BLOOD PRODUCT DERIVED FROM GENE KNOCKOUT PIG AND USE THEREOF
20210254004 · 2021-08-19
Assignee
Inventors
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N9/0071
CHEMISTRY; METALLURGY
C12Y114/18002
CHEMISTRY; METALLURGY
C12N2800/80
CHEMISTRY; METALLURGY
C12Y204/01165
CHEMISTRY; METALLURGY
A01K2267/025
HUMAN NECESSITIES
C12Y204/01087
CHEMISTRY; METALLURGY
C12N15/8509
CHEMISTRY; METALLURGY
International classification
Abstract
A blood product may be derived from a gene knockout pig and used in, e.g., medical applications. The binding of the blood product to immunoglobulin in human serum is reduced, and the blood product can have an effect on overcoming hyperacute immune rejection. The blood product may be derived from a gene knockout pig, wherein a GGTA1 gene, a CMAH gene, and/or a β4GalNT2 gene of the gene knockout pig are knocked out, wherein one or more nucleotides in the β4GalNT2 gene encoding one or more amino acids in exon 8 are deleted such that the β4GalNT2 gene is knocked out.
Claims
1. A blood product derived from a gene knockout pig, wherein a GGTA1 gene, a CMAH gene, and a β4GalNT2 gene of the gene knockout pig are knocked out, and wherein one or more nucleotides in a β4GalNT2 gene encoding one or more amino acids in exon 8 are deleted such that the β4GalNT2 gene is knocked out.
2. The product of claim 1, wherein one or more nucleotides in the GGTA1 gene encoding one or more amino acids in exon 3 are deleted such that the GGTA1 gene is knocked out.
3. The product of claim 1, wherein one or more nucleotides in the CMAH gene encoding one or more amino acids in exon 6 are deleted such that the CMAH gene is knocked out.
4. The product of claim 1, wherein the gene knockout pig is prepared by using a CRISPR/Cas9 vector combination.
5. The product of claim 4, wherein the exon 3 of the GGTA1 gene, the exon 6 of the CMAH gene, and the exon 8 of the β4GalNT2 gene serve as the parts targeted by CRISPR/Cas9.
6. The product of claim 4, wherein the CRISPR/Cas9 vector combination comprises a GGTA1-CRISPR/Cas9 vector, a CMAH-CRISPR/Cas9 vector, and a β4GalNT2-CRISPR/Cas9 vector, wherein the GGTA1-CRISPR/Cas9 vector comprises a SgRNA nucleotide sequence specifically targeting the GGTA1 gene as shown in SEQ ID No: 1, wherein the CMAH-CRISPR/Cas9 vector comprises a SgRNA nucleotide sequence specifically targeting the CMAH gene as shown in SEQ ID No: 2, and wherein the β4GalNT2-CRISPR/Cas9 vector comprises a SgRNA nucleotide sequence specifically targeting the β4GalNT2 gene as shown in SEQ ID No: 3.
7. The product of claim 6, wherein the GGTA1-CRISPR/Cas9 vector comprises a nucleotide sequence as shown in SEQ ID No: 4, wherein the CMAH-CRISPR/Cas9 vector comprises a nucleotide sequence as shown in SEQ ID No: 5, and wherein the β4GalNT2-CRISPR/Cas9 vector comprises a nucleotide sequence as shown in SEQ ID No: 6.
8. The product of claim 1, comprising red blood cells and/or peripheral blood mononuclear cells (PBMC) of the gene knockout pig.
9. (canceled)
10. The product of claim 8, wherein the red blood cells have a reduced aGal antigen level, a reduced Neu5Gc antigen level, and a reduced Sd.sup.a-like antigen level.
11. The product of claim 8, wherein the PBMC have a reduced aGal antigen level, a reduced Neu5Gc antigen level, and a reduced Sd.sup.a-like antigen level.
12. The product of claim 8, wherein the binding level of the red blood cells of the gene knockout pig to human immunoglobulin is reduced compared to red blood cells derived from a wild-type pig.
13. The product of claim 8, wherein the binding level of the PBMC of the gene knockout pig to human immunoglobulin is reduced compared to PBMC derived from a wild-type pig.
14. The product of claim 8, wherein the red blood cells of gene knockout pig have a comparable level of binding to human immunoglobulin compared to human-derived red blood cells.
15. The product of claim 8, wherein the PBMC of the gene knockout pig have a comparable level of binding to human immunoglobulin compared to human-derived PBMC.
16. The product of claim 11, wherein the human immunoglobulin comprises human IgG and/or human IgM.
17. The product of claim 8, wherein the agglutination reaction of the red blood cells of the gene knockout pig in human serum is reduced compared to red blood cells derived from a wild-type pig.
18. The product according of claim 17, wherein the agglutination reaction is caused by an IgM antibody against a blood group antigen and/or an IgG antibody against a blood group antigen.
19. The product of claim 8, wherein the likelihood of a hemolytic transfusion reaction occurring after the red blood cells of the gene knockout pig are introduced into a human body is reduced compared to red blood cells derived from a wild-type pig.
20-21. (canceled)
22. A method of preventing or treating diseases associated with hyperacute rejection, comprising administering to a subject in need thereof the product of claim 1.
23. The method of claim 19, wherein the blood product does not substantially cause hyperacute rejection and/or is capable of ameliorating hyperacute rejection.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0096] The specific characteristics of the invention referred in the application are set forth in the appended claims. The features and advantages of the invention referred in the application can be better understood by referring to the exemplary embodiments described in detail below and the accompanying drawings. A brief description of the drawings is as follows:
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
[0105]
[0106]
[0107]
[0108]
[0109]
[0110]
[0111]
EMBODIMENTS
Embodiment 1 Construction of CRISPR/Cas9 Vector
[0112] Firstly, based on the DNA sequences of GGTA1/CMAH/β4GalNT2 genes, sgRNA (single guide RNAs) targeting GGTA1, CMAH and β4GalNT2 genes were synthesized, thus constructing a GGTA1-CRISPR/Cas9 vector, a CMAH-CRISPR/Cas9 vector and a β4GalNT2-CRISPR/Cas9 vector respectively, with pX330 as the skeleton plasmid.
[0113] 1.1 Preparation of GGTA1-CRISPR/Cas9 Vector
[0114] Firstly, based on the porcine GGTA1 gene sequence published in Genbank, the exon 3 of GGTA1 gene was selected as the CRISPR/Cas9 target. According to the design principle of cas9 target, the 5′ end was G, and the 3′ end was PAM sequence (NGG). The SgRNA sequence was designed to be GAAAATAATGAATGTCAA, as shown in
[0115] The GGTA1-CRISPR/Cas9 vector was prepared as follows:
[0116] Step I. According to the design principle of cas9 target, the 5′ end was G, and the 3′ end was PAM sequence (NGG), and the target position was found on the GGTA1 gene;
[0117] Step II. A pX330 skeleton plasmid (Addgene plasmid 423230) expressing hSpCas9 and gRNA was purchased;
[0118] Step III. Synthesis of 5′-end phosphorylated oligonucleotide chain SgRNA sequence: CACC was added at the 5′ end of the SgRNA nucleotide sequence to obtain a forward oligonucleotide sequence, and AAAC was added at the 5′ end of its complementary strand to obtain a reverse oligonucleotide sequence, thus respectively synthesizing the forward and reverse oligonucleotide sequences:
TABLE-US-00001 (SEQ ID No: 7) 5′-CACCGAAAATAATGAATGTCAA-3′ (SEQ ID No: 8) 3′-CTTTTATTACTTACAGTTCAAA-5′.
[0119] The SgRNA sequence was cloned onto the pX330 skeleton vector, the specific steps of which were as follows:
[0120] 1. 1 μg pX330 plasmid was digested with a restriction endonuclease BbsI;
[0121] 2. The digested pX330 plasmid was separated using an agarose gel (an agarose gel at a concentration of 1%, i.e., 1 g agarose gel being added into 100 mL electrophoresis buffer), the digestion product was then purified and recovered by a gel extraction kit (QIAGEN);
[0122] 3. The forward and reverse oligonucleotide sequences synthesized in step III were annealed as follows:
TABLE-US-00002 1 μL Oligo1 (forward oligonucleotide sequence ) (10 μM) 1 μL Oligo2 (reverse oligonucleotide sequence ) (10 μM) 8 μL ddH.sub.2O Total: 10 μL [0123] At 37° C. for 30 min [0124] At 95° C. for 5 min, then down to 25° C. at a rate of 5° C./min
[0125] 4. A ligation reaction was initiated following the system below: reaction at room temperature for 10 min
TABLE-US-00003 pX330 digested with a BbsI enzyme in step 2 50 ng 5′-end phosphorylated oligonucleotide after 1 μL annealing in step 3 (at a volume ratio of 1:250, diluted with sterile water) 2X Rapid ligation buffer (NEB) 5 μL ddH.sub.2O supplement the system to 10 μL Subtotal 10 μL Rapid ligase (NEB) 1 μL Total 11 μL
[0126] 5. The ligation system was treated with a plasmid-safe exonuclease to eliminate the incorrect-ligated plasmid:
TABLE-US-00004 Ligation reaction system obtained in step 4 11 μL 10X plasmid-safe buffer (NEB) 1.5 μL 10 mM ATP 1.5 μL Plasmid-safe exonuclease (NEB) 1 μL Total 15 μL [0127] Reaction at 37° C. for 30 min
[0128] 6. Transformation
[0129] (1) 50 μL competent cells (TIANGEN) were placed in an ice bath;
[0130] (2) To the centrifuge tube containing the competent cells was added 15 μL the solution with the incorrect-ligated plasmid eliminated obtained in step 5, mixed evenly and left in the ice bath for 30 min;
[0131] (3) The competent cells left in the ice bath for 30 min were placed in a water bath at 42° C. for 60˜90 s, and then transferred into the ice bath quickly to cool the cells for 2 to 3 min;
[0132] (4) 900 μL sterile LB medium (free from antibiotics) was added into the centrifuge tube, mixed evenly and placed in a shaking bed at 37° C. for culture with shaking at 150 rpm for 45 min;
[0133] (5) The centrifuge tube was centrifuged at 12000 rpm in a centrifuge for 5 min. 900 μL supernatant was discarded, and the competent cell precipitates were resuspended with the remaining 100 μL supernatant. The resuspended competent cells were then added onto an LB solid agar medium containing corresponding antibiotics, and coated uniformly with a sterile coating rod; The LB solid agar medium coated with competent cells was inverted in an incubator at 37° C. for culture for 12 to 16 h.
[0134] 7. Mini-extraction of plasmid, sequencing, identification of the successful construction of the target plasmid.
[0135] The constructed CRISPR/Cas9 vector is named as GGTA1-CRISPR/Cas9, its nucleotide sequence is shown in SEQ ID No: 4.
[0136] 1.2. Preparation of CMAH-CRISPR/Cas9 Vector
[0137] Firstly, based on the porcine CMAH gene sequence published in Genbank, the exon 6 of CMAH gene was selected as the CRISPR/Cas9 target. According to the design principle of cas9 target, the 5′ end was G, and the 3′ end was PAM sequence (NGG). The SgRNA guide sequence was designed to be GAGTAAGGTACGTGATCTGT, as shown in
[0138] The CMAH-CRISPR/Cas9 vector was prepared as follows:
[0139] Step I. According to the design principle of cas9 target, the 5′ end was G, and the 3′ end was PAM sequence (NGG), and the target position was found on the CMAH gene;
[0140] Step II. A pX330 skeleton plasmid (Addgene plasmid 423230) expressing hSpCas9 and gRNA was purchased;
[0141] Step III. Synthesis of 5′-end phosphorylated oligonucleotide chain SgRNA sequence by a company: CACC was added at the 5′ end of the SgRNA nucleotide sequence to obtain a forward oligonucleotide sequence, and AAAC was added at the 5′ end of its complementary strand to obtain a reverse oligonucleotide sequence, thus respectively synthesizing the forward and reverse oligonucleotide sequences:
TABLE-US-00005 (SEQ ID No: 9) 5′-CACCGGAGTAAGGTACGTGATCTGT-3′ (SEQ ID No: 10) 3′-CCTCATTCCATGCACTAGACACAAA-5′.
[0142] The SgRNA sequence was cloned onto the pX330 skeleton vector, the specific steps of which were as follows:
[0143] 1. 1 μg pX330 plasmid was digested with a restriction endonuclease BbsI;
[0144] 2. The digested pX330 plasmid was separated using an agarose gel (an agarose gel at a concentration of 1%, i.e., 1 g agarose gel being added into 100 mL electrophoresis buffer), the digestion product was then purified and recovered by a gel extraction kit (QIAGEN);
[0145] 3. The forward and reverse oligonucleotide sequences synthesized in step III were annealed as follows:
TABLE-US-00006 1 μL Oligo1 (forward oligonucleotide sequence) (10 μM) 1 μL Oligo2 (reverse oligonucleotide sequence) (10 μM) 8 μL ddH.sub.2O Total: 10 μL [0146] At 37° C. for 30 min [0147] At 95° C. for 5 min, then down to 25° C. at a rate of 5° C./min
[0148] 4. A ligation reaction was initiated following the system below: reaction at room temperature for 10 min
TABLE-US-00007 pX330 digested with a BbsI enzyme in step 2 50 ng 5′-end phosphorylated oligonucleotide after annealing in step 3 (at a volume ratio of 1:250, diluted with sterile water) 1 μL 2X Rapid ligation buffer (NEB) 5 μL ddH.sub.2O supplement the system to 10 μL Subtotal 10 μL Rapid ligase (NEB) 1 μL Total 11 μL
[0149] 5. The ligation system was treated with a plasmid-safe exonuclease to eliminate the incorrect-ligated plasmid:
TABLE-US-00008 Ligation reaction system obtained in step 4 11 μL 10X plasmid-safe buffer (NEB) 1.5 μL 10 mM ATP 1.5 μL Plasmid-safe exonuclease (NEB) 1 μL Total 15 μL [0150] Reaction at 37° C. for 30 min
[0151] 6. Transformation
[0152] (1) 50 μL competent cells (TIANGEN) were placed in an ice bath;
[0153] (2) To the centrifuge tube containing the competent cells was added 15 μL the solution with the incorrect-ligated plasmid eliminated obtained in step 5, mixed evenly and left in the ice bath for 30 min;
[0154] (3) The competent cells left in the ice bath for 30 min were placed in a water bath at 42° C. for 60˜90 s, and then transferred into the ice bath quickly to cool the cells for 2 to 3 min;
[0155] (4) 900 μL sterile LB medium (free from antibiotics) was added into the centrifuge tube, mixed evenly and placed in a shaking bed at 37° C. for culture with shaking at 150 rpm for 45 min;
[0156] (5) The centrifuge tube was centrifuged at 12000 rpm in a centrifuge for 5 min. 900 μL supernatant was discarded, and the competent cell precipitates were resuspended with the remaining 100 μL supernatant. The resuspended competent cells were then added onto an LB solid agar medium containing corresponding antibiotics, and coated uniformly with a sterile coating rod; The LB solid agar medium coated with competent cells was inverted in an incubator at 37° C. for culture for 12 to 16 h.
[0157] 7. Mini-extraction of plasmid, sequencing, identification of the successful construction of the target plasmid.
[0158] The constructed CRISPR/Cas9 vector is named as CMAH-CRISPR/Cas9, its nucleotide sequence is shown in SEQ ID No: 5.
[0159] 1.3. Preparation of β4GalNT2-CRISPR/Cas9 Vector
[0160] Firstly, based on the porcine β4GalNT2 gene sequence published in Genbank, the exon 8 of β4GalNT2 gene was selected as the CRISPR/Cas9 target. According to the design principle of cas9 target, the 5′ end was G, and the 3′ end was PAM sequence (NGG). The guide sequence was designed to be GGTAGTACTCACGAACACTC as shown in
[0161] The β4GalNT2-CRISPR/Cas9 vector was prepared as follows:
[0162] Step I. According to the design principle of cas9 target, the 5′ end was G, and the 3′ end was PAM sequence (NGG), and the target position was found on the β4GalNT2 gene;
[0163] Step II. A pX330 skeleton plasmid (Addgene plasmid 423230) expressing hSpCas9 and gRNA was purchased;
[0164] Step III. Synthesis of 5′-end phosphorylated oligonucleotide chain SgRNA sequence by a company: CACC was added at the 5′ end of the SgRNA nucleotide sequence to obtain a forward oligonucleotide sequence, and AAAC was added at the 5′ end of its complementary strand to obtain a reverse oligonucleotide sequence, thus respectively synthesizing the forward and reverse oligonucleotide sequences:
TABLE-US-00009 (SEQ ID No: 11) 5′-CACCGGTAGTACTCACGAACACTC-3′ (SEQ 1D No: 12) 3′-CCATCATGAGTGCTTGTGAGCAAA-5′.
[0165] The SgRNA sequence was cloned onto the pX330 skeleton vector, the specific steps of which were as follows:
[0166] 1. 1 μg pX330 plasmid was digested with a restriction endonuclease BbsI;
[0167] 2. The digested pX330 plasmid was separated using an agarose gel (an agarose gel at a concentration of 1%, i.e., 1 g agarose gel being added into 100 mL electrophoresis buffer), the digestion product was then purified and recovered by a gel extraction kit (QIAGEN);
[0168] 3. The forward and reverse oligonucleotide sequences synthesized in step III were annealed as follows:
TABLE-US-00010 1 μL Oligo1 (forward oligonucleotide sequence) (10 μM) 1 μL Oligo2 (reverse oligonucleotide sequence) (10 μM) 8 μL ddH.sub.2O Total: 10 μL [0169] At 37° C. for 30 min [0170] At 95° C. for 5 min, then down to 25° C. at a rate of 5° C./min
[0171] 4. A ligation reaction was initiated following the system below: reaction at room temperature for 10 min
TABLE-US-00011 pX330 digested with a BbsI enzyme in step 2 50 ng 5′-end phosphorylated oligonucleotide after annealing in step 3 (1:250 v/v, diluted with sterile water) 1 μL 2X Rapid ligation buffer (NEB) 5 μL ddH.sub.2O supplement the system to 10 μL Subtotal 10 μL Rapid ligase (NEB) 1 μL Total 11 μL
[0172] 5. The ligation system was treated with a plasmid-safe exonuclease to eliminate the incorrect-ligated plasmid:
TABLE-US-00012 Ligation reaction system obtained in step 4 11 μL 10X plasmid-safe buffer (NEB) 1.5 μL 10 mM ATP 1.5 μL Plasmid-safe exonuclease (NEB) 1 μL Total 15 μL [0173] Reaction at 37° C. for 30 min
[0174] 6. Transformation
[0175] (1) 50 μL competent cells (TIANGEN) were placed in an ice bath;
[0176] (2) To the centrifuge tube containing the competent cells was added 15 μL the solution with the incorrect-ligated plasmid eliminated obtained in step 5, mixed evenly and left in the ice bath for 30 min;
[0177] (3) The competent cells left in the ice bath for 30 min were placed in a water bath at 42° C. for 60˜90 s, and then transferred into the ice bath quickly to cool the cells for 2 to 3 min;
[0178] (4) 900 μL sterile LB medium (free from antibiotics) was added into the centrifuge tube, mixed evenly and placed in a shaking bed at 37° C. for culture with shaking at 150 rpm for 45 min;
[0179] (5) The centrifuge tube was centrifuged at 12000 rpm in a centrifuge for 5 min. 900 μL supernatant was discarded, and the competent cell precipitates were resuspended with the remaining 100 μL supernatant. The resuspended competent cells were then added onto an LB solid agar medium containing corresponding antibiotics, and coated uniformly with a sterile coating rod; The LB solid agar medium coated with competent cells was inverted in an incubator at 37° C. for culture for 12 to 16 h.
[0180] 7. Mini-extraction of plasmid, sequencing, identification of the successful construction of the target plasmid.
[0181] The constructed CRISPR/Cas9 vector is named as β4GalNT2-CRISPR/Cas9, its nucleotide sequence is shown in SEQ ID No: 6.
[0182] The GGTA1-CRISPR/Cas9 vector, the CMAH-CRISPR/Cas9 vector and the β4GalNT2-CRISPR/Cas9 vector (their profiles can be seen in
Embodiment 2 Construction of GGTA1/CMAH/β4GalNT2 Triple Knockout Pigs by Using a Somatic Cell Cloning Method
[0183] The GGTA1-CRISPR/Cas9 vector, CMAH-CRISPR/Cas9 vector and β4GalNT2-CRISPR/Cas9 vector constructed in Embodiment 1 were co-transfected into porcine fetal fibroblasts together with tdTomato plasmid. Single-cell clones were obtained by G418 screening and identified by sequencing to obtain GGTA1/CMAH/β4GalNT2 triple knockout porcine fetal fibroblasts. GGTA1/CMAH/β4GalNT2 triple knockout Landrace pigs were prepared by somatic cell nuclear transfer (SCNT). The genome of a newborn piglet was extracted, amplified by PCR primers, and ligated with a T vector for genotyping.
[0184] Step I. Resuscitation of Porcine Primary Fibroblasts
[0185] 1. The cryopreserved porcine primary fibroblasts were taken out from liquid nitrogen and thawed in a water bath at 37° C.;
[0186] 2. The thawed cells were transferred into a 15 mL sterile centrifuge tube, into which was then added 3 mL cell medium and centrifuged at 1500 rpm for 5 min;
[0187] Wherein, the formula of the complete cell medium was as below: 16% fetal bovine serum (Gibco) and 84% DMEM medium (Gibco), the percentages were percents by volume.
[0188] 3. The supernatant was discarded, the cell precipitates were resuspended by adding 2 mL complete medium, and the resuspended cells were then plated in a 6 cm cell culture dish, into which was supplemented 2 mL complete medium, and placed in a constant temperature incubator at 37° C. and 5% of CO.sub.2 (percents by volume) for culture.
[0189] 4. When the cells were cultured to confluent about 90% the bottom of the dish, they were digested with 0.05% (5 g/100 mL) of trypsin, and a complete medium was then added to terminate the digestion. The cell suspension was transferred into a 15 mL centrifuge tube, centrifuged at 1500 rpm for 5 min. The supernatant was discarded, and the cells were resuspended with 2 mL complete medium and counted. The total amount of cells was adjusted to 1.5×10.sup.6 for the next nucleofection.
[0190] Step II. Co-Transfection of Porcine Primary Fibroblasts with the Constructed GGTA1-PX330, CMAH-PX330, β4GalNT2-PX330 and tdTomato Plasmid (Clontech, PT4069-5)
[0191] The nucleofection experiments were performed by using a mammalian fibroblast nucleofection kit (Lonza) and a Lonza Nucleofactor™ 2 b nucleofection instrument.
[0192] 1. Formulation of a nucleofection reaction liquid, the system was as follows:
TABLE-US-00013 Basic solution for nucleofection 82 μL Supplement components 8 μL
[0193] 2. The three constructed plasmids and the Tdtomato plasmid were added into the 100 μL nucleofection reaction liquid obtained in the previous step 1 at a mass ratio of 5:1 respectively and mixed evenly, being careful not to generate bubbles during the process;
[0194] 3. The cell suspension prepared in step I was rinsed twice with Dulbecco's Phosphate Buffered Saline (DPBS, Gibco), digested at 37° C. for 2 min. A DMEM complete medium containing fetal bovine serum at a volume percent of 10% was then used to terminate the digestion. After then, the suspension was centrifuged at 1500 rpm for 5 min. The supernatant was discarded. The cells were resuspended with the nucleofection reaction liquid containing plasmids in the previous step 2, being careful to avoid the generation of bubbles during the process of resuspension;
[0195] 4. The nucleofection system was added into the electroporation cuvettes contained in the kit carefully, being careful to prevent the bubbles. The electroporation cuvettes containing 100 μL PBS were firstly placed in the cuvette troughs of the Lonza nucleofector. After the program was adjusted by selecting U023 nucleofection procedures, the electroporation cuvettes containing cells were electroporated, and the liquid in the electroporation cuvettes was then immediately sucked out in a Clean Bench gently and transferred into 1 mL DMEM complete medium containing fetal bovine serum of 16% by volume, and mixed gently;
[0196] 5. Preparing several culture dishes (10 cm) each containing 8 mL of complete medium. The cell suspension after nucleofection was pipetted and added into one culture dish containing the complete medium, and mixed evenly. The number of cells was observed under a microscope and counted such that the culture dish contained about 50 to 60 cells in a single field of view under the microscope. The remaining dishes were all added with the cell suspension following this final amount, mixed evenly and then placed in a constant temperature incubator at 37° C. and 5% of CO.sub.2 for culture.
[0197] Step III. Screening on Triple Knockout Cell Lines
[0198] 1. After the cells obtained in the step II were cultured for 24 h, the cell medium was replaced with a complete medium containing 1 mg/mL of G418, and placed in a constant temperature incubator at 37° C. and 5% of CO.sub.2 for culture. The cell medium was replaced every 2 to 3 days, during which the drug concentration of G418 was gradually reduced according to the growth profile of the cells. The final concentration of G418 was 0.3 mg/mL. After culture for about 10 to 14 days, monoclonal cell lines resistant to G418 would successively grew out in the culture dishes;
[0199] 2. The cell lines were sorted by using cloning rings. The sorted monoclonal cell lines were inoculated in a 24-well plate plated with 0.3 mg/mL of G418 complete medium, and placed in a constant temperature incubator at 37° C. and 5% of CO.sub.2 for culture. The cell medium was replaced every 2 to 3 days;
[0200] 3. When the cells were overgrown at the bottom of the wells in the 24-well plate, they were digested with trypsin and collected, wherein 4/5 of the cells were inoculated into a 12-well plate or a 6-well plate (according to the amount of cells) containing 0.3 mg/mL of G418 complete medium, and the remaining 1/5 of the cells were left in the 24-well plate to continue the culture;
[0201] 4. When the bottom of the 12-well plate or the 6-well plate was covered with cells, the cells were digested with 0.05% (5 g/100 mL) of trypsin and collected, and cryopreserved with a cell freezing medium (90% fetal bovine serum+10% DMSO, volume ratio);
[0202] Step IV. Gene Identification of Triple Knockout Cell Lines
[0203] 1. When the cells were overgrown at the bottom of the wells in the 24-well plate, they were digested with 0.05% (5 g/100 mL) of trypsin and collected. Then 25 ml NP-40 lysis buffer was added into the cells to lyse the cells and extract genomic DNA from the cells. The lysis procedures were: at 55° C. for 60 min—at 95° C. for 5 min—at 4° C. Upon the completion of the reaction, the genomic DNA was kept at −20° C.;
[0204] 2. Corresponding PCR primers were designed according to GGTA1/CMAH/β4GalNT2 gene target information. The PCR primer sequences were respectively:
TABLE-US-00014 GGTA1 The forward primer was: (SEQ ID No: 13) 5′-CCTTAGTATCCTTCCCAACCCAGAC-3′ The reverse primer was: (SEQ ID No: 14) 5′-GCTTTCTTTACGGTGTCAGTGAATCC-3′
[0205] The PCR target product was 428 bp in length;
TABLE-US-00015 CMAH The forward primer was: (SEQ ID No: 15) 5′-CTTGGAGGTGATTTGAGTTGGG-3′ The reverse primer was: (SEQ ID No: 16) 5′-CATTTTCTTCGGAGTTGAGGGC-3′
[0206] The PCR target product was 485 bp in length;
TABLE-US-00016 β4GalNT2 The forward primer was: (SEQ ID No: 17) 5′-CCCAAGGATCCTGCTGCC-3′ The reverse primer was: (SEQ ID No: 18) 5′-CGCCGTGTAAAGAAACCTCC-3′
[0207] The PCR target product was 399 bp in length;
[0208] 3. The GGTA1/CMAH/β4GalNT2 target gene was amplified by PCR reaction. The PCR reaction system was as follows:
TABLE-US-00017 Cell genomic DNA 2 μL GGTA1 Forward primer (10 pM) 1 μL GGTA1 reverse primer (10 pM) 1 μL 2X Taq enzyme premix 25 μL dd H.sub.2O 21 μL Total 50 μL
[0209] The reaction conditions were as follows:
TABLE-US-00018 Step 1 95° C. 5 min Step2 95° C. 30 s 64° C. 30 s {close oversize brace} 35 cycles 72° C. 45 s Step3 72° C. 7 min Step4 4° C. ∞
[0210] The amplification of CMAH target gene was performed the same as in the above steps; and the amplification of β4GalNT2 target gene was performed the same as in the above steps.
[0211] 4. The PCR reaction products were subjected to agarose gel electrophoresis (1%, i.e., 1 g agarose gel being added into 100 mL electrophoresis buffer). At the end of electrophoresis, the target band was cut under ultraviolet light, and then recovered by a gel extraction kit (QIAGEN), and the concentration of the recovered PCR products was determined by using NanoDrop 200;
[0212] 5. The recovered PCR products were ligated with T vectors by using a TAKARA pMD™ 18-T Vector Cloning Kit. The T vector reaction system was as follows:
TABLE-US-00019 pMD 18-T vector 1 μL Gel recovered PCR products 81.7 ng* ddH.sub.2O Supplement the system to 10 μL *Note: In the specification of the TAKARA pMD ™18-T Vector Cloning Kit, the amount of Insert DNA (here, gel recovered PCR products) was specified to be 0.1 to 0.3 pM, here 0.2 pM was selected. The amount was calculated as below: the amount of Insert DNA (ng) = the number of nmol × 660 × the number of bp of Insert DNA.
[0213] The reaction condition of T vector ligation was reaction at 16° C. for 30 min;
[0214] 6. The T vector ligation products obtained in the above step 5 were transformed with competent cells (TIANGEN). After the transformation, the competent cells were coated onto an Amp-resistant LB agar solid medium, and cultured in a constant temperature incubator at 37° C. overnight;
[0215] 10 to 15 monoclonal colonies were sorted from the medium cultured overnight and sent to a sequencing company for sequencing. The sequencing results were then compared with the target GGTA1/CMAH/β4GalNT2 information to determine whether the cell line was GGTA1/CMAH/β4GalNT2 gene knockout cell line;
[0216] A total of 27 monoclonal cell lines were sorted, wherein there was one biallelic knockout cell line in which three genes were knocked-out simultaneously, being numbered 50 #. The genotype of the clone is shown in Table 1:
TABLE-US-00020 TABLE 1 Gene identification of Landrace fibroblasts with the GGTA1/CMAH/β4GalNT2 gene knockout GGTA TTTTCCCAGGAGAAAATAATGAATGTCAAA WT GGAAGAGTGGTTCTGTC 50# TTTTCCCAGGAGAAAATAATGAATGTtCAA +1 AGGAAGAGTGGTTCTGTC CMAH AGGTCCATGCAGGCGTGAGTAAGGTACGTG WT ATCTGTTGGAAGACAGT 50# AGGTCCATGCAGGCGTGAGTAAaGGTACGT +1 GATCTGTTGGAAGACAGT β4GalNT2 GGGTAGTACTCACGAACACTCCGGAGCATG WT GTCATGAGCTTGTGGGG 50# GGGTAGT----------ACTCCGGAGCATG −10 GTCATGAGCTTGTGGGG
[0217] It was found from the results that, the knockout efficiencies of knocking-out GGTA1 (the nucleotide sequence of GGTA1 fragment of WT in Table 1 is as shown in SEQ ID No: 19), CMAH (the nucleotide sequence of CMAH fragment of WT in Table 1 is as shown in SEQ ID No: 20), β4GalNT2 (the nucleotide sequence of β4GalNT2 fragment of WT in Table 1 is as shown in SEQ ID No: 21) genes were 56%, 63% and 41%, respectively.
[0218] Since compared with GGTA1/CMAH double knockout, the binding to IgM, IgG of human is significantly reduced in GGTA1/CMAH/β4GalNT2 triple knockout, so triple knockout is necessary.
[0219] Step V. Somatic Cell Nuclear Transfer
[0220] 1. Sow ovarians at an age of six months or above were purchased from a slaughter house. The immature oocytes in the follicle were extracted artificially. The oocytes of good quality were sorted under a microscope and cultured in a constant temperature incubator at 38.5° C. and 5% of CO.sub.2 for 42 to 44 h until the maturation of oocytes;
[0221] 2. The mature oocytes in the above step (1) were denucleated with a micromanipulation system. The GGTA1/CMAH/β4GalNT2 knockout monoclonal cell lines obtained in Step IV were then resuscitated. The GGTA1/CMAH/β4GalNT2 knockout cells were injected into the denucleated oocytes as nuclear donors, wherein one GGTA1/CMAH/β4GalNT2 knockout cell was injected into each denucleated oocyte.
[0222] 3. The injected cells were then be used to activate the reconstructed embryos after nuclear transfer by using an electrofusion technology. The embryos were cultured in an incubator at 38.5° C. for 5 days until they developed into morula;
[0223] 4. The well-developed embryos were implanted into the womb of a surrogate sow. The surrogate sow was taken care carefully. One month after the implantation, the pregnancy profile in the recipient pig was detected with B ultrasound. The surrogate sow was monitored in real time until it labored.
[0224] Step VI. Genotyping of Triple Knockout Landrace
[0225] 1. After the GGTA1/CMAH/β4GalNT2 gene knockout piglets were born, the ear tissue was cut from the piglets, and then genomic DNA was extracted from the piglets by using a blood/cell/tissue genomic DNA isolation kit (TIANGEN);
[0226] 2. The piglet genomic DNA obtained in the above step 1 was subjected to PCR reaction, the conditions for which were the same as in Step IV, 3. The PCR reaction products were then sent to a sequencing company for sequencing. The sequencing results were compared the GGTA1/CMAH/β4GalNT2 gene target sequence.
[0227] A total of 8 GGTA1/CMAH/β4GalNT2 knockout pigs (TKO) were born, being numbered from 1 to 8 (as shown in
[0228] Following the steps in Embodiment 2, the GGTA1-CRISPR/Cas9 vector constructed in Embodiment 1 was used alone to get GGTA1 single gene knockout (GGTA1-KO) pigs.
Embodiment 3 Properties of GGTA1/CMAH/β4GalNT2 Knockout Pigs
[0229] 3.1. GGTA1/CMAH/β4GalNT2 in the GGTA1/CMAH/β4GalNT2 Knockout Pigs was Determined to be Knocked Out
[0230] After the GGTA1/CMAH/β4GalNT2 knockout pigs prepared in Embodiment 2 were weaned, blood was drawn and peripheral blood mononuclear cells (PBMC) were isolated, and the gene knockout profile of the piglets was determined by flow cytometer.
[0231] PBMC were isolated as follows: To 100 μL anticoagulant blood was added 3 times volume of red blood cell lysis buffer (BD, diluted with deionized water by 10 times), and the lysis was performed at room temperature for 5 min to 10 min. After centrifugation, the supernatant was discarded. The remainings were rinsed with a pre-cooled washing liquid 0.1% FBS (the solvent was PBS, 0.1% means 0.1 g FBS/100 mL PBS)(promote cell sedimentation), and centrifuged to obtain PBMC precipitates.
[0232] The commercialized human serum was inactivated in a water bath kettle at 56° C. for 30 min and then used to incubate the obtained PBMC on ice for 2 h, which were then centrifuged at 5000 rpm for 5 min, washed with PBS for three times, blocked with goat serum with a volume ratio of 10% at 4° C. for 30 min, and washed with PBS for additional three times. After incubation with antibodies specifically binding to GGTA1, CMAH and β4GalNT2, the antibodies were washed away with PBS, resuspended and the mean fluorescence intensity was determined on a machine.
[0233] The results were shown in
[0234] 3.2. Binding Level of Peripheral Blood Mononuclear Cells (PBMC) to Immunoglobulin in Human Serum
[0235] PBMC were separated from GGTA1/CMAH/β4GalNT2 knockout pigs (TKO), GGTA1-KO pigs prepared in Embodiment 2, as well as human and wild-type pigs following the process as described in 3.1.
[0236] The commercialized human serum was inactivated in a water bath kettle at 56° C. for 30 min and then used to incubate the obtained PBMC on ice for 2 h, which were then centrifuged at 5000 rpm for 5 min, washed with PBS for three times, blocked with goat serum with a volume ratio of 10% at 4° C. for 30 min, and washed with PBS for additional three times. After incubation with human specific immunoglobulin antibodies (i.e., anti-human IgM antibody and anti-human IgG antibody), the antibodies were washed away with PBS, resuspended and the mean fluorescence intensity was determined on a machine.
[0237] The results were shown in
Embodiment 4 Characteristics of RBC of TKO
[0238] (1) Separation of Red Blood Cells (RBCs)
[0239] The GGTA1/CMAH/β4GalNT2 knockout pigs (TKO) prepared in Embodiment 2 were immobilized, from the anterior vena cava of which 5 mL blood was drawn with a sterile syringe, and placed in an anticoagulation tube and preserved at 4° C. for one week. 2 mL of the above anticoagulant blood was taken and added into a 15 mL centrifuge tube, and then 2 mL PBS solution was added for dilution and mixed evenly. The diluted blood was slowly added into a 15 mL centrifuge tube containing 3 mL Ficoll-paque separation liquid (GE Company), at which there were two layers, wherein the upper layer was blood, and the lower layer was Ficoll-paque separation liquid. After centrifugation at 19° C. and at 400 g for 40 min, the liquid phase was divided into four layers, which were successively, from top to bottom, a plasma layer, a monocyte layer, a Ficoll-paque layer and a red blood cell layer. The supernatant was discarded, and the red blood cells were remained and resuspended with 7 mL PBS solution and mixed evenly. After centrifugation at 19° C. and at 400 g for 10 min, the supernatant was discarded, and 5 mL PBS solution was added for resuspension and mixed evenly. After centrifugation at 19° C. and at 400 g for 10 min, the supernatant was discarded, and 2 mL PBS was added for resuspension, ready for use.
[0240] Following this process, human RBCs and RBCs of wild-type pigs (WT) can be obtained respectively.
[0241] (2) Incubation with IB4 Agglutinin or DBA
[0242] IB4 agglutinin interacted with carbohydrates ligated to a galactose generated from the expression products of GGTA1; and DBA agglutinin interacted with the structures of carbohydrates generated from the expression products of β4GalNT2.
[0243] 1×10.sup.5 red blood cells prepared in step (1) were placed in a 1.5 mL EP tube and centrifuged at 3000 rpm for 5 min, discarding the supernatant. The cell precipitates were resuspended with 200 μL of IB4 agglutinin (purchased from Invitrogen) or DBA agglutinin (purchased from Invitrogen) dilution (at a dilution ratio of 1:1000) diluted with PBS, and incubated at 4° C. in dark for 1 h. The samples which have not been incubated with agglutinin were used as blank control. They were washed twice with a PBS solution, the centrifuged precipitates were resuspended with 200 μL of PBS solution, detected with BD FACSCalibur flow cytometry, and analyzed using FlowJo 10.0 software, with the results being shown in
[0244] Columns 1 and 2 in
[0245] (3) Incubation with Neu5Gc Antibody
[0246] CMAH gene was capable of synthesizing saccharide molecule Neu5Gc. 1×10.sup.5 red blood cells prepared in step (1) were placed in a 1.5 mL EP tube and centrifuged at 3000 rpm for 5 min, discarding the supernatant. The cells were resuspended with 200 μL of 0.5% diluted blocking liquid (free from mammal serum) and incubated at 4° C. in dark for 30 min. They were washed twice with a PBS solution, the centrifuged precipitates were then resuspended with 200 μL of Neu5Gc antibody (Purified anti-Neu5Gc Antibody (biolegend, 146903)) dilution (at a dilution ratio of 1:1000) diluted with a PBS solution, and incubated at 4° C. for 1 h. The samples which have not been incubated with antibodies were used as blank control. They were washed twice with a PBS solution, and the cell precipitates were then resuspended with 200 μL of goat-anti-chick IgY antibody (invitrogen, A11039) dilution (at a dilution ratio of 1:1000) diluted with a PBS solution, incubated at 4° C. in dark for 1 h, and centrifuged at 3000 rpm for 5 min, discarding the supernatant. They were washed twice with a PBS solution, the centrifuged precipitates were then resuspended with 200 μL of PBS solution, detected with BD FACSCalibur flow cytometry, and analyzed using FlowJo 10.0 software, with the results being shown in
[0247] Column 3 in
[0248] (4) Human IgG/IgM Binding Experiment
[0249] Human type AB serum was inactivated in advance by incubation at 56° C. for 30 min. 1×10.sup.5 red blood cells prepared in step (1) were placed in a 1.5 mL EP tube and centrifuged at 3000 rpm for 5 min, discarding the supernatant. The cell precipitates were resuspended with 200 μL of 15% (v/v) human AB serum dilution diluted with a PBS solution and incubated at 4° C. for 1 h. The samples which have not been incubated with human AB serum were used as blank control. They were washed twice with a PBS solution, and the cells were then resuspended with 200 μL of 10% (v/v) ready-to-use normal goat serum and incubated at 4° C. for 30 min. They were washed twice with a PBS solution, and the cell precipitates were then resuspended with 200 μL of goat-anti-human IgG or IgM antibody (anti-human IgM (invitrogen, A18842); anti-human IgG (invitrogen, A18830) dilution (at a dilution ratio of 1:1000) diluted with a PBS solution, incubated at 4° C. in dark for 1 h, and centrifuged at 3000 rpm for min, discarding the supernatant. They were washed twice with a PBS solution, the centrifuged precipitates were then resuspended with 200 μL of PBS, detected with BD FACSCalibur flow cytometry, and analyzed using FlowJo 10.0 software, with the results being shown in
[0250] The results in
Embodiment 5 Red Blood Cell Agglutination Test
[0251] 5.1 Agglutination Test
[0252] See Embodiment 4 for the acquisition process of RBC.
[0253] The collected porcine blood, after being washed for three times, was formulated to a 3% red blood cell suspension. 50 μL of 3% (v/v) RBCs (WT pigs and TKO pigs) suspension and 100 μL of normal human (types A, B, AB and O) serum were respectively added into glass test tubes, incubated at 37° C. for 30 min, centrifuged at 1500 g for 30 s, discarding the supernatant. They were washed with normal saline for 3 times, into which were respectively added 25 μL of anti-human IgG antibodies (Shanghai Blood Biomedicine Co. LTD), centrifuged at 1000 g for 15 s at ambient temperature, and shaked gently. After then, the agglutination degrees were observed, with the results being shown in
[0254] It was indicated from the results in
[0255] Each 2 drops of anti-A human polyclonal antibody, anti-B human polyclonal antibody and anti-D human polyclonal antibody (all purchased from The Institute of Blood Transfusion, Chinese Academy of Medical Sciences) were added into 1 drop of 3% RBCs (WT pigs, TKO pigs and human) suspension to be detected after being washed for three times. They were added into a test tube together, mixed evenly, and centrifuged at 1000 g for 15 seconds. The agglutination degrees were observed by naked eyes, with the results being shown in
[0256] It was indicated from the results in
[0257]
[0258] 5.2 Determination of Red Blood Cell Agglutination by Saline Method
[0259] See Embodiment 4 for the acquisition process of RBCs (WT pigs, TKO pigs and human). These RBCs were used as donor red blood cells.
[0260] Human type A, type B, type AB, and type O sera (all taken from healthy blood donors) were used as recipient sera.
[0261] Two tiny test tubes were taken and marked as the main tube and the self control tube respectively. The main tube was added with 2 drops of recipient serum and 1 drop of donor red blood cell suspension; the self control tube was added with 2 drops of recipient serum and 1 drop of recipient red blood cell suspension. They were mixed evenly by shaking and centrifuged at 1000 g for 15 seconds. The agglutination degrees were observed by naked eyes, with the results being shown in
[0262] It was indicated from the results in
[0263] 5.3 Determination of Red Blood Cell Agglutination by Indirect Antihuman Globulin Method
[0264] See Embodiment 4 for the acquisition process of RBCs (WT pigs, TKO pigs and human). These RBCs were used as donor red blood cells.
[0265] Human type A, type B, type AB, and type O sera (all taken from healthy blood donors) were used as recipient sera.
[0266] The loading of the main tube and the self control tube was achieved following the operational steps of saline method as described in Embodiment 5.2. The mixture was mixed evenly and incubated at 37° C. for 30 minutes. Red blood cells were washed for three times, and the tubes were dried by patting after the last washing. Each tube was added with 1 drop of antihuman IgG antibody (purchased from Shanghai Blood Biomedicine Co. LTD), mixed, and centrifuged at 1000 g for 15 seconds. The results were observed and shown in
[0267] It was indicated from the results in
Embodiment 6 Human Monocyte to Macrophage Differentiation Associated Protein (MMA) Test
[0268] Materials and Methods
[0269] 1. Blood Specimens
[0270] Human blood samples were taken from blood donors, who meet the National standards for blood donors' health examination. 5 mL of whole blood was draw from each person, and preserved at 4° C., ready for use. 5497 (type A), 5119 (type O) blood samples were taken from WT pigs, 0 # (type A), 3 # (type O) blood samples were taken from TKO pigs.
[0271] 2. Instruments and Reagents
[0272] Lymphocyte separation liquid (AS1114545, Axis-Shield, Norway), RPMI 1640 basic medium (gibco, US), fetal bovine serum (FBS, 0500, Sciencell, US), Wright-Giemsa Stain (DN0007, Leagene Biotech. Co., Ltd), Methanol (Sinopharm). Chamber system (154534PK, Thermo Fisher, US), Upright Microscope (BX53, Olympus, Japan).
[0273] 3. Separation and Cultivation of Human Peripheral Blood Mononuclear Cells (PBMCs)
[0274] 5 mL of the whole blood was transferred into a 50 mL centrifuge tube, into which was added an equal amount of PBS for dilution and mixed evenly. Into a 50 mL centrifuge tube was added 10 mL of the lymphocyte separation liquid, and the diluted blood was added gently to the top of the lymphocyte separation liquid in the centrifuge tube, and centrifuged at 2200 rpm at room temperature for 20 min, during which the centrifugal speed rose and fell slowly. After centrifugation, the cell layer at which PBMC were located was white. This layer of cells were pipetted into another 50 mL centrifuge tube, which were washed twice by adding PBS, resuspended in RPMI 1640 +10% FBS medium, and cultivated in the chamber system (500 μL/well, 700000 cells), and incubated in an incubator at 37° C. and 5% of CO.sub.2 for 1 hour to make them adhere to the wall.
[0275] 4. Co-Incubation Treatment of Porcine Red Blood Cells (pRBCs) and Sera
[0276] Porcine red blood cells pRBC (WT pigs and TKO pigs) were drawn, washed twice with PBS, and counted. Sera were drawn from human whole blood. 1.4×10.sup.8 red blood cells were mixed with 200 μL of sera evenly, incubated in an incubator at 37° C. and 5% of CO.sub.2 for 1 hour. A positive control group (Incubation of human-derived anti-D antibody and human red blood cells) and a negative control group (Incubation of type AB serum and human type O red blood cells) were set. They were washed with PBS for 3 times, resuspended in 500 μL RPMI 1640+10% FBS medium.
[0277] 5. MMA Phagocytosis Test
[0278] The adherent PBMCs were sucked out of the medium, then 500 μL of pRBCs which have been reacted with the serum were added, incubated in an incubator at 37° C. and 5% of CO.sub.2 for 2 hours, rinsed with PBS twice, immobilized with methanol at room temperature for 45 s, and stained with Wright-Giemsa Stain at room temperature for 1 minute; an equal amount of phosphate dilution was added and left at room temperature for 5 min. The stain was then flushed away with water. It was dried and then photographed.
[0279] The mean phagocytic index was determined as follows: observation using a microscope, photographing, and counting more than 600 cells. The mean phagocytic index=Number of adherent or phagocytic red blood cells/Total number of cells×100%.
[0280] The results of mean phagocytic index can be found in
[0281] Embodiments of the present application are described herein, including the manner in which the inventors are aware of the practice of the present application. Those embodiments and their simple variations will be apparent to those of ordinary skill in the art in view of this disclosure. It can be anticipated by the inventors that skilled artisans can apply such variations as needed, and the inventors intend to implement the application in ways other than those specifically described herein. Accordingly, this application includes all modifications and equivalents of the subject matter described in the appended claims, which are approved by applicable laws. Moreover, unless otherwise stated herein or clearly contradicted by the context, the application includes any combination of all possible variations of the elements described above.