses

    [0114] It is described a method for treating a tumor or an infection in a patient in need thereof, which method comprises administering said patient with the vectors or mixture of vectors described herein.

    [0115] The vectors used in the present invention especially induce high avidity Th1 polarized CD4 T-cells that significantly enhance CTL responses against weakly immunogenic antigens.

    [0116] The vectors or mixture of vectors as described above is useful in a method for preventing or treating a tumor in a patient.

    [0117] A method for preventing or treating a tumor in a patient is described, which method comprises administering an effective amount of said nucleic acid or immunogenic composition in a patient in need thereof. Said nucleic acid or immunogenic composition is administered in an amount sufficient to induce an immune response in the patient.

    [0118] The tumor may be any undesired proliferation of cells, in particular a benign tumor or a malignant tumor, especially a cancer.

    [0119] The cancer may be at any stage of development, including the metastatic stage. The cancer may be chronic or non-chronic (acute).

    [0120] In another embodiment, the invention also relates to a vaccine useful in preventing a tumor.

    [0121] In a particular embodiment, tumor is a solid cancer or a carcinoma. Examples include melanoma, brain tumor such as glioblastoma, neuroblastoma and astrocytoma and carcinomas of the bladder, breast, cervix, colon, lung, especially non-small cell lung cancer (NSCLC), pancreas, prostate, head and neck cancer, or stomach cancer.

    [0122] In another embodiment, the tumor may be a liquid tumor, e.g. a hematopoietic tumor or leukemia, such as a chronic or acute lymphocytic leukemia, chronic or acute myeloid leukemia, lymphoma including Hodgkin's disease, multiple myeloma, malignant myeloma. Preferably the patient to treat has undergone or is about to undergo a conventional therapy most preferably a first-line conventional therapy.

    [0123] In a particular embodiment, the treatment according to the invention may be combined with conventional therapy, including chemotherapy, radiotherapy or surgery. Combinations with adjuvant immunomodulating molecules such as GM-CSF or a cytokine like IL-2 or IL-12, could also be useful.

    [0124] In another embodiment, the patient may be infected with a virus, a parasite or a bacteria. Examples of virus include papillomavirus, herpes simplex virus, hepatitis virus, adenovirus, myxovirus such as influenza, paramyxovirus, poxvirus such as Vaccinia, lentivirus such as HIV.

    [0125] The Examples and Figures illustrate the invention without limiting its scope.

    EXAMPLES

    Example 1: Induction of a Response Against the E7 Antigen of HPV16 after Co-Delivery of DNA Plasmids

    [0126] Universal hTERT CD4 epitopes encoded by various DNA constructs were shown to play a helper role in the induction of a CTL response against the E7 antigen of HPV16 after co-delivery of DNA plasmids by intradermal injection combined with electroporation.

    [0127] HLA-A2/DR1 transgenic mice were immunized with DNA constructs encoding hTERT-derived CD4 epitopes (namely UCP for Universal Cancer Peptides) in the presence of a plasmid encoding a non-oncogenic mutant of HPV16 E7 antigen. Ten days after a second immunization with plasmids (boost) the frequency of CD4 and CD8 T-cell immune responses were evaluated in the spleen of animals by an IFN-γ ELISpot assay. Functionally-polarized T cell subsets were identified based on their distinctive patterns of cytokine secretion using a CBA assay.

    Abbreviations

    [0128] HLA-A2/DR1: HLA-A*0201/HLA-DRB1*0101 transgenic, H2 class I/class II KO mice, CBA: Cytometric Bead Array, CTL: Cytotoxic T Lymphocyte, DNA: Deoxyribonucleic acid, EP: Electroporation, HLA: Human Leukocyte Antigen, HPV16: Human Papillomavirus type 16, hTERT: human TERT, ID: Intradermal, IL: Interleukin, IFN-γ: Interferon gamma, MHC: Major Histocompatibility Complex, TAA: Tumor-Associated Antigen, TERT: Telomerase Reverse Transcriptase, TNF-α: tumor necrosis factor alpha, RT: Room temperature, wt: wild type, UCP: Universal Cancer Peptide

    Materials and Methods

    Plasmid DNA Vectors

    [0129] pUCPbasic

    [0130] pUCPbasic is a 5717 bp plasmid expression vector encoding human telomerase reverse transcriptase (hTERT) derived class II epitopes, namely UCP1, UCP2, UCP3 and UCP4 (101 AA), linked with a 14 AA V5 tag (FIG. 1, FIG. 8), corresponding to a polypeptide of approximately 12.7 kDa of molecular weight. The hTERT insert sequence is composed of four fragments: AA 2-26, AA 27-51, AA 52-76, AA 77-101 corresponding respectively to wild type hTERT (Acc. Nr NM_198253): AA 39-63 hTERT, AA 573-597 hTERT, AA 911-935 hTERT and AA 1036-1060 hTERT, which includes UCP1-4 class II epitopes and their 5AA flanking sequences. These fragments contain four well characterized 15-mer CD4+ hTERT epitopes (TERT 44-58 PAAFRALVAQCLVCV (SEQ ID NO:1), TERT 578-592 KSVWSKLQSIGIRQH (SEQ ID NO:2), TERT 916-930 GTAFVQMPAHGLFPW (SEQ ID NO:3), TERT 1041-1055 SLCYSILKAKNAGMS, (SEQ ID NO:4) and two 9-mer internal CD8+ telomerase epitopes (Godet et al. 2012; Suso et al. 2011).

    pUCP2(4×)

    [0131] pUCP2(4×) is a 5717 bp plasmid expression vector encoding the human telomerase reverse transcriptase CD4+578-592 (KSVWSKLQSIGIRQH, (SEQ ID NO:2), Acc. Nr NM_198253) epitope with 5AA flanking sequences on each side. This UCP2 epitope unit is repeated four times and linked with a 14 AA V5 epitope tag (FIG. 2, FIG. 9), together corresponding to a polypeptide of approximately 12.7 kDa of molecular weight.

    pDE7

    [0132] pDE7 is a 5708 bp plasmid expression vector encoding a non-oncogenic HPV16 E7 variant (98 AA) (Wieking et al., 2012) linked with a 14 AA V5 epitope tag (FIG. 3, FIG. 10), corresponding to a protein of approximately 14-15 kDa of molecular weight. To decrease the risk associated with the delivery of oncogenic HPV E7, four known oncogenic regions within E7 were mutated (Munger et al., 2004). Mutations introduced in E7 prevent its ability to bind/inactivate pRb and to associate with Mi2β that enhances cell growth (Brehm et al., 1999).

    Gene Synthesis and Cloning

    [0133] Genes were synthesized through an overlapping 40-mer oligonucleotides assembly process (GeneCust, Luxembourg) and included unique flanking restriction sites HindIII/XhoI. The synthetic genes were cloned between HindIII and XhoI restriction sites of the pcDNA3.1(+) expression vector (Life Technologies, Carlsbad, USA). pcDNA3.1(+) is a 5.4 kb vector derived from pcDNA3.0 which was designed for high-level of stable and transient expressions in mammalian cells. This vector contains the human cytomegalovirus immediate-early (CMV-IE) promoter and the bovine growth hormone polyadenylation (BHG-polyA) signal as termination sequence.

    Endotoxin Free Plasmid Production

    [0134] Plasmids were transformed and produced in E. coli 5-alpha cells (fhuA2Δ(argF-lacZ)U169 phoA glnV44 Φ80 Δ(lacZ)M15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17) (Lucigen Corporation, Middleton, USA, ref 60602-2) by RD Biotech (Besancon, France). Endotoxin-free plasmids were resuspended in 1× sterile PBS at 4 mg/mL. The constructs were verified by restriction enzyme digestion.

    Cell Culture and Transient Transfection

    [0135] HEK293T cells were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% heat-inactivated fetal calf serum (PAA, Velizy-Villacoublay, France) and 1% penicillin/streptomycin (Life technologies SAS, Saint-Aubin, France).

    [0136] Cells were grown as monolayers in 75 cm.sup.2 flasks at 37° C. in a humidified atmosphere containing 5% CO.sub.2. 8×10.sup.5 cells were seeded in six-well tissue culture plates and incubated for 24 h. The cells were grown to 70-80% confluence on the day of transfection.

    [0137] pUCPbasic, pUCP2(4×), pDE7 constructs were transfected into target cells using jetPrime cationic polymer transfection reagent (Polyplus-transfection Inc., Illkirch, France). pcDNA3.1 plasmid transfected cells were used as negative control. After 48 hours of transfection, cells were harvested and analyzed for expression.

    Western Blot

    [0138] pUCPbasic, pUCP2(4×), pDE7 and pcDNA3.1 transfected HEK293T cells were lysed on ice for 20 minutes in RIPA buffer (Sigma Aldrich SARL, Saint-Quentin Fallavier, France) supplemented with a protease inhibitor cocktail (Roche Diagnostic, Indianapolis, USA). Lysates were cleared by centrifugation at 14,000 rpm for 15 minutes at 4° C. Supernatants were harvested and the protein concentration was measured using the Bradford colorimetric assay.

    [0139] The pDE7 protein was immunoprecipitated using anti-V5 conjugated agarose beads (Abcam, Cambridge, UK). Cells were lysed with a cell lysis buffer containing 125 mM NaCl, 50 mM Tris pH8, 25 mM EDTA pH8 and 0.5% NP40 for 15 min and centrifuged at 1600 rpm for 5 min, and then 20 μl of anti-V5 agarose (Abcam) was added. Samples were rotated overnight at 4° C. and washed three times with cold cell lysis buffer.

    [0140] All protein samples were resuspended in 1× sample buffer (Life technologies SAS, Saint-Aubin, France), denatured 5 minutes at 90° C., separated on Nu-PAGE® Novex 4-12% Bis-Tris gels (Life Technologies) and electroblotted onto PVDF membranes (iBlot® transfer stack, Life Technologies) using the iBlot® device (Life Technologies). The ProSieve™ QuadColor™ protein marker (Lonza, Levallois-Perret, France) was used to determine molecular weight. The membranes were cut approximately at 40 kDa and blocked with PBS 1×, 0.05% Tween®20, 3% milk. The lower part of the membrane was probed with an anti-V5 mouse monoclonal antibody (Life Technologies) diluted at 1/5000 and the upper part was probed with an anti-β-actin mouse monoclonal antibody (Sigma Aldrich SARL, Saint-Quentin Fallavier, France) diluted at 1/5000. The membranes were then incubated with an anti-mouse HRP linked antibody (GE Healthcare, Vélizy, France) diluted at 1/5000 and the proteins were detected by enhanced chemiluminescence assay using ECL HRP chemiluminescent substrate Reagent Kit. Membranes were visualized on a ChemiDoc XRS system (Bio-Rad, Marnes-la-Coquette, France) and analyzed using Image Lab 5.2.1 (Bio-Rad) software.

    Mice

    [0141] Transgenic HLA-A*0201/DRB1*0101 (HLA-A2/DR1) mice (13-16 week old) were supplied by Institut Pasteur (Paris, France) or CDTA-TAAM (Orleans, France). These mice express the human HLA-A*0201 α1α2 domains and the murine α3 domain of the H2-D molecule, the human β2-microglobulin, and HLA-DRB1*0101 and HLA-DRA*0101 molecules. They are knock-out for murine H2-D.sup.b, H2-K.sup.b and IA.sup.b genes (Pajot et al., 2004).

    [0142] Animals were housed at the Institut Pasteur's pathogen-free animal facility. All animals were handled in strict accordance with good animal practice and complied with local animal experimentation (Directive 2010/63/UE).

    Immunization

    [0143] Prior to treatment, mice were anesthetized with a mix solution of xylazine 2% (Rompun, Bayer Sante, Loos, France) and ketamine 8% (Imalgen 1000, Merial, Lyon, France) in PBS (Life technologies SAS, Saint-Aubin, France) through the intraperitoneal route (IP) according to individual animal weight and duration of anesthesia. Plasmids were then injected intradermally (ID) on the lower back at day 0 (prime) and at day 21 (boost) and electroporated. Briefly, immediately after ID injection, a skin fold was made at the injection site, entirely covered with conductive gel and placed between the electrode plates of the electroporation device (CLINIPORATOR® 2, IGEA, Carpi, Italy). Two pulses of different voltages were applied (HV-LV) as described below. The experimental groups were defined as summarized in Table 6.

    TABLE-US-00009 TABLE 6 Repartition of mice-numbering and treatment conditions Volume of Number Mouse Dose injection/ Electroporation Groups animals number Treatment (μg) mouse Route parameters 1 4 1-4 pDE7/pcDNA3.1 100 + 100 50 μl ID Electrode: 2 5 5-9 pDE7/pUCP2(4x) 100 + 100 P-30-8B 3 4 10-13 pDE7/pUCPbasic 100 + 100 (0.5 cm apart) HV = 1250 V/cm, 1 Hz, 100 μs, 1 pulse, 1000 ms break LV = 180 V/cm, 1 Hz, 400 ms, 1 pulse ID = intradermal;

    Peptides

    [0144] For immune response analyses, hTERT peptides restricted to HLA-DR and E7 peptides restricted to HLA-A*0201 were previously described or were determined by in silico epitope prediction using SYFPEITHI (database found at: syfpeithi.de) Rammensee et al, 1999) or NetMHCII 2.2 (Nielsen and Lund, 2009) algorithms available online. All synthetic peptides were purchased lyophilized (>90% purity) from Proimmune (Oxford, United Kingdom). Lyophilized peptides were dissolved in sterile water at 2 mg/mL and stored at −80° C. prior use. Details of peptide sequences and MHC restrictions are shown in Table 7.

    TABLE-US-00010 TABLE 7 MHC restricted hTERT and E7 peptides Peptide Pool Sequence MHC TERT Pool PAAFRALVAQCLVCV HLA-DR 44-58 1 (SEQ ID NO: 1) (UCP1) TERT KSVWSKLQSIGIRQH 578-592 (SEQ ID NO: 2) (UCP2) TERT GTAFVQMPAHGLFPW 916-930 (SEQ ID NO: 3) (UCP3) TERT SLCYSILKAKNAGMS 1041-1055 (SEQ ID NO: 4) (UCP4) E7 9-23 Pool HEYMLDLQPETTDLY HLA- 2 (SEQ ID NO: 27) DRB1*0101 E7 73-87 HVDIRTLEDLLMGTL (SEQ ID NO: 28) E7 7-15 Pool TLHEYMLDL HLA-A*0201 3 (SEQ ID NO: 29) E7 11-20 YMLDLQPETT (SEQ ID NO: 30) E7 14-22 DLQPETTDL (SEQ ID NO: 31) E7 78-87 TLEDLLMGTL (SEQ ID NO: 32) E7 81-90 DLLMGTLGIV (SEQ ID NO: 33) E7 82-90 LLMGTLGIV (SEQ ID NO: 34) E7 86-93 TLGIVCPI (SEQ ID NO:35)

    IFN-γ ELISpot Assay

    [0145] Ten days after the boost vaccination, mice were euthanized by CO.sub.2 narcosis and spleens were harvested. Spleens were then mashed and splenocyte suspensions were filtered through a 70 μm nylon mesh (Cell Strainer, BD Biosciences, Pont-de-Claix, France), purified on ficoll (Lymphocyte Separation Medium, Eurobio, Les Ulis, France) and numerated using the Cellometer® Auto T4 Plus counter (Ozyme, Montigny-le-Bretonneux, France). Purified splenocytes were then added to ELISpot PVDF microplates (IFN-γ ELISpot kit, Diaclone, Besancon, France) coated with an anti-mouse IFN-γ antibody at 2×10.sup.5 cells/well in triplicates and stimulated with 5 μg/mL of peptides (see Table 7), 10 μg/mL PMA-ionomycin (Sigma-Aldrich), or mock stimulated with serum free culture medium. To score the number of hTERT and E7 antigen-specific IFN-γ secreting cells, three different peptide pools were used: CD4+ hTERT (pool 1), CD4 E7 (pool 2) or CD8 E7 (pool 3) (Table 7). After 19 hours, spots were revealed with a biotin-conjugated anti-IFNγ detection antibody followed by streptavidin-HRP and BCIP/NBT substrate solution. Spots were counted and analyzed using the ImmunoSpot® ELISpot counter and software (Cellular Technology Limited, Bonn, Germany).

    Cytokine Binding Assay (CBA)

    [0146] Splenocytes (6×10.sup.5 cells) from vaccinated HLA-A2/DR1 mice were cultured for 24 h at 37° C. with HLA-DR-restricted hTERT derived peptides from pool 1 at a final concentration of 5 μg/mL. Cytokine culture supernatants were recovered and kept frozen at −20° C. until testing. Mouse Th1/Th2/Th17 Cytometric Beads Array (CBA, BD Biosciences) kit was used to quantify respectively the concentration of IL-2, IFN-γ, TNF-α, IL-4, IL-6, IL-10 and IL-17a. The CBA immunoassay was carried out according to the manufacturer's instructions. Flow cytometry was performed using the FACScan LSRII flow cytometer (BD Biosciences). Quantitative results were generated using the FCAP Array™ Software version 3.0 (Becton Dickinson, Pont-de-Claix, France).

    Statistical Analysis

    [0147] Differences between two groups were evaluated by unpaired t-test or non parametric Mann and Whitney U test. The Pearson's correlation coefficient test was used to evaluate the correlation between hTERT class II and E7 class I responses in immunized mice. All computer analyses were performed using GraphPad Prism 6 (GraphPad Software Inc. La Jolla, Calif., USA). p values <0.05 were considered statistically significant.

    Results

    Characterization and Sequence Analysis of Constructs

    [0148] DNA transgenes expressing UCPbasic, UCP2(4×) and DE7 protein were synthesized and cloned into pcDNA3.1(+) Life Technologies expression vector as shown by restriction enzyme digestion and electrophoresis (FIG. 4). Inserts and junctions were sequenced using T7 (forward 5′ TAATACGACTCACTATAGGG 3′, (SEQ ID NO:36)) and/or BGH (reverse 5′TAGAAGGCACAGTCGAGG 3′ (SEQ ID NO:37)) primers matching the vector sequence flanking the DNA insert (see Table 8). Sequencing results confirmed that transgenes have been correctly synthesized and cloned.

    TABLE-US-00011 TABLE 8 Characterization of constructs based on restriction mapping and DNA sequencing Restriction enzyme or Plasmid sequencing primer Sequence length (bp) pUCPbasic HindIII/XbaI 369 + 5348* pUCP2(4x) HindIII/XhoI 363 + 5354* pDE7 HindIII/XhoI 354 + 5354* pUCPbasic BGH primer HindIII/XhoI sequence confirmed (911-1294 bp) pUCP2(4x) BGH primer HindIII/XhoI sequence confirmed (911-1320 bp) pDE7 T7 and BGH primers HindIII/XhoI sequence confirmed (911-1364 bp) *Digestion product sizes (bp) and generated fragments

    In Vitro Transgene Expression

    [0149] The expression of pUCPbasic and pUCP2(4×) polypeptides, as well as pDE7 protein was assessed by western blot assay. The constructs were transiently transfected into HEK293T cell line, which were then cultured for 48 hours. pUCPbasic and pUCP2(4×) polypeptides were identified at a molecular weight of approximately 12.6 and 12.8 kDa, respectively. Two additional bands were observed for UCP2(4×) (about 11 and 9 kDa) which may be accounted for protein degradation (FIG. 5a). For unknown reasons, it was difficult to detect the DE7 protein directly by western blot (FIG. 5a). An immunoprecipitation step using anti-V5 conjugated agarose beads was necessary to achieve this goal (FIG. 5b). The pDE7 protein was detected at the expected molecular weight of about 14.5 kDa. pcDNA3.1 transfected cells were used as negative control. These results validate in vitro expression pattern and identity of pUCPbasic, pUCP2(4×) and pDE7 DNA constructs.

    hTERT Helper Epitopes Increase E7-Specific Immune Responses in HLA Transgenic Mice

    [0150] In order to determine the frequency of hTERT CD4+ and E7 CD8+/CD4+ specific T-cells in HLA-A2/DR1 transgenic mice immunized with pUCPbasic, pUCP2(4×) and pDE7, ELISpot IFN-γ analyses were performed.

    [0151] As shown in FIG. 6a, immunization with pUCPbasic or pUCP2(4×) induced a strong hTERT CD4+ specific cellular immune response. As expected, no E7 CD4+ specific immune response was detected (FIG. 6b) as the E7 protein does not present high affinity class II epitopes. Co-immunization of pUCPbasic or pUCP2(4×) with pDE7 showed a significant E7 CD8+ specific immune response (FIG. 6c). When compared to the pDE7+pcDNA3.1 DNA vaccine, pDE7 co-immunized with pUCPbasic or pUCP2(4×) was potent in driving an E7-specific immune response, suggesting that pUCPbasic and pUCP2(4×) constructs were able to significantly increase the magnitude of CD8+ cellular immune responses against the E7 antigen.

    [0152] A positive correlation between the strength of the hTERT CD4+ class II and E7 CD8+ class I specific immune responses was observed, both individually (FIG. 6a, c, see numbered points corresponding to the animal identification number) and when aggregated (FIG. 6d).

    [0153] Thus, the increased level of CD4 T cell response was directly proportional to the magnitude of CD8 T cell expansion for each animal. Data analysis using the Pearson's correlation coefficient test indicated that the strength of correlation between the CD4+ and CD8+ responses was very high (R.sup.2=0.95) and statistically significant (p=0.005) at least for pUCP2(4×) (FIG. 6e). This analysis was less reliable for pUCPbasic (R.sup.2=0.42, p=0.35) probably because of the low number of animals included in this study (FIG. 60.

    [0154] Finally, in order to evaluate the role of Th1/Th2 immune response, the different cytokines secreted by hTERT specific CD4 T-cells were examined. To this aim, splenocytes of vaccinated transgenic mice from a second independent experiment were stimulated in vitro for 24 hours with a pool of hTERT peptides or left unstimulated. Supernatants were recovered and assayed in a Cytokine Binding Assay (CBA). Elevated concentrations of Th1 cytokines IFN-γ, TNF-α, IL-2 and Th2 IL-6, but not IL-4, IL-10 and IL-17 were detected in culture supernatants of splenocytes recovered from mice vaccinated with pUCPbasic and pUCP2(4×) in comparison with those of control mice (pDE7+pcDNA3.1 and pcDNA3.1) (FIG. 7). This result indicates that UCP immunization preferentially induced a Th1-polarized immune response in vivo.

    [0155] Thus, vaccination with pUCPbasic or pUCP2(4×) induces a specific Th1 polarized CD4 T-cell response and is able to promote the expansion of E7 specific CD8 T-cells in vivo.

    CONCLUSION

    [0156] The results showed that hTERT CD4 polyepitope DNA constructs were correctly processed and presented to CD4 T cells in HLA-A2/DR1 transgenic mice in the context of a HLA class II restriction and could generate efficient CD4 Th1 cells that produce mainly IFN-γ, TNF-α and IL-2. Moreover, hTERT CD4 Th1 cell response is highly correlated with CD8 T-cell response against the E7 antigen and strongly improves the CD8 T-cell immune response against E7 class I-restricted epitopes and thus the efficacy of E7 antigen vaccination.

    [0157] These results confirm that it is possible to increase the strength and the quality of the immune response against poorly immunogenic antigens by complementing the vaccine formulation by CD4 Th1 epitopes through a DNA delivery approach.

    REFERENCES

    [0158] Adolph, K. 1996 ed. “Viral Genome Methods” CRC Press, Florida [0159] Bernhardt S L, Gjertsen M K, Trachsel S, Moller M, Eriksen J A, et al. (2006) Telomerase peptide vaccination of patients with non-resectable pancreatic cancer: A dose escalating phase I/II study. Br J Cancer 95: 1474-1482. [0160] Bolonaki I, Kotsakis A, Papadimitraki E, Aggouraki D, Konsolakis G, et al. (2007) Vaccination of patients with advanced non-small-cell lung cancer with an optimized cryptic human telomerase reverse transcriptase peptide. J Clin Oncol 25: 2727-2734. [0161] Brehm A, Nielsen S J, Miska E A, McCance D J, Reid J L, et al. (1999) The E7 oncoprotein associates with Mi2 and histone deacetylase activity to promote cell growth. EMBO J 18: 2449-2458. [0162] Chen C H, Wang T L, Hung C F, Yang Y, Young R A, et al. (2000) Enhancement of DNA vaccine potency by linkage of antigen gene to an HSP70 gene. Cancer Res 60: 1035-1042. [0163] Cheever M A, Allison J P, Ferris A S, Finn O J, Hastings B M, et al. (2009) The prioritization of cancer antigens: a national cancer institute pilot project for the acceleration of translational research. Clin Cancer Res 15: 5323-5337. [0164] Godet Y, Fabre E, Dosset M, Lamuraglia M, Levionnois E, et al. (2012) Analysis of spontaneous tumor-specific CD4 T-cell immunity in lung cancer using promiscuous HLA-DR telomerase-derived epitopes: potential synergistic effect with chemotherapy response. Clin Cancer Res 18: 2943-2953. [0165] Mir L M. 2008. Application of electroporation gene therapy: past, current, and future. Methods Mol Biol 423: 3-17. [0166] Munger K, Baldwin A, Edwards K M, Hayakawa H, Nguyen C L, et al. (2004) Mechanisms of human papillomavirus-induced oncogenesis. J Virol 78: 11451-11460. [0167] Murray, 1991, ed. “Gene Transfer and Expression Protocols” Humana Pres, Clifton, N.J. [0168] Nielsen M, Lund O (2009) NN-align. An artificial neural network-based alignment algorithm for MHC class II peptide binding prediction. BMC Bioinformatics 10: 296. [0169] Pajot A, Michel M L, Fazilleau N, Pancre V, Auriault C, et al. (2004) A mouse model of human adaptive immune functions: HLA-A2.1-/HLA-DR1-transgenic H-2 class I-/class II-knockout mice. Eur J Immunol 34: 3060-3069. [0170] Rammensee H, Bachmann J, Emmerich N P, Bachor O A, Stevanovic S (1999) SYFPEITHI: database for MHC ligands and peptide motifs. Immunogenetics 50: 213-219. [0171] Sardesai N Y, Weiner D B. 2011. Electroporation delivery of DNA vaccines: prospects for success. Curr Opin Immunol 23: 421-429. [0172] Shay J W, Bacchetti S (1997) A survey of telomerase activity in human cancer. Eur J Cancer 33: 787-791. [0173] Shedlock D J, Shen H (2003) Requirement for CD4 T cell help in generating functional CD8 T cell memory. Science 300: 337-339. [0174] Suso E M, Dueland S, Rasmussen A M, Vetrhus T, Aamdal S, et al. (2011) hTERT mRNA dendritic cell vaccination: complete response in a pancreatic cancer patient associated with response against several hTERT epitopes. Cancer Immunol Immunother 60: 809-818. [0175] Wieking B G, Vermeer D W, Spanos W C, Lee K M, Vermeer P, et al. (2012) A non-oncogenic HPV 16 E6/E7 vaccine enhances treatment of HPV expressing tumors. Cancer Gene Ther 19: 667-674. [0176] Yang, 1992, “Gene transfer into mammalian somatic cells in vivo”, Crit. Rev. Biotech. 12: 335-356