5′-phosphorothiolate mRNA 5′-end (cap) analogs, mRNA comprising the same, method of obtaining and uses thereof

11066436 · 2021-07-20

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to nucleotides, analogs of mRNA 5′-end (cap) containing sulfur atom at the position 5′ of 7-methylguanosine nucleoside. The disclosed compounds are recognized (bound and non-hydrolyzed) by DcpS enzyme (Decapping Scavenger), and thus may find therapeutic use as inhibitors thereof. DcpS is cap-specific enzyme with pyrophosphatase activity, which was identified as a therapeutic target in the treatment of spinal muscular atrophy (SMA). Some of the compounds disclosed have additional modifications in the phosphate chain, which modulate their affinity for DcpS enzyme. The present invention also relates to mRNAs modified at the 5′ end with mRNA 5′-end (cap) analogs containing 5′-phosphorothiolate moiety, which mRNAs have an increased stability and translational activity in cellular conditions, to a method of their preparation, their uses, and to a pharmaceutical formulation containing them, wherein L.sup.1 and L.sup.2 are independently selected from the group comprising O and S, wherein at least one of L.sup.1 and L.sup.2 is not O. ##STR00001##

Claims

1. A 5′-phosphorothiolate cap analog according to formula 1 ##STR00066## wherein L.sub.1 and L.sub.2 are independently selected from O or S, wherein at least one of L.sub.1 and L.sub.2 is not O; n=0, 1, or 2; X.sub.1, X.sub.2, and X.sub.3 are independently selected from O or S; R.sub.1 is selected from CH.sub.3, C.sub.2H.sub.5, CH.sub.2Ph, alkyl, or substituted alkyl; R.sub.2 and R.sub.3 are independently selected from H, OH, OCH.sub.3, OC.sub.2H.sub.5, —COOH, N.sub.3, alkyl, alkenyl or alkynyl; R.sub.4 and R.sub.5 are independently selected from H, OH, OCH.sub.3, OC.sub.2H.sub.5, —COOH, CH.sub.2COOH, N.sub.3, CH.sub.2N.sub.3, alkyl, alkenyl, or alkynyl; Y.sub.1 and Y.sub.2 are independently selected from CH.sub.2, CHCl, CCl.sub.2, CF.sub.2, CHF, NH, or O; and B is a group according to formula 3, 4, 5, 6 or 7 ##STR00067##

2. The 5′-phosphorothiolate cap analog according to claim 1, wherein the compound is selected from compound no. 21, 22, 23, 24, 25, 26, 30, 31, 32, 33, 34, 35, 36, 37, or 38.

3. A 5′-phosphorothiolate analog according to formula 2 ##STR00068## wherein m=0 or 1; n=0, 1, or 2; L.sub.1 is S; X.sub.1, X.sub.2, and X.sub.3 are independently selected from O or S; R.sub.1 is selected from CH.sub.3, C.sub.2H.sub.5, CH.sub.2Ph, alkyl, or substituted alkyl; R.sub.2 and R.sub.3 are independently selected from H, OH, OCH.sub.3, OC.sub.2H.sub.5, —COOH, N.sub.3, alkyl, or substituted alkyl; and Y.sub.1 and Y.sub.2 are independently selected from CH.sub.2, CHCl, CCl.sub.2, CHF, CF.sub.2, NH, or O.

4. A method for treating a disease or symptoms of a disease comprising administering the 5′-phosphorothiolate cap analog of claim 1.

5. The method of claim 4, wherein the disease or symptoms of a disease is spinal muscular atrophy (SMA) or a symptom of SMA.

6. A composition comprising the 5′-phosphorothiolate cap analog of claim 1.

7. A method for treating spinal muscular atrophy (SMA) or symptoms of SMA, comprising administering the composition of claim 6.

8. A method for regulating DcpS activity, inhibiting of DcpS enzyme activity, or inhibiting hDcpS enzyme activity comprising contacting the 5′-phosphorothiolate cap analog of claim 1.

9. A method for regulating mRNA degradation, mRNA splicing, or both, comprising contacting the 5′-phosphorothiolate cap analog of claim 1.

10. A pharmaceutical formulation comprising the 5′-phosphorothiolate cap analog according to claim 1 and a pharmaceutically acceptable carrier.

11. An mRNA comprising at the 5′ end the 5′-phosphorothiolate cap analog according to claim 1.

12. The mRNA according to claim 11, wherein said 5′-phosphorothiolate cap analog is selected from a group consisting of m.sup.7GSpppG (no. 24), m.sup.7,2′OGSpppG (no. 26), m.sup.7GSpppSG (no. 32), m.sup.7GSpp.sub.spG D1 (no. 30), m.sup.7GSpp.sub.spG D2 (no. 31), m.sup.7GSpp.sub.spSG D1 (no. 33), and m.sup.7GSpp.sub.spSG D2 (no. 34).

13. A method of preparation of mRNA comprising at the 5′ end of the mRNA molecule a 5′-phosphorothiolate cap analog, characterized in that the 5′-phosphorothiolate cap analog of claim 1 is incorporated during synthesis of the mRNA molecule.

14. The method of preparation of mRNA according to claim 13, characterized in that the 5′-phosphorothiolate cap analog is selected from a group comprising m.sup.7GSpppG (no. 24), m.sup.7,2′OGSpppG (no. 26), m.sup.7GSpppSG (no. 32), m.sup.7GSpp.sub.spG D1 (no. 30), m.sup.7GSpp.sub.spG D2 (no. 31), m.sup.7GSpp.sub.spSG D1 (no. 33), m.sup.7GSpp.sub.spSG D2 (no. 34), more preferably it is m.sup.7,2′OGSpppG (no. 26).

15. The method of preparation of mRNA according to claim 13 characterized in that the synthesis of mRNA proceeds through transcription in vitro.

16. An mRNA prepared with the method according to claim 13.

17. A method for the production of proteins using mRNA comprising the 5′-phosphorothiolate cap analog according to claim 11.

18. The method according to claim 17, characterized in that the production of proteins carried out in a cellular or a non-cellular system.

19. A method for treating a disease or symptoms of a disease comprising administering mRNA according to claim 11.

20. The method for treating a disease or symptoms of a disease according to claim 19, wherein the treatment is of spinal muscular atrophy (SMA) an/or for alleviation of symptoms of SMA.

21. The method for treating a disease or symptoms of a disease according to claim 19, wherein the disease is cancer.

22. A composition comprising the mRNA according to claim 11.

23. The composition of claim 22, wherein the composition is for treatment of spinal muscular atrophy (SMA), for alleviation of symptoms of SMA, for use as an anti-cancer medicament, or for use in an anti-cancer immunotherapy.

24. A pharmaceutical formulation comprising the mRNA according to claim 11 and a pharmaceutically acceptable carrier.

Description

BRIEF DESCRIPTION OF DRAWINGS

(1) For better understanding of the invention it was illustrated with examples and on the attached figures wherein:

(2) FIG. 1 Illustrates synthesis of 5′-deoxy-5′-iodo-guanosine analogs

(3) FIG. 2 Illustrates synthesis of 5′-deoxy-5′-thioguanosine-5′-thiophosphates. A—synthesis of guanosine derivative; B—synthesis of 7-methyloguanosine derivatives.

(4) FIG. 3 Illustrates synthesis of 5′-thiophosphate cap analogs via S-alkylation. A—terminal thiophosphates used in alkylation reaction; B—schemes of alkylation reaction using 5′-deoxy-5′-iodo-guanosine (z FIG. 1) and terminal thiophosphates shown in A.

(5) FIG. 4 Illustrates synthesis of 5′-thiophosphate cap analogs via imidazolides. A—compounds used in the method; B—final compounds synthesis using two different activated derivatives no. 9 i 29.

(6) FIG. 5 Illustrates hydrolysis of natural dinucleotide substrate by DcpS and stability studies of 5′-S modified analogs: panel A—stability studies of natural cap analog m.sup.7GpppG against DcpS; panel B—stability studies of cap analog no. 20 against DcpS enzyme (Table 3); panel C—stability studies of cap analog no. 21 against DcpS enzyme (Table 3).

(7) FIG. 6. The result of IC.sub.50 determination for compounds: m.sup.7GSpp.sub.spSG D2, m.sup.7GSpp, m.sup.7GDP and RG3039.

(8) FIG. 7. Illustrates a crystal structure of active site of the enzyme ΔN37hDcpS in complex with m.sup.7GSpp.sub.spSG D2.

(9) FIG. 8. Illustrates susceptibility to Dcp1/2 enzyme activity of short 26 nt RNAs capped with various cap analogs (transcripts without cap at their 5′ ends are 25 nt long) being incubated with the SpDcp1/2 decapping enzyme. The reactions were conducted for 0, 5, 15, 30 min, after termination thereof reaction mixture was resolved on denaturing 15% polyacrylamide gel, after the electrophoretic separation was completed the gel was stained with SYBR-Gold (Invitrogen). On each panel the leftmost lane refers to the control, which is uncapped RNA.

(10) FIG. 9. Illustrates relative susceptibility to Dcp1/2 enzyme activity determined from the data on FIG. 8. The relative susceptibility to Dcp1/2 activity was calculated as the ratio of intensity of the band corresponding to the RNA capped at the 5′ end to the sum of the intensities of bands corresponding to capped and uncapped RNA. All values were normalized in relation to time 0 min for individual RNAs.

(11) FIG. 10. Illustrates relative translational efficiency obtained from measurements of translation efficiencies of mRNA encoding Renilla luciferase capped with various cap analogs on the 5′ end in rabbit reticulocyte extract.

(12) FIG. 11. Illustrates relative translational efficiency in HeLa cells determined on the basis of luciferase activity at selected time points. Results are presented as a ratio of luciferase activity measured for lysate of cells transfected with mRNA capped with m.sub.2.sup.7,2′-OGSpppG or m.sub.2.sup.7,2′-OGpppSG on the 5′ end to luciferase activity measured for lysate of cells transfected with mRNA capped with m.sup.7GpppG. The histograms represent the mean value from three biological repetitions.

(13) Chemical synthesis of 5′-thiophosphate cap analogs is a creative combination of three nucleotide synthesis methods based on chemistry of: 1) Imidazolide nucleotide derivatives (see (Abrams and Schiff 1973); (Barnes, Waldrop et al. 1983); (Kalek, Jemielity et al. 2006) and (Kalek, Jemielity et al. 2005)) 2) S-alkylation by halogen containing nucleoside derivatives (see (Arakawa, Shiokawa et al. 2003)) 3) Synthesis of terminal nucleoside β-thio-di and γ-thio-triphosphates (see (Zuberek, Jemielity et al. 2003))

(14) In order to synthesize sulfur-containing cap analogs at the 5′-position we developed two complementary approaches that on the whole allow synthesis of a whole variety of 5′-phosphorothioate analogs of mono-, di-, and triphosphates of nucleosides and dinucleotide cap analogs (FIG. 2-4). Approach 1 (FIG. 2 and the first step in FIG. 3) involves the reaction of S-alkylation using a nucleophilic substitution reaction of 5′-deoxy-5′-iodonucleoside by β- or γ-thiophosphates. The second approach (FIG. 4) yielding dinucleotide compounds having sulfur atom at the 5′ position, uses a coupling reaction between the prior activated form of an appropriate imidazolide nucleotide and diphosphate (in both cases, at a chosen stage the reaction of S-alkylation was used) in the presence of ZnCl.sub.2 as a catalyst.

(15) The first approach uses the corresponding phosphorothioates (mono-, di-, tri-) bearing at a terminal position a phosphorothioate moiety. The optimum conditions for this reaction is the use of equimolar amounts of phosphorothioate, 5′-iodonucleoside and DBU (1,8-diazabicyclo (5.4.0) undec-7-ene) as a base. To date, using this method, we obtained 9 different dinucleotide cap analogs including two units containing methylene modifications at positions α-β and β-γ of triphosphate bridge (FIG. 3).

(16) The second method for the efficient yield required the presence of divalent metal chlorides such as ZnCl.sub.2, which also improves the solubility in an organic medium, protects against hydrolysis of imidazolide derivative and accelerates the reaction rate by getting the imidazole derivative and the phosphate of the other molecule closer to one another. The optimum conditions for this reaction was the use of 1.5 equivalents of the imidazole derivative relative to the diphosphate in the presence of 8-fold excess of ZnCl.sub.2 in DMF. Using the second method we obtained further nine 5′-phosphorothioate cap analogs containing two sulfurs at the 5 ‘position and sulfur at the β-nonbridging position in the triphosphate chain (FIG. 4). To date the use of 5’-phosphorothioate analogs of nucleotides in this type of reaction have not been described. Due to the presence of a stereogenic center located on the phosphorus atom, each analog containing β-S-sulfur atom was obtained as a mixture of diastereomers (called D1 and D2 according to the order of their elution from the RP-HPLC column). The individual diastereomers were separated by RP-HPLC.

(17) The obtained cap analogs were purified by ion exchange chromatography, DEAE Sephadex A-25, and if the purity was not sufficient, by preparative HPLC. Then, the purified compounds were tested for their biochemical and biological properties.

(18) The synthesis routes leading to cap analogs containing sulfur atom at the 5′ position are shown in FIGS. 1-4.

(19) The obtained cap analogs were then tested as substrates of the human enzyme DcpS (hDcpS). As determined by using reverse phase HPLC (RP HPLC), only four of the analogs: m.sup.7GppSG (no. 21), m.sup.7GpppSG (no. 22) m.sup.7,2′-OGpppSG (no. 38) and m.sup.7Gpp.sub.spSG D1/D2 (no. 35-36) are hydrolyzed by DcpS. Other analogs containing sulfur atom at the 5′ position from the side of the 7-methylated guanosine are resistant to hydrolysis by hDcpS (stability comparison of two different analogs (no. 22) and (no. 24)—FIG. 5, Table 4). In contrast to the compounds no. 21, 22, 38 and 35-36, analog 37 (m.sup.7GpCH.sub.2ppSG) was additionally modified with a methylenebisphosphonate moiety, and was also resistant to hydrolysis by the enzyme hDcpS (Table 5). Then, the fluorescence method and fluorogenic probe were used for determining the ability of these compounds to inhibit the enzyme hDcpS while determining for the compounds which are resistant to the enzyme activity the parameter IC.sub.50 (see patent application PL406893). After the studies, it was discovered that the resulting compounds are very good inhibitors of the human enzyme DcpS.

(20) Analog no. 34, displaying the best inhibitory properties against hDcpS enzyme from all tested cap analogs, was co-crystallized with a shortened version of the enzyme (ΔN37hDcpS; full-length enzyme did not form crystals), and the 2.05 Å resolution structure of the complex was determined by X-Ray crystallography (FIG. 7). Conformation of the analog No. 34 observed in the complex structure differs significantly from the conformation of a non-modified cap analog m.sup.7GpppG (compound No. 0) in complex with a catalytically-inactive H277N hDcpS mutant (Gu, Fabrega et al. 2004). Particularly substantial differences between those two ligands were observed in the alignment of the triphosphate bridge, resulting in exclusion of γ phosphate of the analog no. 34 from the catalytic center Additionally, besides the typical cap/DcpS enzyme complex interactions with the C-terminal domain, analog no. 34 interacts through hydrogen bonds with the lysine 142 and tyrosine 143 residues. Those amino acids are located in the so-called hinge region, connecting C- and N-terminal domains, which move relative to each other during the catalytic cycle.

(21) The structure and purity of the obtained compounds were confirmed by mass spectrometry and .sup.1H and .sup.31P NMR.

(22) The observation that m.sup.7GSpppG (Compound no. 24) and its analogs are resistant to hDcpS is unexpected because the hydrolysis of obtained compounds proceeds through a nucleophilic attack on the phosphate group adjacent to 7-methylguanosine, which is consistent with the catalytic mechanism established for the natural substrates.

(23) In summary, the invention describes structures and methods for synthesis of various analogs of the 5′ end of the mRNA (cap) containing 5′-phosphorothioate moiety. None of the cap analogs described, their properties against the enzyme DcpS, nor methods of their use, particularly for the treatment of spinal muscular atrophy (SMA) and/or alleviating the symptoms of SMA have been previously described in the literature.

(24) Selected analogs were used for mRNA synthesis using in vitro transcription method with RNA SP6 polymerase (New England BioLabs). It was examined which percentage of the pool of transcripts with a length of 35 nucleotides has a cap structure, and then the susceptibility of these transcripts to degradation by a recombinant enzyme Dcp1/2 from Schizosaccharomyces pombe was examined (Example 2, Test 4, FIG. 8, FIG. 9, Tab. 6.). Full-length transcripts encoding luciferase (as a reporter gene) were subjected to translation in rabbit reticulocyte lysate (FIG. 10, Example 2, Test 5) and in HeLa cells transfected with modified mRNA (FIG. 11, Example 2, Test 6). In both cases, the efficiency of mRNA translation in both translational systems was determined by examining the activity of the synthesized protein (luciferase) (Tab. 6).
The terms used in the description have the following meanings. Terms not defined herein have the meaning that is presented and understood by a person skilled in the art in light of this disclosure and the context of the description of the patent application. The following conventions, unless stated otherwise, were used in the present description, the terms having the meanings indicated as in the definitions below.
The term “alkyl” refers to a saturated, linear or branched hydrocarbonyl substituent having the indicated number of carbon atoms. The examples of an alkyl substituent are -methyl, -ethyl, -n-propyl, -n-butyl, -n-pentyl, -n-hexyl, -n-heptyl, -n-octyl, -n-nonyl and -n-decyl. Representative branched —(C1-C10)alkyls include -isopropyl, -sec-butyl, -isobutyl, -tert-butyl, -isopentyl, -neopentyl, -1-methylbutyl, -2-methylbutyl, -3-methylbutyl, -1,1-dimethylpropyl, -1,2-dimethylpropyl, -1-methylpentyl, -2-methylpentyl, -3-methylpentyl, -4-methylpentyl, -1-ethylbutyl, -2-ethylbutyl, -3-ethylbutyl, -1,1-dimethylbutyl, -1,2-dimethylbutyl, 1,3-dimethylbutyl, -2,2-dimethylbutyl, -2,3-dimethylbutyl, -3,3-dimethyl-butyl, -1-methylhexyl, 2-methylhexyl, -3-methylhexyl, -4-methylhexyl, -5-methylhexyl, -1,2-dimethylpentyl, -1,3-dimethylpentyl, -1,2-dimethylhexyl, -1,3-dimethylhexyl, -3,3-dimethylhexyl, 1,2-di-methylheptyl, -1,3-dimethylheptyl and -3,3-dimethylheptyl and others.
The term “alkenyl” refers to a saturated, linear or branched acyclic hydrocarbyl substituent having the indicated number of carbon atoms and containing at least one carbon-carbon double bonds. The examples of an alkenyl substituent are -vinyl, -allyl, -1-butenyl, -2-butenyl, -isobutylenyl, -1-pentenyl, -2-pentenyl, -3-methyl-1-butenyl, -2-methyl-2-butenyl, -2,3-dimethyl-2-butenyl, -1-hexenyl, -2-hexenyl, -3-hexenyl, -1-heptenyl, -2-heptenyl, -3-heptenyl, -1-octenyl, -2-octenyl, -3-octenyl, -1-nonenyl, -2-nonenyl, -3-nonenyl, -1-decenyl, -2-decenyl, -3-decenyl and others.
The term “alkynyl” refers to a saturated, linear or branched acyclic hydrocarbyl substituent having the indicated number of carbon atoms and containing at least one carbon-carbon triple bond. The examples of an alkynyl substituent are acetylenyl, propynyl, -1-butynyl, -2-butynyl, -1-pentynyl, -2-pentynyl, -3-methyl-1-butynyl, 4-pentynyl, -1-hexynyl, -2-hexynyl, -5-hexynyl and others.
The term “heteroatom” refers to an atom selected from the group of oxygen, sulfur, nitrogen, phosphorus and others.
The term “HPLC” refers to high performance liquid chromatography, and the solvents designated as solvents for “HPLC” mean solvents of suitable purity for HPLC analysis (High Performance Liquid Chromatography).
The term “NMR” means nuclear magnetic resonance.
The term “cellular system” refers to cells capable of carrying out a protein biosynthesis process on an RNA template.
The term “non-cellular system” means a biological mixture containing all the ingredients necessary for protein biosynthesis on the basis of an RNA template, usually a lysate of animal or plant cells.

MODES FOR CARRYING OUT THE INVENTION

(25) The following examples are provided merely to illustrate the invention and to explain its various aspects, and not for its limitation, and should not be equated with its all scope, which is defined in the appended claims. The following examples, unless stated otherwise, involved the use of standard materials and methods used in the field or the procedures recommended by the manufacturer for the particular materials and methods.

EXAMPLES

(26) General Information Related to the Synthesis, Isolation and Characterization of New Cap Analogs

(27) Nucleotides which were intermediates were purified by ionexchange chromatography on DEAE Sephadex A-25 (HCO.sub.3.sup.− form) using a linear gradient of triethylammonium bicarbonate (TEAB) in deionized water. After evaporation under reduced pressure, during which 96% ethanol was added several times to decompose the TEAB buffer, intermediates were isolated as a triethyalammonium salts. The final products (cap analogs) were purified in the same manner and then purified by semi-preparative HPLC, and subjected to lyophilization several times and were isolated as ammonium salts. Analytical reverse phase HPLC (RP HPLC) was performed on Agilent Technologies Series 1200 apparatus, with Supelcosil LC-18 RP-T column (4.6×250 mm, flow 1.3 ml/min) with a linear gradient of 0%-25% methanol (program A) in 0.05 M ammonium acetate (pH 5.9) or 0%-50% methanol (program B) in 0.05 M ammonium acetate (pH 5.9). The eluted compounds were detected using UV-VIS detector (at 260 nm) and fluorescence detector (excitation 260 nm, emission 370 nm). Preparative RP HPLC was carried out on the same apparatus using a Discovery RP Amide C16 column (21.2 mm×250 mm, flow 5.0 ml/min) using a linear gradient of acetonitrile in 0.05 M ammonium acetate (pH 5.9) as the mobile phase. .sup.1H NMR and .sup.31P NMR spectra were recorded at 25° C. on a Varian UNITY-plus at a frequency of 399.94 MHz and 161.90 MHz respectively. .sup.1H NMR chemical shifts were reported to TSP (3-trimethylsilyl [2,2,3,3-D4] sodium propionate) in D.sub.2O (internal standard). .sup.31P NMR chemical shifts were reported to 20% phosphoric acid in D20 (external standard). The high resolution mass spectra in negative [MS ESI (−)] or positive ion mode [MS ESI (+)] were recorded on a Micromass QToF 1 MS. Reading the fluorescence plate reader was performed on a Tecan Infinit 200 ® PRO with excitation at 480 nm and emission at 535 nm. Samples were placed in a black 96-well plate (Greiner). Crystallisations were performed on 96-well plates with 3-lens wells (Swissci), utilizing a pipetting robot Mosquito Crystal (TTp Labtech). Solvents and other reagents were purchased from Sigma-Aldrich and used without further purification, unless stated otherwise below. Commercially available sodium salts of GMP and GDP were converted to triethylammonium salts using ion exchange chromatography on Dowex 50 WX8. Triethylammonium salts and m.sup.7GMP and m.sup.7GDP sodium salts, m.sup.7GMP-Im and m.sup.7GDP-Im were obtained as described in the literature (Kalek, Jemielity et al. 2005), (Jemielity, Fowler et al. 2003). 5′-deoxy-5′-iodo-guanosine, 5′-deoxy-5′-thiogaunosin-5′-monothiophosphate and triethylamine phosphorothioate were obtained as described in the literature ((Arakawa, Shiokawa et al. 2003), (Zuberek, Jemielity et al. 2003)). m.sup.7GpCH2p triethylammonium salt was prepared as described in the literature (Kalek, Jemielity et al. 2006). GpCH.sub.2ppS was prepared as described (Kowalska, Ziemniak et al. 2008)

(28) In the examples below, in the brackets for specific compounds the reference to the figure and the number indicating the specified substituents is given, which corresponds to a particular number for the particular cap analog.

Example 1. Synthesis and Isolation of New Cap Analogs

General Method of Synthesis of 5′-Iodo Nucloside Derivatives (FIG. 1, No. 3, 4)

(29) Iodine (3 mmol, M=253.81 g/mol was added over 5 min to a magnetically stirred suspension of the corresponding nucleoside (1 mmol), triphenylphosphine (3 mmol, M=262.29 g/mol) and imidazole (6 mmol, M=68.08 g/mol) in N-methyl-2-pyrrolidinone (to a concentration of nucleoside 0.25 mol/l) at room temperature. The reaction was performed over 3 h, and the progress of the reaction was monitored using RP HPLC. Then, the reaction mixture was poured into a solution of CH.sub.2Cl.sub.2:H.sub.2O (3:1, v/v), diluting the reaction mixture 12-times. A white crystalline precipitate formed during 24 h in 4° C., at the interface of the two layers. The precipitate was filtered off under reduced pressure, washed with methylene chloride and dried in vacuum over P.sub.2O.sub.5.

5′-deoxy-5′-iodo-guanosine (FIG. 1, No. 3)

(30) 5′-deoxy-5′-iodo-guanosine (FIG. 1, no. 3), (10.4 g, 26.5 mmol, 75%) was obtained starting from guanosine (FIG. 1, no. 1), (10 g, 35.3 mmol) following the general procedure. t.sub.R (B)=12.36 min;

(31) .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ ppm 10.65 (s, 1H, H-1), 7.89 (s, 1H, H-8), 6.47 (bs, 2H, NH2), 5.68 (d, 1H, J=6.26 Hz, H-1′), 5.51 (d, 1H, J=6.26 Hz, 2′-OH), 5.35 (d, 1H, J=4.70 Hz, 3′-OH), 4.59 (q, 1H, J=5.48 Hz, H-2′), 4.03 (q, 1H, J=5.09, 3.13 Hz, H-3′), 3.90 (dt, 1H, J=6.26, 3.13 Hz, H-4′), 3.53 (dd, 1H, J=6.26, 5.87 Hz, H-5′), 3.39 (dd, 1H, J=10.17, 6.65 Hz, H-5′); HRMS ESI (−) calcd. m/z for C.sub.10H.sub.11IN.sub.5O.sub.4.sup.−, (M−H).sup.−; 391.9861, found 391.98610.

5′-deoxy-5′-iodo-2′-O-methyl-guanosine (FIG. 1, No. 4)

(32) 2′-O-methyl-5′-deoxy-5′-iodo-guanosine (FIG. 1, no. 4), (328.8 mg, 0.81 mmol, 80%) was obtained starting from 2′-O-methylguanosine (FIG. 1, no. 2) (300 mg, 1.0 mmol) following the general procedure. t.sub.R (B)=14.44 min;

(33) .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ ppm 7.95 (s, 1H, H-8), 6.50 (bs, 2H, NH2), 5.81 (d, 1H, J=6.41 Hz, H-1′), 5.50 (d, 1H, J=5.34 Hz, 3′-OH), 4.41, 4.40 (2d, 1H, J=6.26, 6.41 Hz, H-2′), 4.28-4.25 (m, 1H, H-3′), 3.97, 3.96 (2t, 1H, J=6.56, 3.05 Hz, H-4′), 3.56 (dd, 1H, J=6.41, 10.38 Hz, H-5′), 3.43 (dd, 1H, J=10.53, 6.87, 6.71 Hz, H-5′), 3.30 (s, 3H, CH.sub.3);

(34) HRMS ESI (−) calcd. m/z for C.sub.11H.sub.13IN.sub.5O.sub.4.sup.− [M−H].sup.−: 406.0090, found 406.0021.

5′-deoxy-5′-iodo-7-methylguanosine (FIG. 1, No. 5)

(35) 5′-deoxy-5′-iodo-guanosine (FIG. 1, no. 3) (2 g, 5.09 mmol) was dissolved in anhydrous DMF (20 mL) and MeI (2.5 mL, 40.7 mmol) was added. Reaction mixture was stirred on magnetic stirrer at room temperature. The reaction progress was monitored by RP HPLC. When no starting material was observed, reaction was stopped by adding water (10 mL), and the excess of methyl iodide was evaporated under vacuum and reaction mixture was concentrated under reduced pressure. Then, to the remaining crude product CH.sub.2Cl.sub.2 (100 mL) was added and yellow precipitate was formed. Precipitate was filtered off, under reduced pressure, washed with CH.sub.2Cl.sub.2 (3×20 mL) and dried for 24 h in vacuum over P.sub.4O.sub.10. Yield 1.6 g (77.0%). t.sub.R (B)=11.94 min;

(36) .sup.1H NMR (400 MHz, D.sub.2O) δ ppm 5.98 (d, 1H, J=3.91 Hz, H-1′), 4.81 (dd, 1H, J=4.70 Hz, H-2′), 4.31 (t, 1H, J=5.09, H-3′), 4.15 (q, 1H, J=5.48, H-4′), 4.07 (s, 3H, CH.sub.3), 3.50-3.62 (m, 2H, J=4.70, 5.87 Hz, H-5′);

(37) HRMS ESI (+) calcd. m/z C.sub.11H.sub.15IN.sub.5O.sub.4.sup.+[M+H].sup.+: 408.01687, found 408.01163.

5′-deoxy-5′-iodo-2′-O-methyl-7-methylguanosine (FIG. 1, No. 6)

(38) 5′-deoxy-5′-iodo-2′-O-methylguanosine (FIG. 1, no. 4) (200.8 mg, 0.49 mmol) was dissolved in anhydrous DMSO (3.3 mL) and MeI (0.25 mL, 3.9 mmol) was added. Reaction mixture was stirred on magnetic stirrer at room temperature. The reaction progress was monitored by RP HPLC. When no starting material was observed, reaction was quenched with water (10 mL) and pH was adjusted to neutral using NaHCO.sub.3, excess of methyl iodode was extracted with diethyl ether and the water phases were polled, followed by concentrating the mixture and purification by preparative HPLC obtaining 45.8 mg of the compound (77%). t.sub.R (B)=11.94 min;

(39) .sup.1H NMR (400 MHz, DMSO-d.sub.6) b ppm 9.03 (s, 1H, H-8), 6.39 (bs, 2H, NH2), 5.95 (d, 1H, J=4.27 Hz, H-1′), 4.40 (t, 1H, J=4.58 Hz, H-2′), 4.24 (t, 1H, J=4.88 Hz, H-3′), 4.08-4.06 (m, 1H, H-4′), 4.02 (s, 3H, CH.sub.3), 3.59 (dd, 1H, J=5.19, 4.88, 10.68 Hz, H-5′), 3.50 (dd, 1H, J=7.93, 7.63, 10.68 Hz, H-5′), 3.41 (s, 3H, CH.sub.3);

(40) HRMS ESI (−) calcd. m/z C.sub.12H.sub.15IN.sub.5O.sub.4.sup.− [M−H].sup.−: 420.01741, found: 420.01758.

guanosine 5′-deoxy-5′-thioguanosine-5′-monophosphorothiolate (FIG. 2, No. 7)

(41) To a suspension of 5′-deoxy-5′-iodoguanosine (FIG. 2, nr 3) (2.0 g, 5.1 mmol) in 100 mL of DMF:H.sub.2O mixture (1:1, v/v) trisodium thiophosphate (4.6 g, 25.5 mmol) was added. The reaction mixture was stirred for 24 h at room temperature. Precipitate was removed by filtration, the filtrate was evaporated under reduced pressure. The residue was dissolved in 50 mL of water and the excess of trisodium thiophosphate was precipitated by addition of 100 mL of methanol. After separation, the crude product was purified by ion exchange chromatography on Sephadex. The product was freeze-dried. Yield 1.9 g, (64%). t.sub.R (B)=4.24 min;

(42) .sup.1H NMR (400 MHz, D.sub.2O) δ ppm 8.05 (s, 1H, H-8), 5.89 (d, 1H, J=5.73 Hz, H-1′), 4.85 (dd, 1H, J=5.48 Hz, H-2′), 4.51 (2d, 1H, J=4.98, 4.23 Hz, H-3′), 4.33-4.39 (m, 1H, H-4′), 3.16-3.08 (m, 2H, Hz, H-5′); .sup.31P NMR (162 MHz, D.sub.2O) δ ppm 15.42 (s, 1P);

(43) HRMS ESI (−) calcd. m/z C.sub.10H.sub.13N.sub.5O.sub.7PS.sup.− [M−H].sup.−: 378.02788, found: 378.02828.

guanosine 5′-deoxy-5′-thio-7-methylguanosine-5′-monophosphorothiolate (FIG. 2, No. 8)

(44) To a suspension of 5′-deoxy-5′-iodo-7-methylguanosine (FIG. 2, no. 6) (2.0 g, 4.92 mmol) in 100 mL of DMF trisodium thiophosphate (4.43 g, 24.6 mmol) was added. The reaction mixture was stirred for 48 h at room temperature. Precipitate was removed and the filtrate was evaporated under reduced pressure. The residue was dissolved in 50 mL of water and the excess of trisodium thiophosphate was precipitated by addition of methanol (100 mL). After separation, the crude product was purified by ion exchange chromatography on Sephadex. The product was freeze-dried. Yield 1.55 g, (53%). t.sub.R (B)=4.64 min;

(45) .sup.1H NMR (400 MHz, D.sub.2O) δ ppm 7.85 (s, 1H, H-8), 5.89 (d, 1H, J=3.74 Hz, H-1′), 4.78-4.75 (m, 1H, H-2′), 4.43-4.39 (m, 2H, H-3′, H-4′), 4.09 (s, 3H, CH.sub.3), 3.08-2.94 (m, 2H, Hz, H-5′); .sup.31P NMR (162 MHz, D.sub.2O) δ ppm 14.45 (s, 1P);

(46) HRMS ESI (−) calcd. m/z C.sub.11H.sub.15N.sub.5O.sub.7PS.sup.− [M−H].sup.−: 392.04353, found: 392.04378.

General Procedure of Synthesis of guanosine 5′-deoxy-5′-thioguanosine-5′-monophosphorothiolate imidazolides (FIG. 2, No. 9, 10)

(47) An appropriate starting compound (nucleotide TEA salt) (1 mmol), was mixed with imidazole (10 mmol) and 2,2′-dithiodipyridine (3 mmol) in DMF (to the nucleotide concentration of 0.15 M). Next, triethylamine (3 mmol) and triphenylphosphine (3 mmol) were added, and the mixture was stirred for 24 h at room temperature. Addition of an anhydrous solution of NaClO.sub.4 (4 mmol for each phosphate moiety) in dry acetone (volume 10× greater than the DMF added) resulted in precipitation of the product off the reaction mixture. After cooling to 4° C. the precipitate was filtered off, washed with cold, dry acetone and dried in vacuum over P.sub.4O.sub.10.

guanosine 5′-deoxy-5′-thioguanosine-5′-monophosphorothiolate imidazolide (FIG. 2, No. 9)

(48) Guanosine 5′-deoxy-5′-thioguanosine-5′-monophosphorothioate imidazolide (FIG. 2, no. 9) (352 mg, 0.75 mmol, 89%) was obtained starting from 5′-deoxy-5′-thioguanosine-5′-monophosphorothioate (FIG. 2, no. 7) (500 mg, 0.86 mmol) following the general procedure. t.sub.R (B)=8.27 min;

(49) .sup.31P NMR (162 MHz, D.sub.2O) δ ppm 11.69 (m, 1P);

(50) HRMS ESI (−) calcd. m/z for C.sub.13H.sub.15N.sub.7O.sub.6PS.sup.− [M−H].sup.−: 428.05476, found 428.05452.

5′-deoxy-5′-thioguanosine-7-methylguanosine-5′-monophosphorothiolate imidazolide (FIG. 2, No. 10)

(51) 5′-deoxy-5′-thioguanosine-7-methylguanosine-5′-monophosphorothioate imidazolide (FIG. 2, no. 10) (321 mg, 0.69 mmol, 82%) was obtained starting from 5′-deoxy-5′-thio-7-methylguanosine-5′-monophosphorothioate (FIG. 2, no. 8) (500 mg, 0.84 mmol) following the general procedure. t.sub.R (B)=8.39 min;

(52) HRMS ESI (−) calcd. m/z for C.sub.14H.sub.17N.sub.7O.sub.6PS.sup.− [M−H].sup.−: 442.07041, found 442.07070.

Guanosine 5′-deoxy-5′-thioguanosine-5′-diphosphorothiolate (FIG. 2, No. 11)

(53) Guanosine 5′-deoxy-5′-thioguanosine-5′-monophosphorothioate imidazolide (FIG. 2, no. 9) (100 mg, 0.22 mmol) was dissolved in anhydrous DMF (2 mL), and tris(triethylammonium) phosphate (100 mg, 0.26 mmol) was added, followed by addition of ZnCl.sub.2 (235.84 mg, 1.76 mmol). Reaction progress was controlled with RP-HPLC. The reaction mixture was stirred at room temperature until the disappearance of the starting material. Then, the reaction was stopped by addition of an aqueous solution of EDTA (513.92 mg, 1.76 mmol, 50 mL) and neutralized with 1M NaHCO.sub.3. Crude product was purified by ion exchange chromatography on DEAE-Sephadex and isolated as TEA salts. Yield: 108.5 mg (0.14 mmol, 65%);

(54) HRMS ESI (−) calcd. m/z for C.sub.10H.sub.14N.sub.5O.sub.10P.sub.2S.sup.− [M−H].sup.−: 457.99421, found 457.99481.

5′-deoxy-5′-thioguanosine-7-methylguanosine-diphosphate (FIG. 2, No. 12)

(55) 5′-deoxy-5′-thioguanosine-7-methylguanosine-5′-monophosphorothioate imidazolide (FIG. 2, no. 10) (100 mg, 0.21 mmol) was dissolved in anhydrous DMF (2 mL), and tris(triethylammonium)-phosphate (100 mg, 0.26 mmol) was added, followed by addition of ZnCl.sub.2 (224.54 mg, 1.68 mmol). Reaction progress was controlled with RP-HPLC. The reaction mixture was stirred at room temperature until the disappearance of the starting material. Then, the reaction was stopped by addition of an aqueous solution of EDTA (490.56 mg, 1.68 mmol, 50 mL) and neutralized with 1M NaHCO.sub.3. Crude product was purified by ion exchange chromatography on DEAE-Sephadex and isolated as TEA salts. Yield: 91 mg (0.12 mmol, 54%), t.sub.R (B)=5.07 min,

(56) .sup.1H NMR (400 MHz, D.sub.2O) δ ppm 8.11 (s, 1H, H-8 slowly exchangeable), 5.97 (d, 1H, J=3.91 Hz, H-1′), 4.50, 4.49 (2d, 1H, J=5.09 Hz, H-2′), 4.41 (q, 1H, J=5.48, 5.09 Hz, H-3′), 4.07 (s, 3H, CH.sub.3), 3.34-3.13 (m, 3H, H-4′, H-5′); .sup.31P NMR (162 MHz, D.sub.2O) δ ppm 6.71 (d, 1P, J=30.81 Hz), 8.21 (d, 1P, J=30.81 Hz);

(57) HRMS ESI (−) calcd. m/z for C.sub.11H.sub.16N.sub.5O.sub.10P.sub.2S— [M−H].sup.−: 472.00986, found 472.00967.

guanosine 5′-deoxy-5′-thio-7-methylguanosine-2′-diphosphorothiolate (FIG. 2, No. 13)

(58) 5′-deoxy-5′-thioguanosine-7-methylguanosine-5′-monophosphorothioate imidazolide (FIG. 2, no. 10) (100 mg, 0.21 mmol) was dissolved in anhydrous DMF (2 mL), and sodium thiophosphate (47 mg, 0.26 mmol) was added, followed by addition of ZnCl.sub.2 (224.54 mg, 1.68 mmol). Reaction progress was controlled with RP-HPLC. The reaction mixture was stirred at room temperature until the disappearance of the starting material. Then, the reaction was stopped by addition of an aqueous solution of EDTA (490.56 mg, 1.68 mmol, 50 mL) and neutralized with 1M NaHCO.sub.3. Crude product was purified by ion exchange chromatography on DEAE-Sephadex and the isolated TEA salt was used immediately in the coupling reaction. Yield: 110 mg (0.13 mmol, 64%);

(59) HRMS ESI (−) calcd. m/z for C.sub.11H.sub.16N.sub.5O.sub.9P.sub.2S.sub.2.sup.− [M−H].sup.−: 487.98702, found 487.98724.

Synthesis of 5′-S-Cap Analogs Via S-Alkylation

(60) General Procedure

(61) Nucleoside terminal thiophosphate TEA salt (1 equiv.) was suspended in DMSO (to concentration ca. 0.1-0.2 M). Then, DBU (1,8-diazabicyclo(5.4.0)undec-7-ene) (1 equiv.) and a derivative of 5′-iodoguanosine (1 equiv.) was added. The progress of the reaction was monitored by RP HPLC. The reaction was stopped after there was no signal from the terminal thiophosphate by addition of 1% acetic acid to pH=7, the reaction mixture was diluted with water and washed with ethyl acetate. Product was purified by ion exchange chromatography on DEAE-Sephadex and isolated as triethylammonium salt. The product was purified by semi-preparative RP-HPLC.

P1-(guanosin-5′-yl)-P2-(5′-deoxy-5′-thioguanosin-5′-yl) diphosphate-GppSG (FIG. 3, No. 19)

(62) GppSG (207 mOD, 0.009 mmol, 24%) was obtained starting from GDPβS (FIG. 3, nr 14), (506 mOD, 0.042 mmol) following the general procedure. RP-HPLC: t.sub.R (A)=6.9 min;

(63) .sup.1H NMR (400 MHz, D.sub.2O) δ ppm 7.96 (s, 1H), 7.81 (s, 1H), 5.77 (d, 1H, J=5.48 Hz), 5.70 (d, 1H, J=5.87 Hz), 4.80-4.70 (m, 2H, overlapped with water signal), 4.64 (t, 1H, J=5.48 Hz), 4.43 (t, 1H, t, J=3.91 Hz), 4.37 (t, 1H, J=3.91 Hz), 4.30-4.15 (m, 4H), 3.30-3.13 (m, 2H);

(64) .sup.31P NMR (162 MHz, D.sub.2O) δ ppm 7.63 (d, 1P, J=32.28, 12.5 Hz), -12.02 (d, 1P, J=30.81 Hz); HRMS ESI (−) calcd. m/z for C.sub.20H.sub.25N.sub.10O.sub.14P.sub.2S.sup.− [M−H].sup.−: 723.07531, found 723.07546.

P1-(7-methyl-guanosin-5′-yl)-P2-(5′-deoxy-5′-thioguanosin-5′-yl) diphosphate-m.SUP.7.GppSG (FIG. 3, No. 21)

(65) m.sup.7GppSG (1028 mOD, 0.045 mmol, 9%) was obtained starting from m.sup.7GDPβS (FIG. 3, No. 17, 5830 mOD, 0.51 mmol)) following the general procedure. RP-HPLC: t.sub.R (A)=5.9 min;

(66) .sup.1H NMR (400 MHz, D.sub.2O) δ ppm 8.98 (s, 1H, H-8 m.sup.7G), 7.87 (s, 1H, H-8 G), 5.88 (d, 1H, J=2.0 Hz, H-1′ m.sup.7G), 5.73 (d, 1H, J=5.7 Hz, H-1′ G), 4.69 (t, 1H, J=5.5 Hz, H-2′ G), 4.51 (bs., 1H, H-2′ m.sup.7G), 4.32-4.44 (m, 5H, H-3′ G, H-3′ m.sup.7G, H-4′ G, H-4′ m.sup.7G, H-5′ m.sup.7G), 4.24 (dd, 1H, J=11.3, 5.4 Hz, H5″ m.sup.7G), 4.04 (s, 3H, CH.sub.3), 3.24-3.41 (m, 2H, H5′, 5″ G);

(67) .sup.31P NMR (162 MHz, D.sub.2O) δ ppm 7.38 (dt, 1P, J=29.0, 11.5 Hz), -12.00 (d, 1P, J=32.23 Hz); HRMS ESI (−) calcd. m/z for C.sub.21H.sub.27N.sub.10O.sub.14P.sub.2S.sup.− [M−H].sup.−: 737.09096, found 737.09052.

P1-(7-methyl-5′-deoxy-5′-thioguanosin-5′-yl)-P2-guanosin-5′-yl diphosphate-m.SUP.7.GSppG (FIG. 3, No. 23)

(68) m.sup.7GSppG (1660 mOD, 0.073 mmol, 35%) was obtained starting from GDPβS (FIG. 3, No. 14; 2532 mOD, 0.21 mmol) following the general procedure. RP-HPLC: t.sub.R (A)=7.75 min;

(69) .sup.1H NMR (400 MHz, D.sub.2O) δ ppm 7.99 (s, 1H, H-8 G), 5.83 (d, 1H, J=4.2 Hz, H-1′ m.sup.7G), 5.80 (d, 1H, J=6.0 Hz, H-1′ G), 4.65-4.70 (2H, m, H-2′ G, H-2′ m.sup.7G), 4.45 (t, 1H, J=4.1 Hz, H-3′ G), 4.19-4.41 (5H, m, H-3′ m.sup.7G, H-4′ G, H-4′ m.sup.7G, H5′, 5″ G), 4.05 (s, 3H, CH.sub.3), 3.35-3.43 (m, 2H, H5′, 5″ m.sup.7G);

(70) .sup.31P NMR (162 MHz, D.sub.2O) δ ppm 7.32 (dt, 1P, J=29.0, 11.0 Hz), -11.84 (d, 1P, J=29.00 Hz); HRMS ESI (−) calcd. m/z for C.sub.21H.sub.27N.sub.10O.sub.14P.sub.2S.sup.− [M−H].sup.−: 737.09096, found 737.09146.

P1-(guanosin-5′-yl)-P3-(5′-deoxy-5′-thioguanosin-5′-yl) trifphosphate—GpppSG (FIG. 3, No. 20)

(71) GpppSG (1149 mOD, 0.051 mmol, 51%) was obtained starting from GTP.sub.γS (FIG. 3, No. 15; 1233 mOD, 0.10 mmol) following the general procedure. RP-HPLC: t.sub.R (A)=5.50 min;

(72) .sup.1H NMR (400 MHz, D.sub.2O) δ ppm 8.02 (s, 1H, H-8 G), 7.90 (s, 1H, H-8 G), 5.82 (d, 1H, J=6.0 Hz, H-1′ G), 5.78 (d, 1H, J=6.2 Hz, H-1′ G), 4.84 (t, 1H, J=5.7 Hz, H-2′ G), 4.74 (t, 1H, J=5.7 Hz, H-2′ G), 4.52 (t, 1H, J=4.2 Hz, H-3′ G), 4.47 (t, 1H, J=4.3 Hz, H-3′ G), 4.30-4.38 (m, 2H, H-4′, 5′ G), 4.27 (m, 2H, H-4′, 5″ G), 3.25-3.35 (m, 2H, H5′, 5″ G);

(73) .sup.31P NMR (162 MHz, D.sub.2O) δ ppm 8.21 (dt, 1P, J=27.00, 13.3 Hz), -11.34 (d, 1P, J=19.30 Hz), −23.78 (dd, 1P, J=27.00, 19.30 Hz);

(74) HRMS ESI (−) calcd. m/z for C.sub.20H.sub.26N.sub.10O.sub.17P.sub.3S.sup.− [M−H].sup.−: 803.04164, found 803.04135.

P1-(7-methyl-5′-deoxy-5′-thioguanosin-5′-yl)-P3-guanosin-5′-yl triphosphate-m.SUP.7.GSpppG (FIG. 3, No. 24)

(75) m.sup.7GSpppG (729 mOD, 0.032 mmol, 13%) was obtained starting from GTP.sub.γS (FIG. 3, No. 15; 3000 mOD, 0.25 mmol) following the general procedure. RP-HPLC: t.sub.R (A)=5.36 min;

(76) .sup.1H NMR (400 MHz, D.sub.2O) δ ppm 8.92 (s, 1H, H-8 m.sup.7G), 7.96 (s, 1H, H-8 G), 5.78 (d, 1H, J=4.30 Hz, H-1′ m.sup.7G), 5.74 (d, 1H, J=5.87 Hz, H-1′ G), 4.63 (m, 2H, H-2′ G, H2′ m.sup.7G), 4.48 (dd, 1H, J=4.43, 3.52 Hz, H-3′ m.sup.7G), 4.36-4.26 (m, 4H, H-3′ G, H-4′ G, H-4′ m.sup.7G, H-5′ G), 4.24-4.19 (m, 1H, H-5″ G), 4.00 (s, 3H, CH.sub.3), 3.33-3.24 (2H, m, H-5′, 5″ m.sup.7G);

(77) .sup.31P NMR (162 MHz, D.sub.2O) δ ppm 7.57 (d, 1P, J=27.88 Hz), -11.68 (d, 1P, J=20.54 Hz), -24.00 (dd, 1P, J=29.35, 22.01 Hz);

(78) HRMS ESI (−) calcd. m/z for C.sub.21H.sub.28N.sub.10O.sub.17P.sub.3S.sup.− [M−H].sup.− 817.05729, found 817.05494.

P1-(7-methyl-guanosin-5′-yl)-P3-(5′-deoxy-5′-thioguanosin-5′-yl) triphosphate-m.SUP.7.GpppSG (FIG. 3, No. 22)

(79) m.sup.7GpppSG (1582 mOD, 0.07 mmol, 32%) was obtained starting from m.sup.7GTP.sub.γS (FIG. 3, No. 18; 2616 mOD, 0.23 mmol) following the general procedure. RP-HPLC: t.sub.R (A)=6.06 min;

(80) .sup.1H NMR (400 MHz, D.sub.2O) δ ppm 9.02 (s, 1H, H-8 m.sup.7G), 7.87 (s, 1H, H-8 G), 5.84 (d, 1H, J=3.52 Hz, Ht m.sup.7G), 5.70 (d, 1H, J=6.65 Hz, H-1′ G), 4.80-4.67 (m, 1H, H-2′ G), 4.52 (t, 1H, J=4.30 Hz, H-2′ m.sup.7G), 4.41 (dd, 2H, J=4.70, 4.30 Hz, H3′ G, H3′ m.sup.7G), 4.38-4.30 (m, 2H, H-4′ G, H-4′ m.sup.7G), 4.36-4.31 m, 2H, H5′ m.sup.7G), 4.02 (s, 3H, CH.sub.3), 3.30-3.20 (m, 2H, J=12.6, 6.3 Hz, H5′, 5″ G);

(81) .sup.31P NMR (162 MHz, D.sub.2O) δ ppm 7.66 (d, 1P, J=29.35 Hz), -11.73 (d, 1P, J=22.01 Hz), -23.95 (dd, 1P, J=22.01, 27.88 Hz);

(82) HRMS ESI (−) calcd. m/z for C.sub.21H.sub.28N.sub.10O.sub.17P.sub.3S.sup.− [M−H].sup.−: 817.05729, found 817.05748.

P1-(2′-O-methyl-7-methyl-5′-deoxy-5′-thioguanosin-5′-yl)-P3-guanosin-5′-yl triphosphate-m.SUB.2..SUP.7,2′-O.GSpppG (FIG. 3, No. 26)

(83) m.sub.2.sup.7,2′-OGSpppG (140 mOD, 0.006 mmol, 5%) was obtained starting from GTP.sub.γS (FIG. 3, No. 15; 1500 mOD, 0.12 mmol) following the general procedure. RP-HPLC: t.sub.R (A)=7.89 min;

(84) .sup.1H NMR (400 MHz, D.sub.2O) δ ppm 7.93 (s, 1H, G), 5.81 (d, 1H, J=3.91 Hz, H-1′ m.sup.7G), 5.72 (d, 1H, J=6.26 Hz, H-1′ G), 4.65 (t, 1H, J=5.48 Hz, H-2′ m.sup.7G), 4.43-4.40 (m, 1H, H-2′, G, H-3′ m.sup.7G), 4.32-4.18 (m, 6H, H-3′ G, H-4′, H-5′, G, m.sup.7G), 4.01 (s, 3H, CH.sub.3), 3.52 (s, 3H, OCH.sub.3);

(85) .sup.31P NMR (162 MHz, D.sub.2O) δ ppm 7.35 (d, 1P, J=26.41 Hz), -11.68 (d, 1P, J=19.07 Hz), -24.02, -24.18 (2d, 1P, J=26.41, 19.07 Hz);

(86) HRMS ESI (−) calcd. m/z for C.sub.22H.sub.30N.sub.10O.sub.17P.sub.3S.sup.− [M−H].sup.− 831.07294, found 831.07477.

P1-(7-methyl-5′-deoxy-5′-thioguanosin-5′-yl)-P3-guanosin-5′-yl-2,3-methylenotriphosphate-m.SUP.7.GSppCH.SUB.2.pG (FIG. 3, No. 25)

(87) m.sup.7GSppCH.sub.2pG (353 mOD, 0.016 mmol, 27%) was obtained starting from m.sup.7GpCH.sub.2ppγS (FIG. 3, no. 16; 717 mOD, 0.06 mmol) following the general procedure. RP-HPLC: t.sub.R (A)=6.36 min;

(88) .sup.1H NMR (400 MHz, D.sub.2O) δ ppm 9.03 (s, 1H, H-8, m.sup.7G), 8.17 (s, 1H, G), 5.83 (d, 1H, J=4.30 Hz, H-1′ m.sup.7G), 5.78 (d, 1H, J=4.48 Hz, H-1′ G), 4.70-4.66 (m, 2H, H-2′ m.sup.7G, H-2′, G), 4.46 (d, 1H, J=3.91, 5.09 Hz, H-3′, G), 4.38-4.33 (m, 2H, H-3′, m.sup.7G, H-4′, G), 4.32-4.28 (m, 1H, H-4′, m.sup.7G), 4.26-4.20 (m, 1H, H-5′, G), 4.19-4.13 (m, 1H, H-5″ G), 4.02 (s, 3H, CH.sub.3), 3.34-3.22 (m, 4H, H-5′, G, m.sup.7G); .sup.31P NMR (162 MHz, D.sub.2O) δ ppm

(89) .sup.31P NMR (162 MHz, D.sub.2O) δ ppm 17.03 (d, 1P, J=10.27 Hz), 7.47-6.97 (m, 2P);

(90) HRMS ESI (−) calcd. m/z for C.sub.22H.sub.30N.sub.10O.sub.16P.sub.3S.sup.− [M−H].sup.− 815.07803, found 815.07923.

Synthesis of 5′-S-Cap Analogs Via Imidazolides

(91) General Procedure

(92) 5'S-GMP-Im, (FIG. 2, no. 9) (Na salt, 50 mg, 0.11 mmol) and appropriate diphosphate (1 mmol): m.sub.2.sup.7,2′-OGDP (FIG. 4, No. 28), m.sup.7GpCH.sub.2p (FIG. 4, No. 27), m.sup.7-5'S GDP (FIG. 2, no. 12), m.sup.7GSppβS (FIG. 2, no. 13) or m.sup.7GDPβS (FIG. 3, No. 17) were suspended in anhydrous DMF (1.0 mL) followed by addition of anhydrous ZnCl.sub.2 (95 mg, 10 eq, 0.7 mmol). The reaction mixture was vigorously shaken until the reagents dissolved. The reaction progress was monitored by RP-HPLC. After completion (24 h), appropriate amount of EDTA solution (Na.sub.2EDTA, 237 mg, 0.7 mmol) was added, pH was adjusted to 6 with solid NaHCO.sub.3, followed by purification of the crude product by ion exchange chromatography by DEAE-Sephadex and isolated as TEA salts (or directly purified by preparative HPLC). The products were then additionally purified by RP-HPLC.

P1-(2′-O-methyl-7-methyl-guanosin-5′-yl)-P3-(5′-deoxy-5′-thioguanosin-5′-yl) triphosphate-m.SUB.2..SUP.7,2′-O.GpppSG (FIG. 4, No. 38)

(93) m.sub.2.sup.7,2′-OGpppSG (122 mOD, 0.005 mmol, 6%) was obtained starting from m.sub.2.sup.7,2′-OGDP (FIG. 4, No. 28; 912 mOD, 0.08 mmol) following the general procedure. RP-HPLC: t.sub.R (A)=6.29 min;

(94) .sup.1H NMR (400 MHz, D.sub.2O) δ ppm 9.00 (s, 1H, H-8 m.sup.7G), 7.88 (s, 1H, G), 5.87 (d, 1H, J=2.74 Hz, H-1′ m.sup.7G), 5.69 (d, 1H, J=6.65 Hz, H-1′ G), 4.64 (t, 1H, J=5.48 Hz, H-2′ m.sup.7G), 4.48 (dd, 1H, J=4.48 Hz, H-2′, G), 4.43-4.38 (m, 2H, H-3′, G, H-3′, m7G), 4.36-4.32 (m, 1H, H-4′, G), 4.30-4.26 (m, 1H, H-4′, m.sup.7G), 4.25-4.16 (m, 2H, H-5′, G), 4.03 (s, 3H, CH3), 3.53 (s, 3H, OCH.sub.3), 3.30-3.22 (m, 2H, H-5′, m.sup.7G);

(95) .sup.31P NMR (162 MHz, D.sub.2O) δ ppm 7.68 (d, 1P, J=27.88 Hz), -11.68 (d, 1P, J=20.54 Hz), −23.78, -23.94 (2d, 1P, J=27.88, 19.07 Hz);

(96) HRMS ESI (−) calcd. m/z for C.sub.22H.sub.30N.sub.10O.sub.17P.sub.3S.sup.− [M−H].sup.− 831.07294, found 831.07350.

P1-(7-methyl-5′-deoxy-5′-tioguanozyn-5′-yl)-P3-guanosin-5′-yl 1,2-methylenetriphosphate-m.SUP.7.GpCH.SUB.2.ppSG (FIG. 4, No. 37)

(97) m.sup.7GpCH.sub.2ppSG (1002 mOD, 0.044 mmol, 25%) was obtained starting from m.sup.7GpCH.sub.2p (FIG. 4, no. 27; 2052 mOD, 0.18 mmol) and 5′-S-GMP-Im (122 mg, 0.27 mmol) following the general procedure. RP-HPLC: t.sub.R (A)=6.26 min,

(98) .sup.1H NMR (400 MHz, D.sub.2O) δ ppm 9.31 (s, 1H, H-8, m.sup.7G), 8.02 (s, 1H, G), 5.90 (d, 1H, J=3.13 Hz, H-1′ m.sup.7G), 5.75 (d, 1H, J=5.87 Hz, H-1′ G), 4.80-4.70 (m, 2H, overlapped with solvent signal, H-2′ m.sup.7G, H-2′, G), 4.58 (dd, 1H, J=3.91, 3.48 Hz, H-3′, G), 4.48 (t, 1H, H-3′, m.sup.7G), 4.40 (dd, 1H, J=3.91, 4.06, H-4′, G), 4.37-4.29 (m, 3H, H-4′, m.sup.7G, H-5′, G), 4.19-4.13 (m, 2H, H-5′, G), 4.03 (s, 3H, CH.sub.3), 3.30-3.19 (m, 2H, H-5′, G, m.sup.7G), 2.40 (t, 2H, J=20.35 Hz, CH.sub.2);

(99) .sup.31P NMR (162 MHz, D.sub.2O) δ ppm 17.11 (d, 1P, J=8.80 Hz), 7.64-6.76 (m, 2P);

(100) HRMS ESI (−) calcd. m/z for C.sub.22H.sub.30N.sub.10O.sub.16P.sub.3S.sup.− [M−H].sup.− 815.07803, found 815.07906.

P1-(7-methyl-5′-deoxy-5′-thioguanozy-5′-yl)-P3-(5′-deoxy-5′-thioguanosin-5′-yl) triphosphate-m.SUP.7.GSpppSG (FIG. 4, No. 32)

(101) m.sup.7GSpppSG (768 mOD, 32 mg, 0.028 mmol, 40%) was obtained starting from m.sup.7-5′S-GDP (57 mg, 0.07 mmol) and 5′S-GMP-Im (50 mg, 0.11 mmol) following the general procedure. RP-HPLC: t.sub.R (A)=6.80 min;

(102) .sup.1H NMR (400 MHz, D.sub.2O) δ ppm 8.38 (s, 1H, H-8 m.sup.7G slowly exchangeable), 7.84 (s, 1H, G), 5.78 (d, 1H, J=4.70 Hz, H-1′ m.sup.7G), 5.69 (d, 1H, J=6.65 Hz, H-1′ G), 4.64 (t, 1H, J=4.70 Hz, H-2′ m.sup.7G), 4.40, 4.39 (2d, 1H, J=2.74, 3.52, 4.40 Hz, H-3′, G), 4.36-4.29 (m, 3H, H-4′ G, H-5′, G), 3.99 (s, 3H, CH.sub.3), 4.37-4.28 (m, 3H, H-4′, H-5′, m.sup.7G);

(103) .sup.31P NMR (162 MHz, D.sub.2O) δ ppm 7.74 (t, 2P, J=27.88), -24.61 (t, 1P, J=29.35 Hz);

(104) HRMS ESI (−) calcd. m/z for C.sub.21H.sub.28N.sub.10O.sub.16P.sub.3S.sub.2.sup.− [M−H].sup.− 833.03445, found 833.03550.

P1-(7-methyl-5′-deoxy-5′-thioguanosin-5′-yl)-P3-guanosin-5′-yl 2-thiotriphosphate m.SUP.7.GSpp.SUB.s.pG D1/D2 (FIG. 4, No. 30, 31, respectively)

(105) m.sup.7GSpp.sub.spG (1080 mOD, 45 mg, 0.039 mmol, 56%) was obtained as a mixture of diastareoisomers D1/D2 starting from m.sup.7GSppβS (56 mg, 0.07 mmol) and 5′S-GMP-Im (50 mg, 0.11 mmol) following the general procedure. Diastereoisomers were separated using RP-HPLC and isolated as ammonium salts. D1 (FIG. 4, No. 30): (438 mOD, 18 mg, 0.016 mmol, 23%) RP-HPLC: t.sub.R (A)=6.56 min;

(106) .sup.1H NMR (400 MHz, D.sub.2O) δ ppm 8.98 (s, 1H, H-8, m.sup.7G), 8.08 (s, 1H, G), 5.82 (d, 1H, J=4.27 Hz, H-1′ m.sup.7G), 5.77 (d, 1H, J=5.80 Hz, H-1′ G), 4.67-4.65 (m, 2H, H-2′ m.sup.7G, H-2′, G), 4.49-4.47 (m, 1H, H-3′, G), 4.39-4.35 (m, 1H, H-3′, m.sup.7G, H-4′, G), 4.33-4.23 (m, 3H, H-4′, m.sup.7G, H-5′, G), 4.02 (s, 3H, CH.sub.3), 3.38-3.25 (m, 2H, H-5′, m.sup.7G);

(107) .sup.31P NMR (162 MHz, D.sub.2O) δ ppm 29.18 (dd, 1P, J=34.83, 27.37 Hz), 6.96 (dt, 1P, J=34.83, 12.44 Hz), -12.37 (d, 1P, J=27.37 Hz);

(108) HRMS ESI (−) calcd. m/z for C.sub.21H.sub.28N.sub.10O.sub.16P.sub.3S.sub.2.sup.− [M−H].sup.−: 833.03445, found 833.03549.

(109) D2 (FIG. 4, No. 31): m.sup.7GSpp.sub.spG D2 (380 mOD, 16 mg, 0.014 mmol, 20%) RP-HPLC: t.sub.R (A)=6.71 min;

(110) .sup.1H NMR (400 MHz, D.sub.2O) δ ppm 8.98 (s, 1H, H-8, m.sup.7G), 8.14 (s, 1H, G), 5.82 (d, 1H, J=4.27 Hz, H-1′ m.sup.7G), 5.77 (d, 1H, J=5.49 Hz, H-1′ G), 4.69-4.65 (m, 2H, H-2′ m.sup.7G, H-2′, G), 4.49-4.45 (m, 1H, H-3′, G), 4.40-4.35 (m, 1H, H-3′, m.sup.7G, H-4′, G), 4.34-4.21 (m, 3H, H-4′, m.sup.7G, H-5′, G), 4.03 (s, 3H, CH.sub.3), 3.39-3.24 (m, 2H, H-5′, m.sup.7G);

(111) .sup.31P NMR (162 MHz, D.sub.2O) δ ppm 29.44-28.67 (m, 1P), 7.17-6.54 (m, 1P), −12.09-(−12.72) (m, 1P);

(112) HRMS ESI (−) calcd. m/z for C.sub.21H.sub.28N.sub.10O.sub.16P.sub.3S.sub.2.sup.− [M−H].sup.−: 833.03445, found 833.03606.

P1-(7-methyl-5′-deoxy-5′-thioguanosin-5′-yl)-P3-(5′-deoxy-5′-thioguanosin-5′-yl) 2-tiotriphosphate-m.SUP.7.GSpp.SUB.s.pSG D1/D2 (FIG. 4, No. 33, 34, Respectively)

(113) m.sup.7GSpp.sub.spSG (942 mOD, 39 mg, 0.003 mmol, 48%) was obtained as a mixture of diastareoisomers D1/D2 starting from m.sup.7GSppβS (56 mg, 0.07 mmol) and 5'S-GMP-Im (50 mg, 0.11 mmol) following the general procedure. Diastereoisomers were separated using RP-HPLC and isolated as ammonium salts. D1 (FIG. 4, No. 33) (510 mOD, 21 mg, 0.018 mmol, 26%) RP-HPLC: t.sub.R (A)=7.53 min;

(114) .sup.1H NMR (400 MHz, D.sub.2O) δ ppm 9.00 (s, 1H, H-8, m.sup.7G), 7.99 (s, 1H, G), 5.83 (d, 1H, J=4.27 Hz, H-1′ m.sup.7G), 5.75 (d, 1H, J=6.10 Hz, H-1′ G), 4.79-4.68 (m, 2H, overlapped with solvent signal, H-2′ m.sup.7G, H-2′, G), 4.44 (dd, 1H, J=4.58 Hz, H-3′, G), 4.41-4.33 (m, 3H, H-3′, m.sup.7G, H-4′, G, m.sup.7G), 4.03 (s, 3H, CH.sub.3), 3.39-3.26 (m, 4H, H-5′, G, m.sup.7G);

(115) .sup.31P NMR (162 MHz, D.sub.2O) δ ppm 28.25 (t, 1P, J=34.83 Hz), 7.31-6.74 (m, 2P);

(116) HRMS ESI (−) calcd. m/z for C.sub.21H.sub.28N.sub.10O.sub.15P.sub.3S.sub.3.sup.− [M−H].sup.−: 849.01161, found 849.01213.

(117) D2 (FIG. 4, No. 34) (274 mOD, 11 mg, 0.0098 mmol, 14%), RP-HPLC: t.sub.R (A)=7.62 min;

(118) .sup.1H NMR (400 MHz, D.sub.2O) δ ppm 8.99 (s, 1H, H-8, m.sup.7G), 8.04 (s, 1H, G), 5.83 (d, 1H, J=4.58 Hz, H-1′ m.sup.7G), 5.75 (d, 1H, J=6.10 Hz, H-1′ G), 4.78-4.66 (m, 2H, overlapped with solvent signal, H-2′ m.sup.7G, H-2′, G), 4.46-4.42 (m, 1H, H-3′, G), 4.41-4.34 (m, 3H, H-3′, m.sup.7G, H-4′, G, m.sup.7G), 4.04 (s, 3H, CH.sub.3), 3.39-3.24 (m, 4H, H-5′, G, m.sup.7G);

(119) .sup.31P NMR (162 MHz, D.sub.2O) δ ppm 28.29 (t, 1P, J=34.83 Hz), 7.32-6.68 (m, 2P);

(120) HRMS ESI (−) calcd. m/z for C.sub.21H.sub.28N.sub.10O.sub.15P.sub.3S.sub.3.sup.− [M−H].sup.−: 849.01161, found 849.01217.

P1-(7-methyl-guanosin-5′-yl)-P3-(5′-deoxy-5′-thioguanosin-5′-yl) 2-thiotriphosphate-m.SUP.7.Gpp.SUB.s.pSG D1/D2 (FIG. 4, No. 35, 36, Respectively)

(121) m.sup.7GppspSG (1941 mOD, 0.086 mmol, 28%) was obtained as a mixture of diastareoisomers D1/D2 starting from m.sup.7GDPβS (3492 mOD, 0.31 mmol) and 5′S-GMP-Im (5550 mOD, 0.46 mmol) following the general procedure. Diastereoisomers were separated using RP-HPLC and isolated as ammonium salts. D1 (FIG. 4, No. 35): (888 mOD, 0.039 mmol, 13%) RP-HPLC: t.sub.R (A)=7.12 min;

(122) .sup.1H NMR (400 MHz, D.sub.2O) δ ppm 9.07 (s, 1H, H-8, m.sup.7G), 7.95 (s, 1H, G), 5.88 (d, 1H, J=3.52 Hz, H-1′ m.sup.7G), 5.74 (d, 1H, J=6.26 Hz, H-1′ G), 4.80-4.70 (m, 2H, H-2′ m.sup.7G, H-2′, G overlapped with D20 signal), 4.56 (dd, 1H, J=4.70, 3.52 Hz, H-3′, G), 4.47-4.40 (m, 2H, H-3′, m.sup.7G, H-4′, G), 4.39-4.33 (m, 3H, H-4′, m.sup.7G, H-5′, G), 4.03 (s, 3H, CH.sub.3), 3.35-3.20 (m, 2H, H-5′, m.sup.7G);

(123) .sup.31P NMR (162 MHz, D.sub.2O) δ ppm 29.00 (dd, 1P, J=33.75, 26.41 Hz), 6.98 (d, 1P, J=33.75, Hz), −12.56 (d, 1P, J=24.94 Hz);

(124) HRMS ESI (−) calcd. m/z for C.sub.21H.sub.28N.sub.10O.sub.16P.sub.3S.sub.2.sup.− [M−H].sup.−: 833.03445, found 833.03514.

(125) D2 (FIG. 4, No. 36): m.sup.7GppspG D2 (1053 mOD, 0.046 mmol, 15%) RP-HPLC: t.sub.R (A)=7.42 min;

(126) .sup.1H NMR (400 MHz, D.sub.2O) δ ppm 9.04 (s, 1H, H-8, m.sup.7G), 7.95 (s, 1H, G), 5.85 (d, 1H, J=3.52 Hz, H-1′ m.sup.7G), 5.73 (d, 1H, J=6.26 Hz, H-1′ G), 4.80-4.70 (m, 2H, H-2′ m.sup.7G, H-2′, G overlapped with D.sub.2O signal), 4.54 (dd, 1H, J=4.30, 3.91 Hz, H-3′, G), 4.45 (t, 1H, J=5.09 Hz, H-3′, m.sup.7G), 4.43-4.40 (m, 1H, H-4′, G), 4.39-4.32 (m, 3H, H-4′, m.sup.7G, H-5′, G), 4.03 (s, 3H, CH.sub.3), 3.37-3.21 (m, 2H, H-5′, m.sup.7G);

(127) .sup.31P NMR (162 MHz, D.sub.2O) δ ppm 28.99 (dd, 1P, J=33.75, 26.41, 24.94 Hz), 6.94 (d, 1P, J=35.21, Hz), -12.48 (d, 1P, J=24.94 Hz);

(128) HRMS ESI (−) calcd. m/z for C.sub.21H.sub.28N.sub.10O.sub.16P.sub.3S.sub.2.sup.− [M−H].sup.−: 833.03445, found 833.03494.

(129) TABLE-US-00006 TABLE 4 Synthesised and studied new cap analogs are presented. Num- ber Compound Structural formula Chemical name 12 m.sup.7GSpp 0embedded image 5′-deoxy-5′- thioguanosin-5′-7- methyloguanosine diphosphate 21 m.sup.7GppSG embedded image P1-(7-methyl- guanosin-5-yl)-P2- (5-deoxy-5′- thioguanosin-5′-yl) diphosphate 22 m.sup.7GpppSG embedded image P1-(7-methyl- guanosin-5′-yl)-P3- (5′-deoxy-5′- thioguanosin-5′-yl) triphosphate 23 m.sup.7GSppG embedded image P1-(7-methyl-5′- deoxy-5′- thioguanosin-5′-yl)- P2-guanosin-5′-yl diphosphate 24 m.sup.7GSpppG embedded image P1-(7-methyl-5′- deoxy-5′- thioguanosin-5′-yl)- P3-guanosin-5′-yl triphosphate 25 m.sup.7GSppCH.sub.2pG embedded image P1-(7-methyl-5′- deoxy-5′- thioguanosin-5′-yl)- P3-guanosin-5′-yl 2,3- metylenetriphosphate 26 m.sup.7,2′OGSpppG embedded image P1-(2′-O-methyl-7- methylo-5′-deoxy-5′- thioguanosin-5′-ylo)- P3-guanosin-5′-yl triphosphate 30 m.sup.7GSpp.sub.spG D1 embedded image P1-(7-methyl-5′- deoxy-5′- thioguanosin-5′-yl)- P3-guariosin-5′-yl 2- triphosphate D1 31 m.sup.7GSpp.sub.spG D2 embedded image P1-(7-methyl-5′- deoxy-5′- thioguanosin-5′-yl)- P3-guanosin-5′-yl 2- triphosphate D2 32 m.sup.7GSpppSG embedded image P1-(7-methyl-5′- deoxy-5′- thioguanosin-5′-yl)- P3-(5′-deoxy-5′- thioguanosin-5′-yl) triphosphate 33 m.sup.7GSpp.sub.spSG D1 0embedded image P1-(7-methyl-5′- deoxy5′- thioguanosin-5′-yl)- P3-(5′-deoxy-5′- thioguanosin-5′-yl) 2-triphosphate D1 34 m.sup.7GSpp.sub.spSG D2 embedded image P1-(7-methyl-5′- deoxy-5′- thioguanosin-5′-yl)- P3-(5′-deoxy-5′- thioguanosin-5′-yl) 2-triphosphate D2 35 m.sup.7Gpp.sub.spSG D1 embedded image P1-(7-methyl- guanosin-5′-yl)-P3- (5′-deoxy-5′- thioguanosin-5′-yl) 2-triphosphate D1 36 m.sup.7Gpp.sub.spSG D2 embedded image P1-(7-methyl- guanosin-5′-yl)-P3- (5′-deoxy-5′- thioguanosin-5′-yl) 2-triphosphate D2 37 m.sup.7GpCH.sub.2ppSG embedded image P1-(7-methyl-5′- deoxy-5′- thioguanosin-5′-yl)- P3-guanosin-5′-yl 1,2- metylenetriphosphate 38 m.sup.7,2′OGpppSG embedded image P1-(2′-O-methyl-7- methyl-guanosin-5′- yl)-P3-(5′-deoxy-5′- htioguanosin-5′-yl) triphosphate

Example 2. New Cap Analogs Characteristics

(130) Test 1. The Susceptibility Study of Analogs to Degradation by DcpS Enzyme.

(131) The aim of the test was to check if new 5′-thiophosphate cap analogs are hydrolyzed by human DcpS enzyme (hDcpS). Recombinant human protein encoding DcpS enzyme was expressed as described previously (Kowalska, Lewdorowicz et al. 2008). The susceptibility of new analogs to hDcpS hydrolysis is tested in 50 mM Tris-HCl buffer containing 200 mM KCl and 0.5 mM EDTA. Reaction mixture includes the tested cap analog (20 μM) and hDcpS enzyme (100 nM) in 400 μl of buffer. At the appropriate intervals 100 μl sample is collected from the reaction mixture. Sample is incubated at 98° C. for 2.5 min, and then cooled to 0° C. and analyzed on RP-HPLC under conditions described in general informations. In tests also commercially available inhibitor of DcpS was tested, the compound RG3039 (no. 000) (https://www.mda.org/quest/fda-approves-phase-1-clinical-trial-rg3039-sma), GppSG (no. 19), GpppSG (no. 20), as well m.sup.7GpppG (no. 0) and m.sup.7Gpp (no. 00) as controls. Exemplary results obtained are shown on FIG. 5 and Table 5.

(132) Test 2. IC.sub.50 Determination for Selected Inhibitors

(133) The purpose of the test was to determine the concentration, wherein the given inhibitor inhibits DcpS activity to 50% of the maximal value in the particular conditions. The buffer in this test and in the test 1 is the same. Ten mixture reactions were prepared at the same time and each of them contained a m.sup.7GMPF (60 μM), hDcpS enzyme (50 nM) and the tested compound in concentration range between 0-50 μM in 200 μl of buffer. After appropriate time, when 30% of substrate were converted into product without inhibitor, the reaction was stopped by mixing with 100 μl of ACN. Samples of 25 μl were taken for analysis, followed by mixing with 90 μl of TBDS-fluorescein solution of concentration 2.5 μM in DMSO and incubated for 60 min. Next, 100 μl of 200 mM HEPES buffer pH=7.0 was added to the samples and the fluorescence was measured as described in general information. Based on the results, dependence of inhibitor concentration vs. fluorescence were plotted and the IC.sub.50 values were determined by fitting theoretical curve to data. Obtained results are presented in Table 5 and FIG. 5.

(134) TABLE-US-00007 TABLE 5 IC.sub.50 values and susceptibility for degradation by DcpS enzyme for selected compounds. No. Compound DcpS susceptibility IC.sub.50 [μM]  0 m.sup.7GpppG hydrolyzable nd 00 m.sup.7Gpp resistant/inhibitor 4.30 ± 0.78 000 RG3039 resistant/inhibitor 0.041 ± 0.012 12 m.sup.7GSpp resistant/inhibitor 1.93 ± 0.38 19 GppSG hydrolyzable above 100 20 GpppSG hydrolyzable above 100 21 m.sup.7GppSG hydrolyzable nd 22 m.sup.7GpppSG hydrolyzable nd 23 m.sup.7GSppG resistant/inhibitor 2.81 ± 0.51 24 m.sup.7GSpppG resistant/inhibitor 0.84 ± 0.07 25 m.sup.7GSppCH.sub.2pG resistant/inhibitor 6.25 ± 1.22 26 m.sup.7,2′OGSpppG resistant/inhibitor 12.57 ± 5.22  30 m.sup.7GSpp.sub.spG D1 resistant/inhibitor 0.23 ± 0.04 31 m.sup.7GSpp.sub.spG D2 resistant/inhibitor 0.17 ± 0.02 32 m.sup.7GSpppSG resistant/inhibitor 0.33 ± 0.09 33 m.sup.7GSpp.sub.spSG D1 resistant/inhibitor 0.26 ± 0.04 34 m.sup.7GSpp.sub.spSG D2 resistant/inhibitor 0.051 ± 0.008 35 m.sup.7Gpp.sub.spSG D1 hydrolyzable nd 36 m.sup.7Gpp.sub.spSG D2 hydrolyzable nd 37 m.sup.7GpCH.sub.2ppSG resistant/inhibitor 5.67 ± 1.01 38 m.sup.7,2′OGpppSG hydrolyzable 72 ± 17
Test 3. Structure Determination of Human DcpS Enzyme (ΔN37hDcpS) in Complex with Analog No. 34 (m.sup.7GSpp.sub.spSG D2)

(135) The aim of this test was to study the mechanism of interactions of analog no. 34 with human DcpS enzyme. Recombinant human DcpS enzyme truncated at the N-terminus (ΔN37-residues Ala38 to Ser337) was obtained as described earlier (Singh et al. 2008). Crystallization by sitting drop vapor diffusion was performed using 0.2 uL of sample containing 0.1 M analog 34 and 7.3 mg/mL DcpS enzyme (incubated on ice for 15 min prior to crystallization setup) and 0.2 uL of reservoir solution. Complex crystals appeared in a mixture containing 29% PEG 4000 and 0.1M Tris.HCl pH 7.6 after about a week. To the drop containing crystal a mixture of reservoir solution and glycerol (1:1 v/v) was added and then the crystals were harvested and flash frozen in liquid nitrogen. The diffraction data were collected at 100K at synchrotron source (Beamline 14.1, Bessy II, Helmholtz-Zentrum Berlin, Germany) using a Dectris PILATUS 6M detector and then data were processed using XDS software (Kabsch 2010). The structure was solved by Molecular Replacement using Phaser software (McCoy, Grosse-Kunstleve et al. 2007) with a structure of DcpS bound to DG157493 inhibitor (pdb: 3BL9) (Singh, Salcius et al. 2008) as a search model. Ligand model and dictionary were generated using ProDRG (Schuttelkopf and van Aalten 2004). The model building and ligand fitting was performed in Coot software (Emsley & Cowtan 2004). The structure was refined using phenix.refine (Adams, Afonine et al. 2010).

(136) Test 4. Susceptibility Study of Short RNA Molecules Comprising Cap Analogs at the 5′ End to Degradation with the Dcp1/2 Enzyme.

(137) The aim of this study was to check whether incorporation of selected 5′-phosphothioate cap analogs to 5′ end of RNA could influence susceptibility of thus prepared transcripts towards Dcp1/2 decapping enzyme activity. Schizosaccharomyces pombe recombinant protein in the form of a heterodimer Dcp1/2 was obtained as described previously (Floor, Jones et al. 2010). The trancripts utilized in this assay were obtained by transcription in vitro using RNA SP6 polymerase (New England BioLabs). Annealed oligonucleotides: ATACGATTTAGGTGACACTATAGAAGAAGCGGGCATGCGGCCAGCCATAGCCGATCA (SEQ ID NO.: 1), and TGATCGGCTATGGCTGGCCGCATGCCCGCTTCTTCTATAGTGTCACCTAAATCGTAT (SEQ ID NO: 2) were used as a template in in vitro transcription, the oligonucleotides comprising the promoter sequence for SP6 polymerase (ATTTAGGTGACACTATAGA (SEQ ID NO: 3)) allow to obtain 35 nt long RNAs having a sequence of GAAGAAGCGGGCAUGCGGCCAGCCAUAGCCGAUCA (SEQ ID NO: 4), however 5′ end capped RNAs are 36 nt long. Typical in vitro transcription reaction was performed in volume 20 μl and was incubated in 40° C. for 2 hours and contained the following: 1U SP6 polymerase, 1 U RiboLock RNase Inhibitor (ThermoFisher Scientific), 0.5 mM ATP/CTP/UTP, 0.125 mM GTP, 1.25 mM dinucleotide cap analog and 0.1 μM template. Following 2 hours incubation, 1U DNase I (Ambion) was added to the reaction mixture and incubation was continued for 30 min in 37° C., after that EDTA was added to 25 mM final concentration. Obtained RNAs were purified using RNA Clean & Concentrator-25 (Zymo Research). Then the quality of the synthesized RNA was determined on a denaturating 15% polyacrylamide gel. The concentration of the RNA was in turn evaluated spectrophotometrically. The thus obtained RNA is characterized by substantial heterogeneity of the 3′ end, hence to eliminate the problem, the obtained RNAs were incubated with DNAzyme 10-23 (TGATCGGCTAGGCTAGCTACAACGAGGCTGGCCGC (SEQ ID NO: 5)) which lead to obtaining RNA 25 nt long. RNA having a cap at the 5′ end was 26 nt long. The reaction of cleaving the 3′ ends was as follows: 1 μM of RNA was incubated with 1 μM of DNazyme 10-23 in a mixture containing 50 mM MgCl.sub.2 and 50 mM Tris-HCl pH 8.0 for 1 hour in 37° C. (Coleman et al., 2004).

(138) For enzymatic tests 20 ng of each RNA was used, which were incubated with 3.5 nM Dcp1/2 enzyme in buffer containing 50 mM Tris-HCl pH 8.0, 50 mM NH.sub.4Cl, 0.01% NP-40, 1 mM DTT, and 5 mM MgCl.sub.2. Reactions were performed at 37° C. in the final volume of 25 μl. The reaction was stopped after 0, 5, 15 and 30 min by adding an equal amount of a mixture of 5 M urea, 44% formamide, 20 mM EDTA, 0.03% bromophenol blue, 0.03% xylene cyanol. Reaction products were resolved on denaturing 15% polyacrylamide gels, after the electrophoretic separation was completed, the gel was stained with SYBR Gold (Invitrogen) and visualized using a Storm 860 PhosphorImager (GE Healthcare). Quantification of the obtained results was performed with ImageQuant software (Molecular Dynamics). Representative results of this assay were presented on FIG. 8, FIG. 9 and also in Table 6.

(139) TABLE-US-00008 TABLE 6 Biological properties of mRNAs comprising selected cap analogs at the 5′ end relative capping translation efficiency.sup.a Dcp1/2 susceptibility.sup.b efficiency.sup.c GpppG 0.91 0 0.05 ± 0.01 m.sup.7GpppG 0.93 0.69 1.00 m.sub.2.sup.7,2′-oGpppG 0.84 0.52 1.56 ± 0.14 m.sub.2.sup.7,2′-oGpp.sub.spG D2 0.82 0.43 3.45 ± 0.42 m.sub.2.sup.7,2′-oGSpppG 0.70 0.07 1.73 ± 0.24 m.sub.2.sup.7,2′-oGpppSG 0.76 0.52 2.23 ± 0.31 .sup.aThe data of FIG. 8 (time point 0′) were used to calculate capping efficiency. .sup.bThe data of FIG. 8 were used to calculate susceptibility to Dcp1/2 activity, given as ratio of capped RNAs to a sum of uncapped and capped RNA at one time point 15 min and after normalization to 0′ time for individual RNAs. .sup.cRelative translational efficiency shows the average translation efficiency of Renilla luciferase mRNAs in biological triplicates after normalization to the values obtained for mRNA capped with m.sup.7GpppG at the 5′ end.
Test 5. Study on the Effect of the Presence of Novel Cap Analogs on Translational Efficiency of mRNAs in Rabbit Reticulocyte Lysate.

(140) The aim of this study was to check the effect of introducing novel cap analogs at the 5′ end of mRNAs on translation efficiency. For this purpose series of Renilla luciferase encoding mRNAs, and differing in the cap structure at the 5′ end were prepared. The transcripts used for this test were obtained by in vitro transcription reaction using SP6 RNA polymerase. As the template for the in vitro transcription a PCR product was used, prepared using primers ATTTAGGTGACACTATAGAACAGATCTCGAGCTCAAGCTT (SEQ ID NO: 6) and GTTTAAACATTTAAATGCAATGA (SEQ ID NO: 7) and the hRLuc-pRNA2(A)128 plasmid (Williams et al. 2010). PCR reaction thus conducted allowed to introduce promoter sequence for SP6 polymerase upstream of the sequence encoding Renilla luciferase. The transcription reaction itself was similar to the short RNA synthesis described above (Test 4). The reaction was conducted for 2 hours in 20 μl in 40° C. and contained the following: 1U SP6 polymerase, 1 U RiboLock RNase Inhibitor (ThermoFisher Scientific), 0.5 mM ATP/CTP/UTP, 0.125 mM GTP, 1.25 mM dinucleotide cap analog and 100 μg of a template. Following 2 hours incubation, 1U DNase I (Ambion) was added and incubation was continued for 30 min in 37° C., after that EDTA was added to 25 mM final concentration. Obtained mRNAs were purified using NucleoSpin RNA Clean-up XS (Macherey-Nagel). Quality of the synthetized RNA was checked on a denaturing 15% polyacrylamide gel. The RNA concentrations were determined spectrophotometrically.

(141) An in vitro translation reaction was performed in rabbit reticulocyte lysate (RRL, Promega) in conditions determined for cap-dependent translation (Rydzik et al., 2009). A typical reaction mixture (10 μl) contained: 40% RRL lysate, 0.01 mM mixture of amino acids (Promega), 1.2 mM MgCl.sub.2, 170 mM potassium acetate and a Renilla luciferase encoding mRNA with an appropriate cap analog at the 5′ end, the mixture being incubated in 37° C. for 1 hour. Four different concentrations of mRNAs: 0.1 ng/μl, 0.25 ng/μl, 0.5 ng/μl, 0.75 ng/μl were used in the experiment. Activity of synthesized luciferase was measured using Dual-Luciferase Reporter Assay System (Promega) in a microplate reader Synergy H1 (BioTek). Obtained results were analyzed in Origin (Gambit) software, and theoretical curve was fitted to experimental data, wherein the slope of obtained curve represents translation efficiency. Representative data were presented on FIG. 10, whereas average translation efficiency obtained for biological triplicates is presented in Table 6.

(142) Test 6. Study on the Effect of the Presence of Novel Cap Analogs on Translational Efficiency of mRNAs in HeLa Cells.

(143) Human cervical carcinoma HeLa cells were grown in DMEM (Gibco) supplemented with 10% FBS (Sigma-Aldrich), 1% penicillin/streptomycin (Gibco) and L-glutamine with a final concentration of 2 mM at 5% CO.sub.2 and 37° C. A day before the planned experiment, 10.sup.4 cells suspended in 100 μl medium without antibiotics were seeded per each well of a 96-well plate. The cell transfection was as follows, 0.3 μl Lipofectamine MessengerMAX Transfection Reagent (Invitrogen), 0.1 μg mRNA and 10 μl Opti-MEM (Gibco) were added to each well. The transfections were conducted for 1 hour in an incubator. After transfection, cells were washed three times with PBS and supplemented with fresh medium without antibiotics. After 2, 3, 4.5, 6.5, 10.5 and 24 hours since the beginning of transfection, the cells were washed three times with PBS, lysed and luciferase activity was measured using Luciferase Reporter Assay System (Promega) employing Synergy H1 microplate reader (Exemplary data are shown on FIG. 11.

(144) mRNA encoding firefly luciferase and having two repeats of β-globin 3′UTR and poly(A) tail of 128 adenines at the 3′ end was used for transfection. This mRNA, comprising differen cap analogs at the 5′ end was obtained by in vitro transcription. pJET_luc_128A plasmid digested with Aarl (ThermoFisher Scientifics) was used as a template for the synthesis. Typical in vitro transcription reaction) was conducted for 2 hours in a volume of 20 μl in 40° C. and contained the following: 1 U SP6 polymerase, 1 U RiboLock RNase Inhibitor (ThermoFisher Scientific), 0.5 mM ATP/CTP/UTP, 0.125 mM GTP, 1.25 mM dinucleotide cap analog and 0.1 μg of the template. The following steps of mRNA preparation as described above in the case of Renilla luciferase encoding mRNA (Test 5). Additionally, after purification of the mRNA using NucleoSpin RNA Clean-up XS column the transcripts were ethanol precipitated in presence of 2 μg glycogen and sodium acetate, then dissolved in deionized water.

BIBLIOGRAPHY

(145) Abrams, W. R. and J. A. Schiff (1973). “Studies of sulfate utilization by algae. II. An enzyme-bound intermediate in the reduction of adenosine-5′-phosphosulfate (APS) by cell-free extracts of wild-type Chlorella and mutants blocked for sulfate reduction.” Arch Mikrobiol 94(1): 1-10. Adams, P., P. Afonine, G. Bunkoczi, V. Chen, I. Davis, N. Echols, J. Headd, L. Hung, G. Kapral, R. Grosse-Kunstleve, A. McCoy, N. Moriarty, R. Oeffner, R. Read, D. Richardson, J. Richardson, T. Terwilliger and P. Zwart (2010). “PHENIX: a comprehensive Python-based system for macromolecular structure solution.” Acta Crystallographica Section D—Biological Crystallography 66: 213-221. Akagi, J. M. and L. L. Campbell (1962). “STUDIES ON THERMOPHILIC SULFATE-REDUCING BACTERIA III.: Adenosine Triphosphate-sulfurylase of Clostridium nigrificans and Desulfovibrio desulfuricans.” J Bacteriol 84(6): 1194-1201. Arakawa, H., M. Shiokawa, O. Imamura and M. Maeda (2003). “Novel bioluminescent assay of alkaline phosphatase using adenosine-3′-phosphate-5′-phosphosulfate as substrate and the luciferin-luciferase reaction and its application.” Anal Biochem 314(2): 206-211. Bail, S. and M. Kiledjian (2008). “DcpS, a general modulator of cap-binding protein-dependent processes?” Rna Biology 5(4): 216-219. Barnes, S., R. Waldrop and A. S. Neighbors (1983). “Alkaline butanol extraction of bile salt and steroid sulfate esters: application to the assay of sulfotransferases.” Anal Biochem 133(2): 470-475. Butchbach, M. E. R., J. Singh, M. custom characterorsteinsdóttir, L. Saieva, E. Slominski, J. Thurmond, T. Andrésson, J. Zhang, J. D. Edwards, L. R. Simard, L. Pellizzoni, J. Jarecki, A. H. M. Burghes and M. E. Gurney (2010). “Effects of 2,4-diaminoquinazoline derivatives on SMN expression and phenotype in a mouse model for spinal muscular atrophy.” Human Molecular Genetics 19(3): 454-467. Contreras, R. and W. Fiers (1981). “Initiation of transcription by rna polymerase-II in permeable, SV40-infected or noninfected, CV1 cells—evidence for multiple promoters of SV40 late transcription.” Nucleic Acids Research 9(2): 215-236. Emsley, P. and K. Cowtan (2004). “Coot: model-building tools for molecular graphics.” Acta Crystallographica Section D—Biological Crystallography 60: 2126-2132. Floor, S., B. Jones, G. Hernandez and J. Gross (2010). “A split active site couples cap recognition by Dcp2 to activation.” Nature Structural & Molecular Biology 17(9): 1096-U1099. Grudzien, E., M. Kalak, J. Jemielity, E. Darzynkiewicz and R. E. Rhoads (2006). “Differential inhibition of mRNA degradation pathways by novel cap analogs.” Journal of Biological Chemistry 281(4): 1857-1867. Grudzien-Nogalska, E., J. Jemielity, J. Kowalska, E. Darzynkiewicz and R. E. Rhoads (2007). “Phosphorothioate cap analogs stabilize mRNA and increase translational efficiency in mammalian cells.” Rna-a Publication of the Rna Society 13(10): 1745-1755. Gu, M. G., C. Fabrega, S. W. Liu, H. D. Liu, M. Kiledjian and C. D. Lima (2004). “Insights into the structure, mechanism, and regulation of scavenger mRNA decapping activity.” Molecular Cell 14(1): 67-80. Jemielity, J., T. Fowler, J. Zuberek, J. Stepinski, M. Lewdorowicz, A. Niedzwiecka, R. Stolarski, E. Darzynkiewicz and R. E. Rhoads (2003). “Novel “anti-reverse” cap analogs with superior translational properties.” Rna-a Publication of the Rna Society 9(9): 1108-1122. Kabsch, W. (2010). “XDS.” Acta Crystallographica Section D—Biological Crystallography 66: 125-132. Kalek, M., J. Jemielity, Z. M. Darzynkiewicz, E. Bojarska, J. Stepinski, R. Stolarski, R. E. Davis and E. Darzynkiewicz (2006). “Enzymatically stable 5′ mRNA cap analogs: Synthesis and binding studies with human DcpS decapping enzyme.” Bioorganic & Medicinal Chemistry 14(9): 3223-3230. Kalek, M., J. Jemielity, E. Grudzien, J. Zuberek, E. Bojarska, L. S. Cohen, J. Stepinski, R. Stolarski, R. E. Davis, R. E. Rhoads and E. Darzynkiewicz (2005). “Synthesis and biochemical properties of novel mRNA 5′ cap analogs resistant to enzymatic hydrolysis.” Nucleosides Nucleotides & amp; Nucleic Acids 24(5-7): 615-621. Konarska, M. M., R. A. Padgett and P. A. Sharp (1984). “Recognition of Cap Structure in Splicing Invitro of Messenger-Rna Precursors.” Cell 38(3): 731-736. Kowalska, J., M. Lewdorowicz, J. Zuberek, E. Grudzien-Nogalska, E. Bojarska, J. Stepinski, R. E. Rhoads, E. Darzynkiewicz, R. E. Davis and J. Jemielity (2008). “Synthesis and characterization of mRNA cap analogs containing phosphorothioate substitutions that bind tightly to elF4E and are resistant to the decapping pyrophosphatase DcpS.” RNA-a Publication of the RNA Society 14(6): 1119-1131. Kowalska, J., A. Wypijewska del Nogal, Z. M. Darzynkiewicz, J. Buck, C. Nicola, A. N. Kuhn, M. Lukaszewicz, J. Zuberek, M. Strenkowska, M. Ziemniak, M. Maciejczyk, E. Bojarska, R. E. Rhoads, E. Darzynkiewicz, U. Sahin and J. Jemielity (2014). “Synthesis, properties, and biological activity of boranophosphate analogs of the mRNA cap: versatile tools for manipulation of therapeutically relevant cap-dependent processes.” Nucleic Acids Research 42(16): 10245-10264. Kowalska, J., M. Ziemniak, M. Lukaszewicz, J. Zuberk, M. Strenkowska, E. Darzynkiewicz and J. Jemielity (2008). “Phosphorothioate analogs of m7GTP: Strong inhibitors of translation with increased resistance towards enzymatic degradation.” Chemistry of Nucleic Acid Components 10: 487-490. Kuhn, A. N., M. Diken, S. Kreiter, A. Selmi, J. Kowalska, J. Jemielity, E. Darzynkiewicz, C. Huber, O. Tureci and U. Sahin (2010). “Phosphorothioate cap analogs increase stability and translational efficiency of RNA vaccines in immature dendritic cells and induce superior immune responses in vivo.” Gene Therapy 17(8): 961-971. Lykke-Andersen, J. (2002). “Identification of a human decapping complex associated with hUpf proteins in nonsense-mediated decay.” Molecular and Cellular Biology 22(23): 8114-8121. Mccoy, A., R. Grosse-Kunstleve, P. Adams, M. Winn, L. Storoni and R. Read (2007). “Phaser crystallographic software.” Journal of Applied Crystallography 40: 658-674. Mildvan, A., Z. Xia, H. Azurmendi, V. Saraswat, P. Legler, M. Massiah, S. Gabelli, M. Bianchet, L. Kang and L. Amzel (2005). “Structures and mechanisms of Nudix hydrolases.” Archives of Biochemistry and Biophysics 433(1): 129-143. Rydzik, A. M., M. Lukaszewicz, J. Zuberek, J. Kowalska, Z. M. Darzynkiewicz, E. Darzynkiewicz and J. Jemielity (2009). “Synthetic dinucleotide mRNA cap analogs with tetraphosphate 5′, 5′ bridge containing methylenebis(phosphonate) modification.” Organic & Biomolecular Chemistry 7(22): 4763-4776. Sahin, U., K. Kariko and O. Tureci (2014). “mRNA-based therapeutics—developing a new class of drugs.” Nature Reviews Drug Discovery 13(10): 759-780. Schuttelkopf, A. and D. van Aalten (2004). “PRODRG: a tool for high-throughput crystallography of protein-ligand complexes.” Acta Crystallographica Section D—Biological Crystallography 60: 1355-1363. Shen, V., H. D. Liu, S. W. Liu, X. F. Jiao and M. Kiledjian (2008). “DcpS scavenger decapping enzyme can modulate pre-mRNA splicing.” Rna-a Publication of the Rna Society 14(6): 1132-1142. Singh, J., M. Salcius, S. W. Liu, B. L. Staker, R. Mishra, J. Thurmond, G. Michaud, D. R. Mattoon, J. Printen, J. Christensen, J. M. Bjornsson, B. A. Pollok, M. Kiledjian, L. Stewart, J. Jarecki and M. E. Gurney (2008). “DcpS as a Therapeutic Target for Spinal Muscular Atrophy.” Acs Chemical Biology 3(11): 711-722. Van Meerbeke, J. P., R. M. Gibbs, H. L. Plasterer, W. Miao, Z. Feng, M.-Y. Lin, A. A. Rucki, C. D. Wee, B. Xia, S. Sharma, V. Jacques, D. K. Li, L. Pellizzoni, J. R. Rusche, C.-P. Ko and C. J. Sumner (2013). “The DcpS inhibitor RG3039 improves motor function in SMA mice.” Human Molecular Genetics 22(20): 4074-4083. Warren, L., P. D. Manos, T. Ahfeldt, Y. H. Loh, H. Li, F. Lau, W. Ebina, P. K. Mandal, Z. D. Smith, A. Meissner, G. Q. Daley, A. S. Brack, J. J. Collins, C. Cowan, T. M. Schlaeger and D. J. Rossi (2010). “Highly Efficient Reprogramming to Pluripotency and Directed Differentiation of Human Cells with Synthetic Modified mRNA.” Cell Stem Cell 7(5): 618-630. Ziemniak, M., M. Strenkowska, J. Kowalska and J. Jemielity (2013). “Potential therapeutic applications of RNA cap analogs.” Future medicinal chemistry 5(10): 1141-1172. Zuberek, J., J. Jemielity, A. Niedzwiecka, J. Stepinski, A. Wyslouch-Cieszynska, R. Stolarski and E. Darzynkiewicz (2003). “Influence of the length of the phosphate chain in mRNA 5′ cap analogs on their interaction with eukaryotic initiation factor 4E.” Nucleosides Nucleotides & amp; Nucleic Acids 22(5-8): 1707-1710.