METHOD FOR THE PRODUCTION OF TRIACYLGLYCERIDES AND FATTY ACIDS

20210230650 · 2021-07-29

    Inventors

    Cpc classification

    International classification

    Abstract

    The disclosure pertains to a method for the production of triacylglycerides (TAGs or Triacylglyerols) and fatty acids by the recombinant expression of a Δ11 fatty acid desaturase in protists.

    Claims

    1. (canceled)

    2. A method for producing triacylglycerides and/or fatty acids, expressing a recombinant fatty acid Δ11 desaturase in a protist, wherein said recombinant fatty acid Δ11 desaturase comprises or consists of a sequence having at least 50% identity with the sequence SEQ ID NO: 1.

    3. The method of claim 2, wherein said recombinant fatty acid Δ11 desaturase comprises or consists of the sequence SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3.

    4. The method of claim 2, wherein said protist is a microalgae.

    5. The method of claim 2, wherein said protist is a Thraustochytrid.

    6. The method of claim 2, wherein said fatty acids are polyunsaturated fatty acids.

    7. The method of claim 2, wherein said fatty acids are eicosapentaenoic acid (EPA, 20:5), docosapentaenoic acid (DPA, 22:5) or docosahexaenoic acid (DHA, 22:6).

    8. A nucleic acid encoding a fatty acid Δ11 desaturase comprising or consisting of a sequence having at least 50% identity with the sequence SEQ ID NO: 1, said nucleic acid being codon-optimized for the expression of said fatty acid Δ11 desaturase in a protist.

    9. The nucleic acid according to claim 8 which comprises or consists of the sequence SEQ ID NO: 7.

    10. An expression cassette comprising a nucleic acid encoding a fatty acid Δ11 desaturase as recited in claim 8, said nucleic acid encoding a fatty acid Δ11 desaturase being under the control of a promoter which is functional in a protist.

    11. A vector comprising a nucleic acid as defined in claim 8 or comprising an expression cassette comprising said nucleic acid, wherein said nucleic acid in the expression cassette is under the control of a promoter which is functional in a protist.

    12. A protist comprising: a nucleic acid as defined in claim 8, an expression cassette comprising said nucleic acid, wherein said nucleic acid in the expression cassette is under the control of a promoter which is functional in a protist, or a vector comprising said nucleic acid or said expression cassette.

    13. The method of claim 5, wherein said Thraustochytrid is from a genus selected from the group consisting of Aurantiochytrium, Japonochytrium, Sicyoidochytrium, Ulkenia, Parietichytrium, Botryochytrium, Schizochytrium, Monorhizochytrium and Thraustochytrium.

    14. The method of claim 5, wherein said Thraustochytrid is selected from the species Aurantiochytrium limacinum and Aurantiochytrium mangrovei.

    15. The method of claim 6, wherein said fatty acids are long-chain polyunsaturated fatty acids or very long-chain polyunsaturated fatty acids.

    Description

    FIGURE LEGENDS

    [0095] FIG. 1. Schematic representation of the plasmid pUbi-d11Tp encoding the Δ11 desaturase from T. pityocampa.

    [0096] FIG. 2. Schematic representation of the plasmid pUbi-Zeo encoding the zeocin resistance.

    [0097] FIG. 3. Schematic representation of the plasmid pUbi-d11Tp encoding the Δ11 desaturase from T. pseudonana.

    [0098] FIG. 4. Dot plot of the sequence identity values calculated on a multialignment containing 484 delta11 desaturase sequences from the class Insecta. In x-axis: sequences, in y-axis: sequence identity value.

    [0099] FIG. 5. Neighbor-Joining phylogenetic tree constructed with a subset of Δ11 sequences retrieved from NCBI. In the figure, the orders within the class Insecta of which the sequences belong are reported. For Lepidoptera, two groups have been identified: the butterflies and the moths. A black star identifies the Thaumetopoea pityocampa acyl-CoA Δ11 desaturase sequence.

    [0100] FIG. 6. Fresh weight (A) and optical density at 600 nm (B) of the transgenic lines and control cultures after 5 days of culture run in parallel.

    [0101] FIG. 7. Fatty Acid content in the transgenic lines and control cultures at days 2 and 5. The bold lines show the upper and lower range values for controls at day 5. Inset: picture of the chloroform extracted lipids in one of the transgenic lines (tube on the right) and a control (tube on the left). Note the different color intensities indicating a much higher oil content in the transgenic line.

    [0102] FIG. 8. TAG content (A) and polar lipids (B) in control (empty vector) and four mutants overexpressing the Acyl-CoA Δ11 desaturase from the moth Thaumetopoea pityocampa.

    [0103] FIG. 9. Fatty Acid composition (%) in transgenic lines and controls after 5 days of culture.

    [0104] FIG. 10. DHA (22:6) and DPA (22:5) content in transgenic (dark grey) and control (light grey) cell lines.

    [0105] FIG. 11. Dry weight of the transgenic lines and control cultures after 2 and 5 days of culture run in parallel.

    [0106] FIG. 12. Fatty Acid content in the transgenic lines and control cultures at days 2 and 5.

    [0107] FIG. 13. DPA (22:5) and DHA (22:6) content in transgenic (dark grey) and control (light grey) cell lines.

    EXAMPLES

    Materials and Methods

    Cultivation and Transformation of Aurantiochytrium

    [0108] The thraustochytrid used in the examples is an Aurantiochytrium species (Aurantiochytrium limacinum). It was cultivated in R medium containing the ingredients listed in Table 5:

    TABLE-US-00005 TABLE 5 Composition of the R medium. Component Final Concentration (w/v) NaCl 10.597 g/l Na.sub.2SO.sub.4 1.775 g/l NaHCO.sub.3 87 mg/l KCl 299.5 mg/l KBr 43.15 mg/l H.sub.3BO.sub.3 11.5 mg/l NaF 1.4 mg/l MgCl.sub.2•6H.sub.2O 4.796 g/l CaCl.sub.2•2H.sub.2O 0.672 g/l SrCl.sub.2•6H.sub.2O 10.9 mg/l EDTA-iron 1.50 mg/l Na.sub.2EDTA•2H.sub.2O 1.545 mg/l ZnSO.sub.4•7H.sub.2O 36.5 μg/l CoCl.sub.2•6H.sub.2O 8 μg/l MnCl.sub.2•4H.sub.2O 0.27 mg/l Na.sub.2MoO.sub.4•2H.sub.2O 0.74 μg/l Na.sub.2Se0.sub.3 0.085 μg/l NiCl.sub.2•6H.sub.2O 0.745 μg/l CuSO.sub.4•5H.sub.2O 4.9 μg/l Vitamin H 0.499 μg/l Vitamin B12 0.501 μg/l Vitamin B1 78.54 μg/l NaNO.sub.3 23.33 mg/l NaH.sub.2PO.sub.4 1.343 mg/l Glucose 60 g/l Yeast extract 20 g/l

    [0109] 50 ml cultures were grown in sterile 250 ml Pyrex flasks under agitation (100 rpm).

    [0110] Solid medium has the same composition as Table 5 but contains 1% agar.

    Cassette for the Expression of Acyl-CoA Δ11 Desaturase from Thaumetopoea pityocompa

    [0111] The polynucleotide coding for an acyl-CoA Δ11 desaturase from the moth Thaumetopoea pityocampa (SEQ ID NO: 1) was codon optimized using a homemade codon usage table (based on 30192 residues, see also Table 3) for heterologous over-expression in Aurantiochytrium under the control of the polyubiquitin endogenous gene promoter. The transcription terminator used in this construct was the endogenous polyubiquitin gene terminator. An HA tag sequence (YPYDVPDYA, SEQ ID NO: 9) was added between the last encoding amino acid and the stop codon of the acyl-CoA Δ11 desaturase sequence. Two restriction sites were added at the 5′ end (NotI, NheI) and the 3′ end (NdeI, NcoI) of the DNA sequence, producing the optimized delta11Tp-HA gene. The final delta11-Tp cassette (SEQ ID NO: 8), containing the Ubi promoter region from the pUbi-Zeo, followed by the optimized delta11Tp-HA gene, and the Ubi terminator region from the pUbi-Zeo, was synthesized and subcloned into a commercial pUC19 plasmid using PstI/HindIII restriction sites by the Invitrogen GeneArt Gene Synthesis Service to obtain the vector pUbi-d11Tp (FIG. 1). The plasmid was co-transformed with the zeocin resistance cassette under the same polyubiquitin promoter.

    Cassette for the Expression of the Zeocin Resistance

    [0112] In order to clone the zeocin resistance gene under the polyubiquitin promoter/terminator into the expression vector, an ORF encoding a yeast UBI4 polyubiquitin homologous gene was identified in the genome of Aurantiochytrium. A 917 pb sequence upstream of the ORF was amplified with following primers PromUbi2SacI-F (TTGAGCTCAGAGCGCGAAAGAGAGTGCCGGAATTC, SEQ ID NO: 10)) and PromUbi2BamHI-R (GCGGATCCGAAATTGACCTTACTGCCTCTCCTGTG, SEQ ID NO: 11) to add the restriction sites SacI in 5′ and BamHI in 3′ of the sequence. A 935 pb sequence downstream of the ORF was amplified with the following primers TermUbi2SphI-F (GGGCATGCTGTCAAAACCGGGGTTAGTGACATTGA, SEQ ID NO: 12) and TermUbi2HindIII-R (GGAAGCTTCCATTTGCCTCTGCGTGAAATTCAATC, SEQ ID NO: 13) to add the restriction sites SphI in 5′ and HindIII in 3′ of the sequence. A 375 pb sequence encoding the zeocin gene from the commercial plasmid pTEF1 was amplified with following primers ZeoS1BamHI (GCGGATCCATGGCCAAGTTGACCAGTGCCGTTCC, SEQ ID NO: 14) and ZeoS1SalI (GCGTCGACTCAGTCCTGCTCCTCGGCCACGAAGT, SEQ ID NO: 15) to add the restriction sites BamHI in 5′ and SalI in 3′ of the sequence. All sequences were sequentially inserted into the multiple cloning site of the pUC19 plasmid to obtain the vector pUbi-Zeo (FIG. 2), using common cloning techniques (restriction enzyme digestion, ligation, E. coli termo-transformation, plasmid preparation). The sequence of the complete zeocin resistance cassette corresponds to SEQ ID NO: 16 (see Table 6).

    TABLE-US-00006 TABLE 6 Cassette encoding the zeocin resistance. SEQ ID NO: 16 GAGCTCAGAGCGCGAAAGAGAGTGCCGGATTCAAAGACGCCACAGCGGGAAAG Cassette AAAGAAAGACCTAGGAGGTACTAGCTGGTTGTAGCTAGCTAGCTAGCTAGCTA encoding the GCTTATGCTGCTAAGACGCCCTTCCTCCTCGAGGTCCTTTTGACTTGCCAGCG zeocin resistance CAGTCTCCTTTGTCTTCTTCGCTCATTTAATCAAGTCAAGTCTTCAGGTTTAA AATGAAAAATCCTGCTTCCAGGTTCAGTTCTAGCAAGTAGGTAGGTGGCAGTA GCGTTACGAGGAGGAGTCCCGAGAGGGAGTCGGAGAGTAGAAAACTGGAAGTC GGCGAAACAAAAGGCGCAGAGATTTGCCGGAATGGAGAGTTATCGTGAGACTC TCTGAGTAGACCCAAGTGTCCTGTGAGGCACTCGTGATAGGGAGGGGGCACGG GCTGAAGGGGGCTACAGTAAGGAGAGAGTGGCGTCAGTGGAGTTTCGCCGAGA ACTCTTCGAGAAAGAGGAAGAGAGGAACCGAGAGCGCCGTTGAAGAGGGGAAA AAGCAGACGGTTTAATTATAATTAATTAAGTAATTAATTACTTACTTATTGAT TGATTGATTTGAGAAGAGAAGCAAAGAGAGAGTTGAAGAAATAGTAACGAAGA ATAGGAGAAGAAAGGGGCAAGAAAAGAAAAAAGAAAGAGGAGAATATTGGTCG ATGAGCGAGAACGTGCAAATCCAAAACAGCAAAACTCAAACTCAAACTACAAG AAGCGTGGCGTTGCAGAGGCAACAGCTCGAAAGCAACACAGAACAGACAAACA CAGGAGAGGCAGTAAGGTCAATTTCGGATCCATGGCCAAGTTGACCAGTGCCG TTCCGGTGCTCACCGCGCGCGACGTCGCCGGAGCGGTCGAGTTCTGGACCGAC CGGCTCGGGTTCTCCCGGGACTTCGTGGAGGACGACTTCGCCGGTGTGGTCCG GGACGACGTGACCCTGTTCATCAGCGCGGTCCAGGACCAGGTGGTGCCGGACA ACACCCTGGCCTGGGTGTGGGTGCGCGGCCTGGACGAGCTGTACGCCGAGTGG TCGGAGGTCGTGTCCACGAACTTCCGGGACGCCTCCGGGCCGGCCATGACCGA GATCGGCGAGCAGCCGTGGGGGCAGGAGTTCGCCCTGCGCGACCCGGCCGGCA ACTGCGTGCACTTCGTGGCCGAGGAGCAGGACTGAGTCGACCTGCAGGCATGC TGTCAAAACCGGGGTTAGTGACATTGACTTGTTGACAAAAATCTGTATAGCTA GAAAACTCTAAGCAACGCTTTTCTTTGTTTTATTTTTTATGTTTTAACTCCTT CAGAATTGTAGGATATCTTGTTTTGAAAAATCCAGGACTGAGTTTCGTTGCCC CATTTGCTTGTTCTCGTTTGAAATGTCGAACAGTAGAAATGCTTGCAGAATGA GGTTCTCCTTTACAAAAAACTCGATAGGGTTCAATATGAAGCTGTCTCGATGC ATAGATTTCCACGATTTTACCTTTGCATAATCTATGGTGCGCGTCAGATGCCA CCCTCGTCGCTGTACAACCAATACATTGTAGCTTCATTTTGACATTAGGTACC TTCTTCCCCGACCTCCTTCAGAATCTCAGAGTAAGCGATCGATCGTCACCCCT TCTACCTGAAACTCTACCACTGCATACGTAGTAAAGGCCTCTAATTACCACGG TAGTACTATTCTTGCACTGAGGAATTCTCTAGACGAATGTAGGCTATTCTTAA TGGACCGGCCCTCAGCTCGATTATTTTTGCTTGACTTGACTTGACTTGATTAA TGAAGTTGATAGGAAAGAAACATAACCCATTCCATCCCACAACCTGCGTGTAC TCTGATCGGCAGGTGCACGCTGAGTTGAGGGTGATTTAAGGATCGAAAACATC AGCCTAGAGCACGACGAGGTTCCAGAGAGCCAACTTTTTCTATCTATTAATCT CATCCTTTGCTTCTTCGCGGACAACGACGGTGGATCAGCGCCGCCGCTGAGAA GACAGCAGAGGTAACTCTAGCAAGAGAAGCAGCAGTAGCTTCGTCTGGTCAAG AGACTCTGCTTAAGCACAGTAGCCTGCAAATAAAGACACTTGGGCAAAAGAAA CATTGACATTGATTGAATTTCACGCAGAGGCAAATGGAAGCTT
    Cassette for the Expression of an Acyl-CoA Δ11 Desaturase from Thalassiosira pseudonana

    [0113] A sequence identified as a Δ11 desaturase (SEQ ID NO: 17, Thaps3|23391, see Table 7) was found in the genome of the marine diatom T. pseudonana. The nucleic acid sequence encoding this Δ11 desaturase was codon-optimized and synthesized as described above. Cloning into an expression vector was performed by GeneArt© gene synthesis service to obtain pUbi-d11thala (FIG. 3).

    TABLE-US-00007 TABLE 7 Codon-optimized nucleic acid sequence encoding the Acyl-CoA Δ11 desaturase from Thalassiosirapseudonana. SEQ ID NO: 17 CTGCAGGTAGGTAGGTGGCAGTAGCGTTACGAGGAGGAGTCCCGAGAGGGAGT Cassette CGGAGAGTAGAAAACTGGAAGTCGGCGAAACAAAAGGCGCAGAGATTTGCCGG encoding a Acyl- AATGGAGAGTTATCGTGAGACTCTCTGAGTAGACCCAAGTGTCCTGTGAGGCA CoA Δ11 CTCGTGATAGGGAGGGGGCACGGGCTGAAGGGGGCTACAGTAAGGAGAGAGTG desaturase from GCGTCAGTGGGGTTTTGCCGAGAACTCTTCGAGAAAGAGGAAGAGAGGAACCG Thalassiosira AGAGCGCCGTTGAAGAGGGGAAAAAGCAGACGGTTTAATTATAATTAATTAAG pseudonana TAATTAATTACTTACTTATTGATTGATTGATTTGAGAAGAGAAGCAAAGAGAG AGTTGAAGAAATAGTAACGAAGAATAGGAGAAGAAAGGGGCAAGAAAAGAAAA AGAAAGAGGAGAATATTAGTCGATGAGCGAGAACGTGCAAATCCAAAACAGCA AAACTCAAACTCAAACTCAAACTACAAGAAGCGTGGCGTTGCAGAGGCAACAG CTCGAAAGCAACACAGAACAAACAAACACAGGAGAGGCAGTAAGGTCAATTTC GCGGCCGCGCTAGCATGGCGCCCAACACGCGGGAGAACGAGACGATCTACGAC GAAGTGGAACACAAGCTGGAGAAGCTCGTGCCCCCCCAGGCGGGCCCCTGGAA CTACAAGATCGTGTACCTGAACTTGCTGACCTTCTCCTACTGGCTGATCGCCG GCGCCTACGGGTTGTACTTGTGCTTCACGTCCGCCAAGTGGGCCACGATCATC TTCGAATTCATCTTGTTCTTCTTCGCCGAGATGGGCATCACGGCCGGCGCCCA CCGGCTGTGGACGCACAAGTCCTACAAGGCCAAGTTGCCCTTGGAAATCTTCC TCATGGTGCTGAACTCCGTGGCGTTCCAGAACACGGCCACCGACTGGGTGCGG GACCACCGGCTGCACCACAAGTACAGCGACACGGACGCGGACCCCCACAACGC CGCGCGGGGGCTGTTCTTCTCCCACGTCGGGTGGCTGCTCGTCCGGAAGCACG ACGAAGTCAAGAAGCGCGGGAAGTTCACCGACATGTCCGACATCTACAACAAC CCCGTGTTGAAGTTCCAGAAGAAGTACGCCATCCCCTTCATCGGCGCCGTGTG CTTCATCTTGCCCACGGTGATCCCCATGTACTTCTGGGGCGAGTCCCTCAACA ACGCCTGGCACATCTGCATCCTGCGGTACGCGATGAACCTCAACGTCACGTTC TCCGTGAACTCCCTGGCGCACATCTGGGGCAACAAGCCCTACGACAAGGACAT CAAGCCCGCCCAGAACTTCGGCGTGACGTTGGCGACCTTCGGCGAAGGGTTCC ACAACTACCACCACGTGTTCCCCTGGGACTACCGGACGTCCGAACTCGGCGAC AACAAGTTCAACTTCACGACGAAGTTCATCAACTTCTTCGAACGGATCGGCTT GGCGTACGACCTGAAGACCGTGTCCGACGACGTGATCGCGCAGCGGGCCAAGC GGACCGGCGACGGCACGCACCTGTGGGACTGCGCCGACAAGAACAACAACGAC GTGGTGCAGACGAAGGCGCAGATCGACACCTTGTGCACGAAGCACGAATGAGG TTCTCCTTTACAAAAAAACTCGATAGGGTTCAATATGAAGCTGTCTCAATGCA TAGATTTCCACGATTTTACCTTTGCATAATCTATGGTGCGCGTCAGATGCCAC CCTCGTCGCTGTACAACCAATACATTGTAGCTTCATTTTGACATTAGGTACCT TCTTCCCCGACCTCCTTCAGAATCTCAGAGTAAGCGATCGTCACCCCTTCTAC CTGAAACTCTACCACTGCATACGTAGTAAAGGCCTCTAATTACCACGGTAGTA CTATTCTTGCACTGAGGAATTCTCTAGACGAATGTAGGCTATTCTTAATGGAC CGGCCCTCAGCTCGATTATTTTTGCTTGACTTGACTTGACTTGATTCATGAAG TTGATAGGAAAGAAACATAACCCATCCCATCCCACAACCTGCGTGTACTCTGA TCGGCAGGTGCACGCTGAGTTGAAGGTGGTTCAAGAATCGAAAACATCAGCCT AGAGCACGACGAGGTTTCAGAGAGCCAACTTTTTCTATCTATTAATCTCATCC TTTGCTTCTTCGCGGACAACGACGGTGGATCAGCGCCGCCGCTGAGAAGACAG CAGAGGTAACTCTAGCAAGAGAAGCAGCAGTAGCTTCGTCTGGTCAAGAGACT CTGCTTAAGCACAGTAGCCTGCAAATAAAGACACTTGGGCAAAAGAAACATTG ACATTGATTGAATTTCACGCAGAGGCAAATGGAAGCTT

    Genetic Transformation

    [0114] Genetic transformation was performed by biolistic method. 2×107 cells of Aurantiochytrium, from a 2 to 4-day old-culture, were plated onto solid medium with 200 μg/ml zeocin in 10 cm Petri dishes. Cells were left air-dry in a sterile hood. One to two μg of each plasmid for co-transformation were coated on 25 μl of 0.7 μm diameter tungsten microcarriers (hereon referred to as ‘beads’). 25 μL of CaCl2 2.5 M in absolute ethanol and 10 μL spermidine were added to the beads then 4 volumes of absolute ethanol to wash the beads. The beads were spun down for 6-7 sec at 8000 g, the supernatant discarded and 700 μl ice cold ethanol was added again. The supernatant was discarded and the pellet suspended in 25 μl ethanol. Coated beads were kept on ice until use. The particle bombardment was performed with a PDS-1000/He Particle Delivery System equipped with a rupture disk resistance 1550 psi. 10 μl of the bead mix was placed on the macrocarriers. Two shots per bead preparation were performed.

    [0115] Genetic transformation of Aurantiochytrium can be achieved by other methods, such as electroporation.

    Lipid Extraction and Fatty Acid Analyses

    [0116] Glycerolipids were extracted from freeze-dried cells. First, cells were harvested by centrifugation and snap-frozen in liquid nitrogen. Ten mg dry weight were suspended in 4 mL of boiling ethanol for 5 minutes. Lipids were extracted by addition of 2 mL methanol and 8 mL chloroform at room temperature (as described in Folch T et al., Journal of Biological Chemistry, 226:497-509, 1957). The mixture was saturated with argon and stirred for 1 hour at room temperature. After filtration through glass wool, cell remains were rinsed with 3 mL chloroform/methanol 2:1, v/v. Five mL of NaCl 1% were added to the filtrate to initiate biphase formation. The chloroform phase was dried under argon before solubilizing the lipid extract in pure chloroform (as described in Jouhet J et al., PLoS One, 12(8):e0182423, 2017).

    [0117] Total fatty acids were analyzed as follows: in an aliquot fraction, a known quantity of 21:0 was added and the fatty acids present were converted to methyl esters (fatty acid methyl ester or FAME) by a 1-hour incubation in 3 mL 2.5% H2SO4 in pure methanol at 100° C. (as described in Jouhet et al., FEBS Letters, 544(1-3):63-8, 2003). The reaction was stopped by adding 3 mL 1:1 water:hexane. The hexane phase was analyzed by gas chromatography (gas chromatography coupled to mass spectrometry and flame ionization detection, GC-MS/FID) (Perkin Elmer, Clarus SQ 8 GC/MS series) on a BPX70 (SGE) column. FAMEs were identified by comparison of their retention times with those of standards (obtained from Sigma) and quantified using 21:0 for calibration. Extraction and quantification were performed at least 3 times.

    Quantification of Glycerolipids by High Performance Liquid Chromatography (HPLC) and Tandem Mass Spectrometry (MS/MS) Analyses

    [0118] The various glycerolipids were routinely quantified using an external standard corresponding to a qualified control (QC) of lipids extracted from the same strain (as described in Jouhet J et al., PLoS One, 12(8):e0182423, 2017). This QC extract was a known lipid extract previously qualified and quantified by thin layer chromatography (TLC) and GC-MS/FID, as described above. For the routine analyses of the samples, lipids corresponding to 25 nmol of total fatty acids were dissolved in 100 μL of chloroform/methanol [2/1, (v/v)] containing 125 pmol each of DAG 18:0-22:6, PE 18:0-18:0 and SQDG 16:0-18:0 as internal standard (Avanti Polar Lipids Inc). All the internal standard solutions were first quantified by GC-FID. Lipids were then separated by HPLC and identified by ESI-MS/MS.

    [0119] The HPLC separation method was adapted from Rainteau et al. (PLoS One, 7(7):e4198510, 2012). Lipid classes were separated using an Agilent 1200 HPLC system using a 150 mm×3 mm (length×internal diameter) 5 μm diol column (Macherey-Nagel), at 40° C. The mobile phases consisted of hexane/isopropanol/water/ammonium acetate 1M, pH5.3 [625/350/24/1, (v/v/v/v)] (A) and isopropanol/water/ammonium acetate 1M, pH5.3 [850/149/1, (v/v/v)] (B). The injection volume was 20 μL. After 5 min, the percentage of B was increased linearly from 0% to 100% in 30 min and stayed at 100% for 15 min. This elution sequence was followed by a return to 100% A in 5 min and an equilibration for 20 min with 100% A before the next injection, leading to a total runtime of 70 min. The flow rate of the mobile phase was 200 μL/min. The distinct glycerophospholipid classes were eluted successively as a function of the polar head group. Under these conditions, they were eluted in the following order: Triacylglycerols (TAG), Diacylglycerols (DAG), Phosphatidylethanolamines (PE), Phosphatidylglyecrols (PG), Phosphatidylinositols (PI), Phosphatidylserines (PS), Phosphatidylcholines (PC), Diphosphatidylglycerols (DPG) and Phosphatidic acids (PA).

    [0120] Mass spectrometric analysis was done on a 6460 triple quadrupole mass spectrometer (Agilent) equipped with a Jet stream electrospray ion source under following settings: Drying gas heater: 260° C., Drying gas flow 13 L/min, Sheath gas heater: 300° C., Sheath gas flow: 11 L/min, Nebulizer pressure: 25 psi, Capillary voltage: ±5000 V, Nozzle voltage±1000. Nitrogen was used as collision gas. The quadrupoles Q1 and Q3 were operated at widest and unit resolution respectively. Mass spectra were processed by MassHunter Workstation software (Agilent). The QC sample is used as an external standard, and run with the list of the samples to be analyzed. First, lipid amounts in all samples were adjusted with three internal standards (see above) to correct possible variations linked to the injection and analytical run. Then, within the QC samples, molecules in a given class of glycerolipid were summed and compared to the amount of the same lipid class previously determined by TLC-GC. This is done in order to establish a correspondence between the area of the peaks and a number of pmoles. These corresponding factors were then applied to the samples of the list to be analyzed.

    Example I. Conservation of the Acyl-CoA Δ11 Desaturase Among Insects

    [0121] A multialignment was carried out on 484 Δ11 sequences retrieved from the NCBI database using Thaumetopoea pityocampa acyl-CoA Δ11 desaturase as query (SEQ ID NO: 1). The sequences in fasta format were imported in BioEdit computer program and aligned using the ClustalW algorithm implemented in BioEdit. The alignment was trimmed in N-ter and C-ter taking into account the functional domains of the proteins. A sequence identity matrix was produced using the utility implemented in BioEdit software and the sequence identity values of Thaumetopoea pityocampa acyl-CoA Δ11 desaturase vs all the other 483 sequences in the alignment was plotted in FIG. 4. The 100% identity (value 1.00) of the comparison with the Thaumetopoea pityocampa acyl-CoA Δ11 desaturase sequence itself was not included in the dot plot. 23% (114) of the sequences presented an identity above 60%, 22% (107) an identity below 55%. All the amino acid sequences analyzed have a % identity equal or above 50% compared to SEQ ID NO: 1.

    [0122] A subset of the alignment produced as described above, was used to construct a phylogenetic tree (FIG. 5). The evolutionary history was inferred using the Neighbor-Joining method. The bootstrap consensus tree inferred from 1000 replicates is taken to represent the evolutionary history of the taxa analyzed. Branches corresponding to partitions reproduced in less than 50% bootstrap replicates are collapsed. The evolutionary distances were computed using the Poisson correction method and are in the units of the number of amino acid substitutions per site. The rate variation among sites was modeled with a gamma distribution (shape parameter=1). The analysis involved 285 amino acid sequences. All ambiguous positions were removed for each sequence pair. There were a total of 300 positions in the final dataset. Evolutionary analyses were conducted in MEGA7.

    Example II. Production of Fatty Acids by Aurantiochytrium Clones Expressing the Acyl-CoA Δ11 Desaturase from Thaumetopoea pityocampa

    [0123] Four transformant Aurantiochytrium clones, Thom7, Thom8, Thom10, Thom23′, obtained after transformation with the vector pUbi-d11Tp were PCR validated for the presence of the transgene in the genome and then used for the determination of their growth rate and lipid content. A wild type culture and a transformation control (pUbiZeo5) were added. The latter clone was transformed with the zeocin resistance cassette only and is meant to give the lipid baseline production for a biolistics-derived transformant. Growth was followed by measuring the fresh weight and the optical density at 600 nm of the cultures over a period of 5 days. Lipid measurements were performed on days 2 and 5. All the experiments were run in biological independent duplicates, except for pUbiZeo5 where two independent experiments were run, each in duplicate.

    [0124] Fresh weight was comparable among transformants and controls during the first two days of the experiment, but at day 5 the four transformants had accumulated more biomass (higher fresh weight per milliliter of culture) and displayed a higher optical density (FIGS. 6A and 6B) than the controls. In addition, the four screened clones produced on average 2 times more total fatty acids per ml of culture (FIG. 7) than the controls on day 2 and 2-3 times more on day 5. The TAG content expressed as μmol per mg of fresh weight also increased by a factor of 2 (FIG. 8A), whereas the polar (membrane) lipid content was little affected (FIG. 8B), indicating that the increase of fatty acids was due to a higher level of lipid storage (TAGs). The FAME profiles of the transformants displayed a lower proportion of 15:0 compared to controls, and three transformants (Thom7, Thom8, Thom10) out of the four showed an augmented percentage of DHA. On average at day 5 the transgenic lines presented >54% DHA while the controls showed 45% (FIG. 9). In the transgenic lines Thom7, Thom8, Thom10, Thom23′, the PUFA content (DHA, 22:6 and DPA, 22:5) expressed per mg dry weight was on average twice as much as the controls at day 5 (FIG. 10) and, taking into account that they also produced more biomass (FIG. 6A), the yield of lipid production (μmoles/ml culture) was about three times higher.

    [0125] This result shows that the overexpression of the Acyl-CoA Δ11 desaturase from Thaumetopoea pityocampa results in a higher rate of growth, improving the biomass production, together with an increase of total fatty acids and TAGs, without affecting the fatty acid composition.

    Example III. Production of Fatty Acids by Aurantiochytrium Clones Expressing the Acyl-CoA M1 Desaturase from Thalassiosira pseudonana (Comparative Example)

    [0126] In WO 2005/080578, desaturases from the diatom Thalassiosira pseudonana were identified (TpDESN) and functionally characterized in T. pseudonana and in yeast. By supplementing the culture media with different fatty acids, it was possible to identify such a Δ11 desaturase as not being a front-end desaturase albeit its primary sequence shows high similarity with this protein family. TpDESN acts primarily on 16:0. The expression of this protein in the yeast led to the production of specific fatty acids upon culture medium supplementation with different fatty acid substrates.

    [0127] A sequence identified as a Δ11 desaturase (SEQ ID NO: 17, Thaps3|23391) was found in the genome of the marine diatom T. pseudonana. Aurantiochytrium was transformed to express this Δ11 desaturase. This Δ11 desaturase showed 10.6% homology with the Thaumetopoea pityocampa acyl-CoA Δ11 desaturase of Example 2.

    [0128] Three transformant Aurantiochytrium clones were analyzed, Thala1, Thala5, and Thala9. Growth and biomass accumulation was slightly affected in all the transformants compared to the pUbiZeo5 negative control (FIG. 11).

    [0129] The total fatty acid production was affected in transformant clones (FIG. 12) as well as the DHA and DPA content (FIG. 13), showing reduced fatty acid and PUFA contents.