Chemically Ligated RNAs for CRISPR/Cas9-lgRNA Complexes as Antiviral Therapeutic Agents
20210222165 · 2021-07-22
Inventors
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N15/111
CHEMISTRY; METALLURGY
A61K31/7105
HUMAN NECESSITIES
C12N15/11
CHEMISTRY; METALLURGY
C12N9/96
CHEMISTRY; METALLURGY
International classification
C12N15/11
CHEMISTRY; METALLURGY
A61K31/7105
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
Abstract
Provided herein are chemically ligated guide RNA oligonucleotides (lgRNA) which comprise two functional RNA modules (crgRNA and tracrgRNA) joined by non-nucleotide chemical linkers (nNt-linker), their complexes with CRISPR-Cas9, and cells comprising lgRNAs, preparation methods of Cas9-1gRNA complexes, and their uses for prevention and treatments of viral infections in humans. Also disclosed are processes and methods for preparation of these compounds.
Claims
1. A cell treated with a composition comprising at least one lgRNA, and said lgRNA comprises: a. a synthetic crRNA, comprising a spacer and a second oligonucleotide, wherein i. said spacer is an oligonucleotide of greater than 12 bases that targets a DNA sequence, and said second oligonucleotide is an RNA segment of 8-25 nucleotides, ii. said spacer and said second oligonucleotide are joined between the 3′-end of said spacer and the 5′-end of said second oligonucleotide via an internucleotide phosphate diester, a thiophosphate diester ##STR00035## a boranophosphate diester ##STR00036## a phosphonoacetate ##STR00037## a thiophosphonoacetate ##STR00038## a phosphoramidate ##STR00039## or a thiophosphoramidate ##STR00040## and iii. said spacer and said second oligonucleotide comprise a single or a plurality of nucleosides or nucleotides modified at sugar moieties selected from the group consisting of: ##STR00041## ##STR00042## ##STR00043## ##STR00044## ##STR00045## wherein Q is a natural or modified nucleobase, b. a synthetic tracrRNA, comprising: i. a single or a plurality of oligonucleotides, ii. said oligonucleotides of b. i. are sequentially joined between the 3′-end and the 5′-end via an internucleotide phosphate diester, a thiophosphate diester ##STR00046## a boranophosphate diester ##STR00047## a phosphonoacetate ##STR00048## a thiophosphonoacetate ##STR00049## a phosphoramidate ##STR00050## or a thiophosphoramidate ##STR00051## or an nNt-Linker set forth as in c., and iii. said oligonucleotides of b. i. comprise a single or a plurality of nucleosides or nucleotides modified at sugar moieties, wherein said nucleosides and nucleotides are selected from the group consisting of II-1 to 11-37, c. one or more nNt-Linkers, comprising: i. an optionally substituted M core structure of Formula M-1 to M-18: ##STR00052## ##STR00053## ##STR00054## wherein X=O, S, NH, or CH.sub.2, X.sub.1═N or CH, X.sub.2═N or CH, R.sub.M═H, CH.sub.3, alkyl, aryl, or heteroaryl, m=0 to 3 and n=0 to 3, ii. two L linkers, and each said L linker comprises absent or more structures selected from the group consisting of L-1 to L-24: ##STR00055## ##STR00056## ##STR00057## where m=0 to 16 and n=0 to 16, and wherein iii. said L linkers and said M core structure are joined as L-M-L, wherein the two L linkers are the same or different, and attached to two terminal nucleotides of Formula Nuc-1 to Nuc-19: ##STR00058## ##STR00059## ##STR00060## ##STR00061## wherein the attached positions are ##STR00062## to L-M-L and ##STR00063## or ##STR00064## to upstream and downstream oligonucleotides, respectively, and wherein R is H, OH, ##STR00065## CH.sub.2OH, ##STR00066## F, NH.sub.2, OMe, CH.sub.2OMe, OCH.sub.2CH.sub.2OMe, an alkyl, a cycloalkyl, an aryl, or a heteroaryl, R′ is H, OH, ##STR00067## CH.sub.2OH, ##STR00068## F, NH.sub.2, OMe, CH.sub.2OMe, OCH.sub.2CH.sub.2OMe, an alkyl, a cycloalkyl, an aryl, or a heteroaryl, and Q is a natural or a non-natural nucleic acid base, wherein an nNt-Linker of c. joins the 3′-terminal nucleotide of said synthetic crRNA of a. and the 5′-terminal nucleotide of said synthetic tracrRNA of b. and said at least one nNt-Linkers of c. are positioned outside the bound regions of said lgRNA by a CRSPR-associated-protein.
2. Said cell of claim 1 comprising at least one said lgRNA.
3. Said cell of claim 1, wherein said composition further comprises a polypeptide selected from the group consisting of a Cas9, a Cas9 with reduced nuclease activity, a Cas9 with nickase activity, a Cas9 with no nuclease activity, and a fusion protein comprising a Cas9 domain, wherein the Cas9 domain is capable of binding with the activating duplex region and wherein the fusion protein further comprises a domain from a polypeptide other than Cas9.
4. Said cell of claim 3, wherein said polypeptide is replaced with its encoding nucleic acid.
5. Said cell of claim 1, wherein said composition further comprising a fusion protein comprising a Cas9 domain, wherein the Cas9 domain is capable of binding with the activating duplex region and wherein the fusion protein further comprises a domain from a polypeptide other than Cas9 and which confers an additional activity on the site-directed polypeptide selected from the group consisting of nuclease activity, methyltransferase activity, demethylase activity, DNA repair activity, DNA damage activity, deamination activity, dismutase activity, alkylation activity, depurination activity, oxidation activity, pyrimidine dimer forming activity, integrase activity, transposase activity, recombinase activity, polymerase activity, ligase activity, helicase activity, photolyase activity, glycosylase activity, acetyltransferase activity, deacetylase activity, kinase activity, phosphatase activity, ubiquitin ligase activity, deubiquitinating activity, adenylation activity, deadenylation activity, SUMOylating activity, deSUMOylating activity, ribosylation activity, deribosylation activity, myristoylation activity and demyristoylation activity.
6. Said cell of claim 5, wherein said fusion protein is replaced with its encoding nucleic acid.
7. Said cell of claim 1, wherein said composition further comprises one or more DNA repair templates selected from the group consisting of ssDNA and dsDNA.
8. Said DNA repair template of claim 7 comprising an oligonucleotide sequence to introduce insertion(s) of one or more stop codons selected from the group consisting of 5′-(tga)-3′, 5′-(taa)-3′, 5′-(tag)-3′, 5′-(tga-ntga-ntga)-3′, 5′-(tga-ntga-ntaa)-3′, 5′-(tga-ntga-ntag)-3′, 5′-(tga-ntaa-ntga)-3′, 5′-(tga-ntaa-ntaa)-3′, 5′-(tgantaa-ntag)-3′, 5′-(tga-ntga-ntga)-3′, 5′-(tga-ntga-ntaa)-3′, 5′-(tga-ntga-ntag)-3′, 5′-(taa-ntga-ntga)-3′, 5′-(taa-ntga-ntaa)-3′, 5′-(taa-ntga-ntag)-3′, 5′-(taa-ntaa-ntga)-3′, 5′-(taa-ntaa-ntaa)-3′, 5′-(taa-ntaa-ntag)-3′, 5′-(taa-ntga-ntga)-3′, 5′-(taa-ntga-ntaa)-3′, 5′-(taa-ntga-ntag)-3′, 5′-(tag-ntga-ntga)-3′, 5′-(tag-ntga-ntaa)-3′, 5′-(tag-ntga-ntag)-3′, 5′-(tag-ntaa-ntga)-3′, 5′-(tag-ntaa-ntaa)-3′, 5′-(tag-ntaa-ntag)-3′, 5′-(tag-ntga-ntga)-3′, 5′-(tag-ntga-ntaa)-3′, 5′-(tag-ntga-ntag)-3′, wherein n is any nucleotide, and said more stop codons comprises repetitive said sequence separated by absent or more nucleotides in between or different said sequences separated by absent or more nucleotides in between.
9. Said DNA repair template of claim 7 comprising an oligonucleotide sequence to introduce insertion(s) of one or more transcription cis-regulatory elements, and said more elements comprises repetitive sequence separated by absent or more nucleotides in between or different sequences separated by absent or more nucleotides in between.
10. Said cell of claim 7, wherein said DNA repair template is covalently linked to said lgRNA.
11. Said cell of claim 1, wherein said lgRNA is covalently linked with one or more molecules selected from the group consisting of fluorescent molecules, PEGs, non-PEG polymers, ligands of cellular receptors, lipids, oligonucleotides, polysaccharides, glycans, peptides, aptamers and antibodies to form an lgRNA conjugate, and the said more molecules can be the same or different.
12. Said cell of claim 1, wherein said composition further comprises a carrier containing a DNA repair template, and said carrier is selected from the group consisting of an AAV vector, a plasmid and a retron.
13. Said cell of claim 1, wherein the cell is selected from the group consisting of a bacterial cell, an archaeal cell, a plant cell, an algal cell, a fungal cell, an invertebrate cell, a vertebrate cell, a mammalian cell, and a human cell.
14. Said cell of claim 1, wherein the cell comprises deactivated integrated viral DNAs or deactivated pathogenic genes.
15. Said cell of claim 1, wherein the cell comprises deactivated integrated HBV DNAs.
16. Said cell of claim 1, wherein the cell comprises deactivated integrated HIV DNAs.
17. Said cell of claim 1, wherein the cell comprises a deactivated CCR5 gene.
18. Said cell of claim 1, wherein the cell comprises deactivated integrated HSV DNAs.
19. Said cell of claim 1, wherein the cell comprises an edited host gene.
20. Said cell of claim 1, wherein the cell comprises one or more inserted genes.
21. Said cell of claim 1, wherein the cell further comprises other therapeutic agents.
22. Said cell of claim 2, wherein said at least one lgRNA is introduced into the cell by lipofection, electroporation, nucleofection, microinjection, biolistics, in liposomes, immunoliposomes, with polycations, as nucleic acid conjugates, or combinations thereof.
23. A cell comprising at least one said ligated tracrRNA of claim 1.
24. Said cell of claim 23, wherein said tracrRNA is covalently linked to one or more molecules selected from the group consisting of fluorescent molecules, PEGs, non-PEG polymers, ligands of cellular receptors, lipids, oligonucleotides, polysaccharides, glycans, peptides, aptamers and/or antibodies to form a tracrRNA conjugate, and the said more molecules can be the same or different.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0053]
[0054]
[0055]
[0056]
DEFINITION
[0057] The definitions of terms used herein are consistent to those known to those of ordinary skill in the art, and in case of any differences the definitions are used as specified herein instead.
[0058] The term “nucleoside” as used herein refers to a molecule composed of a heterocyclic nitrogenous base, containing an N-glycosidic linkage with a sugar, particularly a pentose. An extended term of “nucleoside” as used herein also refers to acyclic nucleosides and carbocyclic nucleosides.
[0059] The term “nucleotide” as used herein refers to a molecule composed of a nucleoside monophosphate, di-, or triphosphate containing a phosphate ester at 5′-, 3′-position or both. The phosphate can also be a phosphonate.
[0060] The term of “oligonucleotide” (ON) is herein used interchangeably with “polynucleotide”, “nucleotide sequence”, and “nucleic acid”, and refers to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof. An oligonucleotide may comprise one or more modified nucleotides, which may be imparted before or after assembly of such as oligonucleotide. The sequence of nucleotides may be interrupted by non-nucleotide components.
[0061] The term of “crispr/cas9” refers to the type II CRISPR-Cas system from Streptococcus pyogenes. The type II CRISPR-Cas system comprises protein Cas9 and two noncoding RNAs (crRNA and tracrRNA). These two noncoding RNAs were further fused into one single guide RNA (sgRNA). The Cas9/sgRNA complex binds double-stranded DNA sequences that contain a sequence match to the first 17-20 nucleotides of the sgRNA and immediately before a protospacer adjacent motif (PAM). Once bound, two independent nuclease domains (HNH and RuvC) in Cas9 each cleaves one of the DNA strands 3 bases upstream of the PAM, leaving a blunt end DNA double stranded break (DSB).
[0062] The term of “off-target effects” refers to non-targeted cleavage of the genomic DNA target sequence by Cas9 in spite of imperfect matches between the gRNA sequence and the genomic DNA target sequence. Single mismatches of the gRNA can be permissive for off-target cleavage by Cas9. Off-target effects were reported for all the following cases: (a) same length but with 1-5 base mismatches; (b) off-target site in target genomic DNA has one or more bases missing (‘deletions’); (c) off-target site in target genomic DNA has one or more extra bases (‘insertions’).
[0063] The term of “guide RNA” (gRNA) refers to a synthetic fusion of crRNA and tracrRNA via a tetraloop (GAAA) (defined as sgRNA) or other chemical linkers such as an nNt-Linker (defined as lgRNA), and is used interchangeably with “chimeric RNA”, “chimeric guide RNA”, “single guide RNA” and “synthetic guide RNA”. The gRNA contains secondary structures of the repeat:anti-repeat duplex, stem loops 1-3, and the linker between stem loops 1 and 2.
[0064] The term of “dual RNA” refers to hybridized complex of the short CRISPR RNAs (crRNA) and the trans-activating crRNA (tracrRNA). The crRNA hybridizes with the tracrRNA to form a crRNA:tracrRNA duplex, which is loaded onto Cas9 to direct the cleavage of cognate DNA sequences bearing appropriate protospacer-adjacent motifs (PAM).
[0065] The term of “lgRNA” refers to guide RNA (gRNA) joined by chemical ligations to form non-nucleotide linkers (nNt-linkers) between crgRNA and tracrgRNA, or at other sites.
[0066] The terms of “dual lgRNA”, “triple lgRNA” and “multiple lgRNA” refer to hybridized complexes of the synthetic guide RNA fused by chemical ligations via non-nucleotide linkers. Dual tracrgRNA is formed by chemical ligation between tracrgRNA1 and tracrgRNA2 (RNA segments of ˜30 nt), and crgRNA (˜30 nt) is fused with a dual tracrgRNA to form a triple lgRNA duplex, which is loaded onto Cas9 to direct the cleavage of cognate DNA sequences bearing appropriate protospacer-adjacent motifs (PAM). Each RNA segment can be readily accessible by chemical manufacturing and compatible to extensive chemical modifications.
[0067] The term “guide sequence” refers to the about 20 bp sequence within the guide RNA that specifies the target site and is herein used interchangeably with the terms “guide” or “spacer”. The term “tracr mate sequence” may also be used interchangeably with the term “direct repeat(s)”.
[0068] The term of “crgRNA” refers to crRNA equipped with chemical functions for conjugation/ligation and is used interchangeably with crRNA in an lgRNA comprising at least one non-Nucleotide linker. The oligonucleotide may be chemically modified close to its 3′-end, any one or several nucleotides, or for its full sequence.
[0069] The term of “tracrgRNA” refers to tracrRNA equipped with chemical functions for conjugation/ligation and is used interchangeably with tracrRNA in an lgRNA comprising at least one non-Nucleotide linker. The oligonucleotide may be chemically modified at any one or several nucleotides, or for its full sequence.
[0070] The term of “the protospacer adjacent motif (PAM)” refers to a DNA sequence immediately following the DNA sequence targeted by Cas9 in the CRISPR bacterial adaptive immune system, including NGG, NNNNGATT, NNAGAA, NAAAC, and others from different bacterial species where N is any nucleotide.
[0071] The term of “chemical ligation” refers to joining together synthetic oligonucleotides via an nNt-linker by chemical methods such as click ligation (the azide-alkyne reaction to produce a triazole linkage), thiol-maleimide reaction, and formations of other chemical groups.
[0072] The term of “complementary” refers to the ability of a nucleic acid to form hydrogen bond(s) with another nucleic acid sequence by either traditional Watson-Crick or other non-traditional types. Cas9 contains two nuclease domains, HNH and RuvC, which cleave the DNA strands that are complementary and noncomplementary to the 20 nucleotide (nt) guide sequence in crRNAs, respectively.
[0073] The term of “Hybridization” refers to a reaction in which one or more polynucleotides form a complex that is stabilized via hydrogen bonding between the bases of the nucleotide residues. The complex may comprise two strands forming a duplex structure, three or more strands forming a multi stranded complex, a single self-hybridizing strand, or any combination of these. A sequence capable of hybridizing with a given sequence is referred to as the “complement” of the given sequence.
[0074] The synonymous terms “hydroxyl protecting group” and “alcohol-protecting group” as used herein refer to substituents attached to the oxygen of an alcohol group commonly employed to block or protect the alcohol functionality while reacting other functional groups on the compound. Examples of such alcohol-protecting groups include but are not limited to the 2-tetrahydropyranyl group, 2-(bisacetoxyethoxy)methyl group, trityl group, trichloroacetyl group, carbonate-type blocking groups such as benzyloxycarbonyl, trialkylsilyl groups, examples of such being trimethylsilyl, tert-butyldimethylsilyl, tert-butyldiphenylsilyl, phenyldimethylsilyl, triiospropylsilyl and thexyldimethylsilyl, ester groups, examples of such being formyl, (C.sub.1-C.sub.10) alkanoyl optionally mono-, di- or tri-substituted with (C.sub.1-C.sub.6) alkyl, (C.sub.1-C.sub.6) alkoxy, halo, aryl, aryloxy or haloaryloxy, the aroyl group including optionally mono-, di- or tri-substituted on the ring carbons with halo, (C.sub.1-C.sub.6) alkyl, (C.sub.1-C.sub.6) alkoxy wherein aryl is phenyl, 2-furyl, carbonates, sulfonates, and ethers such as benzyl, p-methoxybenzyl, methoxymethyl, 2-ethoxyethyl group, etc. The choice of alcohol-protecting group employed is not critical so long as the derivatized alcohol group is stable to the conditions of subsequent reaction(s) on other positions of the compound of the formula and can be removed at the desired point without disrupting the remainder of the molecule. Further examples of groups referred to by the above terms are described by J. W. Barton, “Protective Groups In Organic Chemistry”, J. G. W. McOmie, Ed., Plenum Press, New York, N.Y., 1973, and G. M. Wuts, T. W. Greene, “Protective Groups in Organic Synthesis”, John Wiley & Sons Inc., Hoboken, N.J., 2007, which are hereby incorporated by reference. The related terms “protected hydroxyl” or “protected alcohol” define a hydroxyl group substituted with a hydroxyl protecting group as discussed above.
[0075] The term “nitrogen protecting group,” as used herein, refers to groups known in the art that are readily introduced on to and removed from a nitrogen atom. Examples of nitrogen protecting groups include but are not limited to acetyl (Ac), trifluoroacetyl, Boc, Cbz, benzoyl (Bz), N,N-dimethylformamidine (DMF), trityl, and benzyl (Bn). See also G. M. Wuts, T. W. Greene, “Protective Groups in Organic Synthesis”, John Wiley & Sons Inc., Hoboken, N.J., 2007, and related publications.
[0076] The term of “Isotopically enriched” refers to a compound containing at least one atom having an isotopic composition other than the natural isotopic composition of that atom. The term of “Isotopic composition” refers to the amount of each isotope present for a given atom, and “natural isotopic composition” refers to the naturally occurring isotopic composition or abundance for a given atom. As used herein, an isotopically enriched compound optionally contains deuterium, carbon-13, nitrogen-15, and/or oxygen-18 at amounts other than their natural isotopic compositions.
[0077] As used herein, the terms “therapeutic agent” and “therapeutic agents” refer to any agent(s) which can be used in the treatment or prevention of a disorder or one or more symptoms thereof. In certain embodiments, the term “therapeutic agent” includes a compound provided herein. In certain embodiments, a therapeutic agent is an agent known to be useful for, or which has been or is currently being used for the treatment or prevention of a disorder or one or more symptoms thereof.
[0078] Nucleotides
[0079] In some embodiments, the crRNA and tracrRNA are truncated at 3′-end and 5′-end, respectively:
##STR00006##
[0080] and the duplex end is replaced with a small molecule non-nucleotide linker (nNt-linker, ligation1), instead of the tetraloop (GAAA) in sgRNA, to form a ligated dual lgRNA:
##STR00007##
[0081] wherein “NNNNNNNNNN NNNNNNNNNNNNN” is a guide sequence of 17-20 nt, and N is preferably a ribonucleotide with intact 2′-OH, and wherein “” is a chemical nNt-linker.
[0082] In other embodiments, tracrgRNA is a ligated dual oligonucleotide (via ligation2, the inner ligation between tracrgRNA1 and tracrgRNA2), or a multiple oligonucleotide. Non-limiting examples include:
##STR00008##
[0083] In some embodiments, the crRNA and tracrRNA are further truncated, and non-limiting examples of resulting lgRNAs include:
##STR00009##
[0084] The two RNA modules (crgRNA and tracrgRNA, crgRNA and dual-tracrgRNA or multiple-tracrgRNA) are synthesized chemically by phosphoramidite chemistry and ligation chemistry either on solid support(s) or in solution. Non-limiting examples of compounds (oligonucleotide azides, oligonucleotide alkynes, oligonucleotide thiols, and oligonucleotide maleimides) and synthetic methods include:
[0085] 1. Ligation Via Formation of a 1,2,3-Triazole Cross-Linker
[0086] a. Direct modification of fully deprotected oligonucleotide amine (such as ON-1) provides RNA alkynes or azides (ON-2):
##STR00010##
[0087] Non-limiting examples of crosslinking reagents include:
##STR00011##
[0088] b. Azide and alkyne functions are introduced as phosphoramidites in chemical synthesis of the RNAs (ON-5 and ON-7):
##STR00012## ##STR00013##
[0089] Non-limiting examples of these phosphoramidites include:
##STR00014## ##STR00015## ##STR00016##
[0090] c. Preparation of lgRNA by chemical ligation via click chemistry of crgRNA and tracrgRNA and annealing to form RNA duplex, or by annealing followed by chemical ligation via click chemistry.
[0091] 2. Ligation Via Formation of a Thioether Cross-Linker
[0092] a. Thiol function is introduced as a phosphoramidite in chemical synthesis of the RNAs:
##STR00017##
[0093] Non-limiting examples of these phosphoramidites include:
##STR00018##
[0094] b. Direct modification of fully deprotected oligonucleotide amine (such as ON-1) provides the RNA maleimide (ON-10):
##STR00019##
[0095] Non-limiting examples of maleimide crosslinking reagents include:
##STR00020##
[0096] c. Preparation of lgRNA by chemical ligation via thio-ether formation between crgRNA and tracrgRNA and annealing to form RNA duplex, or by annealing followed by chemical ligation via thio-ether formation.
[0097] The above chemical ligations for ligation between crgRNA and tracrgRNA (ligation1) are applicable to formation of ligated dual tracrgRNA between tracrgRNA1 and tracrgRNA2 (ligation2).
[0098] In some embodiments, the two ligations (ligation1 and ligation2) are chemically orthogonal. Non-limiting examples include:
[0099] a. ligation2 by a triazole linker and ligation1 by a thioether linker;
[0100] b. ligation2 by a thioether linker and ligation1 by a triazole linker;
[0101] c. ligation2 by some linker and ligation1 by a second linker, which is chemically orthogonal to that for ligation2;
[0102] In other embodiments, the two ligations can be formed by the same chemistry such as an azide-alkyne [3+2] cycloaddition.
[0103] An aspect of the invention is directed to CRISPR-Cas9-lgRNA system:
[0104] wherein lgRNA is a single ligated RNA composed of dual-modules, a triple or a multiple ligated RNA composed of dual-modules, and ligation sites are preferably located at tetraloop (A32-U37), and/or stem 2 (C70-G79) (of reported sgRNA designed for S. pyogenes Cas9), while any 3′, 5′-phosphodiester of sgRNA can be replaced by single nNt-Linker as a ligation site; and wherein Cas9 composed of a nuclease lobe (NUC) and a recognition lobe (REC) can be a CRISPR-associated protein other than the example of S. pyogenes Cas9 represented here, and can be any engineered Cas9.
[0105] Some aspects of the invention are directed to CRISPR-Cas9-lgRNA-transfecting reagent(s) systems.
[0106] Some aspects of the invention are directed to the use of CRISPR-Cas9-lgRNA system for antiviral therapy targeting against proviral DNAs or episomal circular DNAs.
[0107] In some embodiments, non-limiting examples of targeted viral genomic sequences of HBV include:
TABLE-US-00001 (SEQ ID NO 36) ctctgctagatcccagagtg [aGG], (SEQ ID NO 37) gctatcgctggatgtgtctg [cGG], (SEQ ID NO 38) tggacttctctcaattttct [a[G[G]G]G]], (SEQ ID NO 39) gggggatcacccgtgtgtct [tGG], (SEQ ID NO 40) tatgtggatgatgtggtactgg [gGG], (SEQ ID NO 41) cctcaccatacagcactc [gGG], (SEQ ID NO 42) gtgttggggtgagttgatgaatc [tGG],
[0108] wherein nucleotides in [ ] are PAMs, or any sequence of 17-20 nt upstream adjacent to a PAM sequence. More examples of such sequences can be found in literature (Lee, et al., WO2016/197132A1). A complete list of such sequences can be found in viral genomic sequences of HBV using online Basic Local Alignment Search Tool (BLAST). Useful selection methods to identify sequences having extremely low to no homology between the foreign viral genome and host cellular genome including endogenous retroviral DNA include bioinformatics screening to minimize and/or exclude off-target human transcriptome and essential untranslated genomic sites, and to optimize the efficacy of target cleavage.
[0109] In some embodiments, the therapeutic Cas9-lgRNAs comprise multiple lgRNAs targeting at different sites in viral genome (multiplex editing).
[0110] In some embodiments, multiple crgRNAs, including but not limited to sequences of YMDD and its mutations at catalytic domain of HBV polymerase, corresponding to
TABLE-US-00002 (SEQ ID NO 43) tatgtggatgat gtggtactgg [gGG], (SEQ ID NO 44) tatatggatgat gtggtattgg [gGG], (SEQ ID NO 45) tatgtggatgat gtggtattgg [gGG], (SEQ ID NO 46) tatatagatgat gtggtactgg [gGG],
[0111] are ligated to tracrgRNA to result in a mixture of lgRNAs, and thus of Cas9-lgRNAs to target drug resistance in therapies based on direct-acting antiviral agents (DAA).
[0112] In some embodiments, non-limiting examples of targeted viral genomic sequences of HIV include:
TABLE-US-00003 (SEQ ID NO 47) gattggcaga actacacacc [aGG], (SEQ ID NO 48) atcagatatc cactgacctt [tGG], (SEQ ID NO 49) gcgtggcctg ggcgggactg [gGG], (SEQ ID NO 50) cagcagttct tgaagtactc [cGG],
[0113] wherein nucleotides in [ ] are PAMs, or any sequence of 17-20 nt upstream adjacent to a PAM sequence. A complete list of such sequences can be found in viral genomic sequences of HIV using online Basic Local Alignment Search Tool (BLAST). Useful selection methods to identify sequences having extremely low to no homology between the foreign viral genome and host cellular genome including endogenous retroviral DNA include bioinformatics screening to minimize and/or exclude off-target human transcriptome and essential untranslated genomic sites, and to optimize the efficacy of target cleavage.
[0114] In some embodiments, non-limiting examples of targeted viral genomic sequences of herpesviridae virus such as HSV and EBV include:
TABLE-US-00004 (SEQ ID NO 51) gccctggaccaacccggccc [gGG], (SEQ ID NO 52) ggccgctgccccgctccggg [tGG], (SEQ ID NO 53) ggaagacaatgtgccgcca [tGG], (SEQ ID NO 54) tctggaccagaaggctccgg [cGG], (SEQ ID NO 55) gctgccgcggagggtgatga [cGG], (SEQ ID NO 56) ggtggcccaccgggtccgct [gGG], (SEQ ID NO 57) gtcctcgagggggccgtcgc [gGG],
[0115] wherein nucleotides in [ ] are PAMs, or any sequence of 17-20 nt upstream adjacent to a PAM sequence. A complete list of such sequences can be found in viral genomic sequences of herpesviridae virus using online Basic Local Alignment Search Tool (BLAST). Useful selection methods to identify sequences having extremely low to no homology between the foreign viral genome and host cellular genome including endogenous retroviral DNA include bioinformatics screening to minimize and/or exclude off-target human transcriptome and essential untranslated genomic sites, and to optimize the efficacy of target cleavage.
[0116] Other aspects of the invention are directed to the use of CRISPR-Cas9-lgRNA systems for gene edition and therapy.
[0117] Process for Preparations of Nucleotides
[0118] Other embodiments of this invention represent processes for preparation of these compounds provided herein, which can also be prepared by any other methods apparent to those skilled in the art.
[0119] Chemical Ligations
[0120] In some embodiments, the ligation between crgRNA and tracrgRNA (ligation1) is formation of triazole by Cu(I) catalyzed [2+3] cycloaddition. An azide or alkyne function is introduced at 3′-end of crgRNA which is an aminoalkyl oligonucleotide as represented by a non-limiting example of ON-11:
##STR00021##
[0121] An azide or alkyne function is introduced at 5′-end nucleotide of tracrgRNA as represented by a non-limiting example of ON-12 by solid phase supported synthesis:
##STR00022##
[0122] TracrgRNA and crgRNA are then ligated by click reaction, and annealed as represented by a non-limiting example of ON-13:
##STR00023##
or are annealed, and then ligated by click chemistry.
[0123] In other embodiments, the ligation between crgRNA and tracrgRNA is formation of thioether linker or any compatible crosslinking chemistry.
[0124] In some embodiments for triple lgRNAs, the ligation in tracrgRNA (ligation2) and the ligation between crgRNA and tracrgRNA (ligation1) are orthogonal, and two ligations are realized in one pot:
[0125] A maleimide is introduced to 3′-end of crgRNA in solid phase supported synthesis as represented by a non-limiting example of ON-14:
##STR00024##
[0126] A thiol and an azide are introduced at 5′-end and 3′-end of tracrgRNA1, respectively as represented by a non-limiting example of ON-15:
##STR00025##
[0127] An alkyne is introduced at 5′-end of tracrgRNA2 as represented by a non-limiting example of ON-16:
##STR00026##
[0128] TracrgRNA1, tracrgRNA2, and crgRNA are then ligated, and annealed as represented by a non-limiting example of ON-17:
##STR00027##
[0129] In some embodiments, the ligation in tracrgRNA (ligation2) and the ligation between crgRNA and tracrgRNA (ligation1) are orthogonal, and two ligations are realized in two sequential steps.
[0130] In other embodiments, the ligation in tracrgRNA (ligation2) and the ligation between crgRNA and tracrgRNA (ligation1) are formed by the same ligation chemistry, and two ligations are realized sequentially as represented by synthesis of ON-20:
##STR00028## ##STR00029##
[0131] Formation OF Cas9-lgRNA, Cellular Transfections, and ASSAYS
[0132] The formation of Cas9-lgRNA complex, and cellular transfections are performed as reported.
[0133] a. Transfection with cationic lipids (Liu, D. et al. Nature Biotechnology 2015, 33, 73-80):
[0134] Purified synthetic lgRNA or mixture of synthetic lgRNAs is incubated with purified Cas9 protein for 5 min, and then complexed with the cationic lipid reagent in 25 μL OPTIMEM. The resulting mixture is applied to the cells for 4 h at 37° C.
[0135] b. Transfection with cell-penetrating peptides (Kim, H. et al. Genome Res. 2014, 24: 1012-1019):
[0136] Cell-penetrating peptide (CPP) is conjugated to a purified recombinant Cas9 protein (with appended Cys residue at the C terminus) by drop wise mixing of 1 mg Cas9 protein (2 mg/mL) with 50 μg 4-maleimidobutyryl-GGGRRRRRRRRRLLLL (m9R; 2 mg/mL) in PBS (pH 7.4) followed by incubation on a rotator at room temperature for 2 h. To remove unconjugated 9mR, the samples are dialyzed against DPBS (pH 7.4) at 4° C. for 24 h using 50 kDa molecular weight cutoff membranes. Cas9-m9R protein is collected from the dialysis membrane and the protein concentration is determined using the Bradford assay (Biorad).
[0137] Synthetic lgRNA or a mixture of synthetic lgRNAs is complexed with CPP: lgRNA (1 μg) in 1 μl of deionized water is gently added to the C3G9R4LC peptide (9R) in lgRNA:peptide weight ratios that range from 1:2.5 to 1:40 in 100 μl of DPBS (pH 7.4). This mixture is incubated at room temperature for 30 min and diluted 10-fold using RNase-free deionized water.
[0138] 150 μl Cas9-m9R (2 μM) protein is mixed with 100 μl lgRNA:9R (10:50 μg) complex and the resulting mixture is applied to the cells for 4 h at 37° C. Cells can also be treated with Cas9-m9R and lgRNA:9R sequentially.
[0139] The antiviral assay is performed according to reported procedures (Hu, W. et al. Proc Natl Acad Sci USA 2014, 110: 11461-11466; Lin, Su. et al. Molecular Therapy—Nucleic Acids, 2014, 3, e186). Delivery to cell lines is based either cationic lipid or CPP based delivery of Cas9-lgRNA complexes instead of plasmid transfection/transduction using gRNA/Cas9 expression vectors.
EXAMPLES
[0140] The following examples further illustrate embodiments of the disclosed invention, which are not limited by these examples.
Example 1: Compound 4
[0141] ##STR00030##
[0142] Compound 2 is prepared essentially according to a reported procedure in 4 steps (Santner, T. et al. Bioconjugate Chem. 2014, 25, 188-195). Compound 1 is treated with 2-azidoethanol in dimethylacetamide at 120° C. at the presence of BF.sub.3.OEt.sub.2, and the resulting 2′-azido nucleoside is tritylated (DMTrCl, in pyridine, RT), and attached to an amino-functionalized support.
[0143] To compound 2 (0.99 mmol) in THF/H.sub.2O (2:1) (18 mL) is then added trimethylphosphine (1.5 mL, 1.5 mmol). Reaction is shaken at room temperature for 8 h and washed thoroughly with THF/H.sub.2O (2:1). Dioxane/H.sub.2O (1:1) (20 mL) and NaHCO.sub.3 (185 mg, 2.2 mmol) are added. The reaction mixture is cooled down to 0° C., and Fmoc-OSu (415 mg, 1.23 mmol) in dioxane (2 mL) is added. The reaction is shaked for 15 min at 0° C., and then washed with water and then THF (3×20 mL) to give compound 4.
Example 2: Compound 7
[0144] ##STR00031##
[0145] 6-Benzoyl-5′-O-DMTr-adenosine 5 (1.24 g, 1.84 mmole) is dissolved in THF (40 mL) and sodium hydride (60% dispersion in mineral oil, 0.184 g, 4.6 mmole) is added in portions at 0° C. The reaction mixture is warmed up to room temperature and stirred for 15 min. The reaction is then cooled to 0° C., and propargyl bromide (80% in toluene, 0.44 mL, 3.98 mmole) is added. The reaction is then stirred under reflux for 12 h. Saturated aqueous sodium bicarbonate (10 mL) is added, and volatiles are removed in vacuo. The resulting residue is dissolved in DCM, and washed with water and saturated brine. The organic layer is collected, dried over anhydrous sodium sulfate, and concentrated till dryness in vacuo. The resulting residue is purified by silica-gel chromatography (eluent: 97:3, DCM:MeOH, 0.5% pyridine) to provide compound 6.
[0146] To a solution of compound 6 (0.30 g, 0.42 mmol) in anhydrous dichloromethane (5 mL) and diisopropylethylamine (0.15 mL, 0.83 mmol), under nitrogen, is added 2-cyanoethyl-N,N-diisopropyl-chlorophosphoramidite (0.13 mL, 0.58 mmol) dropwise. The reaction is stirred at room temperature for 3 h, and then diluted with dichloromethane (25 mL). The resulting solution is washed with saturated aqueous KCl (25 mL), dried from anhydrous Na.sub.2SO.sub.4, and concentrated in vacuo. The residue is purified by column chromatography (60% EtOAc/hexane, 0.5% pyridine) to give compound 7.
Example 3: ON-11
[0147] ##STR00032##
[0148] ON-11 is prepared using 2′-TBS protected RNA phosphoramidite monomers with t-butylphenoxyacetyl protection of the A, G and C nucleobases and unprotected uracil. 0.3 M Benzylthiotetrazole in acetonitrile (Link Technologies) is used as the coupling agent, t-butylphenoxyacetic anhydride as the capping agent and 0.1 M iodine as the oxidizing agent. Oligonucleotide synthesis is carried out on an Applied Biosystems 394 automated DNA/RNA synthesizer using the standard 1.0 μmole RNA phosphoramidite cycle. Compound 4 (20 mg) is packed into a twist column. All β-cyanoethyl phosphoramidite monomers are dissolved in anhydrous acetonitrile to a concentration of 0.1 M immediately prior to use. Stepwise coupling efficiencies are determined by automated trityl cation conductivity monitoring and in all cases are >96.5%.
[0149] Fmoc is then cleaved by treatment with 20% piperidine in DMF. The resulting 3′-end aminoethyl oligonucleotide is then treated with NHS ester of 6-azido caproic acid in DMF.
[0150] Cleavage of oligonucleotides from the solid support and deprotection are achieved by exposure to concentrated aqueous ammonia/ethanol (3/1 v/v) for 2 h at room temperature followed by heating in a sealed tube for 45 min at 55° C. and desilylation in 1.0 M TBAF in THF for 24 h.
[0151] The above resulting oligonucleotide is dissolved in 0.5 M Na.sub.2CO.sub.3/NaHCO.sub.3 buffer (pH 8.75) and incubated with succinimidyl-6-azidohexanate (20 eq.) in DMSO to give ON-11.
[0152] Purification of the oligonucleotide is carried out by reversed-phase HPLC on a Gilson system using an XBridge™ BEH300 Prep C18 10 μM 10×250 mm column (Waters) with a gradient of acetonitrile in ammonium acetate (0% to 50% buffer B over 30 min, flow rate 4 mL/min), buffer A: 0.1 M ammonium acetate, pH 7.0, buffer B: 0.1 M ammonium acetate, pH 7.0, with 50% acetonitrile. Elution is monitored by UV absorption at 295 nm. After HPLC purification, the oligonucleotide is desalted using an NAP-10 column.
##STR00033##
Example 4: ON-12
[0153] ON-12 is synthesized in a way similar to the synthesis of ON-11, except that commercially available solid phase supported uridine phosphoramidite is used, and the last nucleoside phosphoramidite is compound 7.
[0154] The oligonucleotide is cleaved off the solid phase and fully deprotected, and purified as in example 3.
Example 5: ON-13
[0155] ##STR00034##
[0156] A solution of alkyne ON-12 and azide ON-11 (0.2 nmol of each) in 0.2 M NaCl (50 μL) is annealed for 30 min at room temperature. In the meantime tris-hydroxypropyl triazole ligand (28 nmol in 42 μL 0.2 M NaCl), sodium ascorbate (40 nmol in 4 μL 0.2 M NaCl) and CuSO.sub.4.5H.sub.2O (4 nmol in 4.0 μL 0.2 M NaCl), are added under argon. The reaction mixture is kept under argon at room temperature for the desired time, and formamide (50 μL) is added. The reaction is analyzed by and loading directly onto a 20% polyacrylamide electrophoresis gel, and purified by reversed-phase HPLC.
Example 6: ON-17
[0157] The ON-14 oligonucleotide carrying a maleimido group is incubated with 5′-SH-oligonucleotide (ON-15, 1:1 molar ratio) in 0.1 M triethylammonium acetate (TEAA) at pH 7.0 overnight at room temperature. The solution is evaporated to dryness, and to the resulting mixture is added ON-16 in 250 μM final concentration in phosphate-buffered saline (PBS), pH 7.4, containing 0.7% DMF and incubated at room temperature. The reaction mixture is analyzed and separated by HPLC to give ON-17.
Example 7: Cas9::ON-13 Complex
[0158] Cas9 protein: Recombinant Cas9 protein is available from New England BioLabs, Inc. and other providers or purified from E. coli by a routinely used protocol (Anders, C. and Jinek, M. Methods Enzymol. 2014, 546, 1-20). The purity and concentration of Cas9 protein are analyzed by SDS-PAGE.
[0159] Cas9-lgRNA Complex:
[0160] Cas9 and lgRNA are preincubated in a 1:1 molar ratio in the cleavage buffer to reconstitute the Cas9-lgRNA complex.