Use of pinocarveol

Abstract

The present invention relates to a pharmaceutical composition comprising pinocarveol for preventing or treating metabolic diseases, and functional food composition using the pharmaceutical composition for improving or alleviating metabolic diseases. Pinocarveol according to the present invention reduces weight, visceral fat, and cholesterol concentration, improves blood liver function index, reduces blood sugar, and additionally inhibits a metabolic inflammation reaction, and thus can be effectively used ultimately as a medical or functional food composition exhibiting prevention or treatment activities for metabolic diseases selected from the group consisting of obesity, diabetes, dyslipidemia, and syndromes of fatty liver and insulin-resistance.

Claims

1. A method of treating a metabolic disease, the method comprising: administering a pharmaceutical composition comprising isolated or purified pinocarveol as an active ingredient to a subject in need thereof, wherein the metabolic disease is obesity, diabetes, dyslipidemia, fatty liver, or insulin resistance syndrome, wherein the subject in need thereof has the metabolic disease and the metabolic disease is treated, wherein the subject in need thereof has a reduction in body weight, and wherein the isolated or purified pinocarveol does not suppress the subject's appetite, and wherein 0.0001 to 1,000 mg/kg per day of the pharmaceutical composition is administered to the subject.

2. The method of claim 1, wherein the dyslipidemia is hyperlipidemia.

3. The method of claim 1, wherein the fatty liver is non-alcoholic fatty liver.

4. The method of claim 1, wherein the pharmaceutical composition reduces body weight, diet efficiency, visceral fat, a plasma lipid concentration, liver weight or a lipid concentration in a liver tissue.

5. The method of claim 1, wherein the pharmaceutical composition reduces alanine aminotransferase (ALT) activity or aspartate aminotransferase (AST) activity in blood.

6. The method of claim 1, wherein the pharmaceutical composition reduces a fasting blood sugar concentration, a fasting insulin concentration in blood or an inflammatory cytokine concentration in blood.

7. The method of claim 1, wherein the pharmaceutical composition increases expression of uncoupling protein 1 (UCP1), uncoupling protein 3 (UCP3), peroxisome proliferator-activated receptor-gamma coactivator 1 alpha (PGC-1α), or (β-catenin, or activity of AMP-activated protein kinase (AMPK); or reduces expression of CCAAT enhancer-binding proteins (C/EBPα), peroxisome proliferator-activated receptor gamma (PPARγ), cluster of differentiation 36 (CD36), fatty acid synthase (FAS), leptin, sterol regulatory element-binding factor 1c (SREBP1C), liver X receptor alpha (LXRα), lipoprotein lipase (LPL), or acetyl-CoA carboxylase (ACC), in visceral fat or the liver.

8. The method of claim 1, wherein the metabolic disease is obesity.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIGS. 1A-1D shows an increased amount of weight of mice fed within experimental diet (FIG. 1A) and a diet intake amount thereof (FIG. 1B-1D). Each value is a mean±standard deviation (SEM) of the measurement values of 8 mice. The letter on the graph bar indicates a significant difference within P<0.001 according to one-way ANOVA analysis and Duncan's multiple range test.

(2) FIGS. 2A-2B shows images of visceral adipose tissues of mice fed with the experimental diet (FIG. 2A) and visceral fat weights for each part (FIG. 2B). Each value is a mean±standard deviation (SEM) of the measurement values of 8 mice. The letter on the graph bar indicates a significant difference within P<0.001 according to one-way ANOVA analysis and Duncan's multiple range test.

(3) FIGS. 3A-3D shows lipid concentrations in blood of mice fed with the experimental diet (FIG. 3A: neutral fat (mmol/L), FIG. 3B: total cholesterol (mmol/L), FIG. 3C: HDL-cholesterol (mmol/L), and FIG. 3D: free fatty acid (μEq/L)). Each value is a mean±standard deviation (SEM) of the measurement values of 8 mice. The letter on the same column indicates a significant difference within P<0.05 according to one-way ANOVA analysis and Duncan's multiple range test.

(4) FIGS. 4A-4G shows indicators related to the non-alcoholic fatty liver of mice fed with the experimental diet (FIG. 4A: image of hepatic tissue, FIG. 4B: weight of liver (g), FIG. 4C: neutral fat (μmol/g), FIG. 4D: cholesterol (μmol/g), FIG. 4E: free fatty acid (μEq/g), FIG. 4F: alanineaminotransferase (IU/L), and FIG. 4G: aspartateaminotransferase (IU/L)). Each value is a mean±standard deviation (SEM) of the measurement values of 8 mice. The letter on the same column indicates a significant difference within P<0.05 according to one-way ANOVA analysis and Duncan's multiple range test.

(5) FIGS. 5A-5D shows indicators related to the insulin resistance of mice fed with the experimental diet (FIG. 5A: oral glucose tolerance test, FIG. 5B: AUC, FIG. 5C: blood glucose level during fasting (mmol/L), and FIG. 5D: insulin level during fasting (pg/mL)). The letter on the same column indicates a significant difference within P<0.05 according to one-way ANOVA analysis and Duncan's multiple range test.

(6) FIGS. 6A-6D shows inflammatory cytokine concentrations in blood of mice fed with the experimental diet (FIG. 6A: IL-6 (pg/mL), FIG. 6B: TNFα (pg/mL), FIG. 6C: MCP1 (pg/mL), and FIG. 6D: leptin (pg/mL)). Each value is a mean±standard deviation (SEM) of the measurement values of 8 mice. The letter on the same column indicates a significant difference within P<0.05 according to one-way ANOVA analysis and Duncan's multiple range test.

(7) FIGS. 7A-7C shows changes in the expressions of genes and proteins related to thermogenesis (FIG. 7A) and adipogenesis (FIG. 7B) in adipose tissues of internal organs of mice. The upper panel is a representative gel image of RT-PCR analysis, and the lower panel indicates relative expression amounts of the genes. Data were standardized based on GAPDH mRNA levels, and all expression levels were expressed as values relative to normal diet mice. The upper panel of FIG. 7C is a representative gel image of western blot analysis, and the lower panel indicates relative expression amounts of the proteins. Data were standardized based on GAPDH levels, and all expression levels were expressed as values relative to normal diet mice. The results are indicated as results for three independent experiments using an RNA sample pool of 8 mice. The letter on the graph bar indicates a significant difference from other diet groups within P<0.05 according to one-way ANOVA analysis and Duncan's multiple range test.

(8) FIGS. 8A-8B are images showing changes in the expressions of genes and proteins related to lipogenesis in hepatic tissues of mice. The upper panel of FIG. 8A is a representative gel image of RT-PCR analysis, and the lower panel indicates relative expression amounts of the genes. Data were standardized based on GAPDH mRNA levels, and all expression levels were expressed as values relative to normal diet mice. The upper panel of FIG. 8B is a representative gel image of western blot analysis of p-AMPK and AMPK, and the lower panel indicates relative ratios of the expressions of p-AMPK/AMPK proteins in hepatic tissues. Data were standardized based on GAPDH levels, and all expression levels were expressed as values relative to normal diet mice. The results are indicated as results for three independent experiments using an RNA sample pool of 8 mice. The letter on the graph bar indicates a significant difference from other diet groups within P<0.05 according to one-way ANOVA analysis and Duncan's multiple range test.

DETAILED DESCRIPTION OF THE INVENTION

(9) Hereinafter, exemplary embodiments of the present invention will be described in detail. However, these exemplary embodiments are only for more specifically describing the present invention, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not limited by these exemplary embodiments in accordance with the gist of the present invention.

EXAMPLES

Example 1: Effect of Pinocarveol on Reduction of Body Weight and Visceral Fat in Dietary Obese Mice

(10) 1) Preparation of Experimental Diets and Raising of Experimental Animals

(11) An obesity inducing diet used in the present invention included a high fat control diet (HFD: 40% fat calorie, 17 g lard, and 3% corn oil/100 g diet), and a pinocarveol-supplemented high fat diet (PD) supplemented with pinocarveol (80,613, Sigma-Aldrich Company, CAS Number: 547-61-5, (1S,3R,5S)-6,6-dimethyl-2-methylenebicyclo[3,1,1]heptan-3-ol) has the same composition as HFD, but about 0.2% of pinocarveol was added. As a control drug, metformin (Met) or sibutramine (Sibu) which is an anti-obesity drug was added at a concentration of about 0.01% to HFD and used (Table 1). For a normal diet (chow) group, a commercially available rodent chow was fed. Pinocarveol, metformin, and sibutramine were all purchased from Sigma-Aldrich Company (U.S.).

(12) TABLE-US-00001 TABLE 1 Experimental diet composition table (g/kg diet) Pinocarveol- Metformin- Sibutramine- High fat diet supplemented supplemented supplemented Ingredient (HFD) control diet (PD) diet (Met) diet (Sibu) Casein 200 200 200 200 DL-Methionine 3 3 3 3 Corn starch 111 109 110 110.9 Sucrose 370 370 370 370 Cellulose 50 50 50 50 Corn oil 30 30 30 30 Lard 170 170 170 170 Vitamin complex 12 12 12 12 Mineral complex 42 42 42 42 Choline bitartrate 2 2 2 2 Cholesterol 10 10 10 10 tert- 0.04 0.04 0.04 0.04 Butylhydroquinone Experimental — 2 1 0.1 substance Total amount (g) 1,000 1,000 1,000 1,000 Fat (% calorie) 39.0 39.0 39.0 39.0 Total calorie, kJ/kg 19,315 19,315 19,315 19,315 diet

(13) 5-week-old male C57BL/6J mice (Orient, Korea) were adjusted to a laboratory condition with solid feed for one week and randomly assigned to a high fat diet control group and experimental groups according to the randomized block method, followed by raising for ten weeks. Diet was supplied with water between 10 and 11 a.m. every day, intake amounts of diet was measured every day, and weight was measured every week. In order to prevent sudden weight changes due to feed intake, feed containers were removed, and weight was measured after 2 hours. Experimental animals were fasted for 12 hours or longer and anaesthetized by diethyl ether, and blood, liver, adipose tissues of internal organs (epididymal fat, fat around the kidney, mesenteric fat, and retroperitoneal fat) were collected, washed with 0.1M phosphate buffer solution (pH 7.4), and measured for weight. Blood collected from abdominal aorta was centrifuged at 1,000×g for 15 minutes to separate blood plasma.

(14) 2) Changes in Body Weight and Visceral Fat Weight

(15) After feeding the experimental diets for 10 weeks, the final weight and the increased amount of body weight over 10 weeks were considered. Compared to the high fat diet control group (HFD), the pinocarveol-supplemented group (PD) showed a significant decrease of 32% in the cumulative body weight gain (FIGS. 1A and 1B). Pinocarveol intake did not cause any significant changes in daily diet intake amount, and as a result, the food efficiency ratio where the cumulative body weight gain is divided by the total diet intake amount during the experimental raising was also significantly decreased by 32% in the PD group compared to the HFD group (FIGS. 1C and 1D). As a result, it was found that the effect of reducing body weight of pinocarveol was not due to appetite suppression.

(16) After feeding the experimental diets for 10 weeks, each of epididymal fat, fat around the kidney, mesenteric fat, and retroperitoneal fat, which compose visceral fat, was extracted to measure the weight thereof. As a result, in the pinocarveol-supplemented group (PD), the weights of epididymal fat, fat around the kidney, mesenteric fat, and retroperitoneal fat were significantly reduced compared to the control group (HFD), and the total visceral fat weight where the weights of the four parts are added was significantly reduced by 32% (FIG. 2B). Therefore, it was confirmed that pinocarveol exhibited as much excellent effect of reducing body weight and visceral fat amount as commercially available anti-obesity drugs (sibutramine) and diabetes treatment drugs (metformin).

Example 2: Effects of Pinocarveol on Preventing or Treating Hyperlipidemia of Dietary Obese Mice

(17) 1) Biochemical Analysis Method of Blood

(18) In order to evaluate the concentrations of plasma cholesterol, neutral fat, and free fatty acids of experimental animals raised for ten weeks, a commercially available measurement kit (Bio Clinical System, Korea) was used to perform measurement by repeating 2 measurements, respectively.

(19) 2) Changes in Plasma Lipid Concentration

(20) Plasma lipid concentrations of mice fed with the experimental diet for ten weeks were considered. Compared to the HFD group, the PD group showed significant decreases of 27% in the neutral fat concentration, 16% in the total cholesterol concentration, and 39% in the free fatty acid concentration. Meanwhile, the HDL-cholesterol concentration in blood did not show any significant difference between the experimental groups (FIGS. 3A-3D). Therefore, pinocarveol exhibited an effect of significantly alleviating hyperlipidemia which is displayed in obesity induced by high fat diet, and such a hyperlipidemia improving effect is similar to or more excellent than the used control drugs (sibutramine and metformin).

Example 3: Effect of Pinocarveol for Preventing or Treating Non-Alcoholic Fatty Liver in Dietary Obese Mice

(21) 1) Analysis Method of Lipid Concentration in Hepatic Tissue

(22) Lipid components of hepatic tissues were collected as follows according to the method by Folch, et al. (Folch J, Lees M, Sloane Stanley G H. A simple method for the isolation and purification of total lipids from animal tissues. J Bio Chem. 1957; 226: 497-509). 1 mL of distilled water was applied to a hepatic tissue (0.25 g) and homogenized by using a Polytron homogenizer (IKA-WERKE GmbH & Co., Ultra-Turrax, Staufen, Germany). 5 mL of a chloroform:methanol solution (2:1, v/v) was added to the homogeneous solution, mixed well and centrifuged at 1,000×g for 10 minutes to separate a lower phase. 2 mL of a chloroform:methanol solution (2:1, v/v) was added to an upper phase again, and after repeating the same procedure, lipid components of the liver were completely separated. 3 mL of a chloroform:methanol:0.05% CaCl.sub.2) (3:48:47, v/v/v) solution was added to the lower phase thus obtained, mixed for 1 minute, and centrifuged at 1,000×g for 10 minutes. After obtaining the final lower phase and completely drying with nitrogen gas, the dried lipids were dissolved in 1 mL of methanol to use for lipid component analysis.

(23) The concentrations of neutral fat, cholesterol, and free fatty acids of the lipid extracts of hepatic tissues were measured by using the same commercially available measurement kit (Bio Clinical System, Korea) as previously used for the analysis of plasma lipid concentration.

(24) 2) Changes in Lipid Concentration of Hepatic Tissue and Liver Function Index

(25) Weights of the liver of mice fed with the experimental diet for ten weeks were considered. Compared to the HFD group, the PD group showed significant decreases of 30% in the absolute liver weight (g) (FIGS. 4A and 4B).

(26) Lipid concentrations of hepatic tissues were considered. Compared to the HFD group, the PD group showed significant decreases of 33% in the neutral fat concentration, 31% in total cholesterol concentration, and 65% in the free fatty acid concentration (FIGS. 4C and 4D). Compared to the HFD group, the PD group showed significant decreases of 44% in the alanine aminotransferase (ALT) activity and 32% in the aspartate aminotransferase (AST) activity which are liver function indexes measured in blood plasma (FIGS. 4F and 4G). Therefore, pinocarveol exhibited an effect of significantly alleviating fatty liver phenomena which are displayed in obesity induced by high fat diet, and such a fatty liver improving effect of pinocarveol is similar to or more excellent than that of the control drugs.

Example 4: Effects of Pinocarveol on Preventing or Treating Type 2 Diabetes and Insulin Resistance Syndrome in Dietary Obese Mice

(27) 1) Oral Glucose Tolerance Test and Measurement Method of Blood Sugar and Insulin Concentrations During Fasting

(28) At 8 weeks of experimental raising, experimental animals were fasted for 16 hours and orally administered with d-glucose corresponding to 2 g/kg body weight, and blood was collected from the tail vein of mice at time points of 15 minutes, 30 minutes, 60 minutes, and 120 minutes. The glucose concentration of collected blood was measured by using a script-operation blood glucose sensor (ONETOUCH Ultra, Inverness Medical Ltd., U.K.).

(29) Meanwhile, the glucose concentration of the blood plasma obtained during fasting which was collected from mice raised for 10 weeks was measured by using a biochemical automatic analyzer (Express Plus, Chiron Diagnostics Co., U.S.), and kit reagents for analysis were purchased from Bio-Clinical System (Korea).

(30) The insulin concentration of blood plasma obtained during fasting was measured by using a mouse insulin ELISA kit (Millipore Corporation, U.S.).

(31) 2) Changes in Index (Oral Glucose Resistance) Related to Type 2 Diabetes and Insulin Resistance Syndrome

(32) As a result of performing oral glucose tolerance tests for mice at 8 weeks of experimental raising (2 weeks before autopsy), compared to the HFD group, the PD group showed a decrease in blood glucose concentrations over time after sugar intake, and the area under the curve (AUC) of the glucose concentration was significantly reduced by 20% (FIGS. 5A and 5B). Meanwhile, the glucose and insulin concentrations of blood during fasting collected at the completion of experimental raising were significantly decreased by 21% and 50%, respectively, in the PD group, compared to the HFD group (FIGS. 5C and 5D).

Example 5: Effect of Pinocarveol on Alleviating Inflammation Activation in Dietary Obese Mice

(33) 1) Analysis Method of Concentration of Inflammatory Cytokine in Blood

(34) The concentrations of plasma IL-6, TNFα, MCP1, and leptin were measured by the ELISA method using the Milliplex map kit (Millipore Corporation, U.S.).

(35) 2) Changes in Concentration of Inflammatory Cytokine in Blood

(36) Studies on the correlation between obesity and the immune system are actively carried out, for example, a new term of “metaflammation” was introduced for inflammatory responses caused by an oversupply of nutrients or metabolic substances, and obesity is interpreted as “chronic and low-level inflammation”. As an example, in the case of toll-like receptor 4 (TLR4) involved in innate immune responses, dietary fat (particularly, saturated fatty acid) is used as a ligand to act as an important factor in inflammatory responses and insulin resistance pathway. When obesity is induced by high fat diet, it has been known that the amount of free fatty acids (particularly, saturated fatty acids) increases in body fluids, and when free fatty acids bind to TLR4 as ligands, IKK is activated to further activate NF-kB, which promotes the secretion of TNFα, IL-6, and the like which are proinflammatory cytokines to finally result in inflammatory responses. Besides, since TNFα and IL-6 activate cytokine signaling 3 (SOCS3) and JNK, it has been known that serine residues of insulin receptor substrate (IRS) are phosphorylated to suppress sugar transport, and as a result, insulin resistance is induced in peripheral tissues such as liver, muscle, or the like.

(37) As a result of measuring the concentration of inflammatory cytokine in blood by the ELISA method, the PD group showed significant decreases in the concentrations of IL-6 (70%), TNFα (28%), MCP1 (35%), and leptin (40%), compared to the HFD group (FIGS. 6A-6D). Therefore, ingestion of pinocarveol significantly ameliorates inflammation activation induced by obesity.

Example 6: Expression Control of Genes and Proteins Related to Lipid Accumulation and Thermogenesis by Pinocarveol

(38) 1) RNA Separation and RT-PCR

(39) 1 mL of TRIzol solution was added per 0.1 g of adipose tissues of internal organs and hepatic tissues, and tissues were crushed and centrifuged at 4° C. and 12,000×g for 10 minutes. The supernatant was placed in a new tube, and 200 μL of chloroform was added followed by stirring. After repeating this procedure twice, the supernatant was placed in a new tube, and isopropanol and the supernatant were added at a ratio of 1:1. After strongly shaking for 10 times, the mixture was placed at room temperature for 10 minutes, centrifuged at 4° C. and 12,000×g for 10 minutes to remove the supernatant, and 1 mL of 70% ethanol was added to the precipitate to be centrifuged at 4° C. and 7,500×g for 5 minutes. After removing ethanol, the tube containing RNA precipitate was dried at room temperature for 5 minutes, and RNA pellet was dissolved using nuclease free water. By a using UV/VIS spectrophotometer (Beckman coulter, DU730, U.S.), the concentrations of RNA samples extracted at wavelengths of 260 nm and 280 nm were measured, and by carrying out agarose gel electrophoresis, the integrity of RNA samples was determined.

(40) For RNA samples extracted from adipose tissues of internal organs and hepatic tissues, oligo dT primers and superscript reverse transcriptase (GIBCO BRL, U.S.) were used to carry out reverse transcription to synthesize cDNA. By using the cDNA obtained by reverse transcription as a ligand and using a 5′ and 3′ flanking sequence of the cDNA of the gene to be amplified as a primer, PCR was carried out, and at this time, the sequences of the used primers are shown in Table 2. 1 μL of the amplified PCR product was subject to electrophoresis on a 1% agarose gel to check for DNA bands.

(41) TABLE-US-00002 TABLE 2 Primer sequences used for semi-quantitative RT-PCR analysis Annealing PCR temperature product Gene Primer Sequence (5′ .fwdarw. 3′) (° C.) (bp) Peroxisome F TTCGGAATCAGCTCTGTGGA 55 148 proliferator- R CCATTGGGTCAGCTCTTGTG activated receptor gamma 2 (PPARγ2) CCAAT/enhance F TCGGTGCGTCTAAGATGAGG 55 187 r binding protein R TCAAGGCACATTTTTGCTCC alpha (C/EBPα) Cluster of F ATGACGTGGCAAAGAACAGC 55 160 differentiation 36 R GAAGGCTCAAAGATGGCTCC (CD36) Fatty acid F AGGGGTCGACCTGGTCCTCA 65 132 synthase (FAS) R GCCATGCCCAGAGGGTGGTT Lipoprotein F CTCCAAGGTTGTCCAGGGTT 55 143 lipase (leptin) R AAAACTCCCCACAGAATGGG Uncoupling F GGTTTGCACCACACTOCTG 70 108 protein 1 (UCP1) R ACATGGACATCGCACAGCTT Uncoupling F ATGCTGAAGATGGTGGCTCA 55 179 protein 3 (UCP3) R TTGCCTTGTTCAAAACGGAG Peroxisome F TAAATCTGCGGGATGATGGA 67 109 proliferator- R GTTTCGTTCGACCTGCGTAA activated receptor-gamma coactivator 1 alpha (PFC1-α) Sterol regulatory F TTGTGGAGCTCAAAGACCTG 55 94 element-binding R TGCAAGAAGCGGATGTAGTC factor 1c (SREBP1C) Liver X receptor F TCCTACACGAGGATCAAGCG 55 119 (LXR) R AGTCGCAATGCAAAGACCTG Lipoprotein F TGCCGCTGTTTTGTTTTACC 55 172 lipase (LPL) R TCACAGTTTCTGCTCCCAGC Acetyl-CoA F TGATGTCAATCTCCCCGCAGC 60 353 carboxylase R TTGCTTCTTCTCTGTTTTCTCC (ACC) C Glyceraldehyde- F AGAACATCATCCCTGCATCC 55 321 3-phosphate R TCCACCACCCTGTTGCTGTA dehydrogenase (GAPDH)

(42) 2) Western Blot Analysis

(43) A predetermined amount of visceral fat or hepatic tissues was homogenized with liquid nitrogen and a lysis buffer solution in a mortar and centrifuged at 13,000×g and 4° C. for 20 minutes, and the middle layer was obtained to quantify proteins according to the Bradford method. 50 μg of the protein was subject to electrophoresis on an SDS polyacrylamide gel, was subject to electroblotting on a PVDF hyper film, and was reacted with the corresponding antibody, β-catenin, phospho-AMPK (AMP-activated protein kinase), AMPK, GAPDH (Cell-Signaling Technology, U.S.), respectively. The signal of each protein was visualized by a chemiluminescent detection system (Amersham, U.K.), and the thickness of bands was quantified by using the Quantity One Analysis Software (Bio-Rad Laboratories, U.S.).

(44) 3) Changes in Expression of Gene and Proteins of Adipose Tissues of Internal Organs

(45) As a result of measuring expressions of genes (UCP1 and UCP3) and a transcriptional regulatory factor (PGC-1α) related to thermogenesis in adipose tissues of internal organs using RT-PCR, the HFD group showed a significant decrease in the expression of the genes related to thermogenesis compared to the normal diet group. The supplemental intake of pinocarveol significantly increased all of the gene expressions of UCP1, UCP3, and PGC-1α, which had been decreased by an intake of high fat diet (FIG. 7A).

(46) In addition, the HFD group showed a significant increase in all of the expressions of C/EBPα and PPARγ2 which are nuclear transcription factors which have an important role in adipogenesis, and CD36, FAS, and leptin which are target genes of the transcription factors, compared to the normal diet group. As a result of supplemental feeding of pinocarveol to mice fed with the high fat diet, all of the expressions of nuclear transcription factors and target genes thereof, which had been increased due to an intake of the high fat diet, significantly decreased in adipose tissues of internal organs (FIG. 7B). As a result of evaluating the protein expression amount of β-catenin which is an upstream signal transduction substance controlling lipogenesis in adipose tissues of internal organs by using western blot, the PD group showed a significant increase compared to the HFD group (FIG. 7C). Therefore, it was found that the supplemental feeding of pinocarveol reduced expressions of the nuclear transcription factors and the target genes thereof which serve a pivotal role in lipogenesis in adipose tissues of internal organs and increased the protein expression of β-catenin, thereby preventing the accumulation of visceral fat.

(47) 4) Changes in Expressions of Genes and Proteins in Hepatic Tissues

(48) As a result of evaluating the degree of mRNA expressions of hepatic tissues using RT-PCR, the HFD group showed significant increases in all of the expressions of SREBP and LXRα which are nuclear transcription factors that have an important role in lipogenesis, and LPL, FAS, and ACC which are target genes of the transcription factors, compared to the normal control group. Meanwhile, as a result of supplemental feeding of pinocarveol, all of the expressions of the nuclear transcription factors and target genes thereof, which had been increased due to an intake of the high fat diet, significantly decreased in hepatic tissues (FIG. 8A). As a result of evaluating the activation (p-AMPK/AMPK ratio) of AMPK which is a signal transduction substance promoting the oxidation of fatty acids in hepatic tissues by using western blot, the PD group showed a significant increase compared to the HFD group (FIG. 8B). Therefore, it was found that the supplemental feeding of pinocarveol reduced expressions of the nuclear transcription factors and the target genes thereof which serve a pivotal role in lipogenesis in hepatic tissues and increased the activation of signal transduction substances which promote oxidation of fatty acids, thereby exhibiting an effect of ameliorating fatty liver induced by obesity.

(49) While specific parts of the present invention have been described in detail, these specific techniques are only preferred embodiments for those having ordinary skill in the art, and it is apparent that the scope of the invention is not limited thereto. Therefore, the substantial scope of the present invention may be defined by the appended claims and their equivalents.