Lactoferrin aptamers and use thereof

11091757 · 2021-08-17

Assignee

Inventors

Cpc classification

International classification

Abstract

A method screens for aptamers by using a microarray microfluidic chip. The screening chip integrates microarray and microfluidic technology to integrate the positive and negative screening process on a microfluidic chip, and obtains aptamers with high affinity after 7 rounds of screening. It also discloses specific steps for screening of lactoferrin aptamers, including detailed processes such as chip preparation, positive and negative screening processes, and PCR amplification. The aptamers screened by the method have good specificity and affinity to the target protein. The aptamers are easier to be obtained than the antibody, and can be synthesized rapidly in large quantities in vitro. The preparation method is simpler and faster, so aptamers are expected to be a useful complement to antibody technology in many areas.

Claims

1. A lactoferrin-bound aptamer, wherein the lactoferrin-bound aptamer is a polynucleotide having the nucleotide sequence shown as SEQ ID No: 6.

2. A method for detecting lactoferrin content comprising a step for determining the amount of an aptamer that interacted with the lactoferrin, wherein the aptamer is a polynucleotide having the nucleotide sequence shown as SEQ ID NO: 6.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 Schematics of aptamer screening based on microarray microfluidics.

(2) FIG. 2. Results of the first screening, (a) amount of library per round, (b) fluorescence signal intensity of the aptamer on the chip, (c) imaging image of the aptamer on the chip, (d) Image after chip cleaning.

(3) FIG. 3. Results of the second screening, (a) amount of library per round, (b) fluorescence signal intensity of the aptamer on the chip, (c) imaging image of the aptamer on the chip, (d) Image image after chip cleaning.

(4) FIG. 4. Results of the third screening, (a) amount of library per round, (b) fluorescence signal intensity of the aptamer on the chip, (c) imaging image of the aptamer on the chip, (d)) Image image after chip cleaning.

(5) FIG. 5. A linear plot of other aptamers for lactoferrin detection by fluorescence polarization: (a) a polarization plot for aptamer N2, (b) a polarization plot for aptamer N14, (c) a polarization plot for aptamer N16 and (d) a polarization plot for aptamer N31.

DETAILED DESCRIPTION OF INVENTION

(6) The invention can be better understood in light of the following examples. However, those skilled in the art will understand that the description of the embodiments is only intended to illustrate the invention and should not be construed as limiting the invention as described in the claims.

Example 1: Preparation of Microarray Microfluidic Chip

(7) Chip preparation: The microfluidic channel template was fabricated by the combination of lithography mask and chemical etching, and was reserved for the subsequent PDMS channel preparation. The PDMS pre-polymer and the curing agent are mixed at a mass ratio of 10:1. After vacuuming, it was poured onto a microfluidic channel template to obtain a PDMS microfluidic channel. A spotting instrument was used to prepare a 5 mg/mL of lactoferrin and a negative protein microarray on a glass substrate. PDMS and the spotted glass substrate are simultaneously plasma treated, and then closely adhered together as a screening chip for the next round of screening.

Example 2: PCR Amplification

(8) The eluted solution on the chip was divided into 6 equal volumes of 23 μL, each of which was sequentially added with 25 μL of 2×Taq polymerase, 1 μL of 20 μM TAMRA-labeled forward primer and 1 μL of 20 μM biotinylated backward primers for PCR amplification. PCR thermal cycling is as follows: 94° C. for 5 min, cycling 94° C. for 30 s, 60.5° C. for 30 s, 72° C. for 30 s with 10 rounds. The reaction was stopped at 72° C. for 5 min. The product obtained in this step was diluted 10-fold and then amplified as a template. 5 μL of the diluted PCR product, 1 μL of 2×SYBR Premix Ex Taq™ enzyme, 1 μL of 20 μM TAMRA labeled before Primer, 1 μL of 20 μM biotinylated backward primer and 18 μL of ultrapure water were mixed well. 10 μL of sample in every round was taken for fluorescence in microplate by BioTek. The round number with highest fluorescence signal was selected to amplify the remaining products.

Example 3: Screening of Lactoferrin Aptamers

(9) The specific steps of screening the lactoferrin aptamer include detailed processes such as chip preparation, positive and negative screening process, and PCR amplification, as described below, wherein:

(10) TABLE-US-00001 Library: (SEQ ID NO: 66) 5′-TAMRA-GACAGGCAGGACACCGTAAC-N40- CTGCTACCTCCCTCCTCTTC-3′ TARMA modified forward primer: (SEQ ID NO: 3) 5′-TARMA-GACAGGCAGGACACCGTAAC-3′ Biotinylated backward primer: (SEQ ID NO: 4) 5′Biotin-GAAGAGGAGGGAGGTAGCAG-3′

(11) (1) Chip preparation: The microfluidic channel template was fabricated by the combination of lithography mask and chemical etching, and was reserved for the subsequent PDMS channel preparation.

(12) The PDMS prepolymer and the curing agent are mixed at a mass ratio of 10:1. After vacuuming, it was poured onto a microfluidic channel template to obtain a PDMS microfluidic channel. A spotting instrument was used to prepare a 5 mg/mL of lactoferrin and a negative protein microarray on a glass substrate. PDMS and the spotted glass substrate are simultaneously plasma treated, and then closely adhered together as a screening chip for the next round of screening.

(13) (2) Screening preparation: The screening chip obtained in step (1) was placed in a constant temperature water bath for incubation for 2 h at 37° C. Then 20 mg/ml of BSA and 0.01 mM of random sequence short-chain ssDNA (20 nt) were introduced and incubated at 37° C. for 1 h. Then, 150 μL of 1×PBST solution was used to clean the positive and negative screen channels.

(14) (3) First round of screening: 0.5 nmol, 125 μL of the original library was heated at 95° C. for 5 min, and immediately frozen on ice for 10 s. Then the syringe was used to deliver the library into the positive channel at a flow rate of 2.5 μL/min. The reaction was carried out at room temperature for 50 min. Then 150 μL of 1×PBS buffer solution was passed at a flow rate of 15 μL/min to remove the unbound ssDNA sequence in the positive channel. The PDMS layer was gently torn off and Luxscan-10K/A microarray scanner is used to scan the chip. Finally, the lactoferrin-bound ssDNA sequence is eluted with DPEC water at 95° C. for 5 min, and the resulting solution is dried to a volume of 69 μL under high purity nitrogen at 50° C.

(15) (4) PCR amplification process: the solution obtained in step (3) is divided into 3 parts of the same solution with a volume of 23 μL. Each step is added with 25 μL of 2×Taq polymerase, 1 μL of 20 μM TAMRA labeled forward primers and 1 μL of 20 μM biotinylated backward primers and the mixture were PCR-amplified. PCR thermal cycling is as follows: 94° C. for 5 min, cycling 94° C. for 30 s, 60.5° C. for 30 s, 72° C. 30 s for 10 rounds and terminated at 72° C. for 5 min. The product obtained in this step is diluted 10 times and then amplified as a template: 5 μL of the diluted PCR product and 1 μL of 2×SYBR Premix Ex Taq™ enzyme, 1 μL of 20 μM TAMRA-labeled forward primer, 1 μL of 20 μM biotinylated backward primer and 18 μL DPEC water were mixed well. 10 μL of sample in every round was taken for fluorescence in microplate by BioTek. The round number with highest fluorescence signal was selected to amplify the remaining products.

(16) (5) Separation and purification: Mix the PCR product obtained in step (4) with 600 μL of Promega beads, shake the plate for 1 h and remove the supernatant. Then 25 μL of 50 mM NaOH is added to vortex for 5 min. The double strands attached to the magnetic beads were dissociated, the supernatant was aspirated and sequentially added with 12.5 μL of 100 mM HCl, 25 μL of H.sub.2O, 62.5 μL of 2×PBSM, and the resulting solution was used as a secondary library for the next round of screening. The content is about 40 pmol.

(17) (6) The second round of screening: The library was pumped into the negative channel at a flow rate of 2.5 μL/min, and reacted at room temperature for 50 min. Then the pump was used to input the library into the positive channel at a flow rate of 2.5 μL/min. The reaction was carried out at room temperature for 50 min. Then 150 μL of 1×PBS buffer solution is passed at a flow rate of 15 μL/min to remove unreacted chains in the positive channel. The PDMS layer is gently torn off and Luxscan-10K/A microarray scanner is used to scan the chip. Finally, the protein-bound chain was eluted by heating with non-nuclear water at 95° C. for 5 min, and the resulting solution was dried at 60° C. to a volume of 92 μL, which was left for PCR amplification;

(18) (7) Repeat steps (4), (5), (6) to the eighth round of screening;

(19) (8) The fifth, sixth and seventh rounds of PCR amplification products are sent to Shanghai Biotech for sequencing. 120 rounds of sequencing are randomly selected in each round, and the obtained chains are analyzed by IDT software for secondary structure analysis. The optimal aptamers are obtained.

Example 4: Screening of Lactoferrin Aptamers

(20) The specific steps of screening the lactoferrin aptamer include detailed processes such as chip preparation, positive and negative screening process, and micro PCR amplification, as described below, wherein:

(21) TABLE-US-00002 Library: (SEQ ID NO: 66) 5′-TAMRA-GACAGGCAGGACACCGTAAC-N40- CTGCTACCTCCCTCCTCTTC-3′ TARMA modified forward primer: (SEQ ID NO: 3) 5′-TARMA-GACAGGCAGGACACCGTAAC-3′ Biotinylated backward primer: (SEQ ID NO: 4) 5′Biotin-GAAGAGGAGGGAGGTAGCAG-3′

(22) (1) Chip preparation: The microfluidic channel template was fabricated by the combination of lithography mask and chemical etching, and was reserved for the subsequent PDMS channel preparation. The PDMS prepolymer and the curing agent are mixed at a mass ratio of 10:1. After vacuuming, it was poured onto a microfluidic channel template to obtain a PDMS microfluidic channel. A spotting instrument was used to prepare a 2.5 mg/mL of lactoferrin and a negative protein microarray on a glass substrate. PDMS and the spotted glass substrate are simultaneously plasma treated, and then closely adhered together as a screening chip for the next round of screening.

(23) (2) Screening preparation: The screening chip obtained in step (1) was placed in a constant temperature water bath for incubation for 3 h at 37° C. Then 20 mg/ml of BSA and 0.01 mM of random sequence short-chain ssDNA (20 nt) were introduced and incubated at 37° C. for 2 h. Then, 150 μL of 1×PBST solution was used to clean the positive and negative screen channels.

(24) (3) First round of screening: 1 nmol, 125 μL of the original library was heated at 95° C. for 5 min, and immediately frozen on ice for 10 s. Then the syringe was used to deliver the library into the positive channel at a flow rate of 2.5 μL/min. The reaction was carried out at room temperature for 50 min. Then 150 μL of 1×PBS buffer solution was passed at a flow rate of 15 μL/min to remove the unbound ssDNA sequence in the positive channel. The PDMS layer was gently torn off and Luxscan-10K/A microarray scanner is used to scan the chip. Finally, the lactoferrin-bound ssDNA sequence is eluted with DPEC water at 95° C. for 5 min, and the resulting solution is dried to a volume of 92 μL under high purity nitrogen at 50° C.

(25) (4) PCR amplification process: the solution obtained in step (3) is divided into 4 parts of the same solution with a volume of 23 μL. Each step is added with 25 μL of 2×Taq polymerase, 1 μL of 20 μM TAMRA labeled forward primers and 1 μL of 20 μM biotinylated backward primers and the mixture were PCR-amplified. PCR thermal cycling is as follows: 94° C. for 5 min, cycling 94° C. for 30 s, 60.5° C. for 30 s, 72° C. 30 s for 10 rounds and terminated at 72° C. for 5 min. The product obtained in this step is diluted 10 times and then amplified as a template: 5 μL of the diluted PCR product and 1 μL of 2×SYBR Premix Ex Taq™ enzyme, 1 μL of 20 μM TAMRA-labeled forward primer, 1 μL of 20 μM biotinylated backward primer and 18 μL DPEC water were mixed well. 10 μL of sample in every round was taken for fluorescence in microplate by BioTek. The round number with highest fluorescence signal was selected to amplify the remaining products.

(26) (5) Separation and purification: Mix the PCR product obtained in step (4) with 800 μL of Promega beads, shake the plate for 1 h and remove the supernatant. Then 25 μL of 1 M NaOH is added to vortex for 5 min. The double strands attached to the magnetic beads were dissociated, the supernatant was aspirated and sequentially added with 12.5 μL of 2 M HCl, 25 μL of H.sub.2O, 62.5 μL of 2×PBSM, and the resulting solution was used as a secondary library for the next round of screening. The content is about 90 pmol.

(27) (6) The second round of screening: The library was pumped into the negative channel at a flow rate of 2.5 μL/min, and reacted at room temperature for 50 min. Then the pump was used to input the library into the positive channel at a flow rate of 2.5 μL/min. The reaction was carried out at room temperature for 50 min. Then 150 μL of 1×PBS buffer solution is passed at a flow rate of 15 μL/min to remove unreacted chains in the positive channel. The PDMS layer is gently torn off and Luxscan-10K/A microarray scanner is used to scan the chip. Finally, the protein-bound chain was eluted by heating with non-nuclear water at 95° C. for 5 min, and the resulting solution was dried at 60° C. to a volume of 92 μL, which was left for PCR amplification;

(28) (7) Repeat steps (4), (5), (6) to the eighth round of screening;

(29) (8) The fifth, sixth and seventh rounds of PCR amplification products are sent to Shanghai Biotech for sequencing. 120 rounds of sequencing are randomly selected in each round, and the obtained chains are analyzed by IDT software for secondary structure analysis. The optimal aptamers are obtained.

Example 5: Screening of Lactoferrin Aptamers

(30) The specific steps of screening the lactoferrin aptamer include detailed processes such as chip preparation, positive and negative screening process, and micro PCR amplification, as described below, wherein:

(31) TABLE-US-00003 Library: (SEQ ID NO: 66) 5′-TAMRA-GACAGGCAGGACACCGTAAC-N40- CTGCTACCTCCCTCCTCTTC-3′ TARMA modified forward primer: (SEQ ID NO: 3) 5′-TARMA-GACAGGCAGGACACCGTAAC-3′ Biotinylated backward primer: (SEQ ID NO: 4) 5′Biotin-GAAGAGGAGGGAGGTAGCAG-3′

(32) (1) Chip preparation: The microfluidic channel template was fabricated by the combination of lithography mask and chemical etching, and was reserved for the subsequent PDMS channel preparation. The PDMS pre-polymer and the curing agent are mixed at a mass ratio of 10:1. After vacuuming, it was poured onto a microfluidic channel template to obtain a PDMS microfluidic channel. A spotting instrument was used to prepare a 5 mg/mL of lactoferrin and a negative protein microarray on a glass substrate. PDMS and the spotted glass substrate are simultaneously plasma treated, and then closely adhered together as a screening chip for the next round of screening.

(33) (2) Screening preparation: The screening chip obtained in step (1) was placed in a constant temperature water bath for incubation for 2 h at 37° C. Then 20 mg/ml of BSA and 0.01 mM of random sequence short-chain ssDNA (20 nt) were introduced and incubated at 37° C. for 1 h. Then, 150 μL of 1×PBST solution was used to clean the positive and negative screen channels.

(34) (3) First round of screening: 1 nmol, 125 μL of the original library was heated at 95° C. for 5 min, and immediately frozen on ice for 10 s. Then the syringe was used to deliver the library into the positive channel at a flow rate of 5 μL/min. The reaction was carried out at room temperature for 50 min. Then 150 μL of 1×PBS buffer solution was passed at a flow rate of 30 μL/min to remove the unbound ssDNA sequence in the positive channel. The PDMS layer was gently torn off and Luxscan.sup.˜10K/A microarray scanner is used to scan the chip. Finally, the lactoferrin-bound ssDNA sequence is eluted with DPEC water at 95° C. for 5 min, and the resulting solution is dried to a volume of 92 μL under high purity nitrogen at 50° C.

(35) (4) PCR amplification process: the solution obtained in step (3) is divided into 4 parts of the same solution with a volume of 23 μL. Each step is added with 25 μL of 2×Taq polymerase, 1 μL of 20 μM TAMRA labeled forward primers and 1 μL of 20 μM biotinylated backward primers and the mixture were PCR-amplified. PCR thermal cycling is as follows: 94° C. for 5 min, cycling 94° C. for 30 s, 60.5° C. for 30 s, 72° C. 30 s for 10 rounds and terminated at 72° C. for 5 min. The product obtained in this step is diluted 10 times and then amplified as a template: 5 μL of the diluted PCR product and 1 μL of 2×SYBR Premix Ex Taq™ enzyme, 1 μL of 20 μM TAMRA-labeled forward primer, 1 μL of 20 μM biotinylated backward primer and 18 μL DPEC water were mixed well. 10 μL of sample in every round was taken for fluorescence in microplate by BioTek. The round number with highest fluorescence signal was selected to amplify the remaining products.

(36) (5) Separation and purification: Mix the PCR product obtained in step (4) with 800 μL of Promega beads, shake the plate for 1 h and remove the supernatant. Then 25 μL of 50 mM NaOH is added to vortex for 5 min. The double strands attached to the magnetic beads were dissociated, the supernatant was aspirated and sequentially added with 12.5 μL of 100 mM HCl, 25 μL of H.sub.2O, 62.5 μL of 2×PBSM, and the resulting solution was used as a secondary library for the next round of screening. The content is about 60 pmol.

(37) (6) The second round of screening: The library was pumped into the negative channel at a flow rate of 5 μL/min, and reacted at room temperature for 50 min. Then the pump was used to input the library into the positive channel at a flow rate of 5 μL/min. The reaction was carried out at room temperature for 50 min. Then 150 μL of 1×PBS buffer solution is passed at a flow rate of 30 μL/min to remove unreacted chains in the positive channel. The PDMS layer is gently torn off and Luxscan-10K/A microarray scanner is used to scan the chip. Finally, the protein-bound chain was eluted by heating with non-nuclear water at 95° C. for 5 min, and the resulting solution was dried at 60° C. to a volume of 92 μL, which was left for PCR amplification;

(38) (7) Repeat steps (4), (5), (6) to the eighth round of screening;

(39) (8) The fifth, sixth and seventh rounds of PCR amplification products are sent to Shanghai Biotech for sequencing. 120 rounds of sequencing are randomly selected in each round, and the obtained chains are analyzed by IDT software for secondary structure analysis. The optimal aptamers are obtained.

Example 6: Screening of Lactoferrin Aptamers

(40) The specific steps of screening the lactoferrin aptamer include detailed processes such as chip preparation, positive and negative screening process, and micro PCR amplification, as described below, wherein:

(41) TABLE-US-00004 Library: (SEQ ID NO: 66) 5′-TAMRA-GACAGGCAGGACACCGTAAC-N40- CTGCTACCTCCCTCCTCTTC-3′ TARMA modified forward primer: (SEQ ID NO: 3) 5′-TARMA-GACAGGCAGGACACCGTAAC-3′ Biotinylated backward primer: (SEQ ID NO: 4) 5′Biotin-GAAGAGGAGGGAGGTAGCAG-3′

(42) (1) Chip preparation: The microfluidic channel template was fabricated by the combination of lithography mask and chemical etching, and was reserved for the subsequent PDMS channel preparation. The PDMS prepolymer and the curing agent are mixed at a mass ratio of 10:1. After vacuuming, it was poured onto a microfluidic channel template to obtain a PDMS microfluidic channel. A spotting instrument was used to prepare a 5 mg/mL of lactoferrin and a negative protein microarray on a glass substrate. PDMS and the spotted glass substrate are simultaneously plasma treated, and then closely adhered together as a screening chip for the next round of screening.

(43) (2) Screening preparation: The screening chip obtained in step (1) was placed in a constant temperature water bath for incubation for 2 h at 37° C. Then 20 mg/ml of BSA and 0.01 mM of random sequence short-chain ssDNA (20 nt) were introduced and incubated at 37° C. for 1 h. Then, 150 μL of 1×PBST solution was used to clean the positive and negative screen channels.

(44) (3) First round of screening: 1 nmol, 125 μL of the original library was heated at 95° C. for 5 min, and immediately frozen on ice for 10 s. Then the syringe was used to deliver the library into the positive channel at a flow rate of 2.5 μL/min. The reaction was carried out at room temperature for 50 min. Then 150 μL of 1×PBS buffer solution was passed at a flow rate of 15 μL/min to remove the unbound ssDNA sequence in the positive channel. The PDMS layer was gently torn off and Luxscan-10K/A microarray scanner is used to scan the chip. Finally, the lactoferrin-bound ssDNA sequence is eluted with DPEC water at 95° C. for 5 min, and the resulting solution is dried to a volume of 92 μL under high purity nitrogen at 50° C.

(45) (4) PCR amplification process: the solution obtained in step (3) is divided into 4 parts of the same solution with a volume of 23 μL. Each step is added with 25 μL of 2×Taq polymerase, 1 μL of 20 μM TAM RA labeled forward primers and 1 μL of 20 μM biotinylated backward primers and the mixture were PCR-amplified. PCR thermal cycling is as follows: 94° C. for 5 min, cycling 94° C. for 30 s, 60.5° C. for 30 s, 72° C. 30 s for 10 rounds and terminated at 72° C. for 5 min. The product obtained in this step is diluted 10 times and then amplified as a template: 5 μL of the diluted PCR product and 1 μL of 2×SYBR Premix Ex Taq™ enzyme, 1 μL of 20 μM TAMRA-labeled forward primer, 1 μL of 20 μM biotinylated backward primer and 18 μL DPEC water were mixed well. 10 μL of sample in every round was taken for fluorescence in microplate by BioTek. The round number with highest fluorescence signal was selected to amplify the remaining products.

(46) (5) Separation and purification: Mix the PCR product obtained in step (4) with 800 μL of Promega beads, shake the plate for 1 h and remove the supernatant. Then 25 μL of 50 mM NaOH is added to vortex for 5 min. The double strands attached to the magnetic beads were dissociated, the supernatant was aspirated and sequentially added with 12.5 μL of 100 mM HCl, 25 μL of H.sub.2O, 62.5 μL of 2×PBSM, and the resulting solution was used as a secondary library for the next round of screening. The content is about 60 pmol.

(47) (6) The second round of screening: The library was pumped into the negative channel at a flow rate of 5 μL/min, and reacted at room temperature for 50 min. Then the pump was used to input the library into the positive channel at a flow rate of 5 μL/min. The reaction was carried out at room temperature for 50 min. Then 150 μL of 1×PBS buffer solution is passed at a flow rate of 30 μL/min to remove unreacted chains in the positive channel. The PDMS layer is gently torn off and Luxscan-10K/A microarray scanner is used to scan the chip. Finally, the protein-bound chain was eluted by heating with non-nuclear water at 95° C. for 5 min, and the resulting solution was dried at 60° C. to a volume of 92 μL, which was left for PCR amplification;

(48) (7) Repeat steps (4), (5), (6) to the eighth round of screening;

(49) (8) The fifth, sixth and seventh rounds of PCR amplification products are sent to Shanghai Biotech for sequencing. 120 rounds of sequencing are randomly selected in each round, and the obtained chains are analyzed by IDT software for secondary structure analysis. The optimal aptamers are obtained. The sequence of the resulting test aptamer is shown in SEQ ID NO. 5 to SEQ ID NO. 65.

Example 7: Detection of Lactoferrin Standard Samples by Fluorescence Polarization

(50) (1) 100 μL of 25 μg/mL lactoferrin standard sample is mixed with 10 μL of 250 nM FITC (fluorescein isothiocyanate)-labeled aptamer N2 (base sequence: AGGCAGGACACCGTAACCGGTGCATCTATGGCTACTAGCTTTTCCTGCCT) (SEQ ID NO: 06).

(51) (2) The mixture of step (1) is placed in a 96-well plate at 37° C. for 15 min, and directly scanned with a BioTeK microplate reader. The excitation wavelength is 480 nm and the emission wavelength is 528 nm.

Example 8: Method for Detecting Lactoferrin Content

(52) (1) 25-100 fold diluted milk sample is mixed with 10 μL of 250 nM FITC solution (fluorescein isothiocyanate)-labeled aptamer N2 (base sequence: AGGCAGGACACCGTAACCGGTGCATCTATGGCTACTAGCTTTTCCTGCCT) (SEQ ID NO: 06).

(53) (2) The mixture of the step (1) is placed in a 96-well plate at 37° C. for 15 min, and directly scanned with a BioTeK microplate reader with an excitation wavelength of 480 nm and an emission wavelength of 528 nm.

(54) (3) Compare the standard curve to obtain the concentration of lactoferrin in the milk sample.

Example 9: Method for Detecting Lactoferrin Content

(55) (1) 25-100 fold diluted milk sample is mixed with 10 μL of 250 nM FITC solution (fluorescein isothiocyanate)-labeled aptamer N6 (base sequence: gcaggacacc gtaactcggg caaagctctg aataatgttc aaccaatatt ctgtcctgc) (SEQ ID NO: 10), and mix well.

(56) (2) The mixture of the step (1) is placed in a 96-well plate at 37° C. for 15 min, and directly scanned with a BioTeK microplate reader with an excitation wavelength of 480 nm and an emission wavelength of 528 nm.

(57) (3) Compare the standard curve to obtain the concentration of lactoferrin in the milk sample, as shown in FIG. 5(a).

Example 10: Method for Detecting Lactoferrin Content

(58) (1) 25-100 fold diluted milk sample is mixed with 10 μL of 250 nM FITC solution (fluorescein isothiocyanate)-labeled aptamer N14 (base sequence: gcaggacacc gtaacactgc tttatccccg tcggcttggc tcttcgacag tgtggctgc) (SEQ ID NO: 18), and mix well.

(59) (2) The mixture of the step (1) is placed in a 96-well plate at 37° C. for 15 min, and directly scanned with a BioTeK microplate reader with an excitation wavelength of 480 nm and an emission wavelength of 528 nm.

(60) (3) Compare the standard curve to obtain the concentration of lactoferrin in the milk sample, as shown in FIG. 5(b).

Example 11: Method for Detecting Lactoferrin Content

(61) (1) 25-100 fold diluted milk sample is mixed with 10 μL of 250 nM FITC solution (fluorescein isothiocyanate)-labeled aptamer N16 (base sequence: ggcaggacac cgtaacccct agttcctggt gcatttatgg caaagctttt cctgcc) (SEQ ID NO: 20), and mix well.

(62) (2) The mixture of the step (1) is placed in a 96-well plate at 37° C. for 15 min, and directly scanned with a BioTeK microplate reader with an excitation wavelength of 480 nm and an emission wavelength of 528 nm.

(63) (3) Compare the standard curve to obtain the concentration of lactoferrin in the milk sample, as shown in FIG. 5(c).

Example 12: Method for Detecting Lactoferrin Content

(64) (1) 25-100 fold diluted milk sample is mixed with 10 μL of 250 nM FITC solution (fluorescein isothiocyanate)-labeled aptamer N31 (ggcaggacac cgtaaccagt ataggtgcat ttttggcgca agctcttcct gccctg) (SEQ ID NO: 35), and mix well.

(65) (2) The mixture of the step (1) is placed in a 96-well plate at 37° C. for 15 min, and directly scanned with a BioTeK microplate reader with an excitation wavelength of 480 nm and an emission wavelength of 528 nm.

(66) (3) Compare the standard curve to obtain the concentration of lactoferrin in the milk sample, as shown in FIG. 5(d).

Example 13: Screening of α-Lactalbumin Aptamers

(67) The specific steps of the α-lactalbumin aptamer screening include detailed processes such as chip preparation, positive and negative screening process, and PCR amplification, as described below, wherein:

(68) TABLE-US-00005 Library: (SEQ ID NO: 66) 5′-TAMRA-GACAGGCAGGACACCGTAAC-N40- CTGCTACCTCCCTCCTCTTC-3′ TARMA modified forward primer: (SEQ ID NO: 3) 5′-TARMA-GACAGGCAGGACACCGTAAC-3′ Biotinylated backward primer: (SEQ ID NO: 4) 5′Biotin-GAAGAGGAGGGAGGTAGCAG-3′

(69) (1) Chip preparation: The microfluidic channel template was fabricated by the combination of lithography mask and chemical etching, and was reserved for the subsequent PDMS channel preparation. The PDMS prepolymer and the curing agent are mixed at a mass ratio of 10:1. After vacuuming, it was poured onto a microfluidic channel template to obtain a PDMS microfluidic channel. A spotting instrument was used to prepare a 5 mg/mL of lactoferrin and a negative protein microarray on a glass substrate. PDMS and the spotted glass substrate are simultaneously plasma treated, and then closely adhered together as a screening chip for the next round of screening.

(70) (2) Screening preparation: The screening chip obtained in step (1) was placed in a constant temperature water bath for incubation for 2 h at 37° C. Then 20 mg/ml of BSA and 0.01 mM of random sequence short-chain ssDNA (20 nt) were introduced and incubated at 37° C. for 1 h. Then, 150 μL of 1×PBST solution was used to clean the positive and negative screen channels.

(71) (3) First round of screening: 0.5 nmol, 125 μL of the original library was heated at 95° C. for 5 min, and immediately frozen on ice for 10 s. Then the syringe was used to deliver the library into the positive channel at a flow rate of 2.5 μL/min. The reaction was carried out at room temperature for 50 min. Then 150 μL of 1×PBS buffer solution was passed at a flow rate of 15 μL/min to remove the unbound ssDNA sequence in the positive channel. The PDMS layer was gently torn off and Luxscan-10K/A microarray scanner is used to scan the chip. Finally, the α-lactalbumin-bound ssDNA sequence is eluted with DPEC water at 95° C. for 5 min, and the resulting solution is dried to a volume of 92 μL under high purity nitrogen at 50° C.

(72) (4) PCR amplification process: the solution obtained in step (3) is divided into 4 parts of the same solution with a volume of 23 μL. Each step is added with 25 μL of 2×Taq polymerase, 1 μL of 20 μM TAMRA labeled forward primers and 1 μL of 20 μM biotinylated backward primers and the mixture were PCR-amplified. PCR thermal cycling is as follows: 94° C. for 5 min, cycling 94° C. for 30 s, 60.5° C. for 30 s, 72° C. 30 s for 10 rounds and terminated at 72° C. for 5 min. The product obtained in this step is diluted 10 times and then amplified as a template: 5 μL of the diluted PCR product and 1 μL of 2×SYBR Premix Ex Taq™ enzyme, 1 μL of 20 μM TAMRA-labeled forward primer, 1 μL of 20 μM biotinylated backward primer and 18 μL DPEC water were mixed well. 10 μL of sample in every round was taken for fluorescence in microplate by BioTek. The round number with highest fluorescence signal was selected to amplify the remaining products.

(73) (5) Separation and purification: Mix the PCR product obtained in step (4) with 800 μL of Promega beads, shake the plate for 1 h and remove the supernatant. Then 25 μL of 50 mM NaOH is added to vortex for 5 min. The double strands attached to the magnetic beads were dissociated, the supernatant was aspirated and sequentially added with 12.5 μL of 100 mM HCl, 25 μL of H.sub.2O, 62.5 μL of 2×PBSM, and the resulting solution was used as a secondary library for the next round of screening. The content is about 40 pmol.

(74) (6) The second round of screening: The library was pumped into the negative channel at a flow rate of 2.5 μL/min, and reacted at room temperature for 50 min. Then the pump was used to input the library into the positive channel at a flow rate of 2.5 μL/min. The reaction was carried out at room temperature for 50 min. Then 150 μL of 1×PBS buffer solution is passed at a flow rate of 15 μL/min to remove unreacted chains in the positive channel. The PDMS layer is gently torn off and Luxscan-10K/A microarray scanner is used to scan the chip. Finally, the protein-bound chain was eluted by heating with non-nuclear water at 95° C. for 5 min, and the resulting solution was dried at 60° C. to a volume of 92 μL, which was left for PCR amplification;

(75) (7) Repeat steps (4), (5), (6) to the eighth round of screening;

(76) (8) The fifth, sixth and seventh rounds of PCR amplification products are sent to Shanghai Biotech for sequencing. 120 rounds of sequencing are randomly selected in each round, and the obtained chains are analyzed by IDT software for secondary structure analysis. The optimal aptamers are obtained.

Example 14: Screening of β-Lactoglobulin Aptamers

(77) The specific steps of the β-lactoglobulin aptamer screening include detailed processes such as chip preparation, positive and negative screening process, and PCR amplification, as described below, wherein:

(78) TABLE-US-00006 Library: (SEQ ID NO: 66) 5′-TAMRA-GACAGGCAGGACACCGTAAC-N40- CTGCTACCTCCCTCCTCTTC-3′ TARMA modified forward primer: (SEQ ID NO: 3) 5′-TARMA-GACAGGCAGGACACCGTAAC-3′ Biotinylated backward primer: (SEQ ID NO: 4) 5′Biotin-GAAGAGGAGGGAGGTAGCAG-3′

(79) (1) Chip preparation: The microfluidic channel template was fabricated by the combination of lithography mask and chemical etching, and was reserved for the subsequent PDMS channel preparation. The PDMS prepolymer and the curing agent are mixed at a mass ratio of 10:1. After vacuuming, it was poured onto a microfluidic channel template to obtain a PDMS microfluidic channel. A spotting instrument was used to prepare a 5 mg/mL of β-lactoglobulin and a negative protein microarray on a glass substrate. PDMS and the spotted glass substrate are simultaneously plasma treated, and then closely adhered together as a screening chip for the next round of screening.

(80) (2) Screening preparation: The screening chip obtained in step (1) was placed in a constant temperature water bath for incubation for 2 h at 37° C. Then 20 mg/ml of BSA and 0.01 mM of random sequence short-chain ssDNA (20 nt) were introduced and incubated at 37° C. for 1 h. Then, 150 μL of 1×PBST solution was used to clean the positive and negative screen channels.

(81) (3) First round of screening: 0.5 nmol, 125 μL of the original library was heated at 95° C. for 5 min, and immediately frozen on ice for 10 s. Then the syringe was used to deliver the library into the positive channel at a flow rate of 2.5 μL/min. The reaction was carried out at room temperature for 50 min. Then 150 μL of 1×PBS buffer solution was passed at a flow rate of 15 μL/min to remove the unbound ssDNA sequence in the positive channel. The PDMS layer was gently torn off and Luxscan-10K/A microarray scanner is used to scan the chip. Finally, the β-lactoglobulin-bound ssDNA sequence is eluted with DPEC water at 95° C. for 5 min, and the resulting solution is dried to a volume of 92 μL under high purity nitrogen at 50° C.

(82) (4) PCR amplification process: the solution obtained in step (3) is divided into 4 parts of the same solution with a volume of 23 μL. Each step is added with 25 μL of 2×Taq polymerase, 1 μL of 20 μM TAMRA labeled forward primers and 1 μL of 20 μM biotinylated backward primers and the mixture were PCR-amplified. PCR thermal cycling is as follows: 94° C. for 5 min, cycling 94° C. for 30 s, 60.5° C. for 30 s, 72° C. 30 s for 10 rounds and terminated at 72° C. for 5 min. The product obtained in this step is diluted 10 times and then amplified as a template: 5 μL of the diluted PCR product and 1 μL of 2×SYBR Premix Ex Taq™ enzyme, 1 μL of 20 μM TAMRA-labeled forward primer, 1 μL of 20 μM biotinylated backward primer and 18 μL DPEC water were mixed well. 10 μL of sample in every round was taken for fluorescence in microplate by BioTek. The round number with highest fluorescence signal was selected to amplify the remaining products.

(83) (5) Separation and purification: Mix the PCR product obtained in step (4) with 800 μL of Promega beads, shake the plate for 1 h and remove the supernatant. Then 25 μL of 50 mM NaOH is added to vortex for 5 min. The double strands attached to the magnetic beads were dissociated, the supernatant was aspirated and sequentially added with 12.5 μL of 100 mM HCl, 25 μL of H.sub.2O, 62.5 μL of 2×PBSM, and the resulting solution was used as a secondary library for the next round of screening. The content is about 40 pmol.

(84) (6) The second round of screening: The library was pumped into the negative channel at a flow rate of 2.5 μL/min, and reacted at room temperature for 50 min. Then the pump was used to input the library into the positive channel at a flow rate of 2.5 μL/min. The reaction was carried out at room temperature for 50 min. Then 150 μL of 1×PBS buffer solution is passed at a flow rate of 15 μL/min to remove unreacted chains in the positive channel. The PDMS layer is gently torn off and Luxscan-10K/A microarray scanner is used to scan the chip. Finally, the protein-bound chain was eluted by heating with non-nuclear water at 95° C. for 5 min, and the resulting solution was dried at 60° C. to a volume of 92 μL, which was left for PCR amplification;

(85) (7) Repeat steps (4), (5), (6) to the eighth round of screening;

(86) (8) The fifth, sixth and seventh rounds of PCR amplification products are sent to Shanghai Biotech for sequencing. 120 rounds of sequencing are randomly selected in each round, and the obtained chains are analyzed by IDT software for secondary structure analysis. The optimal aptamers are obtained.