Transaminases and method, for deaminating amino compound, using same
11091744 · 2021-08-17
Assignee
Inventors
Cpc classification
C12P13/00
CHEMISTRY; METALLURGY
C12N15/70
CHEMISTRY; METALLURGY
International classification
C12N15/70
CHEMISTRY; METALLURGY
C12P13/00
CHEMISTRY; METALLURGY
Abstract
Provided are a novel separated polypeptide having transaminase activity, a polynucleotide encoding the polypeptide, a microorganism including the polynucleotide, and a method of deaminating an amino compound by using the polypeptide or the microorganism.
Claims
1. A microorganism transformed to express a polypeptide having transaminase activity for an amino compound, wherein the polypeptide has the amino acid sequence of SEQ ID NO: 7, 9, 11, 13, 15, or 17.
2. The microorganism of claim 1, wherein the microorganism belongs to the genus Escherichia.
3. The microorganism of claim 2, wherein the microorganism is Escherichia coli.
4. A method of deaminating an amino compound, the method comprising: adding the microorganism of claim 1 to a solution containing the amino compound.
5. The method of claim 4, wherein the amino compound is at least one selected from the group consisting of N-acetylornithine, gamma-aminobutyric acid, 5-aminovaleric acid, and 6-aminocaproic acid.
6. The method of claim 4, wherein the solution further contains pyridoxal phosphate, in addition to at least one selected from the group consisting of pyruvate, oxaloacetate, and alpha-ketoglutarate.
7. A method of producing an amino compound, the method comprising: adding the microorganism of claim 1 to a solution containing a semi-aldehyde compound.
8. The method of claim 7, wherein the semi-aldehyde compound is at least one selected from the group consisting of N-acetylglutamate 5-semialdehyde, succinate semialdehyde, glutarate semialdehyde, and adipate semialdehyde.
9. A composition for deaminating an amino compound, the composition comprising the microorganism of claim 1, wherein the amino compound is selected from the group consisting of N-acetylornithine, gamma-aminobutyric, 5-aminovaleric acid, and 6-aminocaproic acid.
Description
DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4) [T: cell lysate; S: soluble protein].
(5)
(6) [1: reaction between overexpressed pETDuet1 (empty vector) and 4-aminobutyric acid; 2: reaction between overexpressed polypeptide having transaminase activity of the present disclosure and 4-aminobutyric acid; 4: reaction between overexpressed pETDuet1 and 6-aminocaproic acid; 5: reaction between overexpressed polypeptide having transaminase activity of the present disclosure and 6-aminocaproic acid; 7: reaction between overexpressed pETDuet1 and N-acetylornithine; 8: reaction between overexpressed polypeptide having transaminase activity of the present disclosure and N-acetylornithine; and 10: glutamate (standard)].
(7)
(8) [C: reaction between overexpressed pETDuet1 and 6-aminocaproic acid; D: reaction between overexpressed polypeptide having transaminase activity of the present disclosure and 6-aminocaproic acid, and E: 10 mM glutamate (standard)].
(9)
(10)
(11)
(12)
(13)
(14)
(15)
BEST MODE
Mode of the Invention
(16) Hereinafter, one or more embodiments will be described in more detail with reference to the following examples. However, these examples are not intended to limit the scope of the present disclosure.
Example 1: Identification of a Microorganism Using 6-Aminocaproic Acid as a Nitrogen Source
(17) 1) Screening of a Microorganism Using 6-Aminocaproic Acid as a Nitrogen Source and Analysis of 16S rRNA
(18) 6-aminocaproic acid (6-ACA) was fixed as a nitrogen source, and a novel strain, P. stutzeri CJ-MKB, which can deaminate 6-ACA, was selected through a subculture. For the selection, a minimal medium in which a microorganism can be cultured was prepared with the composition of Table 1. Here, a nitrogen source for the strain culture was 6-ACA.
(19) TABLE-US-00001 TABLE 1 Medium composition Final concentration Na.sub.2HPO.sub.4•H.sub.2O 15.1 mM KH.sub.2PO.sub.4 22 mM NaCl 8.6 mM 6-aminocaproic acid 20 mM MgSO.sub.4 1 mM CaCl.sub.2 100 mM (NH.sub.4)6Mo.sub.7O.sub.24•H.sub.2O 3 nM H.sub.3BO.sub.3 400 nM CoCl.sub.2•H.sub.2O 30 nM CuSo.sub.4•H.sub.2O 10 nM MnCl.sub.2•H.sub.2O 80 nM ZnSO.sub.4•H.sub.2O 10 nM FeSO.sub.4•H.sub.2O 1 mM Glucose 11.1 mM
(20) In detail, a soil sample from the Gimpo Plant of CJ Cheiljedang Corp., located in Gayang-dong, Seoul, Korea, was cultured in a medium having the composition of Table 1 at a temperature of 37° C. and at a speed of 200 rpm. The cultured candidate strains were cultured again until an optical density thereof reached 0.5 under the conditions where the same medium was used at an initial inoculation optical density (OD600) of 0.05, at a temperature of 37° C., and at a speed of 200 rpm. Then, a microorganism cultured in the medium having the composition of Table 1 was selected through a subculture five times. The selected microorganism was primarily named ‘CJ-MKB’, and the following experiment was performed to confirm that the selected microorganism was a new microorganism.
(21) The CJ-MKB strains cultured in the liquid medium were streaked and spread over an M9 agar plate to obtain colonies. The colonies obtained therefrom were resistant to ampicillin at a concentration of 25 mg/ml. In addition, it was observed that a light-colored bio-film was formed around the colonies. Two colonies were selected and cultured again in the M9 liquid medium, and genomic DNA was extracted using a genomic DNA prep kit. To identify the obtained genome, 16S ribosomal RNA (16S rRNA) sequences were analyzed. Here, primers commonly used for analysis of the 16S rRNA sequences of the microorganism, such as 27F (AGA GTT TGA TCC TGG CTC AG; SEQ ID NO: 18) and 1492R (GGT TAC CTT GTT ACG ACT T; SEQ ID NO: 19), were used, and accordingly it was confirmed that the 16S rRNA of the CJ-MKB genome had a base sequence of SEQ ID NO: 1.
(22) The BLAST program provided by the National Center for Biotechnology Information (NCBI) was used to search for a strain having high nucleic acid homology with SEQ ID NO: 1 (http://blast.ncbi.nlm.nih.gov/Blast.cgi′CPROGRAM=blastn&PAGE_TYPE=BlastSear ch&LINK_LOC=blasthome). As a result, it was confirmed that the strain had the same sequence as 16S rRNA of each of P. stutzeri strain NBRIS11, gamma proteobacterium BP44-iso8, uncultured bacterium clone 9, Escherichia coli strain BM0446, and enterobacteriaceae bacterium BM005, respectively.
(23) Several microorganisms of the genus Pseudomonas are known to produce exopolysaccharide for the formation of a bio-film. In addition, the microorganisms of the genus Pseudomonas were also resistant to beta-lactam antibiotics, such as penicillin. In consideration of the sequence information of 16S rRNA of the CJ-MKB strain, the resistance to ampicillin, and the bio-film as shown during the culturing, the selected strain was highly expected to be a microorganism of the genus Pseudomonas. The single colony obtained on the M9 medium agar plate containing 25 mg/ml of ampicillin was cultured in an LB broth, and then centrifuged at a speed of 13,000 rpm for 1 minute, thereby obtaining a culture of the strain (
(24) 2) Sequence Analysis of Oxidoreductase
(25) To determine whether the selected strain was a microorganism of the genus Pseudomonas, it was analyzed whether the novel CJ-MKB strain had a base sequence of an oxidoreductase that is present in the genus Pseudomonas. Here, newly designed primers, such as NCPPB 5P (ATGAGCAAGACTAACGAATCCC, SEQ ID NO: 20) and NCPPB 3P (TCCAGAATGGCCAGCCCGCG, SEQ ID NO: 21), were used to perform the sequence analysis. As a result, it was confirmed that the selected strain had a base sequence of SEQ ID NO: 2.
(26) As a result of analysis using the BLAST problem of NCBI with respect to the base sequence of SEQ ID NO: 2, it was confirmed that the base sequence of SEQ ID NO: 2 has the same sequence as a molybdopterin-binding sequence of an oxidoreductase of the known P. stutzeri A1501 strain. In this regard, it was confirmed that selected novel CJ-MKB strain was a microorganism of the genus Pseudomonas.
(27) 3) Sequence Analysis of Transaminase
(28) Since the nucleotide sequence confirmed to have homology is a short sequence of 714 bases, the subgrouping of the microorganism could not be classified correctly. In this regard, additional protein nucleic acid sequences were analyzed to confirm the subgrouping. When the microorganism used 6-ACA as a nitrogen source, N-ACETYLORNITHINE transaminase or 4-aminobutyrate transaminase, among transaminases, is specifically expected to be involved in an enzyme conversion reaction. Accordingly, the base sequence of the protein having the two enzymatic activities was confirmed.
(29) In detail, for comparative analysis of the base sequences for N-acetylornithine transaminase that are present in the genomes of P. stutzeri A1501 and the selected CJ-MKB strain, argD_F2 (5′ primer: ATTTAAGGATCCGTCCGCCCCGCACACCCCGG, SEQ ID NO: 22) and argD_R2 (3′ primer: ATTTAAGAGCTCTCAGGCCTGGGTCAGCGTC, SEQ ID NO: 23) were used to analyze the nucleic acid sequences by PCR. As a result, it was confirmed that the N-acetylornithine transaminase of P. stutzeri A1501 and the N-acetylornithine transaminase of the new microorganism had the base sequences of SEQ ID NO: 3 and SEQ ID NO: 4, respectively.
(30) In the same manner, for comparative analysis of the base sequences for 4-aminobutyrate transaminase of P. stutzeri A1501 and the selected strain, gabT_F (5′ primer: ATTTAACATATGCAACGCCGTGTCGCCGCCGTTCC, SEQ ID NO: 24) and gabT_R (3′ primer: ATTTAAGAATTCTCAGGTCAGCTCGTCGAAACACT, SEQ ID NO: 25) were used to perform PCR. As a result, it was confirmed that P. stutzeri A1501 and the selected strain had the base sequences of SEQ ID NO: 5 and SEQ ID NO: 6, respectively.
(31) For comparative analysis of the base sequences for N-acetylornithine transaminase of P. stutzeri A1501 and the selected strain, multiple sequence alignment was used. As a result, it was confirmed that 13 nucleic acids out of 1,221 nucleic acid sequences were different (nucleic acid homology: 98.9353%). In addition, in the same manner as the above, the results of comparative analysis of the nucleic acid sequences of 4-aminobutyrate transaminase of P. stutzeri A1501 and the selected strain confirmed that 21 nucleic acids out of 1,257 nucleic acid sequences were different (nucleic acid homology: 98.3294%).
(32) In conclusion, it was confirmed that the selected P. stutzeri CJ-MKB strain had the highest homology with P. stutzeri A1501 among the known microorganism genomic sequences to date, and thus, it is a novel strain. Accordingly, the selected strain was deposited on Oct. 22, 2014 in the Korean Culture Center of Microorganisms, and was given accession number KCCM11587P.
Example 2: Identification of Deamination Reactivity of P. stutzeri CJ-MKB
(33) P. stutzeri CJ-MKB was subjected to an evaluation of deamination reactivity of 5-aminovaleric acid and 6-aminocaproic acid. Since a transaminase reaction is a substitution reaction between an amine group and a ketone group, the substrates and the products were easily identified through a color reaction in which the reaction products that were subjected to material separation using thin layer chromatography (TLC) were able to be easily identified by color reaction of an amine group of ninhydrin. To confirm transaminase activity of P. stutzeri CJ-MKB, a whole cell reaction was performed. When P. stutzeri CJ-MKB was cultured and the optical density of the culture reached 0.7, the culture was sub-cultured on a new M9 medium. Here, 6-aminocaproic acid and 5-aminovaleric acid were fixed as a nitrogen source, and then cultured. Alpha-ketoglutarate and pyridoxal phosphate that are required for the medium were added to the culture, and to confirm the degree of deamination of 5-aminovaleric acid and 6-aminocaproic acid, TLC was performed thereon. Here, the reaction volume was 100 μl, and the production of glutamate and the degree of substrate degradation, which were dependent upon various concentrations of 5-aminovaleric acid, 6-aminocaproic acid, alpha-ketoglutarate, and pyridoxal phosphate and the presence and absence of each substrate, were confirmed on TLC. After the TLC development was completed, a material containing an amine group was developed with the 3% ninhydrin solution. According to the TLC results, it was confirmed that 5-aminovaleric acid and 6-aminocaproic acid was reduced, and glutamate was produced (see
(34) As shown in
(35) From this experimental result, it was confirmed that P. stutzeri CJ-MKB can use 6-aminocaproic acid as a single nitrogen source, and in the presence of alpha-ketoglutarate and pyridoxal phosphate, the deamination of 5-aminovaleric acid and 6-aminocaproic acid was accelerated (see
Example 3: Induction of Overexpression of a New Polypeptide Having Transaminase Activity of the Present Disclosure in an E. coli Strain, and Evaluation of Reactivity of the Polypeptide
(36) 1) Induction of Overexpression of a Polypeptide Having Transaminase Activity and being Derived from P. stutzeri CJ-MKB Strains in E. coli Strains
(37) To confirm the activity of an enzyme, which is presumed to be a transaminase and expected to be involved in the deamination reaction in the new P. stutzeri CJ-MKB strain that was selected and identified in Example 1, the following experiment was carried out. Through the sequence analysis, a base sequence of a gene (hereinafter, referred to as “argD”) encoding the transaminase of the P. stutzeri CJ-MKB was confirmed (SEQ ID NO: 4).
(38) For expression and purification, cloning was performed by adding a His-tag at the 5-terminal of the base sequence of argD for the expression. In detail, recombinant argD derived from the P. stutzeri CJ-MKB was introduced to E. coli Rosetta by using E. coli expression vector pETDuet1 (Merch Millipore, Darmstadt, Germany) to prepare a transformed strain. Then, the prepared transformed strain was added to a 3 mL LB broth medium to which 50 mg/ml of ampicillin was added, and the strain was cultured at a temperature of 37° C. for 12 hours. The cultured strain was cultured at a temperature of 37° C. in a 50 mL LB medium containing antibiotics. When the optical intensity thereof (at a wavelength of 600 nm) reached 0.8, expression was induced, and then, the strain was further cultured at a temperature of 18° C. for 48 hours. The cultured strain was washed and disrupted using a sonicator. Then, soluble proteins overexpressed after the disruption were identified by SDS-PAGE gel results (
(39) The transformed E. coli Rosetta was named ‘E. coli Rosetta 0004-0057’, and deposited in the Korean Culture Center of Microorganisms (KCCM) on Oct. 22, 2014 under accession number of KCCM11588P.
(40) 2) Evaluation of Deamination Reactivity of Lysate of E. coli in which Polypeptides Having Transaminase Activity of the Present Disclosure are Overexpressed
(41) The reactivity of each of the amino compounds (gamma-aminobutyric acid, 6-aminocaproic acid, and N-acetylornithine) was evaluated using the lysate of E. coli in which N-acetylornithine transaminase of Example 3-1 was overexpressed. 10 mM of each of the three amino compounds, 10 mM alpha-ketoglutarate, and 0.1 mM pyridoxal phosphate were added, and the activity of the overexpressed N-acetylornithine transaminase was evaluated. 50 μl of the lysate of E. coli, in which overexpression was induced, and substrates were added to 50 mM HEPES buffer (pH 8.0) to perform a reaction at a volume of 100 μl. After 30 minutes of the reaction at a temperature of 37° C., the degree of deamination of 6-aminocaproic acid was identified by TLC (
(42) The overexpressed N-acetylornithine transaminase was observed to be highly reactive with N-acetylornithine which is known to be an original substrate (Lane 8 of
(43) In addition, by increasing the concentration of 6-aminocaproic acid in the same manner as in the above-described reactivity evaluation, the amount of glutamate produced in the conversion reaction was analyzed by TLC (
(44) In conclusion, based on the above results, it was confirmed that, when the gene for a polypeptide having transaminase activity derived from P. stutzeri CJ-MKB was transformed and overexpressed in E. coli, the polypeptide of the present disclosure had deamination activity for 6-aminocaproic acid.
Example 4: Evaluation of Deamination Activity of N-Acetylornithine Transaminase Derived from Various Pseudomonas Strains
(45) The deamination activity of the polypeptide for 6-aminocaproic acid was evaluated, wherein the polypeptide was derived from P. stutzeri CJ-MKB and had the transaminase activity of Example 3. In this regard, genes for N-acetylornithine transaminases derived from microorganisms of the genus Pseudomonas, such as P. mendocina, P. putida, P. resinovorans, P. syringae, and P. thermotolerans, that are considered to be capable of the same bioconversion reaction as the above, were expressed in E. coli for the evaluation of the reactivity thereof.
(46) 1) Comparison of Homology of N-Acetylornithine Transaminases Derived from Various Pseudomonas Strains
(47) Five strains were selected from microorganisms of the genus Pseudomonas, and then, nucleotides provided by the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov) and the genome program were used to identify genes and amino acid sequences for N-acetylornithine transaminases derived from P. mendocina, P. putida, P. resinovorans, P. syringae, and P. thermotolerans. Then, the homology with the amino acid sequence of the polypeptide derived from P. stutzeri CJ-MKB and having transaminase activity was compared (Table 2). Each of the enzymes derived from the microorganisms of the genus Pseudomonas showed at least about 75% homology with each other.
(48) TABLE-US-00002 TABLE 2 Amino acid homology comparison results between N-acetylornithine transaminases derived from five microorganisms of the genus Pseudomonas and polypeptides derived from P. stutzeri CJ-MKB (unit: %) P. stutzeri P. resinovorans P. thermotolerans CJ-MKB P. mendocina P. syringae P. putida P. resinovorans 86.1728 80.0493 78.0788 80.4938 83.4975 P. thermotolerans 86.1728 78.0247 79.2593 78.2716 78.0247 P. stutzeri 80.0493 78.0247 76.3547 75.3086 78.0788 CJ-MKB P. mendocina 78.0788 79.2593 76.3547 80.9877 80.2956 P. syringae 80.4938 78.2716 75.3086 80.9877 79.0123 P. putida 83.4975 78.0247 78.0788 80.2956 79.0123
(49) 2) Separation and Purification of N-Acetylornithine Transaminases Derived from Five Pseudomonas Strains and Polypeptide of the Present Disclosure
(50) The genes for N-acetylornithine transaminases of five Pseudomonas strains and the gene for the polypeptide having transaminase activity derived from P. stutzeri CJ-MKB of the present disclosure in Example 4-1 were obtained, and expressed in E. coli in the same manner as in Example 3-1. Then, proteins purified using the His-tag column were obtained. As a result of comparing the obtained proteins on SDS-PAGE gel, it was confirmed that the proteins were purified in a normal manner (
(51) 3) Evaluation of Deamination Activity of N-Acetylornithine Transaminases Derived from Five Pseudomonas Strains and the Polypeptide of the Present Disclosure for 6-Aminocaproic Acid
(52) The reactivities of the proteins purified in Example 4-2 for 6-aminocaproic acid were verified (Lanes 3, 5, 7, 9, 11, and 13 of
(53) As a result, it was confirmed that the N-acetylornithine transaminase derived from P. syringae showed 56.69% conversion of 6-aminocaproic acid, whereas the polypeptide derived from P. stutzeri CJ-MKB showed 45.52% conversion of 6-aminocaproic acid in a similar manner to the other compared strains.
(54) The same sample was used to compare the degree of aldehyde formation by using the relative activity values using Schiff's reagent (
(55) The aldehyde production in the reaction sample of the N-acetylornithine transaminase derived from P. thermotolerans was measured as higher than the LC-Mass results, but the overall reaction degree was confirmed in the same order. In addition, it was confirmed that the LC-Mass results and the Schiff's reagent results had a correlation.
(56) 4) Evaluation of Deamination Activities of N-Acetylornithine Transaminases Derived from Genus Pseudomonas Strains and the Polypeptide of the Present Disclosure for N-Acetylornithine, Gamma-Aminobutyric Acid, and 5-Aminovaleric Acid Substrates
(57) With respect to various substrates, the reactivities of the N-acetylornithine transaminases, which were derived from five microorganisms of the genus Pseudomonas and of which reactivities were identified in Example 4-3, and reactivities of the polypeptide of the present disclosure, were evaluated. Along with 10 mM alpha-keto glutamate and 0.1 mM pyridoxal phosphate, N-acetylornithine, gamma-aminobutyric acid, or 5-aminovaleric acid was added at a concentration of 10 mM of the total reaction solution, and N-acetylornithine transaminase was added at a concentration of 0.5 mg/ml of the total reaction solution, for a reaction at a temperature of 37° C. for 1 hour. 10 μl out of 100 μl of the reactant was diluted with 180 μl of 50 mM HEPES buffer (pH 8.0), and 10 μl of Schiff's reagent was used for a reaction for 30 minutes. Then, a 96-well plate reader was used to compare relative enzymatic activities.
(58) The deamination reaction of N-acetylornithine, which is known as the original substrate of N-acetylornithine transaminase, showed the highest activity when derived from P. mendocina (
(59) Regarding gamma-aminobutyric acid, the highest reactivity was shown for the N-acetylornithine transaminase derived from P. resinovorans (
(60) Regarding 5-aminovaleric acid, the highest reactivity was shown for the polypeptide derived from P. stutzeri CJ-MKB (
Example 5: Evaluation of Reverse-Reaction Activity of Polypeptide Having Transaminase Activity Derived from P. stutzeri CJ-MKB
(61) According to Example 4, it was confirmed that the N-acetylornithine transaminases derived from various Pseudomonas strains and the polypeptide of the present disclosure were converted to adipate semialdehyde and the like by deamination of an amine compound, such as 6-aminocaproic acid. In Example 5, as a reverse reaction of the reaction of Example 4, for confirming the conversion reactivity from adipate semialdehyde to 6-aminocaproic acid, excess glutamate was treated in the presence of adipate semialdehyde produced by N-acetylornithine transaminase to thereby confirm whether adipate semialdehyde was produced to 6-aminocaproic acid.
(62) First, 5 mM 6-aminocaproic acid, 5 mM alpha-ketoglutarate, and 0.1 mM pyridoxal phosphate were prepared with 50 mM HEPES buffer (pH 8.0) at a volume of 100 μl, and N-acetylornithine transaminases derived from five Pseudomonas strains and the polypeptide of the present disclosure were added thereto at a concentration of 0.5 mg/ml of the total reaction solution, thereby performing a reaction at a temperature of 37° C. for 1 hour. After the completion of the reaction, the reaction sample was treated at a temperature of 100° C. for at least 5 minutes to thereby remove the enzyme activity. The heat-treated sample was centrifuged at a speed of 14,000 rpm for 10 minutes at a temperature 4° C., and then, 10 μl of the supernatant was diluted with 180 μl of 50 mM HEPES buffer (pH 8.0) (forward reaction, alpha-ketoglutarate (α-KG) reaction),
(63) In addition, to induce a reverse reaction of the reaction above, a sample having a volume of 200 μl was prepared and treated under the same conditions as above. After performing centrifugation thereon, 20 mM glutamate and 0.5 mg/ml of enzyme were added to 97 μl of the supernatant. Then, at a volume of 100 μl, the reaction sample was reacted at a temperature of 37° C. for 1 hour, followed by treatment at a temperature of 100° C. for 5 minutes. Afterwards, centrifugation was performed thereon at a speed of 14,000 rpm for 10 minutes at a temperature 4° C., and then, 10 μl of the supernatant was diluted with 180 μl of 50 mM HEPES buffer (pH 8.0) (reverse reaction, glutamate reaction).
(64) The obtained sample was reacted with 10 μl of Schiff's reagent for 30 minutes, and a 96-well plate reader was used to compare the relative enzymatic activities. As a result, when comparing the values obtained using a 96-well plate reader after the reaction of the Schiff's reagent, it was confirmed that the N-acetylornithine transaminases derived from 5 Pseudomonas strains and the polypeptide of the present disclosure converted adipate semialdehyde to 6-aminocaproic acid (