EXTRACELLULAR VESICLES LOADED WITH AN EXOGENOUS MOLECULE
20210238552 · 2021-08-05
Assignee
Inventors
Cpc classification
C12N2320/32
CHEMISTRY; METALLURGY
C12N5/0672
CHEMISTRY; METALLURGY
C12N5/0663
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
Active loading of extracellular vesicles (EVs) with an exogenous molecule without damaging the extracellular vesicles is provided. A composition comprising a population of extracellular vesicles loaded with an exogenous molecule, which have maintained their integrity, original endogenous cargo and functionality, compared to unloaded controls is also provided. Extracellular vesicles are derived from a stem cell, preferably an adult stem cell, or from a biological fluid, a conditioned cell medium or a tissue culture medium.
Claims
1. A composition comprising a population of extracellular vesicles (EVs), wherein the EVs of the population are loaded with an exogenous molecule and are not damaged, wherein absence of damage is defined as follows: (i) the mean diameter in the population of exogenous molecule-loaded EVs is increased by no more than 10% compared to the mean diameter in a population of unloaded control EVs; (ii) the total nucleic acid content present in the population of exogenous molecule-loaded EVs is not significantly decreased compared to the total nucleic acid content present in the population of unloaded control EVs; and/or (iii) the mean expression level of a panel of surface markers in the population of exogenous molecule-loaded EVs is reduced by no more than 15% compared to the mean expression level of the same panel of surface markers in the population of unloaded control EVs.
2. The composition according to claim 1, wherein the EVs are derived from a stem cell, preferably from an adult stem cell.
3. The composition according to claim 2, wherein the stem cell is an adult stem cell selected from a human liver stem cell (HLSC) and a human mesenchymal stem cell (MSC).
4. The composition according to claim 1, wherein the EVs are derived from a biological fluid, a conditioned cell medium or a tissue culture medium.
5. The composition according to claim 4, wherein the biological fluid is whole blood, plasma, serum or urine.
6. The composition according to claim 1, wherein the exogenous molecule is selected from the group consisting of nucleic acid, protein, peptide, aptamer, chemical drug and any combination thereof.
7. The composition according to claim 1, wherein the expression level of the panel of surface membrane-markers in the population of exogenous molecule-loaded EVs is reduced by no more than 12%.
8. The composition according to claim 1, wherein biological activity in the population of exogenous molecule-loaded EVs is not significantly reduced compared to the biological activity in the population of unloaded control EVs.
9. The composition according to claim 8, wherein the biological activity is a pro-angiogenic activity.
10. The composition according to claim 1, wherein the amount of exogenous molecules loaded in the extracellular vesicles is of at least 3 ng/10.sup.10 EVs.
11. The composition according to claim 1, wherein the loaded exogenous molecule is a nucleic acid.
12. The composition according to claim 11, wherein loaded nucleic acid is a microRNA (miRNA) or a small interfering RNA (siRNA).
13. The composition according to claim 12, wherein the miRNA and/or the siRNA is a pro-angiogenic RNA, an anti-angiogenic RNA or an anti-tumor RNA.
14. The composition according to claim 12 or 13, wherein the miRNA is hsa-miR-451 and/or hsa-miR-31.
15. A method for treating, in a subject in need thereof, a disease selected from the group consisting of cancer disease, cardiovascular disease, genetic disease, fibrotic diseases, wound healing, organ injury and viral infection, the method comprising administering to said subject the composition of claim 11.
16. The composition according to claim 1, wherein the panel of surface markers comprises one or more markers selected from the group consisting of CD9, CD19, CD81, CD86, CD90, HLA DR, CD47, CD34, CD40, CD31, CD144, CD3, CD146, CD105, CD5, HLA ABC, CD29, CD44, CD49d, CD49e, CD49f.
17. The composition according to claim 1, wherein exogenous molecule loading is performed by electroporation.
18. The composition according to claim 1, wherein the composition is obtainable by electroporation.
19. The composition according to claim 18, wherein electroporation is carried out at a voltage comprised between 500 and 900 Volt, with a number of pulses comprised between 1 and 10, the duration of each pulse being comprised between 10 and 25 milliseconds.
20. The composition according to claim 19, wherein electroporation is carried out at a voltage comprised between 600 and 800 Volt.
21. The composition according to claim 19, wherein the duration of each pulse is comprised between 18 and 22 milliseconds.
22. The composition according to claim 19, wherein electroporation is carried out with 2 or 10 pulses.
23. A method of loading a population of extracellular vesicles (EVs) with an exogenous molecule, the method comprising subjecting the EVs of the population to electroporation, wherein electroporation is carried out at a voltage comprised between 500 and 900 Volt, with a number of pulses comprised between 1 and 10, the duration of each pulse being comprised between 10 and 25 milliseconds.
24. The method according to claim 23, wherein the EVs are derived from a stem cell, preferably from an adult stem cell.
25. The method according to claim 23, wherein the EVs are derived from a biological fluid, a conditioned cell medium or a tissue culture medium.
Description
[0062] The following experimental section is provided purely by way of illustration and is not intended to limit the scope of the invention as defined in the appended claims. In the following experimental section reference is made to the appended drawings, wherein:
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
1. MATERIAL AND METHODS
1.1 Cell Culture
[0076] Human tumoral endothelial cell line TEC was established and maintained in culture in Endogro basal complete medium (Merck Millipore, Burlington, Mass., USA). Briefly, TECs were isolated from renal clear-cell carcinomas and previously characterized as endothelial cells by morphology, positive staining for vWF antigen, CD105, CD146, and vascular endothelial-cadherin and negative staining for cytokeratin and desmin
[0077] Human hepatoma cell line HepG2 (American Type Culture Collection, Manassas, Va., USA) was cultured in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal bovine serum (FBS).
[0078] Human microvascular endothelial cell line HMEC (American Type Culture Collection, Manassas, Va., USA) was cultured in Endogro basal complete medium (Merck Millipore, Burlington, Mass., USA) and 10% fetal calf serum (FCS).
[0079] Bone marrow MSCs were purchased by Lonza (Basel, Switzerland). Cells were used up to the seventh passage of culture. MSCs characterization was performed by cytofluorimetric analysis for the expression of the typical mesenchymal markers CD29, CD73, CD44, α4- and α5 integrins.
[0080] HLSCs were isolated from human cryopreserved normal adult hepatocytes (Lonza, Basel, Switzerland). Briefly, hepatocytes were first cultivated for 2 weeks in Hepatozyme-SFM medium (Gibco, Grand Island, N.Y., USA), then in α-MEM/EBM-1 media (3:1) (Invitrogen, Carlsbad, Calif., USA) added with HEPES (12 mM, pH 7.4), L-glutamine (5 mM) penicillin (50 IU/ml), streptomycin (50 μg/ml) (all from Sigma, St. Louis, Mo., USA), and fetal calf serum (FCS) (10%) (Invitrogen). The cells were expanded and characterized. The characterization of HLSCs by cytofluorimetric analysis demonstrated the expression of the mesenchymal stem cell markers but not of the endothelial and hematopoietic markers. HLSCs also expressed α-fetoprotein, human albumin, vimentin and nestin resident stem cell markers, but not CD34, CD117 and cytokeratin 19 oval cell markers. In addition, HLSCs were positive for the Nanog, Sox2, Oct4 and SSEA4 embryonic stem cell markers. HLSCs were shown to undergo osteogenic, endothelial and hepatic differentiation under appropriate culture conditions. Cells were used up to the seventh passage of culture. within the seven passages.
1.2 Extracellular Vesicle Isolation
[0081] Plasma-derived EVs were isolated from frozen human plasma of healthy blood donors provided by the Blood Bank of “Citta della Salute e della Scienza di Torino”. All samples were obtained after informed consent and approval by the internal Review Board of the Blood Bank. EVs from each donor were isolated from 250 ml plasma bags. Briefly, plasma samples were centrifuged at 1,500 g for 20 minutes to remove debris and apoptotic bodies. The supernatant was subsequently ultracentrifuged at 100,000 g for 2 hours at 4° C. using a 70 ml polycarbonate tube (SW 45 Ti rotor, Beckman Coulter Optima L-90 K ultracentrifuge, Indianapolis, Ind.). Samples were then washed with saline buffer solution and ultracentrifuged at 100,000 g for 2 hours at 4° C.
[0082] In order to isolate adult stem cell EVs, HLSC and MSC cells were cultured in the presence of their expansion medium until 80% of confluence. EVs were isolated from the supernatants of HLSC and MSC cells cultured overnight in Dulbecco's modified Eagle's medium (DMEM) using first differential centrifugation (1,500 g for 20 minutes to remove debris and apoptotic bodies) and then ultracentrifugation at 100,000 g for 2 hours at 4° C. in a 70 ml polycarbonate tube (SW 45 Ti rotor, Beckman Coulter Optima L-90 K ultracentrifuge, Indianapolis, Ind.). EVs pellets from plasma and cultured cells were then resuspended in saline buffer solution with 1% of DMSO, filtered through 0.22 micrometer filters to sterilize and stored at −80° C. EVs aliquots were then thawed and used for biological assays and molecular analysis.
1.3 EVs Analysis by NanoSight
[0083] EVs size and concentration were analyzed by nanoparticle tracking analysis (NTA), using the NanoSight LM10 system (NanoSight Ltd., Amesbury, UK), equipped with a 405 nm laser and with the NTA 3.1 analytic software). The Brownian movements of the EVs present in the sample subjected to a laser light source were recorded by a camera and converted into size and concentration parameters by the NTA software using the Stokes-Einstein equation. For all acquisition, camera levels were set at 16 and three videos of 30 s duration were recorded for each sample. Briefly, EVs were diluted (1: 1000 plasma-derived EVs and 1: 200 adult stem cell-derived EVs and nucleic acid-loaded EVs) in 1 ml vesicle-free saline solution (Fresenius Kabi, Runcorn, UK). NTA post-acquisition settings were optimized and maintained constant across all samples, and each video was then analyzed to calculate the concentration of EVs in the population under analysis along with the mean and mode vesicle diameter size and the different size distributions (D10, D50-median- and D90). D10=10% of vesicles have a diameter below the size indicated as D10; D50=50% of vesicles have a diameter below the size indicated as D50; D90=90% of vesicles have a diameter below the size indicated as D90.
1.4 FACS Characterization of EVs
[0084] Plasma-derived EVs were also characterized by cytofluorimetric analysis using the CytoFLEX flow cytometer (Beckman Coulter, Indianapolis, Ind.) together with the CytExpert software. The following FITC (fluorescein isothiocyanate) or APC (allophycocyanin) conjugated antibodies were used: anti-CD9, -CD19, -CD81, -CD86, -CD90, -HLA DR, -CD47, -CD34 (BD Biosciences, San Jose, Calif., USA), anti-CD40, -CD31, -CD144, -CD3, -CD146, -CD105 (Miltenyi Biotec, Bergisch Gladbach, Germany), anti-CD5 (Thermo Fisher Scientific, Waltham, Mass., USA) and anti-HLA ABC (BioLegend, San Diego, Calif., USA). Conjugated mouse non-immune isotypic immunoglobulin G (IgG) (Miltenyi Biotec, Bergisch Gladbach, Germany) was used as control. Briefly, EVs samples (5×10.sup.8 particles) diluted 1:3, were labeled with the above-listed conjugated antibodies for 15 minutes at 4° C. and, immediately after labelling, samples were acquired.
1.5 EVs Loading
[0085] Loading of EVs populations was performed using electroporation on a Neon Transfection System (Thermo Fisher Scientific, Waltham, Mass., USA) following manufacturer's instructions. For loading experiments with plasma EVs, the miRNAs hsa-miR-451a (SEQ ID NO. 1), hsa-miR-31-5p (SEQ ID NO. 3) and cel-miR-39-3p (SEQ ID NO. 5: 5′ UCACCGGGUGUAAAUCAGCUUG 3′) were used. Briefly, plasma EVs and miRNAs molecules (Qiagen, Hilden, Germany) were mixed (3×10.sup.10 EVs and 10 pmol, dose×1, 5 pmol, dose×½, 20 pmol, dose×2 miRNA) and diluted in the electroporation buffer R (Thermo Fisher Scientific, Waltham, Mass., USA) to a final volume of 100 μl. The mixture was subjected to electroporation using a pulse width of 20 milliseconds (ms) at increasing voltages (500, 750, 1000 V) with increasing number of pulses (from 1 to 10). Following electroporation, the mixture was incubated for 30 minutes at 37° C. and overnight at 4° C. EVs samples after co-incubation with miRNAs or EVs samples after electroporation in the absence of miRNAs were used as controls.
[0086] For the electroporation experiments with adult stem cell EVs, the following siRNA molecules were used: PCS-C2 (SEQ ID NO. 6: 5′ AGGUGUAUCUCCUAGACACTT 3′, sense strand; SEQ ID NO. 7: 5′ GUGUCUAGGAGAUACACCUTT 3′, antisense strand) and Scramble siRNA (SEQ ID NO. 8: 5′ GAGAUUACGAUUGCUGGGCTT 3′, sense strand; SEQ ID NO. 9: 5′ GCCCAGCAAUCGUAAUCUCTT 3′, antisense strand). A total of 3×10.sup.10 adult stem cell EVs were mixed with 10 pmol siRNA, either PCS-C2 or Scramble, and diluted in the electroporation buffer to a final volume of 100 μl. The mixture was electroporated using a pulse width of 20 ms, at 750 Volt with a different number of pulses, 2 or 10. Following electroporation, the mixture was incubated for 30 minutes at 37° C. and overnight at 4° C.
[0087] After electroporation of plasma EVs or adult stem cell EVs, in order to eliminate free not bound miRNA or siRNA molecules, the electroporated samples were washed by ultracentrifugation at 100,000 g for 2 hours at 4° C. using a 10 ml polycarbonate tube (SW 90 Ti rotor, Beckman Coulter Optima L-90 K ultracentrifuge, Indianapolis, Ind.). Finally, EVs pellets were resuspended in saline buffer solution with 1% of DMSO, analyzed by Nanosight and stored at −80° C. for downstream analysis. In these experiments, samples of adult stem cell EVs electroporated with the scrambled siRNA sequence or samples of adult stem cell EVs electroporated in the absence of siRNA were used as controls.
1.6 RNAse Treatment
[0088] To test the ability of EVs to protect their cargo from microenvironmental degradation, the samples of loaded EVs were treated with RNAse A (Thermo Fisher Scientific, Waltham, Mass., USA), using a concentration of 0.2 μg/ml, for 30 minutes at 37° C. Following the incubation period, a RNAse inhibitor (Thermo Fisher Scientific, Waltham, Mass., USA) was added to the mixture to stop the reaction according to manufacturer's protocol, and RNase-treated EVs were washed by ultracentrifugation at 100,000 g for 2 hours at 4° C. using a 10 ml polycarbonate tube (SW 90 Ti rotor, Beckman Coulter Optima L-90 K ultracentrifuge, Indianapolis, Ind.). Eventually, EV pellets were resuspended in saline buffer solution with 1% of DMSO and stored at −80° C. for downstream analysis.
1.7 RNA Isolation and qRT-PCR
[0089] Total RNA was isolated from the EVs populations using the miRNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer's instruction, and quantified using spectrophotometric analysis. Absorbance (A) values at 260 nm and 280 nm were measured with a VWR mySPEC spectrophotometer (VWR, Radnor, Pa., USA). An OD of 1 at 260 nm was equated to 40 μg/ml RNA. The A260/A280 ratio was used to determine the RNA purity of the samples. A pure RNA sample has an A260/A280 ratio of 1.8-2.0
[0090] The composition of small RNAs in EVs populations was assessed by capillary electrophoresis on an Agilent 2100 Bioanalyzer using the small RNAs kit (Agilent Technologies, Inc., Santa Clara, Calif.).
[0091] The expression levels of mRNAs and miRNAs were analyzed by performing quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) in triplicate using a 96-well QuantStudio 12K Flex Real-Time PCR (qRT-PCR) system (Thermo Fisher Scientific, Waltham, Mass., USA).
[0092] Briefly, to assess gene-downregulation in HepG2 cells in the apoptosis assay, cDNA was generated by reverse-transcription on cellular RNA samples using the “High-Capacity cDNA Reverse Transcription Kit” (Applied Biosystems, Foster City, Calif., USA). Five nanograms of cDNA were then combined to the “SYBR GREEN PCR Master Mix” (Applied Biosystems, Foster City, Calif., USA) according to manufacturer's instruction, and the GAPDH gene was used as housekeeping control.
[0093] For miRNAs expression analysis, the “miScript SYBR Green PCR Kit” (Qiagen, Hilden, Germany) was used. Briefly, the samples of miRNAs were reverse transcribed into cDNA using the “miScript Reverse Transcription Kit” (Qiagen, Hilden, Germany). The qRT-PCR experiments were carried out using 3 ng of cDNA in each reaction as described by the manufacturer's protocol (Qiagen, Hilden, Germany). The RNU6B small nucleolar RNA was used as control.
[0094] The levels of mRNA and miRNA were compared across samples based on relative expression data normalized using appropriate endogenous controls. The real-time PCR data were analyzed using the ΔΔCt method, and/or the fold changes in expression levels (RQ=2.sup.−ΔΔCt) were calculated for all EVs samples, compared to controls. In details, ΔCt was measured as Ct difference between miRNA/mRNA of interest and housekeeping control. ΔΔCt was calculated as ΔCt difference between sample and control. RQ was the calculated as 2{circumflex over ( )}(−ΔΔCt).
[0095] In RNase-treated EVs samples, the percentage of protected miRNA was calculated based on cycle threshold (Ct) differences between treated and untreated EVs. More specifically, the ΔCt values measured for miRNAs in the RNAse treated samples were compared to the ΔCt values measured in untreated samples (untreated controls were considered as 100%). For the generation of standard curve to perform absolute quantification, miRNA cel-miR-39-3p and siRNA PCS-C2 were spectrophotometrically quantified (mySPEC, VWR, Radnor, Pa., USA) and 200 ng of RNA were reverse transcribed using the miScript Reverse Transcription Kit (Qiagen, Hilden, Germany). The cDNA thus generated was serially diluted 1:5 from an initial quantity of 2.4 ng to produce 10 dilutions. These serial dilutions were run in 5 replicates using Relative Standard Curve on 96-well QuantStudio 12K Flex Real-Time PCR (qRT-PCR) system according to the manufacturer's protocol (Thermo Fisher Scientific, Waltham, Mass., USA). The Standard curve was used to convert the cycle threshold (Ct) values measured for each sample into the corresponding number of microRNA or siRNA copies.
[0096] To analyze miRNA transfer from EVs to target cells, TEC or HepG2 were pre-plated in a 24-well plates and stimulated with 30,000 EVs/cell for 24 hours. Then, cell samples were subjected to RNA extraction and qRT-PCR analysis as described above
1.8 Protein Extraction and Western Blot Analysis
[0097] Proteins were extracted from EVs samples by using RIPA buffer (20 nM Tris-HCl, 150 nM NaCl, 1% deoxycholate, 0.1% sodium dodecyl sulfate, 1% Triton X-100, pH 7.8) supplemented with a cocktail of protease and phosphatase inhibitors (Sigma-Aldrich). The protein content of analyzed EVs was quantified by BCA Protein Assay Kit (Pierce, Thermo Fisher Scientific, Rockford, IL-61105, USA) following manufacturer's instruction. Briefly, 5 μl of EVs sample were dispensed into a 96-well plate and total protein concentrations was determined with a spectrophotometer using a linear standard curve established with bovine serum albumin (BSA). Thirty micrograms of proteins were separated by electrophoresis using a 7.5% gradient sodium dodecyl sulfate—polyacrylamide gel. The proteins were transferred to a PVDF membrane by the Trans-Blot® Turbo™ Transfer System (Bio-rad, Hercules, Calif., USA) and then immunoblotted with the following antibodies: anti-CD63 and anti-TSG101 (Santa Cruz Biotechnology, Dallas, Tex., USA), anti-CD81 and anti-CD9 (Abcam, Cambridge, UK) and anti-CD29 (Thermo Fisher Scientific, Waltham, Mass., USA). The protein bands were visualized using a ChemiDoc (Bio-rad, Hercules, Calif., USA) with an enhanced chemiluminescence detection kit (ECL) (GE Healthcare, Amersham, Buckinghamshire, UK). Protein quantification was performed normalizing sample amount to the total protein loaded detected by ponceau.
1.9 Apoptosis Assay
[0098] HepG2 cells were seeded at 25,000 cells/well into 24-well plates and cultured in serum free low-glucose DMEM in the absence (vehicle, CTR−) or presence of different populations of EVs (30,000 EVs/cell) for 24 hours. Cells maintained in low-glucose DMEM plus 150 ng/ml Doxorubicin were used as positive control (CTR+). Apoptosis was measured by using Muse™ Annexin V and Dead Cell Assay Kit (Merck Millipore, Burlington, Mass., USA) following the manufacturer's instructions. The assay is based on the detection of phosphatidylserine (PS) on the surface of apoptotic cells, using fluorescently labeled Annexin V in combination with the dead cell marker, 7-AAD. The results were shown as the percentage of apoptotic cells. compared to untreated cells.
1.10 Tubulogenesis Assay
[0099] The tubulogenesis assay is based on the in vitro formation of capillary-like structures on growth factor—reduced Matrigel (BD Bioscience, Franklin Lakes, N.J., USA). HMECs cells were seeded at 25,000 cells/well into 24-well plates in DMEM plus 5% EVs-depleted fetal calf serum (FCS) and stimulated with 50,000 EVs/cell for 24 hours. As negative controls, cultures of HMECs cells in DMEM plus 5% EVs-depleted FCS were used since under these growing conditions, endothelial cells do not exert angiogenetic activity. As positive controls, HMECs cells grown in the endothelial specific-EndoGRO basal medium (Merck Millipore, Burlington, Mass., USA) were used since such medium preserves their angiogenetic properties. Cell organization onto Matrigel was imaged with a Nikon Eclipse TE200. After incubation for 24 h, phase-contrast images (magnification, ×10) were recorded and the total length of the network structures was measured using ImageJ software. The total length per field was calculated in five random fields and expressed as a ratio to the respective control.
1.11 Statistical Analysis
[0100] Data were analyzed using the GraphPad Prism 6.0 Demo program. Statistical analyses were conducted using ANOVA with Dunnett's or Turkey's post-tests, or t-test where appropriated. The relative expression of miRNAs and mRNAs in samples was compared to suitable controls by Kruskal-Wallis ANOVA with Dunn's multiple comparisons test. Values were expressed as their mean and standard error of the mean (±SEM). Statistical significance was established at P<0.05 (illustrated as *p<0.05, **p<0.01, ***p<0.005, ****p<0.001).
2. RESULTS
[0101] 2.1 Optimization of EVs Loading with an Exogenous Molecule
[0102] Human plasma from healthy donors is an easy and abundant source of EVs, with a recovery rate of about 5.33×10.sup.9 EVs (±2.40×10.sup.9)/ml of plasma (data not shown). In addition, the present inventors found that plasma-derived EVs were ineffective in their in vitro models, making them a useful source to test the potential therapeutic effects of specific miRNAs. EVs were isolated from human plasma of healthy donors by ultracentrifugation at 100,000 g for 2 h at 4° C. To define the most efficient electroporation protocol, the present inventors evaluated different electroporation parameters, including different voltages (500-, 750-, 1000 Volt) and different number of applied pulses (1, 2 or 10 pulses), each of 20 ms. To set up the electroporation (EP) protocol, the present inventors employed a synthetic miRNA (cel-miR-39-3p) which is easily detectable in human plasma-EVs and human cells because it is isolated from an unrelated organism (Caenhorabditis.elegans). Since electrical discharge of electroporation can damage EVs, the EV size distribution was taken into consideration when comparing the different protocols in order to select the most efficient and useful method of EVs loading. Results are shown in
[0103] The above-illustrated data reflect the shift in the size profile of EVs, i.e. the diameter size, after electroporation with higher voltages. In fact, the analysis of EVs subjected to electroporation with different protocols showed a similar EVs size distribution across the majority of samples, with a peak of EVs higher concentration around 100-150 nm. In particular, the profiles of unloaded EVs, EVs co-incubated and EVs subject to electroporation at 750V with 10 pulses of 20 ms were very similar. On the contrary, a relevant shift of the peak of EVs higher concentration to 150-200 nm was detected when applying the protocol employing 1000V with 10 pulses of 20 ms, suggesting that electroporation with higher voltages can damage EVs by inducing vesicles aggregation (
[0104] The efficiency of electroporation was evaluated by measuring miRNA active loading into EVs along with the ability of EVs to transfer the loaded miRNA into recipient target cells. [mp1] The analysis of the total RNA content in electroporated EVs revealed a significant increase in the RNA content when EVs were subjected to high-voltage electroporation. In particular, the major RNA enrichment was achieved using 750 Volt with 10 pulses of 20 ms (
[0105] To deeper investigate the efficiency of selected electroporation protocols, the present inventors calculated the amount (nanograms) and the number of molecules of exogenous miRNA loaded into EVs after electroporation, using a standard curve method. The graphs in
TABLE-US-00002 TABLE 1 Exogenous miRNA amount (number of molecules) loaded into EVs. Mean Std. Error EV 0.0 0.0 EV + cel-39 Co-incubated 15.6 12.2 EV + cel-39 500 V 1 p 10.3 6.8 EV + cel-39 500 V 10 p 12.6 2.7 EV + cel-39 750 V 1 p 12.6 3.9 EV + cel-39 750 V 10 p 24.9 11.5 EV + cel-39 1000 V 1 p 11.5 8.5 EV + cel-39 1000 V 10 p 23.1 11.8
2.2. Electroporation Effects on EVs
[0106] Permeabilization of EVs membrane caused by electroporation can lead to the loss of molecules contained in these vesicles, thereby altering their original cargo and their biological activity. To determine whether the electroporation method can modify the endogenous content of EVs, the present inventors analyzed the RNA, miRNAs and protein cargo in control EVs and in EVs after electroporation in the presence or absence of a miRNA. As expected, a significant increase in the RNA content was observed following electroporation with the miRNAs, whereas the quantification of EVs total RNA following electroporation in the absence of nucleic acid did not reveal any significant reduction in the RNA cargo compared to control EVs (p-value>0.05) (
2.3 EVs Protection of Loaded Exogenous Molecule
[0107] EVs are widely reported to protect their cargo from the microenvironmental degradation mediated by RNAse enzymes. To verify whether loaded exogenous molecules are actually encapsulated within the vesicles, EVs carrying the synthetic miRNA cel-miR-39-3p were analyzed by qRT-PCR after RNAse treatment. The present inventors investigated the resistance to RNAse displayed by EVs samples treated with a physiological dose of RNAse A, by comparing unloaded EVs and EVs electroporated or co-incubated with the specific miRNA (cel-miR-39-3p). Relative expression values of miRNA cel-miR-39-3p measured by qRT-PCR indicate that a significant enrichment of this miRNA into EVs was achieved after either electroporation or co-incubation (
2.4 Functional Evaluation of Plasma EVs Loaded with an Exogenous Molecule
[0108] Upon validation of EV integrity after electroporation, EVs were loaded with antitumor miRNAs and evaluated for their capacity to induce apoptosis in the human hepatocellular carcinoma cell line HepG2. For this purpose, the present inventors electroporated plasma EVs, which do not exhibit a natural pro-apoptotic activity in the employed in vitro model, with two synthetic miRNAs, namely hsa-miR-451a and hsa-miR-31-5p, which are known to promote apoptotic signals in HepG2 cells (Fonsato V. et al, Human liver stem cell-derived microvesicles inhibit hepatoma growth in SCID mice by delivering antitumor microRNAs. Stem Cells. 2012 September; 30(9):1985-98). Electroporation was carried out at 750 V with 10 pulses of 20 ms with different miRNA doses (the initial dose, ×1; half dose, ×1/2; double dose×2) to evaluate the biological effect of varying miRNA quantities. The apoptosis assay performed by treating HepG2 cells with loaded EVs as above described demonstrated a general significant increase in cancer cell apoptosis when EVs electroporated with hsa-miR-451a and hsa-miR-31-5p were used, compared to untreated cells (CTL−) (
2.5 Electroporation Effects of the Integrity of Adult Stem Cell EVs
[0109] To assess the viability of electroporation as a method for loading exogenous molecules into adult stem cells EVs, the present inventors applied the electroporation protocol at 750 Volt with 10 pulses of 20 ms to EVs isolated from MSCs and HLSCs in the presence of a synthetic siRNA (siRNA PCS-C2). By qRT-PCR analysis, a clear enrichment of the exogenous siRNA was demonstrated in the populations of adult stem cell EVs after electroporation (
[0110] Differences in EV membrane composition may depend on the cell origin. Thus, NTA analysis was performed to evaluate possible structural alterations of adult stem cell EVs after electroporation. In particular, the present inventors found that electroporated HLSC-EVs displayed NTA profiles and sizes similar to unloaded HLSC-EVs (
[0111] Exogenous molecule loading by electroporation did not induce any significant change in the mean, mode and distribution of diameter size in the population of MSCs-EVs (
[0112] In order to avoid EVs damage, electroporation experiments with a lower number of pulses were conducted.
[0113] Loading of HLSC-EVs by electroporation using 2 pulses of 20 ms instead of 10 did not lead to increased EV mean size (
[0114] The maximum increase in diameter detected by the present inventors in the populations of adult stem cell EVs, which had previously been validated as not damaged by exogenous molecule loading, is 9.86%.
TABLE-US-00003 TABLE 2 Size alterations in adult stem cell EVs loaded with an exogenous molecule Increase of mean sample size EV HLSC CTR 0.00% EV HLSC 10 p 12.11% EV HLSC 2 p 2.29% EV MSC CTR 0.00% EV MSC 10 p 18.74% EV MSC 2 p 9.86%
2.6 Functional Evaluation of Adult Stem Cell EVs Loaded with an Exogenous Molecule
[0115] As a further assessment of the absence of damage in the population of adult stem cell EVs after active exogenous molecule loading, the present inventors verified whether these EVs maintain their biological activity compared to unloaded EVs. More particularly, the pro-angiogenic activity of unloaded control EVs and adult stem cell EVs subjected to electroporation at 750 Volt with 10 or 2 pulses of 20 ms, in the presence or absence of the siRNA PCS-C2, was analyzed carrying out a tubulogenesis assay on endothelial cells (
TABLE-US-00004 TABLE 3 Reduction of biological activity of loaded adult stem EVs relative to unloaded controls Biological activity reduction (%) in respect to unloaded EVs MSC MSC HLSC MSC 10 p 2 p HLSC 10 p HLSC2 p 0.00% 12.81% −0.75% 0.00% 7.29% −2.04%