LACTATE DEHYDROGENASE A (LDHA) iRNA COMPOSITIONS AND METHODS OF USE THEREOF

20210228614 · 2021-07-29

    Inventors

    Cpc classification

    International classification

    Abstract

    The invention relates to double-stranded ribonucleic acid (dsRNA) compositions targeting the LDHA gene, as well as methods of inhibiting expression of LDHA, methods of inhibiting LDHA and HAO1, and methods of treating subjects that would benefit from reduction in expression of LDHA, such as subjects having an oxalate pathway-associated disease, disorder, or condition, using such dsRNA compositions.

    Claims

    1.-3. (canceled)

    4. The dsRNA agent of claim 31, wherein at least one of said modified nucleotides is selected from the group consisting of a deoxy-nucleotide, a 3′-terminal deoxy-thymine (dT) nucleotide, a 2′-O-methyl modified nucleotide, a 2′-fluoro modified nucleotide, a 2′-deoxy-modified nucleotide, a locked nucleotide, an unlocked nucleotide, a conformationally restricted nucleotide, a constrained ethyl nucleotide, an abasic nucleotide, a 2′-amino-modified nucleotide, a 2′-O-allyl-modified nucleotide, 2′-C-alkyl-modified nucleotide, 2′-hydroxyl-modified nucleotide, a 2′-methoxyethyl modified nucleotide, a 2′-O-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, a non-natural base comprising nucleotide, a tetrahydropyran modified nucleotide, a 1,5-anhydrohexitol modified nucleotide, a cyclohexenyl modified nucleotide, a nucleotide comprising a phosphorothioate group, a nucleotide comprising a methylphosphonate group, a nucleotide comprising a 5′-phosphate, a nucleotide comprising a 5′-phosphate mimic, a glycol modified nucleotide, and a 2-O—(N-methylacetamide) modified nucleotide, and combinations thereof.

    5. The dsRNA agent of claim 31, wherein the modified nucleotides are selected from the group consisting of a 2′-O-methyl modified nucleotide and a 2′-fluoro modified nucleotide.

    6. The dsRNA agent of claim 31, wherein at least one strand comprises a 3′ overhang of at least 1 nucleotide.

    7. The dsRNA agent of claim 31, wherein the agent further comprises at least one phosphorothioate or methylphosphonate internucleotide linkage.

    8. The dsRNA agent of claim 7, wherein the sense strand comprises at least one phosphorothioate internucleotide linkage at the 3′terminus.

    9. The dsRNA agent of claim 7, wherein the antisense strand comprises at least one phosphorothioate internucleotide linkage at the 3′terminus

    10. The dsRNA agent of claim 31, wherein the ligand is conjugated to the 3′ end of the sense strand of the dsRNA agent.

    11. (canceled)

    12. The dsRNA agent of claim 31 wherein said double stranded region comprises 20 nucleotides.

    13. The dsRNA agent of claim 31, wherein said double stranded region exhibits 100% complementarity between the sense and antisense strands.

    14. (canceled)

    15. The dsRNA agent of claim 31, wherein the dsRNA agent is capable of knocking down LDHA expression by at least 80% in a cell when provided as a single dose of 10 nM to the cell.

    16. The dsRNA agent of claim 31, wherein the antisense strand is 22 nucleotides in length.

    17. A cell containing the dsRNA agent of claim 31.

    18. A pharmaceutical composition for inhibiting expression of a lactic acid dehydrogenase A (LDHA) gene comprising the dsRNA agent of claim 31.

    19. (canceled)

    20. (canceled)

    21. A method of inhibiting lactic acid dehydrogenase A (LDHA) expression in a cell, the method comprising contacting the cell with the dsRNA agent of claim 31, or the pharmaceutical composition of claim 18, thereby inhibiting expression of LDHA in the cell.

    22. The method of claim 21, wherein the cell is within a subject.

    23. The method of claim 22, wherein the subject is a human.

    24. The method of claim 21, wherein the LDHA expression is inhibited by at least 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95%, or to below the level of detection of LDHA expression.

    25. The method of claim 23, wherein the human subject suffers from an oxalate pathway-associated disease, disorder, or condition.

    26. The method of claim 25, wherein the oxalate pathway-associated disease, disorder, or condition is an oxalate-associated disease, disorder, or condition, or a lactate dehydrogenase-associated disease, disorder, or condition.

    27. The method of claim 26, wherein the oxalate-associated disease, disorder, or condition is a kidney stone formation disease, disorder, or condition, or a calcium oxalate tissue deposition disease, disorder, or condition.

    28. The method of claim 26, wherein the lactate dehydrogenase-associated disease, disorder, or condition is selected from the group consisting of cancer, fatty liver (steatosis), nonalcoholic steatohepatitis (NASH), cirrhosis of the liver, accumulation of fat in the liver, inflammation of the liver, hepatocellular necrosis, liver fibrosis, and nonalcoholic fatty liver disease (NAFLD).

    29. (canceled)

    30. A method of treating a subject having a disorder that would benefit from a reduction in LDHA expression, the method comprising administering to the subject a therapeutically effective amount of the dsRNA agent of claim 31, or the pharmaceutical composition of claim 18, thereby treating the subject.

    31. A double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of lactic acid dehydrogenase A (LDHA) in a cell, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the antisense nucleotide sequences listed in any one of Tables 2-5, wherein the antisense strand is 19-23 nucleotides in length, wherein all of the nucleotides of the sense strand are modified nucleotides wherein all of the nucleotides of the antisense strand are modified nucleotides, and wherein a ligand comprising one or more N-acetylgalactosamine (GalNAc) derivatives attached through a monovalent, bivalent, or trivalent branched linker is conjugated to at least one strand of the agent.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0109] FIG. 1A is a schematic of the endogenous pathways for oxalate synthesis.

    [0110] FIG. 1B is a schematic of the metabolic pathways associated with LDHA.

    [0111] FIG. 2 is a graph showing the level of Ldha mRNA remaining in wild-type C57BL/6J mice at 10 days post-dose of a single 0.1 mg/kg, 0.3 mg/kg, 1.0 mg/kg, 3.0 mg/kg, or 10 mg/kg dose of AD-84788.

    [0112] FIG. 3 is a graph showing hepatic LDHA activity in adult male Agxt knockout mice 4 weeks after subcutaneous administration of a single 0.3 mg/kg, 1 mg/kg, 3 mg/kg, or 10 mg/kg dose of AD-84788. Agxt knockout mice administered 0 mg/kg of AD-84788 served as untreated controls.

    [0113] FIG. 4 is a schematic of the study protocol described in Example 3 and referred to in FIGS. 6-17B.

    [0114] FIG. 5 is a graph showing the amount of urinary oxalate (mg per g of creatinine) excreted by Agxt knockout mice over a twenty-four hour period at weeks 0, 1, 2, 3, 4, 6, 8, 9, and 10 following subcutaneous administration of a single 0.3 mg/kg, 1 mg/kg, 3 mg/kg, or 10 mg/kg dose of AD-84788. Agxt knockout mice administered 0 mg/kg of AD-84788 served as untreated controls.

    [0115] FIG. 6 is a graph showing the amount of oxalate (mg per g of creatinine) excreted in the urine of Agxt knockout mice, wild-type mice, and Grhpr (glyoxylate reductase/hydroxypyruvate reductase) knockout mice 4 weeks after a single 10 mg/kg dose of AD-84788.

    [0116] FIG. 7 is a graph showing the amount of oxalate (mg per g of creatinine) excreted in the urine of Agxt deficient mice administered the dsRNA agent AD-84788 at Day 0 pre-dose (baseline, i.e., at days −6, −5, −4, and −3); at days 7-10 after a single 10 mg/kg dose of AD-84788; and at days 28-31 following the last administration of four 10/mg/kg doses of AD-84788 on days 0, 11, 18, and 25 (see, FIG. 4).

    [0117] FIG. 8A is a graph showing the enzymatic activity of LdhA in wild-type liver homogenates of untreated control mice and mice administered four 10 mg/kg doses of AD-84788 (see, FIG. 4) using lactic acid as a substrate. Absorbance increases as NAD is reduced to NADH via LDH enzymatic activity. The initial linear range was selected, and absorbances at 1 and 6 minutes were utilized in specific activity calculations as Δ.sub.abs, across a Δ.sub.time of 5 minutes.

    [0118] FIG. 8B is a graph showing the mean specific activity of LdhA in wild-type liver homogenates of untreated control mice and mice administered four 10 mg/kg doses of AD-84788 (see, FIG. 4) using lactic acid as a substrate. Specific activity is expressed as μmol NADH formed/min/g protein. Calculations were performed for all animals individually, and a t-test was conducted comparing all specific activity data from both treatment groups. Mean specific activity of both treatment groups is presented. (p<0.001).

    [0119] FIG. 9A is a graph showing the enzymatic activity of LdhA in wild-type liver homogenates of untreated control mice and mice administered four 10 mg/kg doses of AD-84788 (see, FIG. 4) using glyoxylate as a substrate. Absorbance increases as NAD is reduced to NADH via LDH enzymatic activity. The initial linear range was selected, and absorbances at 0 and 4 minutes were utilized in specific activity calculations as Δ.sub.abs across a Δ.sub.time of 4 minutes.

    [0120] FIG. 9B is a graph showing the mean specific activity of LdhA in wild-type liver homogenates of untreated control mice and mice administered four 10 mg/kg doses of AD-84788 (see, FIG. 4) using glyoxylate as a substrate. Specific activity is expressed as μmol NADH formed/min/g protein. Calculations were performed for all animals individually, and a t-test was conducted comparing all specific activity data from both treatment groups. Mean specific activity of both treatment groups is presented. (p<0.001).

    [0121] FIG. 10A is a graph showing the enzymatic activity of LdhA in Agxt deficient liver homogenates of untreated control mice and mice administered four 10 mg/kg doses of AD-84788 (see, FIG. 4) using lactic acid as a substrate. Absorbance increases as NAD is reduced to NADH via LDH enzymatic activity. The initial linear range was selected, and absorbances at 0 and 4 minutes were utilized in specific activity calculations as Δ.sub.abs across a Δ.sub.time of 4 minutes. SD is too small to be visualized in the mean treated group.

    [0122] FIG. 10B is a graph showing the mean specific activity of LdhA in Agxt deficient liver homogenates of untreated control mice and mice administered four 10 mg/kg doses of AD-84788 (see, FIG. 4) using lactic acid as a substrate. Specific activity is expressed as μmol NADH formed/min/g protein. Calculations were performed for all animals individually, and a t-test was conducted comparing all specific activity data from both treatment groups. Mean specific activity of both treatment groups is presented. (p<0.001).

    [0123] FIG. 11A is a graph showing the enzymatic activity of LdhA in Agxt deficient liver homogenates of untreated control mice and mice administered four 10 mg/kg doses of AD-84788 (see, FIG. 4) using glyoxylate as a substrate. Absorbance increases as NAD is reduced to NADH via LDH enzymatic activity. The initial linear range was selected, and absorbances at 0 and 4 minutes were utilized in specific activity calculations Δ.sub.abs across a Δ.sub.time of 4 minutes.

    [0124] FIG. 11B is a graph showing the mean specific activity of LdhA in Agxt deficient liver homogenates of untreated control mice and mice administered four 10 mg/kg doses of AD-84788 (see, FIG. 4) using glyoxylate as a substrate. Specific activity is expressed as μmol NADH formed/min/g protein. Calculations were performed for all animals individually, and a t-test was conducted comparing all specific activity data from both treatment groups. Mean specific activity of both treatment groups is presented. (p<0.001).

    [0125] FIG. 12A is a graph showing the enzymatic activity of LdhA in wild-type heart homogenates of untreated control mice and mice administered four 10 mg/kg doses of AD-84788 (see, FIG. 4) using lactic acid as a substrate. Absorbance for both the control group and the treatment group increases as NAD is reduced to NADH via LDH enzymatic activity. The initial linear range was selected, and absorbances at 0 and 4 minutes were utilized in specific activity calculations as Δ.sub.abs across a Δ.sub.time of 4 minutes.

    [0126] FIG. 12B is a graph showing the mean specific activity of LdhA in wild-type heart homogenates of untreated control mice and mice administered four 10 mg/kg doses of AD-84788 (see, FIG. 4) using lactic acid as a substrate. Specific activity is expressed as μmol NADH formed/min/g protein. Calculations were performed for all animals individually, and a t-test was conducted comparing all specific activity data from both treatment groups. Mean specific activity of both treatment groups is presented. There is no significant difference.

    [0127] FIG. 12C is a graph showing the enzymatic activity of LdhA in wild-type thigh muscle homogenates of untreated control mice and mice administered four 10 mg/kg doses of AD-84788 (see, FIG. 4) using lactic acid as a substrate. Absorbance for both the control group and the treatment group increases as NAD is reduced to NADH via LDH enzymatic activity. The initial linear range was selected, and absorbances at 0 and 4 minutes were utilized in specific activity calculations as Δ.sub.abs across a Δ.sub.time of 4 minutes.

    [0128] FIG. 12D is a graph showing the mean specific activity of LdhA in wild-type thigh muscle homogenates of untreated control mice and mice administered four 10 mg/kg doses of AD-84788 (see, FIG. 4) using lactic acid as a substrate. Specific activity is expressed as μmol NADH formed/min/g protein. Calculations were performed for all animals individually, and a t-test was conducted comparing all specific activity data from both treatment groups. Mean specific activity of both treatment groups is presented. There is no significant difference.

    [0129] FIG. 13A is a graph showing the mean amount of lactate in wild-type liver homogenates of wild-type mice prior to the administration of four 10 mg/kg doses of AD-84788 (baseline) and the mean amount of lactate in wild-type liver homogenates of wild-type mice four weeks after the administration of four 10 mg/kg doses of AD-84788 (see, FIG. 4).

    [0130] FIG. 13B is a graph showing the mean amount of pyruvate in wild-type liver homogenates of wild-type mice prior to the administration of four 10 mg/kg doses of AD-84788 (baseline) and the mean amount of pyruvate in wild-type liver homogenates of wild-type mice four weeks after the administration of four 10 mg/kg doses of AD-84788 (see, FIG. 4).

    [0131] FIG. 14A is a graph showing the mean amount of lactate in Agxt deficient liver homogenates of Agxt deficient mice prior to the administration of four 10 mg/kg doses of AD-84788 (baseline) and the mean amount of lactate in Agxt deficient liver homogenates of Agxt deficient mice four weeks after the administration of four 10 mg/kg doses of AD-84788 (see, FIG. 4).

    [0132] FIG. 14B is a graph showing the mean amount of pyruvate in Agxt deficient liver homogenates of Agxt deficient mice prior to the administration of four 10 mg/kg doses of AD-84788 (baseline) and the mean amount of pyruvate in Agxt deficient liver homogenates of Agxt deficient mice four weeks after the administration of four 10 mg/kg doses of AD-84788 (see, FIG. 4)

    [0133] FIG. 15A is a graph showing the mean amount of glyoxylate in wild-type liver homogenates of wild-type mice prior to the administration of four 10 mg/kg doses of AD-84788 (baseline) and the mean amount of glyoxylate in wild-type liver homogenates of wild-type mice four weeks after the administration of four 10 mg/kg doses of AD-84788 (see, FIG. 4).

    [0134] FIG. 15B is a graph showing the mean amount of glyoxylate in Agxt deficient liver homogenates of Agxt deficient mice prior to the administration of four 10 mg/kg doses of AD-84788 (baseline) and the mean amount of glyoxylate in Agxt deficient liver homogenates of Agxt deficient mice four weeks after the administration of four 10 mg/kg doses of AD-84788 (see, FIG. 4).

    [0135] FIG. 16A is a graph showing the mean body weights of wild-type mice prior to the administration of four 10 mg/kg doses of AD-84788 (baseline) and the mean body weights of wild-type mice four weeks after the administration of four 10 mg/kg doses of AD-84788 (see, FIG. 4).

    [0136] FIG. 16B is a graph showing the mean body weights of Agxt deficient mice prior to the administration of four 10 mg/kg doses of AD-84788 (baseline) and the mean body weights of Agxt deficient mice four weeks after the administration of four 10 mg/kg doses of AD-84788 (see, FIG. 4).

    [0137] FIG. 17A is is a graph showing the mean plasma lactate levels of wild-type mice prior to the administration of four 10 mg/kg doses of AD-84788 (baseline) and the mean plasma lactate levels of wild-type mice four weeks after the administration of four 10 mg/kg doses of AD-84788 (see, FIG. 4).

    [0138] FIG. 17B is is a graph showing the mean plasma lactate levels of Agxt deficient mice prior to the administration of four 10 mg/kg doses of AD-84788 (baseline) and the mean plasma lactate levels of Agxt deficient mice four weeks after the administration of four 10 mg/kg doses of AD-84788 (see, FIG. 4).

    [0139] FIGS. 18A-18O depict exemplary dual targeting agents of the invention.

    [0140] FIG. 18A depicts an exemplary dual targeting agent of the invention comprising a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1, wherein the first dsRNA agent comprises a first sense strand (S) and a first antisense strand (AS), wherein the second dsRNA agent comprises a second sense strand (S) and a second antisense strand, wherein the 3′end of the first sense strand is covalently attached to the 5′ end of the second sense strand with a nucleotide linker comprising 2′OMe modified nucleotides (uuu), wherein the 3′ end of the second sense strand comprises a GalNAc ligand, and wherein the two 5′-most nucleotides of the first sense strand each independently comprise a phosphorothioate linkage.

    [0141] FIG. 18B depicts an exemplary dual targeting agent of the invention comprising a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1, wherein the first dsRNA agent comprises a first sense strand (S) and a first antisense strand (AS), wherein the second dsRNA agent comprises a second sense strand (S) and a second antisense strand (AS), wherein the 3′end of the first sense strand is covalently attached to the 5′ end of the second sense strand with a nucleotide linker comprising 2′Fluoro modified nucleotides (GfAfAf), wherein the 3′ end of the second sense strand comprises a GalNAc ligand, and wherein the two 5′-most nucleotides of the first sense strand, the 3′-most nucleotide of the first sense strand, and the 5′-most nucleotide of the second sense strand each independently comprise a phosphorothioate linkage.

    [0142] FIG. 18C depicts an exemplary dual targeting agent of the invention comprising a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1, wherein the first dsRNA agent comprises a first sense strand (S) and a first antisense strand (AS), wherein the second dsRNA agent comprises a second sense strand (S) and a second antisense strand (AS), wherein the 3′end of the first sense strand is covalently attached to the 5′ end of the second sense strand with a nucleotide linker comprising 2′Fluoro modified nucleotides (GfAfUf), wherein the 3′ end of the second sense strand comprises a GalNAc ligand, and wherein the two 5′-most nucleotides of the first sense strand, the 3′-most nucleotide of the first sense strand, and the 5′-most nucleotide of the second sense strand each independently comprise a phosphorothioate linkage.

    [0143] FIG. 18D depicts an exemplary dual targeting agent of the invention comprising a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1, wherein the first dsRNA agent comprises a first sense strand (S) and a first antisense strand (AS), wherein the second dsRNA agent comprises a second sense strand (S) and a second antisense strand (AS), wherein the 3′end of the first sense strand is covalently attached to the 5′ end of the second sense strand with a nucleotide linker comprising deoxynucleotides (dgdada), wherein the 3′ end of the second sense strand comprises a GalNAc ligand, and wherein the two 5′-most nucleotides of the first sense strand, the 3′-most nucleotide of the first sense strand, and the 5′-most nucleotide of the second sense strand each independently comprise a phosphorothioate linkage.

    [0144] FIG. 18E depicts an exemplary dual targeting agent of the invention comprising a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1, wherein the first dsRNA agent comprises a first sense strand (S) and a first antisense strand (AS), wherein the second dsRNA agent comprises a second sense strand (S) and a second antisense strand (AS), wherein the 3′end of the first sense strand is covalently attached to the 5′ end of the second sense strand with a nucleotide linker comprising deoxynucleotides (dgda), wherein the 3′ end of the second sense strand comprises a GalNAc ligand, and wherein the two 5′-most nucleotides of the first sense strand, the 3′-most nucleotide of the first sense strand, and the 5′-most nucleotide of the second sense strand each independently comprise a phosphorothioate linkage.

    [0145] FIG. 18F depicts an exemplary dual targeting agent of the invention comprising a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1, wherein the first dsRNA agent comprises a first sense strand (S) and a first antisense strand (AS), wherein the second dsRNA agent comprises a second sense strand (S) and a second antisense strand (AS), and the 3′end of the first sense strand is directly attached (no linker) to the 5′ end of the second sense strand, wherein the two 5′-most nucleotides of the first sense strand and the two 3′-most nucleotides of the second sense strand each independently comprise a phosphorothioate linkage, and wherein the 3′ end of the first sense strand comprises a GalNAc ligand.

    [0146] FIG. 18G depicts an exemplary dual targeting agent of the invention comprising a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1, wherein the first dsRNA agent comprises a first sense strand (S) and a first antisense strand (AS), wherein the second dsRNA agent comprises a second sense strand (S) and a second antisense strand (AS), wherein the 5′end of the first antisense strand is covalently attached to the 3′ end of the second antisense strand with a nucleotide linker comprising 2′OMe modified nucleotides (acu), wherein the 3′ end of the second sense strand comprises a GalNAc ligand, and wherein the two 3′-most nucleotides of the first antisense strand and the two 5′-most nucleotides of the second antisense strand each independently comprise a phosphorothioate linkage.

    [0147] FIG. 18H depicts an exemplary dual targeting agent of the invention comprising a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1, wherein the first dsRNA agent comprises a first sense strand (S) and a first antisense strand (AS), wherein the second dsRNA agent comprises a second sense strand (S) and a second antisense strand (AS), wherein the 5′end of the first antisense strand is covalently attached to the 3′ end of the second antisense strand with a nucleotide linker comprising 2′Flouro modified nucleotides (AfAfGf), wherein the 3′ end of the second sense strand comprises a GalNAc ligand, and wherein the two 3′-most nucleotides of the first antisense strand, the 5′ nucleotide of the first antisense strand, the 3′ nucleotide of the second antisense strand, and the two 5′-most nucleotides of the second antisense strand each independently comprise a phosphorothioate linkage.

    [0148] FIG. 18I depicts an exemplary dual targeting agent of the invention comprising a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1, wherein the first dsRNA agent comprises a first sense strand (S) and a first antisense strand (AS), wherein the second dsRNA agent comprises a second sense strand (S) and a second antisense strand (AS), wherein the 5′end of the first antisense strand is directly attached (no linker) to the 3′ end of the second antisense strand, wherein the 3′ end of the second sense strand comprises a GalNAc ligand, and wherein the two 3′-most nucleotides of the first antisense strand and the two 5′-most nucleotides of the second antisense strand each independently comprise a phosphorothioate linkage.

    [0149] FIG. 18J depicts an exemplary dual targeting agent of the invention comprising a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1, wherein the first dsRNA agent comprises a first sense strand (S) and a first antisense strand (AS), wherein the second dsRNA agent comprises a second sense strand (S) and a second antisense strand (AS), wherein the 3′end of the first sense strand is covalently attached to the 5′ end of the second sense strand with a nucleotide linker comprising 2′OMe modified nucleotides (uuu), wherein the 5′ end of the first sense strand and the 3′ end of the second sense strand each independently comprise a GalNAc ligand, and wherein the 5′ nucleotide of the first sense strand comprises a phosphorothioate linkage.

    [0150] FIG. 18K depicts an exemplary dual targeting agent of the invention comprising a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1, wherein the first dsRNA agent comprises a first sense strand (S) and a first antisense strand (AS), wherein the second dsRNA agent comprises a second sense strand (S) and a second antisense strand (AS), wherein the 3′end of the first sense strand is covalently attached to the 5′ end of the second sense strand with a nucleotide linker comprising 2′Fluoro modified nucleotides (GfAfAf), wherein the 5′ end of the first sense strand and the 3′ end of the second sense strand each independently comprise a GalNAc ligand, and wherein the 5′ nucleotide of the first sense strand, the 3′ nucleotide of the first sense strand, and the 5′ nucleotide of the second sense strand each independently comprise a phosphorothioate linkage.

    [0151] FIG. 18L depicts an exemplary dual targeting agent of the invention comprising a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1, wherein the first dsRNA agent comprises a first sense strand (S) and a first antisense strand (AS), wherein the second dsRNA agent comprises a second sense strand (S) and a second antisense strand (AS), wherein the 3′end of the first sense strand is directly attached (no linker) to the 5′ end of the second sense strand, wherein the 3′ end of the first sense strand and the 3′ end of the second sense strand each independently comprise a GalNAc ligand, and wherein the two 5′-most nucleotides of the first sense strand each independently comprise a phosphorothioate linkage.

    [0152] FIG. 18M depicts an exemplary dual targeting agent of the invention comprising a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1, wherein the first dsRNA agent comprises a first sense strand (S) and a first antisense strand (AS), wherein the second dsRNA agent comprises a second sense strand (S) and a second antisense strand (AS), wherein the 5′end of the first antisense strand is covalently attached to the 3′ end of the second antisense strand with a nucleotide linker comprising 2′-O-Me modified nucleotides (acu), wherein the 3′ end of the first antisense strand and the 3′ end of the second sense strand each independently comprise a GalNAc ligand, and wherein the two most 5′ nucleotides of the second antisense strand each independently comprise a phosphorothioate linkage.

    [0153] FIG. 18N depicts an exemplary dual targeting agent of the invention comprising a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1, wherein the first dsRNA agent comprises a first sense strand (S) and a first antisense strand (AS), wherein the second dsRNA agent comprises a second sense strand (S) and a second antisense strand (AS), wherein the 5′end of the first antisense strand is covalently attached to the 3′ end of the second antisense strand with a nucleotide linker comprising 2′Fluoro modified nucleotides (AfAfGf), wherein the 3′ end of the first antisense strand and the 3′ end of the second sense strand each independently comprise a GalNAc ligand, and wherein the 5′ nucleotide of the first antisense strand, the 3′ nucleotide of the second antisense strand, and the two 5′-most nucleotides of the second antisense strand each independently comprise a phosphorothioate linkage.

    [0154] FIG. 18O depicts an exemplary dual targeting agent of the invention comprising a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1, wherein the first dsRNA agent comprises a first sense strand (S) and a first antisense strand (AS), wherein the second dsRNA agent comprises a second sense strand (S) and a second antisense strand (AS), wherein the 5′end of the first antisense strand is directly attached (no linker) to the 3′ end of the second antisense strand, wherein the 3′ end of the first antisense strand and the 3′ end of the second sense strand each independently comprise a GalNAc ligand, and wherein the two most 5′ nucleotides of the second antisense strand each independently comprise a phosphorothioate linkage.

    DETAILED DESCRIPTION OF THE INVENTION

    [0155] The present invention provides iRNA compositions, which effect the RNA-induced silencing complex (RISC)-mediated cleavage of RNA transcripts of an LDHA gene. The LDHA gene may be within a cell, e.g., a cell within a subject, such as a human. The present invention also provides methods of using the iRNA compositions of the invention for inhibiting the expression of an LDHA gene, and for treating a subject who would benefit from inhibiting or reducing the expression of an LDHA gene, e.g., a subject that would benefit from a reduction or inhibition in urinary oxalate production, e.g., a subject suffering or prone to suffering from an oxalate pathway-associated disease disorder, or condition, such as a subject suffering or prone to suffering from an oxalate-associated disease, disorder, or condition, e.g., a kidney stone formation disease, disorder, or condition or a calcium oxalate tissue deposition disease, disorder, or condition; or an LDH-associated disease, disorder, or condition.

    [0156] The present invention also provides methods of using the iRNA compositions of the invention for inhibiting the expression of an LDHA gene and an HAO1 gene for treating a subject who would benefit from inhibiting or reducing the expression of an LDHA gene and an HAO1 gene, e.g., a subject that would benefit from a reduction or inhibition in urinary oxalate production, e.g., a subject suffering or prone to suffering from an oxalate pathway-associated disease disorder, or condition, such as a subject suffering or prone to suffering from an oxalate-associated disease, disorder, or condition, e.g., a kidney stone formation disease, disorder, or condition or a calcium oxalate tissue deposition disease, disorder, or condition; or an LDH-associated disease, disorder, or condition.

    [0157] The iRNAs of the invention targeting LDHA may include an RNA strand (the antisense strand) having a region which is about 30 nucleotides or less in length, e.g., 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length, which region is substantially complementary to at least part of an mRNA transcript of an LDHA gene.

    [0158] The iRNAs of the invention targeting HAO1 may include an RNA strand (the antisense strand) having a region which is about 30 nucleotides or less in length, e.g., 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length, which region is substantially complementary to at least part of an mRNA transcript of an HAO1 gene.

    [0159] When the RNAi agent is a dual targeting RNAi agent, as described herein, the agent targeting LDHA may include an antisense strand comprising a region of complementarity to LDHA which is the same length or a different length from the region of complementarity of the antisense strand of the agent targeting HAO1.

    [0160] In some embodiments, one or both of the strands of the double stranded RNAi agents of the invention is up to 66 nucleotides in length, e.g., 36-66, 26-36, 25-36, 31-60, 22-43, 27-53 nucleotides in length, with a region of at least 19 contiguous nucleotides that is substantially complementary to at least a part of an mRNA transcript of an LDHA gene. In some embodiments, such iRNA agents having longer length antisense strands may include a second RNA strand (the sense strand) of 20-60 nucleotides in length wherein the sense and antisense strands form a duplex of 18-30 contiguous nucleotides.

    [0161] In other embodiments, one or both of the strands of the double stranded RNAi agents of the invention is up to 66 nucleotides in length, e.g., 36-66, 26-36, 25-36, 31-60, 22-43, 27-53 nucleotides in length, with a region of at least 19 contiguous nucleotides that is substantially complementary to at least a part of an mRNA transcript of an HAO1 gene. In some embodiments, such iRNA agents having longer length antisense strands may include a second RNA strand (the sense strand) of 20-60 nucleotides in length wherein the sense and antisense strands form a duplex of 18-30 contiguous nucleotides.

    [0162] In embodiments in which a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1 are covalently attached, the duplex lengths of the first agent and the second agent may be the same or different.

    [0163] The use of these iRNA agents described herein enables the targeted degradation of mRNAs of an LDHA gene in mammals or the targeted degradation of an LDHA gene and an HAO1 gene in mammals.

    [0164] Very low dosages of the iRNAs, in particular, can specifically and efficiently mediate RNA interference (RNAi), resulting in significant inhibition of expression of an LDHA gene or an LDHA gene and an HAO1 gene. Using cell-based and in vivo assays, the present inventors have demonstrated that iRNAs targeting LDHA can mediate RNAi, resulting in significant inhibition of expression of an LDHA gene and significant inhibition of oxalate production. Thus, methods and compositions including these iRNAs are useful for treating a subject who would benefit by a reduction or inhibition in LDHA expression or LDHA expression and HAO1 expression, e.g., a subject suffering or prone to suffering from an oxalate pathway-associated disease, disorder, or condition.

    [0165] The following detailed description discloses how to make and use compositions containing iRNAs to inhibit the expression of an LDHA gene, an HAO1gene, and both an LDHA gene and an HAO1 gene, as well as compositions and methods for treating subjects having diseases and disorders that would benefit from inhibition and/or reduction of the expression of these genes.

    I. Definitions

    [0166] In order that the present invention may be more readily understood, certain terms are first defined. In addition, it should be noted that whenever a value or range of values of a parameter are recited, it is intended that values and ranges intermediate to the recited values are also intended to be part of this invention.

    [0167] The articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element, e.g., a plurality of elements.

    [0168] The term “including” is used herein to mean, and is used interchangeably with, the phrase “including but not limited to”. The term “or” is used herein to mean, and is used interchangeably with, the term “and/or,” unless context clearly indicates otherwise.

    [0169] The term “LDHA” (used interchangeable herein with the term “Ldha”), also known as Cell Proliferation-Inducing Gene 19 Protein, Renal Carcinoma Antigen NY-REN-59, LDH Muscle Subunit, EC 1.1.1.27 4 61, LDH-A, LDH-M, Epididymis Secretory Sperm Binding Protein Li 133P, L-Lactate Dehydrogenase A Chain, Proliferation-Inducing Gene 19, Lactate Dehydrogenase M, HEL-S-133P, EC 1.1.1, GSD11, PIG19, and LDHM, refers to the well known gene encoding a lactate dehydrogenase A from any vertebrate or mammalian source, including, but not limited to, human, bovine, chicken, rodent, mouse, rat, porcine, ovine, primate, monkey, and guinea pig, unless specified otherwise.

    [0170] The term also refers to fragments and variants of native LDHA that maintain at least one in vivo or in vitro activity of a native LDHA. The term encompasses full-length unprocessed precursor forms of LDHA as well as mature forms resulting from post-translational cleavage of the signal peptide and forms resulting from proteolytic processing.

    [0171] The sequence of a human LDHA mRNA transcript can be found at, for example, GenBank Accession No. GI: 207028493 (NM_001135239.1; SEQ ID NO:1), GenBank Accession No. GI: 260099722 (NM_001165414.1; SEQ ID NO:3), GenBank Accession No. GI: 260099724 (NM_001165415.1; SEQ ID NO:5), GenBank Accession No. GI: 260099726 (NM_001165416.1; SEQ ID NO:7), GenBank Accession No. GI: 207028465 (NM_005566.3; SEQ ID NO:9); the sequence of a mouse LDHA mRNA transcript can be found at, for example, GenBank Accession No. GI: 257743038 (NM_001136069.2; SEQ ID NO:11), GenBank Accession No. GI: 257743036 (NM_010699.2; SEQ ID NO:13); the sequence of a rat LDHA mRNA transcript can be found at, for example, GenBank Accession No. GI: 8393705 (NM_017025.1; SEQ ID NO:15); and the sequence of a monkey LDHA mRNA transcript can be found at, for example, GenBank Accession No. GI: 402766306 (NM_001257735.2; SEQ ID NO:17), GenBank Accession No. GI: 545687102 (NM_001283551.1; SEQ ID NO:19).

    [0172] Additional examples of LDHA mRNA sequences are readily available using publicly available databases, e.g., GenBank, UniProt, and OMIM.

    [0173] The term “LDHA” as used herein also refers to a particular polypeptide expressed in a cell by naturally occurring DNA sequence variations of the LDHA gene, such as a single nucleotide polymorphism in the LDHA gene. Numerous SNPs within the LDHA gene have been identified and may be found at, for example, NCBI dbSNP (see, e.g., www.ncbi.nlm.nih.gov/snp).

    [0174] As used herein, the term “HAO1” refers to the well known gene encoding the enzyme hydroxyacid oxidase 1 from any vertebrate or mammalian source, including, but not limited to, human, bovine, chicken, rodent, mouse, rat, porcine, ovine, primate, monkey, and guinea pig, unless specified otherwise. Other gene names include GO, GOX, GOX1, HAO, and HAOX1. The protein is also known as glycolate oxidase and (S)-2-hydroxy-acid oxidase.

    [0175] The term also refers to fragments and variants of native HAO1 that maintain at least one in vivo or in vitro activity of a native HAO1. The term encompasses full-length unprocessed precursor forms of HAO1 as well as mature forms resulting from post-translational cleavage of the signal peptide and forms resulting from proteolytic processing. The sequence of a human HAO1 mRNA transcript can be found at, for example, GenBank Accession No. GI:11184232 (NM_017545.2; SEQ ID NO:21); the sequence of a monkey HAO1 mRNA transcript can be found at, for example, GenBank Accession No. GI:544464345 (XM_005568381.1; SEQ I DNO:23); the sequence of a mouse HAO1 mRNA transcript can be found at, for example, GenBank Accession No. GI:133893166 (NM_010403.2; SEQ ID NO:25); and the sequence of a rat HAO1 mRNA transcript can be found at, for example, GenBank Accession No. GI: 166157785 (NM_001107780.2; SEQ ID NO:27).

    [0176] The term “HAO1,” as used herein, also refers to naturally occurring DNA sequence variations of the HAO1 gene, such as a single nucleotide polymorphism (SNP) in the HAO1 gene. Exemplary SNPs may be found in the NCBI dbSNP Short Genetic Variations database available at www.ncbi.nlm.nih.gov/projects/SNP.

    [0177] As used herein, “target sequence” refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of an LDHA gene or an HAO1 gene, including mRNA that is a product of RNA processing of a primary transcription product. In one embodiment, the target portion of the sequence will be at least long enough to serve as a substrate for iRNA-directed cleavage at or near that portion of the nucleotide sequence of an mRNA molecule formed during the transcription of an LDHA gene. In another embodiment, the target portion of the sequence will be at least long enough to serve as a substrate for iRNA-directed cleavage at or near that portion of the nucleotide sequence of an mRNA molecule formed during the transcription of an HAO1 gene.

    [0178] The target sequence of an LDHA gene may be from about 9-36 nucleotides in length, e.g., about 15-30 nucleotides in length. For example, the target sequence can be from about 15-nucleotides, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the invention.

    [0179] The target sequence of an HAO1 gene may be from about 9-36 nucleotides in length, e.g., about 15-30 nucleotides in length. For example, the target sequence can be from about 15-nucleotides, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the invention.

    [0180] In aspects in which a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1 are covalently attached (i.e., a dual targeting RNAi agent), the length of the LDHA target sequence may be the same as the HAO1 target sequence or different.

    [0181] As used herein, the term “strand comprising a sequence” refers to an oligonucleotide comprising a chain of nucleotides that is described by the sequence referred to using the standard nucleotide nomenclature.

    [0182] “G,” “C,” “A,” “T” and “U” each generally stand for a nucleotide that contains guanine, cytosine, adenine, thymidine and uracil as a base, respectively. However, it will be understood that the term “ribonucleotide” or “nucleotide” can also refer to a modified nucleotide, as further detailed below, or a surrogate replacement moiety (see, e.g., Table 1). The skilled person is well aware that guanine, cytosine, adenine, and uracil can be replaced by other moieties without substantially altering the base pairing properties of an oligonucleotide comprising a nucleotide bearing such replacement moiety. For example, without limitation, a nucleotide comprising inosine as its base can base pair with nucleotides containing adenine, cytosine, or uracil. Hence, nucleotides containing uracil, guanine, or adenine can be replaced in the nucleotide sequences of dsRNA featured in the invention by a nucleotide containing, for example, inosine. In another example, adenine and cytosine anywhere in the oligonucleotide can be replaced with guanine and uracil, respectively to form G-U Wobble base pairing with the target mRNA. Sequences containing such replacement moieties are suitable for the compositions and methods featured in the invention.

    [0183] The terms “iRNA”, “RNAi agent,” “iRNA agent,”, “RNA interference agent” as used interchangeably herein, refer to an agent that contains RNA as that term is defined herein, and which mediates the targeted cleavage of an RNA transcript via an RNA-induced silencing complex (RISC) pathway. iRNA directs the sequence-specific degradation of mRNA through a process known as RNA interference (RNAi). The iRNA modulates, e.g., inhibits, the expression of LDHA and/or HAO1 gene in a cell, e.g., a cell within a subject, such as a mammalian subject.

    [0184] In one embodiment, an RNAi agent of the invention includes a single stranded RNA that interacts with a target RNA sequence, e.g., an LDHA target mRNA sequence and/or an HAO1 target mRNA sequence, to direct the cleavage of the target RNA. Without wishing to be bound by theory it is believed that long double stranded RNA introduced into cells is broken down into siRNA by a Type III endonuclease known as Dicer (Sharp et al. (2001) Genes Dev. 15:485). Dicer, a ribonuclease-III-like enzyme, processes the dsRNA into 19-23 base pair short interfering RNAs with characteristic two base 3′ overhangs (Bernstein, et al., (2001) Nature 409:363). The siRNAs are then incorporated into an RNA-induced silencing complex (RISC) where one or more helicases unwind the siRNA duplex, enabling the complementary antisense strand to guide target recognition (Nykanen, et al., (2001) Cell 107:309). Upon binding to the appropriate target mRNA, one or more endonucleases within the RISC cleave the target to induce silencing (Elbashir, et al., (2001) Genes Dev. 15:188). Thus, in one aspect the invention relates to a single stranded RNA (sssiRNA) generated within a cell and which promotes the formation of a RISC complex to effect silencing of the target gene, i.e., an LDHA gene and/or an HAO1 gene. Accordingly, the term “siRNA” is also used herein to refer to an RNAi as described above.

    [0185] In another embodiment, the RNAi agent may be a single-stranded RNAi agent that is introduced into a cell or organism to inhibit a target mRNA. Single-stranded RNAi agents (ssRNAi) bind to the RISC endonuclease, Argonaute 2, which then cleaves the target mRNA. The single-stranded siRNAs are generally 15-30 nucleotides and are chemically modified. The design and testing of single-stranded RNAi agents are described in U.S. Pat. No. 8,101,348 and in Lima et al., (2012) Cell 150: 883-894, the entire contents of each of which are hereby incorporated herein by reference. Any of the antisense nucleotide sequences described herein may be used as a single-stranded siRNA as described herein or as chemically modified by the methods described in Lima et al., (2012) Cell 150; 883-894.

    [0186] In another embodiment, an “iRNA” for use in the compositions and methods of the invention is a double-stranded RNA and is referred to herein as a “double stranded RNAi agent,” “double-stranded RNA (dsRNA) molecule,” “dsRNA agent,” or “dsRNA”. The term “dsRNA”, refers to a complex of ribonucleic acid molecules, having a duplex structure comprising two anti-parallel and substantially complementary nucleic acid strands, referred to as having “sense” and “antisense” orientations with respect to a target RNA, i.e., an LDHA gene and/or an HAO1 gene. In some embodiments of the invention, a double-stranded RNA (dsRNA) triggers the degradation of a target RNA, e.g., an mRNA, through a post-transcriptional gene-silencing mechanism referred to herein as RNA interference or RNAi.

    [0187] In yet another embodiment, an “iRNA” for use in the compositions and methods of the invention is a “dual targeting RNAi agent.” The term “dual targeting RNAi agent” refers to a molecule comprising a first dsRNA agent comprising a complex of ribonucleic acid molecules, having a duplex structure comprising two anti-parallel and substantially complementary nucleic acid strands, referred to as having “sense” and “antisense” orientations with respect to a first target RNA, i.e., an LDHA gene, covalently attached to a molecule comprising a second dsRNA agent comprising a complex of ribonucleic acid molecules, having a duplex structure comprising two anti-parallel and substantially complementary nucleic acid strands, referred to as having “sense” and “antisense” orientations with respect to a second target RNA, i.e., an HAO1 gene. In some embodiments of the invention, a dual targeting RNAi agent triggers the degradation of the first and the second target RNAs, e.g., mRNAs, through a post-transcriptional gene-silencing mechanism referred to herein as RNA interference or RNAi.

    [0188] In general, the majority of nucleotides of each strand of a dsRNA molecule are ribonucleotides, but as described in detail herein, each or both strands can also include one or more non-ribonucleotides, e.g., a deoxyribonucleotide and/or a modified nucleotide. In addition, as used in this specification, an “RNAi agent” may include ribonucleotides with chemical modifications; an RNAi agent may include substantial modifications at multiple nucleotides. As used herein, the term “modified nucleotide” refers to a nucleotide having, independently, a modified sugar moiety, a modified internucleotide linkage, and/or a modified nucleobase. Thus, the term modified nucleotide encompasses substitutions, additions or removal of, e.g., a functional group or atom, to internucleoside linkages, sugar moieties, or nucleobases. The modifications suitable for use in the agents of the invention include all types of modifications disclosed herein or known in the art. Any such modifications, as used in a siRNA type molecule, are encompassed by “RNAi agent” for the purposes of this specification and claims.

    [0189] The duplex region may be of any length that permits specific degradation of a desired target RNA through a RISC pathway, and may range from about 9 to 36 base pairs in length, e.g., about 15-30 base pairs in length, for example, about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 base pairs in length, such as about 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the invention.

    [0190] In embodiments in which a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1 are covalently attached (i.e., a dual targeting RNAi agent), the length of the duplex region of the first agent and the second agent may be the same or different.

    [0191] The two strands forming the duplex structure may be different portions of one larger RNA molecule, or they may be separate RNA molecules. Where the two strands are part of one larger molecule, and therefore are connected by an uninterrupted chain of nucleotides between the 3′-end of one strand and the 5′-end of the respective other strand forming the duplex structure, the connecting RNA chain is referred to as a “hairpin loop.” A hairpin loop can comprise at least one unpaired nucleotide. In some embodiments, the hairpin loop can comprise at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 23 or more unpaired nucleotides.

    [0192] In embodiments in which a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1 are covalently attached (i.e., a dual targeting RNAi agent), the first dsRNA agent may comprise a harpin loop, the second dsRNA agent may comprise a hairpin loop, or both the first and the second dsRNA agents may independently comprise a hairpin loop.

    [0193] In addition, in embodiments in which a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1 are covalently attached (i.e., a dual targeting RNAi agent), the first dsRNA agent may comprise unpaired nucleotides, the second dsRNA agent may comprise unpaired nucleotides, or both the first and the second dsRNA agents may independently comprise unpaired nucleotides. When both the first and the second dsRNA agents independently comprise unpaired nucleotides, the first dsRNA agent and the second dsRNA agent may comprise the same or a different number of unpaired nucleotides.

    [0194] Where the two substantially complementary strands of a dsRNA are comprised by separate RNA molecules, those molecules need not, but can be covalently connected. Where the two strands are connected covalently by means other than an uninterrupted chain of nucleotides between the 3′-end of one strand and the 5′-end of the respective other strand forming the duplex structure, the connecting structure is referred to as a “linker.” The RNA strands may have the same or a different number of nucleotides. The maximum number of base pairs is the number of nucleotides in the shortest strand of the dsRNA minus any overhangs that are present in the duplex. In addition to the duplex structure, an RNAi may comprise one or more nucleotide overhangs.

    [0195] In one embodiment, an RNAi agent of the invention is a dsRNA, each strand of which comprises 19-23 nucleotides, that interacts with a target RNA sequence, e.g., an LDHA target mRNA sequence, to direct the cleavage of the target RNA. In another embodiment, an RNAi agent of the invention is a dsRNA, each strand of which comprises 19-23 nucleotides, that interacts with a target RNA sequence, e.g., an HAO1 target mRNA sequence, to direct the cleavage of the target RNA. In yet other embodiments an RNAi agent of the invention comprises a first dsRNA agent, each strand of which comprises 19-23 nucleotides, that interacts with a target RNA sequence, e.g., an LDHA target mRNA sequence, to direct the cleavage of the target RNA, and a second dsRNA agent, each strand of which independently comprises 19-23 nucleotides, that interacts with a target RNA sequence, e.g., an HAO1 target mRNA sequence, to direct the cleavage of the target RNA, wherein the first and second dsRNA agents are covalently attached.

    [0196] In embodiments in which a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1 are covalently attached (i.e., a dual targeting RNAi agent), the two strands of the first dsRNA agent may be connected covalently by means other than an uninterrupted chain of nucleotides between the 3′-end of one strand and the 5′-end of the respective other strand forming the duplex structure, the two strands of the second dsRNA agent may be connected covalently by means other than an uninterrupted chain of nucleotides between the 3′-end of one strand and the 5′-end of the respective other strand forming the duplex structure, or the two strands of the first dsRNA agent and the two strands of the second dsRNA agent may independently be connected covalently by means other than an uninterrupted chain of nucleotides between the 3′-end of one strand and the 5′-end of the respective other strand forming the duplex structure.

    [0197] As used herein, the term “nucleotide overhang” refers to at least one unpaired nucleotide that protrudes from the duplex structure of an iRNA, e.g., a dsRNA. For example, when a 3′-end of one strand of a dsRNA extends beyond the 5′-end of the other strand, or vice versa, there is a nucleotide overhang. A dsRNA can comprise an overhang of at least one nucleotide; alternatively the overhang can comprise at least two nucleotides, at least three nucleotides, at least four nucleotides, at least five nucleotides or more. A nucleotide overhang can comprise or consist of a nucleotide/nucleoside analog, including a deoxynucleotide/nucleoside. The overhang(s) can be on the sense strand, the antisense strand or any combination thereof. Furthermore, the nucleotide(s) of an overhang can be present on the 5′-end, 3′-end or both ends of either an antisense or sense strand of a dsRNA.

    [0198] In embodiments in which a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1 are covalently attached (i.e., a dual targeting RNAi agent), the first agent may comprise a nucleotide overhang, the second agent may comprise a nucleotide overhang, or both the first and the second agent may independently comprise a nucleotide overhang, e.g., the 5′ end of the sense strand of the first agent may comprise an overhang, the 3′ end of the sense strand of the first agent may comprise an overhang, the 5′ end of the antisense strand of the first agent may comprise an overhang, the 3′ end of the antisense strand of the first agent may comprise an overhang, the 5′ end and the 3′ end of the sense stand of the first agent may comprise an overhang, the 5′ end and the 3′ end of the antisense stand of the first agent may comprise an overhang, the 5′ end of the sense strand of the second agent may comprise an overhang, the 3′ end of the sense strand of the second agent may comprise an overhang, the 5′ end of the antisense strand of the second agent may comprise an overhang, the 3′ end of the antisense strand of the second agent may comprise an overhang, the 5′ end and the 3′ end of the sense stand of the second agent may comprise an overhang, the 5′ end and the 3′ end of the antisense stand of the second agent may comprise an overhang, or any combination of the foregoing.

    [0199] In embodiments in which a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1 are covalently attached (i.e., a dual targeting RNAi agent), the length of an overhang of the first agent and the second agent may be the same or different.

    [0200] In one embodiment, the antisense strand of a dsRNA has a 1-10 nucleotide, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide, overhang at the 3′-end and/or the 5′-end. In one embodiment, the sense strand of a dsRNA has a 1-10 nucleotide, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide, overhang at the 3′-end and/or the 5′-end. In another embodiment, one or more of the nucleotides in the overhang is replaced with a nucleoside thiophosphate.

    [0201] In certain embodiments, the overhang on the sense strand or the antisense strand, or both, can include extended lengths longer than 10 nucleotides, e.g., 10-30 nucleotides, 10-25 nucleotides, 10-20 nucleotides or 10-15 nucleotides in length. In certain embodiments, an extended overhang is on the sense strand of the duplex. In certain embodiments, an extended overhang is present on the 3′end of the sense strand of the duplex. In certain embodiments, an extended overhang is present on the 5′end of the sense strand of the duplex. In certain embodiments, an extended overhang is on the antisense strand of the duplex. In certain embodiments, an extended overhang is present on the 3′end of the antisense strand of the duplex. In certain embodiments, an extended overhang is present on the 5′end of the antisense strand of the duplex. In certain embodiments, one or more of the nucleotides in the extended overhang is replaced with a nucleoside thiophosphate.

    [0202] In embodiments in which a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1 are covalently attached (i.e., a dual targeting RNAi agent), and one and/or both strands of both the first and the second dsRNA agent independently comprise an overhang, e.g., an extended overhang, the length of the overhang may be the same or different, and/or, in some embodiments, one or more of the nucleotides in the overhang in the first dsRNA agent and one or more nucleotides in the overhang of the second dsRNA agent may be independently replaced with a nucleoside thiophosphate.

    [0203] The terms “blunt” or “blunt ended” as used herein in reference to a dsRNA mean that there are no unpaired nucleotides or nucleotide analogs at a given terminal end of a dsRNA, i.e., no nucleotide overhang. One or both ends of a dsRNA can be blunt. Where both ends of a dsRNA are blunt, the dsRNA is said to be blunt ended. To be clear, a “blunt ended” dsRNA is a dsRNA that is blunt at both ends, i.e., no nucleotide overhang at either end of the molecule. Most often such a molecule will be double-stranded over its entire length.

    [0204] In embodiments in which a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1 are covalently attached (i.e., a dual targetingRNAi agent), one or both of the dsRNA agents may independently comprise a blunt end.

    [0205] The term “antisense strand” or “guide strand” refers to the strand of an iRNA, e.g., a dsRNA, which includes a region that is substantially complementary to a target sequence, e.g., an LDHA mRNA or an HAO1 mRNA.

    [0206] As used herein, the term “region of complementarity” refers to the region on the antisense strand that is substantially complementary to a sequence, for example a target sequence, e.g., an LDHA nucleotide sequence or an HAO1 nucleotide sequence, as defined herein. Where the region of complementarity is not fully complementary to the target sequence, the mismatches can be in the internal or terminal regions of the molecule. Generally, the most tolerated mismatches are in the terminal regions, e.g., within 5, 4, 3, or 2 nucleotides of the 5′- and/or 3′-terminus of the iRNA.

    [0207] In embodiments in which a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1 are covalently attached (i.e., a dual targetingRNAi agent), one or both of the dsRNA agents may independently comprise a mismatch.

    [0208] The term “sense strand” or “passenger strand” as used herein, refers to the strand of an iRNA that includes a region that is substantially complementary to a region of the antisense strand as that term is defined herein.

    [0209] As used herein, the term “cleavage region” refers to a region that is located immediately adjacent to the cleavage site. The cleavage site is the site on the target at which cleavage occurs. In some embodiments, the cleavage region comprises three bases on either end of, and immediately adjacent to, the cleavage site. In some embodiments, the cleavage region comprises two bases on either end of, and immediately adjacent to, the cleavage site. In some embodiments, the cleavage site specifically occurs at the site bound by nucleotides 10 and 11 of the antisense strand, and the cleavage region comprises nucleotides 11, 12 and 13.

    [0210] As used herein, and unless otherwise indicated, the term “complementary,” when used to describe a first nucleotide sequence in relation to a second nucleotide sequence, refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize and form a duplex structure under certain conditions with an oligonucleotide or polynucleotide comprising the second nucleotide sequence, as will be understood by the skilled person. Such conditions can, for example, be stringent conditions, where stringent conditions can include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50° C. or 70° C. for 12-16 hours followed by washing (see, e.g., “Molecular Cloning: A Laboratory Manual, Sambrook, et al. (1989) Cold Spring Harbor Laboratory Press). Other conditions, such as physiologically relevant conditions as can be encountered inside an organism, can apply. The skilled person will be able to determine the set of conditions most appropriate for a test of complementarity of two sequences in accordance with the ultimate application of the hybridized nucleotides.

    [0211] Complementary sequences within an iRNA, e.g., within a dsRNA as described herein, include base-pairing of the oligonucleotide or polynucleotide comprising a first nucleotide sequence to an oligonucleotide or polynucleotide comprising a second nucleotide sequence over the entire length of one or both nucleotide sequences. Such sequences can be referred to as “fully complementary” with respect to each other herein. However, where a first sequence is referred to as “substantially complementary” with respect to a second sequence herein, the two sequences can be fully complementary, or they can form one or more, but generally not more than 5, 4, 3 or 2 mismatched base pairs upon hybridization for a duplex up to 30 base pairs, while retaining the ability to hybridize under the conditions most relevant to their ultimate application, e.g., inhibition of gene expression via a RISC pathway. However, where two oligonucleotides are designed to form, upon hybridization, one or more single stranded overhangs, such overhangs shall not be regarded as mismatches with regard to the determination of complementarity. For example, a dsRNA comprising one oligonucleotide 21 nucleotides in length and another oligonucleotide 23 nucleotides in length, wherein the longer oligonucleotide comprises a sequence of 21 nucleotides that is fully complementary to the shorter oligonucleotide, can yet be referred to as “fully complementary” for the purposes described herein.

    [0212] “Complementary” sequences, as used herein, can also include, or be formed entirely from, non-Watson-Crick base pairs and/or base pairs formed from non-natural and modified nucleotides, in so far as the above requirements with respect to their ability to hybridize are fulfilled. Such non-Watson-Crick base pairs include, but are not limited to, G:U Wobble or Hoogstein base pairing.

    [0213] The terms “complementary,” “fully complementary” and “substantially complementary” herein can be used with respect to the base matching between the sense strand and the antisense strand of a dsRNA, or between the antisense strand of an iRNA agent and a target sequence, as will be understood from the context of their use.

    [0214] As used herein, a polynucleotide that is “substantially complementary to at least part of” a messenger RNA (mRNA) refers to a polynucleotide that is substantially complementary to a contiguous portion of the mRNA of interest (e.g., an mRNA encoding LDHA or an mRNA encoding HAO1). For example, a polynucleotide is complementary to at least a part of an LDHA mRNA if the sequence is substantially complementary to a non-interrupted portion of an mRNA encoding LDHA.

    [0215] Accordingly, in some embodiments, the antisense strand polynucleotides disclosed herein are fully complementary to the target LDHA sequence. In other embodiments, the antisense strand polynucleotides disclosed herein are substantially complementary to the target LDHA sequence and comprise a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to the equivalent region of the nucleotide sequence of SEQ ID NO:1, or a fragment of SEQ ID NO:1, such as about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about % 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary.

    [0216] In one embodiment, an RNAi agent of the invention includes a sense strand that is substantially complementary to an antisense polynucleotide which, in turn, is complementary to a target LDHA sequence, and wherein the sense strand polynucleotide comprises a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to the equivalent region of the nucleotide sequence of SEQ ID NO:2, or a fragment of any one of SEQ ID NO:2, such as about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about % 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary.

    [0217] In some embodiments, an iRNA of the invention includes an antisense strand that is substantially complementary to the target LDHA sequence and comprises a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to the equivalent region of the nucleotide sequence of any one of the sense strands in any one of Tables 2-5, or a fragment of any one of the sense strands in any one of Tables 2-5, such as about about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementary, or 100% complementary.

    [0218] Accordingly, in some embodiments, the antisense strand polynucleotides disclosed herein are fully complementary to the target HAO1 sequence. In other embodiments, the antisense strand polynucleotides disclosed herein are substantially complementary to the target HAO1 sequence and comprise a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to the equivalent region of the nucleotide sequence of SEQ ID NO:21, or a fragment of SEQ ID NO:21, such as about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about % 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary.

    [0219] In one embodiment, an RNAi agent of the invention includes a sense strand that is substantially complementary to an antisense polynucleotide which, in turn, is complementary to a target HAO1 sequence, and wherein the sense strand polynucleotide comprises a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to the equivalent region of the nucleotide sequence of SEQ ID NO:22, or a fragment of any one of SEQ ID NO:22, such as about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about % 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary.

    [0220] In some embodiments, an iRNA of the invention includes an antisense strand that is substantially complementary to the target HAO1 sequence and comprises a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to the equivalent region of the nucleotide sequence of any one of the sense strands in any one of Tables 7-14, or a fragment of any one of the sense strands in any one of Tables 7-14, such as about about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementary, or 100% complementary.

    [0221] The term “inhibiting,” as used herein, is used interchangeably with “reducing,” “silencing,” “downregulating,” “suppressing” and other similar terms, and includes any level of inhibition.

    [0222] The phrase “inhibiting expression of an LDHA gene,” as used herein, includes inhibition of expression of any LDHA gene (such as, e.g., a mouse LDHA gene, a rat LDHA gene, a monkey LDHA gene, or a human LDHA gene) as well as variants or mutants of an LDHA gene that encode an LDHA protein.

    [0223] “Inhibiting expression of an LDHA gene” includes any level of inhibition of an LDHA gene, e.g., at least partial suppression of the expression of an LDHA gene, such as an inhibition by at least about 20%. In certain embodiments, inhibition is by at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.

    [0224] The phrase “inhibiting expression of an HAO1 gene,” as used herein, includes inhibition of expression of any HAO1 gene (such as, e.g., a mouse HAO1 gene, a rat HAO1 gene, a monkey HAO1 gene, or a human HAO1 gene) as well as variants or mutants of an HAO1 gene that encode an HAO1 protein.

    [0225] “Inhibiting expression of an HAO1 gene” includes any level of inhibition of an HAO1 gene, e.g., at least partial suppression of the expression of an HAO1 gene, such as an inhibition by at least about 20%. In certain embodiments, inhibition is by at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.

    [0226] In embodiments in which a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1 are covalently attached, the inhibition of expression of LDHA may be the same or different than the inhibition of HAO1 expression.

    [0227] The expression of an LDHA gene and/or an HAO1 gene may be assessed based on the level of any variable associated with LDHA gene expression and/or HAO1 gene expression, e.g., LDHA and/or HAO1 mRNA level or LDHA and/or HAO1 protein level. The expression of an LDHA gene and/or an HAO1 gene may also be assessed indirectly based on the levels of oxalate or glycolate in a urine, a plasma, or a tissue sample, or the enzymatic activity of LDHA in a tissue sample, such as a liver sample, a skeletal muscle sample, and/or a heart sample. Inhibition may be assessed by a decrease in an absolute or relative level of one or more of these variables compared with a control level. The control level may be any type of control level that is utilized in the art, e.g., a pre-dose baseline level, or a level determined from a similar subject, cell, or sample that is untreated or treated with a control (such as, e.g., buffer only control or inactive agent control).

    [0228] In one embodiment, at least partial suppression of the expression of an LDHA gene, is assessed by a reduction of the amount of LDHA mRNA which can be isolated from, or detected, in a first cell or group of cells in which an LDHA gene is transcribed and which has or have been treated such that the expression of an LDHA gene is inhibited, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has or have not been so treated (control cells).

    [0229] In one embodiment, at least partial suppression of the expression of an HAO1 gene, is assessed by a reduction of the amount of HAO1 mRNA which can be isolated from or detected in a first cell or group of cells in which an HAO1 gene is transcribed and which has or have been treated such that the expression of an HAO1 gene is inhibited, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has or have not been so treated (control cells).

    [0230] In one embodiment, at least partial suppression of the expression of an LDHA gene and an HAO1 gene, is assessed by a reduction of the amount of LDHA mRNA and HAO1 mRNA which can be isolated from or detected in a first cell or group of cells in which an LDHA gene and an HAO1 gene are transcribed and which has or have been treated such that the expression of an LDHA gene and an HAO1 gene is inhibited, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has or have not been so treated (control cells).

    [0231] The degree of inhibition may be expressed in terms of:

    [00001] ( mRNA in control cells ) - ( mRNA in treated cells ) ( mRNA in control cells ) .Math. 100 %

    [0232] The phrase “contacting a cell with an RNAi agent,” such as a dsRNA, as used herein, includes contacting a cell by any possible means. Contacting a cell with an RNAi agent includes contacting a cell in vitro with the iRNA or contacting a cell in vivo with the iRNA. The contacting may be done directly or indirectly. Thus, for example, the RNAi agent may be put into physical contact with the cell by the individual performing the method, or alternatively, the RNAi agent may be put into a situation that will permit or cause it to subsequently come into contact with the cell.

    [0233] In the methods of the invention in which a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1 are covalently attached (i.e., a dual targetingRNAi agent), contacting a cell may include contacting the cell with the first agent at the same time or at a different time than contacting the cell with the second agent.

    [0234] Contacting a cell in vitro may be done, for example, by incubating the cell with the RNAi agent. Contacting a cell in vivo may be done, for example, by injecting the RNAi agent into or near the tissue where the cell is located, or by injecting the RNAi agent into another area, e.g., the bloodstream or the subcutaneous space, such that the agent will subsequently reach the tissue where the cell to be contacted is located. For example, the RNAi agent may contain and/or be coupled to a ligand, e.g., GalNAc3, that directs the RNAi agent to a site of interest, e.g., the liver. Combinations of in vitro and in vivo methods of contacting are also possible. For example, a cell may also be contacted in vitro with an RNAi agent and subsequently transplanted into a subject.

    [0235] In one embodiment, contacting a cell with an iRNA includes “introducing” or “delivering the iRNA into the cell” by facilitating or effecting uptake or absorption into the cell. Absorption or uptake of an iRNA can occur through unaided diffusive or active cellular processes, or by auxiliary agents or devices. Introducing an iRNA into a cell may be in vitro and/or in vivo. For example, for in vivo introduction, iRNA can be injected into a tissue site or administered systemically. In vivo delivery can also be done by a beta-glucan delivery system, such as those described in U.S. Pat. Nos. 5,032,401 and 5,607,677, and U.S. Publication No. 2005/0281781, the entire contents of which are hereby incorporated herein by reference. In vitro introduction into a cell includes methods known in the art such as electroporation and lipofection. Further approaches are described herein below and/or are known in the art.

    [0236] The term “lipid nanoparticle” or “LNP” is a vesicle comprising a lipid layer encapsulating a pharmaceutically active molecule, such as a nucleic acid molecule, e.g., an iRNA or a plasmid from which an iRNA is transcribed. LNPs are described in, for example, U.S. Pat. Nos. 6,858,225, 6,815,432, 8,158,601, and 8,058,069, the entire contents of which are hereby incorporated herein by reference.

    [0237] As used herein, a “subject” is an animal, such as a mammal, including a primate (such as a human, a non-human primate, e.g., a monkey, and a chimpanzee), a non-primate (such as a cow, a pig, a camel, a llama, a horse, a goat, a rabbit, a sheep, a hamster, a guinea pig, a cat, a dog, a rat, a mouse, a horse, and a whale), or a bird (e.g., a duck or a goose).

    [0238] In an embodiment, the subject is a human, such as a human being treated or assessed for a disease, disorder or condition that would benefit from reduction in LDHA expression; a human at risk for a disease, disorder or condition that would benefit from reduction in LDHA expression; a human having a disease, disorder or condition that would benefit from reduction in LDHA expression; and/or human being treated for a disease, disorder or condition that would benefit from reduction in LDHA expression as described herein.

    [0239] It is to be understood that a human being treated or assessed for a disease, disorder or condition that would benefit from reduction in LDHA expression includes a a human being treated or assessed for a disease, disorder or condition that would benefit from reduction in LDHA and HAO1 expression; that a human at risk for a disease, disorder or condition that would benefit from reduction in LDHA expression includes a human at risk for a disease, disorder or condition that would benefit from reduction in LDHA and HAO1 expression; that a human having a disease, disorder or condition that would benefit from reduction in LDHA expression includes a human at risk for a disease, disorder or condition that would benefit from reduction in LDHA and HAO1 expression; and that a human being treated for a disease, disorder or condition that would benefit from reduction in LDHA expression includes a human being treated for a disease, disorder or condition that would benefit from reduction in LDHA and HAO1 expression as described herein.

    [0240] As used herein, the terms “treating” or “treatment” refer to a beneficial or desired result, such as lowering urinary excretion levels of oxalate in a subject. The terms “treating” or “treatment” also include, but are not limited to, alleviation or amelioration of one or more symptoms of an oxalate pathway-associated disease disorder, or condition, such as, e.g., slowing the course of the disease; reducing the severity of later-developing disease; reduction in edema of the extremities, face, larynx, upper respiratory tract, abdomen, trunk, and/or genitals, prodrome, laryngeal swelling, nonpruritic rash, nausea, vomiting, and/or abdominal pain; decreasing progression of liver disease to cirrhosis or hepatocellular carcinoma; stabilizing current stone burden; decreasing recurrence of stones formed; and/or preventing further oxalate tissue deposition. “Treatment” can also mean prolonging survival as compared to expected survival in the absence of treatment.

    [0241] The term “lower” in the context of a disease marker or symptom refers to a statistically significant decrease in such level. The decrease can be, for example, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or more and is preferably down to a level accepted as within the range of normal for an individual without such disorder.

    [0242] As used herein, “prevention” or “preventing,” when used in reference to a disease, disorder or condition thereof, that would benefit from a reduction in expression of an LDHA gene, refers to a reduction in the likelihood that a subject will develop a symptom associated with such disease, disorder, or condition, e.g., stone formation. The likelihood of, e.g., stone formation, is reduced, for example, when an individual having one or more risk factors for stone formation either fails to develop stones or develops stones with less severity relative to a population having the same risk factors and not receiving treatment as described herein. The failure to develop a disease, disorder or condition, or the reduction in the development of a symptom associated with such a disease, disorder or condition (e.g., by at least about 10% on a clinically accepted scale for that disease or disorder), or the exhibition of delayed symptoms delayed (e.g., by days, weeks, months or years) is considered effective prevention.

    [0243] There are numerous disorders that would benefit from reduction in expression of an LDHA gene, such as an oxalate pathway-associated disease disorder, or condition.

    [0244] As used herein, the term “oxalate pathway-associated disease, disorder, or condition” refers to a disease, disorder or condition thereof, in which lactate dehydrogenase knockdown is known or predicted to be therapeutic or otherwise advantageous, e.g., associated with or caused by a disturbance in lactate dehydrogenase production and/or urinary oxalate production.

    [0245] In one embodiment, an “oxalate pathway-associated disease, disorder, or condition” is a “lactate dehydrogenase-associated disease, disorder, or condition.” As used herein, a “lactate dehydrogenase-associated disease, disorder, or condition” includes any disease, disorder or condition that would benefit from a decrease in lactate dehydrogenase gene expression, replication, or protein activity. Exemplary lactate dehydrogenase-associated disease, disorders, and conditions include, for example, fatty liver (steatosis), nonalcoholic steatohepatitis (NASH), cirrhosis of the liver, accumulation of fat in the liver, inflammation of the liver, hepatocellular necrosis, liver fibrosis, obesity, nonalcoholic fatty liver disease (NAFLD), and cancer, e.g., hepatocellular carcinoma.

    [0246] In another embodiment, an “oxalate pathway-associated disease, disorder, or condition” is “an oxalate-associated disease, disorder, or condition.” As used herein, “an oxalate-associated disease, disorder, or condition” includes any disease, disorder or condition that would benefit from a decrease in lactate dehydrogenase gene expression, replication, or protein activity. The term “oxalate-associated disease, disorder, or condition” refers to inherited disorders, or induced or acquired disorders. Exemplary “oxalate-associated diseases, disorders, or conditions” include “kidney stone formation diseases, disorders, and conditions” and “calcium oxalate tissue deposition diseases, disorders, and conditions.”

    [0247] Exemplary kidney stone formation diseases, disorders, and conditions include “calcium oxalate stone formation diseases, disorders, and conditions” and “non-calcium oxalate stone formation diseases, disorders, and conditions.”

    [0248] Non-limiting examples of “calcium oxalate stone formation diseases, disorders, and conditions” include a hyperoxaluria (e.g., a. primary hyperoxaluria, such as primary hyperoxaluria 1 (PH1), primary hyperoxaluria 2 (PH2), primary hyperoxaluria 3 (PH3) and nonPH1/PH2/PH3; enteric hyperoxaluria; dietary hyperoxaluria; and idiopathic hyperoxaluria) and a non-hyperoxaluria disorder (e.g., a hypercalciuria, such as primary hyperparathyroid, Dent's disease, absorptive hypercalciuria, and renal hypercalciuria; and hypocitraturia).

    [0249] Non-limiting examples of “non-calcium oxalate stone formation diseases, disorders, and conditions” include subjects having kidney stones that are comprised of less than about 50%, less than about 45%, less than about 40%, less than about 35%, less than about 30%, less than about 25% less than about 20%, less than about 15%, or less than about 10% oxalate, and more than about 50% non-oxalate, e.g. calcium phosphate, uric acid, struvite, cystinuria, or other component.

    [0250] Exemplary “calcium oxalate tissue deposition diseases, disorders, and conditions” include systemic calcium oxalate tissue deposition diseases, disorders, and conditions, such as calcium oxalate tissue deposition due to end-stage renal disease, sarcoidosis, or arthritis; and tissue specific calcium oxalate deposition diseases, disorders, and conditions, e.g., in the kidney (e.g., due to nephrocalcinosis, or medullary sponge kidney), in the thyroid, in the breast, in the bone, in the heart, in the vasculature, or in any soft tissue due to an organ transplant, such as a kidney transplant.

    [0251] “Therapeutically effective amount,” as used herein, is intended to include the amount of an RNAi agent that, when administered to a subject having an oxalate pathway-associated disease, disorder, or condition, is sufficient to effect treatment of the disease (e.g., by diminishing, ameliorating or maintaining the existing disease or one or more symptoms of disease). The “therapeutically effective amount” may vary depending on the RNAi agent, how the agent is administered, the disease and its severity and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the subject to be treated.

    [0252] “Prophylactically effective amount,” as used herein, is intended to include the amount of an iRNA that, when administered to a subject having an oxalate pathway-associated disease, disorder, or condition, is sufficient to prevent or ameliorate the disease or one or more symptoms of the disease. Ameliorating the disease includes slowing the course of the disease or reducing the severity of later-developing disease. The “prophylactically effective amount” may vary depending on the iRNA, how the agent is administered, the degree of risk of disease, and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the patient to be treated.

    [0253] A “therapeutically-effective amount” or “prophylactically effective amount” also includes an amount of an RNAi agent that produces some desired local or systemic effect at a reasonable benefit/risk ratio applicable to any treatment. iRNA employed in the methods of the present invention may be administered in a sufficient amount to produce a reasonable benefit/risk ratio applicable to such treatment.

    [0254] In the methods of the invention which include administering to a subject a pharmaceutical composition comprising a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1, the therapeutically effective amount of the first dsRNA agent may be the same or different than the therapeutically effective amount of the second dsRNA agent. Similarly, in the methods of the invention which include administering to a subject a pharmaceutical composition comprising a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1, the prophylacticly effective amount of the first dsRNA agent may be the same or different than the prophylactically effective amount of the second dsRNA agent.

    [0255] The phrase “pharmaceutically acceptable” is employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human subjects and animal subjects without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.

    [0256] The phrase “pharmaceutically-acceptable carrier” as used herein means a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid), or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject being treated. Some examples of materials which can serve as pharmaceutically-acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricating agents, such as magnesium state, sodium lauryl sulfate and talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffered solutions; (21) polyesters, polycarbonates and/or polyanhydrides; (22) bulking agents, such as polypeptides and amino acids (23) serum component, such as serum albumin, HDL and LDL; and (22) other non-toxic compatible substances employed in pharmaceutical formulations.

    [0257] The term “sample,” as used herein, includes a collection of similar fluids, cells, or tissues isolated from a subject, as well as fluids, cells, or tissues present within a subject. Examples of biological fluids include blood, serum and serosal fluids, plasma, cerebrospinal fluid, ocular fluids, lymph, urine, saliva, and the like. Tissue samples may include samples from tissues, organs or localized regions. For example, samples may be derived from particular organs, parts of organs, or fluids or cells within those organs. In certain embodiments, samples may be derived from the liver (e.g., whole liver or certain segments of liver or certain types of cells in the liver, such as, e.g., hepatocytes). In some embodiments, a “sample derived from a subject” refers to blood or plasma drawn from the subject.

    II. iRNAs of the Invention

    [0258] Described herein are iRNAs which inhibit the expression of a target gene. In one embodiment, the iRNAs inhibit the expression of an LDHA gene. In one embodiment, the iRNA agent includes double stranded ribonucleic acid (dsRNA) molecules for inhibiting the expression of an LDHA gene in a cell, such as a liver cell, such as a liver cell within a subject, e.g., a mammal, such as a human having an oxalate pathway-associated disease, disorder, or condition, e.g., a stone formation disease, disorder, or condition. In another embodiment, the iRNAs inhibit the expression of an HAO1 gene. In one embodiment, the iRNA agent includes double stranded ribonucleic acid (dsRNA) molecules for inhibiting the expression of an HAO1 gene in a cell, such as a liver cell, such as a liver cell within a subject, e.g., a mammal, such as a human having a an oxalate pathway-associated disease, disorder, or condition, e.g., an oxalate-associated disease, disorder, or condition, e.g., a kidney stone formation disease, disorder, or condition or a calcium oxalate tissue deposition disease, disorder, or condition; or an LDH-associated disease, disorder, or condition.

    [0259] Also provided herein are iRNAs which inhibit the expression of two target genes, referred to as dual targeting RNAi agents. In one embodiment, the dual targeting RNAi agent includes a first double stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of an LDHA gene in a cell (such as a liver cell, e.g., a liver cell within a subject) covalently attached to a second double stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of an HAO1 gene in a cell (such as a liver cell, e.g., a liver cell within a subject), such as a cell within a subject, e.g., a mammal, such as a human having an oxalate pathway-associated disease, disorder, or condition, e.g., an oxalate-associated disease, disorder, or condition, e.g., a kidney stone formation disease, disorder, or condition or a calcium oxalate tissue deposition disease, disorder, or condition; or an LDH-associated disease, disorder, or condition.

    [0260] The dsRNA includes an antisense strand having a region of complementarity which is complementary to at least a part of an mRNA formed in the expression of an LDHA gene or an HAO1 gene, The region of complementarity is about 30 nucleotides or less in length (e.g., about 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, or 18 nucleotides or less in length). Upon contact with a cell expressing the target gene, the iRNA inhibits the expression of the target gene (e.g., a human, a primate, a non-primate, or a bird target gene) by at least about 10% as assayed by, for example, a PCR or branched DNA (bDNA)-based method, or by a protein-based method, such as by immunofluorescence analysis, using, for example, Western Blotting or flowcytometric techniques.

    [0261] A dsRNA includes two RNA strands that are complementary and hybridize to form a duplex structure under conditions in which the dsRNA will be used. One strand of a dsRNA (the antisense strand) includes a region of complementarity that is substantially complementary, and generally fully complementary, to a target sequence. The target sequence can be derived from the sequence of an mRNA formed during the expression of an LDHA gene or an HAO1 gene. The other strand (the sense strand) includes a region that is complementary to the antisense strand, such that the two strands hybridize and form a duplex structure when combined under suitable conditions. As described elsewhere herein and as known in the art, the complementary sequences of a dsRNA can also be contained as self-complementary regions of a single nucleic acid molecule, as opposed to being on separate oligonucleotides.

    [0262] Generally, the duplex structure is between 15 and 30 base pairs in length, e.g., between, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the invention.

    [0263] Similarly, the region of complementarity to the target sequence is between 15 and 30 nucleotides in length, e.g., between 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the invention.

    [0264] In some embodiments, the dsRNA is between about 15 and about 23 nucleotides in length, or between about 25 and about 30 nucleotides in length. In general, the dsRNA is long enough to serve as a substrate for the Dicer enzyme. For example, it is well known in the art that dsRNAs longer than about 21-23 nucleotides can serve as substrates for Dicer. As the ordinarily skilled person will also recognize, the region of an RNA targeted for cleavage will most often be part of a larger RNA molecule, often an mRNA molecule. Where relevant, a “part” of an mRNA target is a contiguous sequence of an mRNA target of sufficient length to allow it to be a substrate for RNAi-directed cleavage (i.e., cleavage through a RISC pathway).

    [0265] One of skill in the art will also recognize that the duplex region is a primary functional portion of a dsRNA, e.g., a duplex region of about 9 to 36 base pairs, e.g., about 10-36, 11-36, 12-36, 13-36, 14-36, 15-36, 9-35, 10-35, 11-35, 12-35, 13-35, 14-35, 15-35, 9-34, 10-34, 11-34, 12-34, 13-34, 14-34, 15-34, 9-33, 10-33, 11-33, 12-33, 13-33, 14-33, 15-33, 9-32, 10-32, 11-32, 12-32, 13-32, 14-32, 15-32, 9-31, 10-31, 11-31, 12-31, 13-32, 14-31, 15-31, 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs. Thus, in one embodiment, to the extent that it becomes processed to a functional duplex, of e.g., 15-30 base pairs, that targets a desired RNA for cleavage, an RNA molecule or complex of RNA molecules having a duplex region greater than 30 base pairs is a dsRNA. Thus, an ordinarily skilled artisan will recognize that in one embodiment, a miRNA is a dsRNA. In another embodiment, a dsRNA is not a naturally occurring miRNA. In another embodiment, an iRNA agent useful to target LDHA expression or LDHA and HAO1 expression is not generated in the target cell by cleavage of a larger dsRNA.

    [0266] A dsRNA as described herein can further include one or more single-stranded nucleotide overhangs e.g., 1, 2, 3, or 4 nucleotides. dsRNAs having at least one nucleotide overhang can have unexpectedly superior inhibitory properties relative to their blunt-ended counterparts. A nucleotide overhang can comprise or consist of a nucleotide/nucleoside analog, including a deoxynucleotide/nucleoside. The overhang(s) can be on the sense strand, the antisense strand or any combination thereof. Furthermore, the nucleotide(s) of an overhang can be present on the 5′-end, 3′-end or both ends of either an antisense or sense strand of a dsRNA.

    [0267] A dsRNA can be synthesized by standard methods known in the art as further discussed below, e.g., by use of an automated DNA synthesizer, such as are commercially available from, for example, Biosearch, Applied Biosystems, Inc.

    [0268] iRNA compounds of the invention may be prepared using a two-step procedure. First, the individual strands of the double-stranded RNA molecule are prepared separately. Then, the component strands are annealed. The individual strands of the siRNA compound can be prepared using solution-phase or solid-phase organic synthesis or both. Organic synthesis offers the advantage that the oligonucleotide strands comprising unnatural or modified nucleotides can be easily prepared. Single-stranded oligonucleotides of the invention can be prepared using solution-phase or solid-phase organic synthesis or both.

    [0269] In one aspect, a dsRNA of the invention includes at least two nucleotide sequences, a sense sequence and an anti-sense sequence. The sense strand sequence is selected from the group of sequences provided in any one of Tables 2-5 and the corresponding nucleotide sequence of the antisense strand of the sense strand is selected from the group of sequences of any one of Tables 2-5. In this aspect, one of the two sequences is complementary to the other of the two sequences, with one of the sequences being substantially complementary to a sequence of an mRNA generated in the expression of an LDHA gene. As such, in this aspect, a dsRNA will include two oligonucleotides, where one oligonucleotide is described as the sense strand (passenger strand) in any one of Tables 2-5 and the second oligonucleotide is described as the corresponding antisense strand (guide strand) of the sense strand in any one of Tables 2-5. In one embodiment, the substantially complementary sequences of the dsRNA are contained on separate oligonucleotides. In another embodiment, the substantially complementary sequences of the dsRNA are contained on a single oligonucleotide.

    [0270] In another aspect, a dsRNA of the invention targets an HAO1 gene and includes at least two nucleotide sequences, a sense sequence and an anti-sense sequence. The sense strand sequence is selected from the group of sequences provided in any one of Tables 7-14 and the corresponding nucleotide sequence of the antisense strand of the sense strand is selected from the group of sequences of any one of Tables 7-14. In this aspect, one of the two sequences is complementary to the other of the two sequences, with one of the sequences being substantially complementary to a sequence of an mRNA generated in the expression of an HAO1 gene. As such, in this aspect, a dsRNA will include two oligonucleotides, where one oligonucleotide is described as the sense strand (passenger strand) in any one of Tables 7-14 and the second oligonucleotide is described as the corresponding antisense strand (guide strand) of the sense strand in any one of Tables 7-14. In one embodiment, the substantially complementary sequences of the dsRNA are contained on separate oligonucleotides. In another embodiment, the substantially complementary sequences of the dsRNA are contained on a single oligonucleotide.

    [0271] It will be understood that, although the sequences in Tables 2-5 and 7-14 are described as modified, unmodified, unconjugated. and/or conjugated sequences, the RNA of the iRNA of the invention e.g., a dsRNA of the invention, may comprise any one of the sequences set forth in any one of Table 2-5 and 7-14 that is un-modified, un-conjugated, and/or modified and/or conjugated differently than described therein.

    [0272] The skilled person is well aware that dsRNAs having a duplex structure of between about and 23 base pairs, e.g., 21, base pairs have been hailed as particularly effective in inducing RNA interference (Elbashir et al., (2001) EMBO J., 20:6877-6888). However, others have found that shorter or longer RNA duplex structures can also be effective (Chu and Rana (2007) RNA 14:1714-1719; Kim et al. (2005) Nat Biotech 23:222-226). In the embodiments described above, by virtue of the nature of the oligonucleotide sequences provided herein, dsRNAs described herein can include at least one strand of a length of minimally 21 nucleotides. It can be reasonably expected that shorter duplexes minus only a few nucleotides on one or both ends can be similarly effective as compared to the dsRNAs described above. Hence, dsRNAs having a sequence of at least 15, 16, 17, 18, 19, 20, or more contiguous nucleotides derived from one of the sequences provided herein, and differing in their ability to inhibit the expression of an LDHA gene or an HAO1 gene by not more than about 5, 10, 15, 20, 25, or 30% inhibition from a dsRNA comprising the full sequence, are contemplated to be within the scope of the present invention.

    [0273] In addition, the RNAs described in any one of Tables 2-5 identify a site(s) in an LDHA transcript that is susceptible to RISC-mediated cleavage and those RNAs described in any one of Tables 7-14 identify a site(s) in an HAO1 transcript that is susceptible to RISC-mediated cleavage. As such, the present invention further features iRNAs that target within this site(s). As used herein, an iRNA is said to target within a particular site of an RNA transcript if the iRNA promotes cleavage of the transcript anywhere within that particular site. Such an iRNA will generally include at least about 15 contiguous nucleotides from one of the sequences provided herein coupled to additional nucleotide sequences taken from the region contiguous to the selected sequence in the gene.

    [0274] While a target sequence is generally about 15-30 nucleotides in length, there is wide variation in the suitability of particular sequences in this range for directing cleavage of any given target RNA. Various software packages and the guidelines set out herein provide guidance for the identification of optimal target sequences for any given gene target, but an empirical approach can also be taken in which a “window” or “mask” of a given size (as a non-limiting example, 21 nucleotides) is literally or figuratively (including, e.g., in silico) placed on the target RNA sequence to identify sequences in the size range that can serve as target sequences. By moving the sequence “window” progressively one nucleotide upstream or downstream of an initial target sequence location, the next potential target sequence can be identified, until the complete set of possible sequences is identified for any given target size selected. This process, coupled with systematic synthesis and testing of the identified sequences (using assays as described herein or as known in the art) to identify those sequences that perform optimally can identify those RNA sequences that, when targeted with an iRNA agent, mediate the best inhibition of target gene expression. Thus, while the sequences identified herein represent effective target sequences, it is contemplated that further optimization of inhibition efficiency can be achieved by progressively “walking the window” one nucleotide upstream or downstream of the given sequences to identify sequences with equal or better inhibition characteristics.

    [0275] Further, it is contemplated that for any sequence identified herein, further optimization could be achieved by systematically either adding or removing nucleotides to generate longer or shorter sequences and testing those sequences generated by walking a window of the longer or shorter size up or down the target RNA from that point. Again, coupling this approach to generating new candidate targets with testing for effectiveness of iRNAs based on those target sequences in an inhibition assay as known in the art and/or as described herein can lead to further improvements in the efficiency of inhibition. Further still, such optimized sequences can be adjusted by, e.g., the introduction of modified nucleotides as described herein or as known in the art, addition or changes in overhang, or other modifications as known in the art and/or discussed herein to further optimize the molecule (e.g., increasing serum stability or circulating half-life, increasing thermal stability, enhancing transmembrane delivery, targeting to a particular location or cell type, increasing interaction with silencing pathway enzymes, increasing release from endosomes) as an expression inhibitor.

    [0276] An iRNA agent as described herein can contain one or more mismatches to the target sequence. In one embodiment, an iRNA as described herein contains no more than 3 mismatches. If the antisense strand of the iRNA contains mismatches to a target sequence, it is preferable that the area of mismatch is not located in the center of the region of complementarity. If the antisense strand of the iRNA contains mismatches to the target sequence, it is preferable that the mismatch be restricted to be within the last 5 nucleotides from either the 5′- or 3′-end of the region of complementarity. For example, for a 23 nucleotide iRNA agent the strand which is complementary to a region of an LDHA gene or an HAO1 gene, generally does not contain any mismatch within the central 13 nucleotides. The methods described herein or methods known in the art can be used to determine whether an iRNA containing a mismatch to a target sequence is effective in inhibiting the expression of an LDHA gene and/or an HAO1 gene. Consideration of the efficacy of iRNAs with mismatches in inhibiting expression of an LDHA gene and/or an HAO1 gene is important, especially if the particular region of complementarity in an LDHA gene and/or HAO1 gene is known to have polymorphic sequence variation within the population.

    [0277] The dual targeting RNAi agents of the invention, which include two dsRNA agents, are covalently attached via, e.g., a covalent linker. Covalent linkers are well known in the art and include, e.g., nucleic acid linkers, peptide linkers, carbohydrate linkers, and the like. The covalent linker can include RNA and/or DNA and/or a peptide. The linker can be single stranded, double stranded, partially single strands, or partially double stranded. Modified nucleotides or a mixture of nucleotides can also be present in a nucleic acid linker.

    [0278] Suitable linkers for use in the dual targeting agent of the invention include those described in U.S. Pat. No. 9,187,746, the entire contents of which are incorporated herein by reference.

    [0279] In some embodiments the linker includes a disulfide bond. The linker can be cleavable or non-cleavable.

    [0280] The linker can be, e.g., dTsdTuu=(5′-2′deoxythymidyl-3′-thiophosphate-5′-2′deoxythymidyl-3′-phosphate-5′-uridyl-3′-phosphate-5′-uridyl-3′-phosphate); rUsrU (a thiophosphate linker: 5′-uridyl-3′-thiophosphate-5′-uridyl-3′-phosphate); an rUrU linker; dTsdTaa (aadTsdT, 5′-2′deoxythymidyl-3′-thiophosphate-5′-2′deoxythymidyl-3′-phosphate-5′-adenyl-3′-phosphate-5′-adenyl-3′-phosphate); dTsdT (5′-2′deoxythymidyl-3′-thiophosphate-5′-2′ deoxythymidyl-3′-phosphate); dTsdTuu=uudTsdT=5′-2′deoxythymidyl-3′-thiophosphate-5′-2′deoxythymidyl-3′-phosphate-5′-uridyl-3′-phosphate-5′-uridyl-3′-phosphate.

    [0281] The linker can be a polyRNA, such as poly(5′-adenyl-3′-phosphate-AAAAAAAA) or poly(5′-cytidyl-3′-phosphate-5′-uridyl-3′-phosphate-CUCUCUCU)), e.g., Xn single stranded poly RNA linker wherein n is an integer from 2-50 inclusive, preferable 4-15 inclusive, most preferably 7-8 inclusive. Modified nucleotides or a mixture of nucleotides can also be present in said polyRNA linker. The covalent linker can be a polyDNA, such as poly(5′-2′deoxythymidyl-3′-phosphate-TTTTTTTT), e.g., wherein n is an integer from 2-50 inclusive, preferable 4-15 inclusive, most preferably 7-8 inclusive. Modified nucleotides or a mixture of nucleotides can also be present in said polyDNA linker, a single stranded polyDNA linker wherein n is an integer from 2-50 inclusive, preferable 4-inclusive, most preferably 7-8 inclusive. Modified nucleotides or a mixture of nucleotides can also be present in said polyDNA linker.

    [0282] The linker can include a disulfide bond, optionally a bis-hexyl-disulfide linker. In one embodiment, the disulfide linker is

    ##STR00005##

    [0283] The linker can include a peptide bond, e.g., include amino acids. In one embodiment, the covalent linker is a 1-10 amino acid long linker, preferably comprising 4-5 amino acids, optionally X-Gly-Phe-Gly-Y wherein X and Y represent any amino acid.

    [0284] The linker can include HEG, a hexaethylenglycol linker.

    [0285] The covalent linker can attach the sense strand of the first dsRNA agent to the sense strand of the second dsRNA agent; the antisense strand of the first dsRNA agent to the antisense strand of the second dsRNA agent; the sense strand of the first dsRNA agent to the antisense strand of the second dsRNA agent; or the antisense strand of the first dsRNA agent to the sense strand of the second dsRNA agent.

    [0286] In some embodiments, the covalent linker further comprises at least one ligand, described below.

    III. Modified iRNAs of the Invention

    [0287] In one embodiment, the RNA of the iRNA of the invention e.g., a dsRNA, is un-modified, and does not comprise, e.g., chemical modifications and/or conjugations known in the art and described herein. In another embodiment, the RNA of an iRNA of the invention, e.g., a dsRNA, is chemically modified to enhance stability or other beneficial characteristics. In certain embodiments of the invention, substantially all of the nucleotides of an iRNA of the invention are modified. In other embodiments of the invention, all of the nucleotides of an iRNA of the invention are modified. iRNAs of the invention in which “substantially all of the nucleotides are modified” are largely but not wholly modified and can include not more than 5, 4, 3, 2, or 1 unmodified nucleotides.

    [0288] In embodiments in which a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1 are covalently attached (i.e., a dual targeting RNAi agent), substantially all of the nucleotides of the first agent and substantially all of the nucleotides of the second agent may be independently modified; all of the nucleotides of the first agent may be modified and all of the nucleotides of the second agent may be independently modified; substantially all of the nucleotides of the first agent and all of the nucleotides of the second agent may be independently modified; or all of the nucleotides of the first agent may be modified and substantially all of the nucleotides of the second agent may be independently modified.

    [0289] In some aspects of the invention, substantially all of the nucleotides of an iRNA of the invention are modified and the iRNA agents comprise no more than 10 nucleotides comprising 2′-fluoro modifications (e.g., no more than 9 2′-fluoro modifications, no more than 8 2′-fluoro modifications, no more than 7 2′-fluoro modifications, no more than 6 2′-fluoro modifications, no more than 5 2′-fluoro modifications, no more than 4 2′-fluoro modifications, no more than 5 2′-fluoro modifications, no more than 4 2′-fluoro modifications, no more than 3 2′-fluoro modifications, or no more than 2 2′-fluoro modifications). For example, in some embodiments, the sense strand comprises no more than 4 nucleotides comprising 2′-fluoro modifications (e.g., no more than 3 2′-fluoro modifications, or no more than 2 2′-fluoro modifications). In other embodiments, the antisense strand comprises no more than 6 nucleotides comprising 2′-fluoro modifications (e.g., no more than 5 2′-fluoro modifications, no more than 4 2′-fluoro modifications, no more than 4 2′-fluoro modifications, or no more than 2 2′-fluoro modifications).

    [0290] In embodiments in which a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1 are covalently attached (i.e., a dual targeting RNAi agent), substantially all of the nucleotides of the first agent and/or substantially all of the nucleotides of the second agent may be independently modified and the first and second agents may independently comprise no more than 10 nucleotides comprising 2′-fluoro modifications.

    [0291] In other aspects of the invention, all of the nucleotides of an iRNA of the invention are modified and the iRNA agents comprise no more than 10 nucleotides comprising 2′-fluoro modifications (e.g., no more than 9 2′-fluoro modifications, no more than 8 2′-fluoro modifications, no more than 7 2′-fluoro modifications, no more than 6 2′-fluoro modifications, no more than 5 2′-fluoro modifications, no more than 4 2′-fluoro modifications, no more than 5 2′-fluoro modifications, no more than 4 2′-fluoro modifications, no more than 3 2′-fluoro modifications, or no more than 2 2′-fluoro modifications).

    [0292] In embodiments in which a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1 are covalently attached (i.e., a dual targeting RNAi agent), all of the nucleotides of the first agent and/or all of the nucleotides of the second agent may be independently modified and the first and second agents may independently comprise no more than 10 nucleotides comprising 2′-fluoro modifications.

    [0293] In one embodiment, the double stranded RNAi agent of the invention further comprises a 5′-phosphate or a 5′-phosphate mimic at the 5′ nucleotide of the antisense strand. In another embodiment, the double stranded RNAi agent further comprises a 5′-phosphate mimic at the 5′ nucleotide of the antisense strand. In a specific embodiment, the 5′-phosphate mimic is a 5′-vinyl phosphate (5′-VP).

    [0294] In embodiments in which a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1 are covalently attached (i.e., a dual targeting RNAi agent), the first agent may further comprise a 5′-phosphate or a 5′-phosphate mimic at the 5′ nucleotide of the antisense strand; the second agent may further comprise a 5′-phosphate or a 5′-phosphate mimic at the 5′ nucleotide of the antisense strand; or the first agent and the second agent may further independently comprise a 5′-phosphate or a 5′-phosphate mimic at the 5′ nucleotide of the antisense strand.

    [0295] The nucleic acids featured in the invention can be synthesized and/or modified by methods well established in the art, such as those described in “Current protocols in nucleic acid chemistry,” Beaucage, S. L. et al. (Edrs.), John Wiley & Sons, Inc., New York, N.Y., USA, which is hereby incorporated herein by reference. Modifications include, for example, end modifications, e.g., 5′-end modifications (phosphorylation, conjugation, inverted linkages) or 3′-end modifications (conjugation, DNA nucleotides, inverted linkages, etc.); base modifications, e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, removal of bases (abasic nucleotides), or conjugated bases; sugar modifications (e.g., at the 2′-position or 4′-position) or replacement of the sugar; and/or backbone modifications, including modification or replacement of the phosphodiester linkages. Specific examples of iRNA compounds useful in the embodiments described herein include, but are not limited to RNAs containing modified backbones or no natural internucleoside linkages. RNAs having modified backbones include, among others, those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, modified RNAs that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides. In some embodiments, a modified iRNA will have a phosphorus atom in its internucleoside backbone.

    [0296] Modified RNA backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3′-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3′-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3′-5′ linkages, 2′-5′-linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3′-5′ to 5′-3′ or 2′-5′ to 5′-2′. Various salts, mixed salts and free acid forms are also included.

    [0297] Representative U.S. patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,195; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,316; 5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,625,050; 6,028,188; 6,124,445; 6,160,109; 6,169,170; 6,172,209; 6,239,265; 6,277,603; 6,326,199; 6,346,614; 6,444,423; 6,531,590; 6,534,639; 6,608,035; 6,683,167; 6,858,715; 6,867,294; 6,878,805; 7,015,315; 7,041,816; 7,273,933; 7,321,029; and U.S. Pat. RE39464, the entire contents of each of which are hereby incorporated herein by reference.

    [0298] Modified RNA backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH.sub.2 component parts.

    [0299] Representative U.S. patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,64,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and, 5,677,439, the entire contents of each of which are hereby incorporated herein by reference.

    [0300] In other embodiments, suitable RNA mimetics are contemplated for use in iRNAs, in which both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, an RNA mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of an RNA is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, the entire contents of each of which are hereby incorporated herein by reference. Additional PNA compounds suitable for use in the iRNAs of the invention are described in, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.

    [0301] Some embodiments featured in the invention include RNAs with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular —CH.sub.2—NH—CH.sub.2—, —CH.sub.2—N(CH.sub.3)—O—CH.sub.2—[known as a methylene (methylimino) or MMI backbone], —CH.sub.2—O—N(CH.sub.3)—CH.sub.2—, —CH.sub.2—N(CH.sub.3)—N(CH.sub.3)—CH.sub.2— and —N(CH.sub.3)—CH.sub.2—CH.sub.2—[wherein the native phosphodiester backbone is represented as —O—P—O—CH.sub.2-] of the above-referenced U.S. Pat. No. 5,489,677, and the amide backbones of the above-referenced U.S. Pat. No. 5,602,240. In some embodiments, the RNAs featured herein have morpholino backbone structures of the above-referenced U.S. Pat. No. 5,034,506.

    [0302] Modified RNAs can also contain one or more substituted sugar moieties. The iRNAs, e.g., dsRNAs, featured herein can include one of the following at the 2′-position: OH; F; O—, S—, or N-alkyl; O—, S—, or N-alkenyl; O—, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl can be substituted or unsubstituted C.sub.1 to C.sub.10 alkyl or C.sub.2 to C.sub.10 alkenyl and alkynyl. Exemplary suitable modifications include O[(CH.sub.2).sub.nO].sub.mCH.sub.3, O(CH.sub.2)..sub.nOCH.sub.3, O(CH.sub.2).sub.nNH.sub.2, O(CH.sub.2).sub.nCH.sub.3, O(CH.sub.2).sub.nONH.sub.2, and O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.sub.3)].sub.2, where n and m are from 1 to about 10. In other embodiments, dsRNAs include one of the following at the 2′ position: C.sub.1 to C.sub.10 lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH.sub.3, OCN, Cl, Br, CN, CF.sub.3, OCF.sub.3, SOCH.sub.3, SO.sub.2CH.sub.3, ONO.sub.2, NO.sub.2, N.sub.3, NH.sub.2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an iRNA, or a group for improving the pharmacodynamic properties of an iRNA, and other substituents having similar properties. In some embodiments, the modification includes a 2′-methoxyethoxy (2′-O—CH.sub.2CH.sub.2OCH.sub.3, also known as 2′-O-(2-methoxyethyl) or 2′-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504) i.e., an alkoxy-alkoxy group. Another exemplary modification is 2′-dimethylaminooxyethoxy, i.e., a O(CH.sub.2).sub.2ON(CH.sub.3).sub.2 group, also known as 2′-DMAOE, as described in examples herein below, and 2′-dimethylaminoethoxyethoxy (also known in the art as 2′-O-dimethylaminoethoxyethyl or 2′-DMAEOE), i.e., 2′-O—CH.sub.2—O—CH.sub.2—N(CH.sub.2).sub.2. Further exemplary modifications include: 5′-Me-2′-F nucleotides, 5′-Me-2′-OMe nucleotides, 5′-Me-2′-deoxynucleotides, (both R and S isomers in these three families); 2′-alkoxyalkyl; and 2′-NMA (N-methylacetamide).

    [0303] Other modifications include 2′-methoxy (2′-OCH.sub.3), 2′-aminopropoxy (2′-OCH.sub.2CH.sub.2CH.sub.2NH.sub.2) and 2′-fluoro (2′-F). Similar modifications can also be made at other positions on the RNA of an iRNA, particularly the 3′ position of the sugar on the 3′ terminal nucleotide or in 2′-5′ linked dsRNAs and the 5′ position of 5′ terminal nucleotide. iRNAs can also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Representative U.S. patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920, certain of which are commonly owned with the instant application. The entire contents of each of the foregoing are hereby incorporated herein by reference.

    [0304] An iRNA of the invention can also include nucleobase (often referred to in the art simply as “base”) modifications or substitutions. As used herein, “unmodified” or “natural” nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl anal other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-daazaadenine and 3-deazaguanine and 3-deazaadenine. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008; those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. L, ed. John Wiley & Sons, 1990, these disclosed by Englisch et al., (1991) Angewandte Chemie, International Edition, 30:613, and those disclosed by Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., Ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds featured in the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2° C. (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., Eds., dsRNA Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are exemplary base substitutions, even more particularly when combined with 2′-O-methoxyethyl sugar modifications.

    [0305] Representative U.S. patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include, but are not limited to, the above noted U.S. Pat. Nos. 3,687,808, 4,845,205; 5,130,30; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,681,941; 5,750,692; 6,015,886; 6,147,200; 6,166,197; 6,222,025; 6,235,887; 6,380,368; 6,528,640; 6,639,062; 6,617,438; 7,045,610; 7,427,672; and 7,495,088, the entire contents of each of which are hereby incorporated herein by reference.

    [0306] An iRNA of the invention can also be modified to include one or more locked nucleic acids (LNA). A locked nucleic acid is a nucleotide having a modified ribose moiety in which the ribose moiety comprises an extra bridge connecting the 2′ and 4′ carbons. This structure effectively “locks” the ribose in the 3-endo structural conformation. The addition of locked nucleic acids to siRNAs has been shown to increase siRNA stability in serum, and to reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, O R. et al., (2007) Mol Canc Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193).

    [0307] An iRNA of the invention can also be modified to include one or more bicyclic sugar moities. A “bicyclic sugar” is a furanosyl ring modified by the bridging of two atoms. A“bicyclic nucleoside” (“BNA”) is a nucleoside having a sugar moiety comprising a bridge connecting two carbon atoms of the sugar ring, thereby forming a bicyclic ring system. In certain embodiments, the bridge connects the 4′-carbon and the 2′-carbon of the sugar ring. Thus, in some embodiments an agent of the invention may include one or more locked nucleic acids (LNA). A locked nucleic acid is a nucleotide having a modified ribose moiety in which the ribose moiety comprises an extra bridge connecting the 2′ and 4′ carbons. In other words, an LNA is a nucleotide comprising a bicyclic sugar moiety comprising a 4′-CH2-O-2′ bridge. This structure effectively “locks” the ribose in the 3′-endo structural conformation. The addition of locked nucleic acids to siRNAs has been shown to increase siRNA stability in serum, and to reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, O R. et al., (2007) Mol Canc Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). Examples of bicyclic nucleosides for use in the polynucleotides of the invention include without limitation nucleosides comprising a bridge between the 4′ and the 2′ ribosyl ring atoms. In certain embodiments, the antisense polynucleotide agents of the invention include one or more bicyclic nucleosides comprising a 4′ to 2′ bridge. Examples of such 4′ to 2′ bridged bicyclic nucleosides, include but are not limited to 4′-(CH2)-O-2′ (LNA); 4′-(CH2)-S-2′; 4′-(CH2)2-O-2′ (ENA); 4′-CH(CH3)-O-2′ (also referred to as “constrained ethyl” or “cEt”) and 4′-CH(CH2OCH3)-O-2′ (and analogs thereof, see, e.g., U.S. Pat. No. 7,399,845); 4′-C(CH3)(CH3)-O-2′ (and analogs thereof; see e.g., U.S. Pat. No. 8,278,283); 4′-CH2-N(OCH3)-2′ (and analogs thereof; see e.g., U.S. Pat. No. 8,278,425); 4′-CH2-O—N(CH3)-2′ (see, e.g., U.S. Patent Publication No. 2004/0171570); 4′-CH2-N(R)—O-2′, wherein R is H, C1-C12 alkyl, or a protecting group (see, e.g., U.S. Pat. No. 7,427,672); 4′-CH2-C(H)(CH3)-2′ (see, e.g., Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134); and 4′-CH2-C(═CH2)-2′ (and analogs thereof, see, e.g., U.S. Pat. No. 8,278,426). The entire contents of each of the foregoing are hereby incorporated herein by reference.

    [0308] Additional representative U.S. patents and US patent Publications that teach the preparation of locked nucleic acid nucleotides include, but are not limited to, the following: U.S. Pat. Nos. 6,268,490; 6,525,191; 6,670,461; 6,770,748; 6,794,499; 6,998,484; 7,053,207; 7,034,133; 7,084,125; 7,399,845; 7,427,672; 7,569,686; 7,741,457; 8,022,193; 8,030,467; 8,278,425; 8,278,426; 8,278,283; US 2008/0039618; and US 2009/0012281, the entire contents of each of which are hereby incorporated herein by reference.

    [0309] Any of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example α-L-ribofuranose and β-D-ribofuranose (see WO 99/14226).

    [0310] An iRNA of the invention can also be modified to include one or more constrained ethyl nucleotides. As used herein, a “constrained ethyl nucleotide” or “cEt” is a locked nucleic acid comprising a bicyclic sugar moiety comprising a 4′-CH(CH3)-O-2′ bridge. In one embodiment, a constrained ethyl nucleotide is in the S conformation referred to herein as “S-cEt.”

    [0311] An iRNA of the invention may also include one or more “conformationally restricted nucleotides” (“CRN”). CRN are nucleotide analogs with a linker connecting the C2′ and C4′ carbons of ribose or the C3 and —C5′ carbons of ribose. CRN lock the ribose ring into a stable conformation and increase the hybridization affinity to mRNA. The linker is of sufficient length to place the oxygen in an optimal position for stability and affinity resulting in less ribose ring puckering.

    [0312] Representative publications that teach the preparation of certain of the above noted CRN include, but are not limited to, US Patent Publication No. 2013/0190383; and PCT publication WO 2013/036868, the entire contents of each of which are hereby incorporated herein by reference.

    [0313] In some embodiments, an iRNA of the invention comprises one or more monomers that are UNA (unlocked nucleic acid) nucleotides. UNA is unlocked acyclic nucleic acid, wherein any of the bonds of the sugar has been removed, forming an unlocked “sugar” residue. In one example, UNA also encompasses monomer with bonds between C1′-C4′ have been removed (i.e. the covalent carbon-oxygen-carbon bond between the C1′ and C4′ carbons). In another example, the C2′-C3′ bond (i.e. the covalent carbon-carbon bond between the C2′ and C3′ carbons) of the sugar has been removed (see Nuc. Acids Symp. Series, 52, 133-134 (2008) and Fluiter et al., Mol. Biosyst., 2009, 10, 1039 hereby incorporated by reference).

    [0314] Representative U.S. publications that teach the preparation of UNA include, but are not limited to, U.S. Pat. No. 8,314,227; and US Patent Publication Nos. 2013/0096289; 2013/0011922; and 2011/0313020, the entire contents of each of which are hereby incorporated herein by reference.

    [0315] Potentially stabilizing modifications to the ends of RNA molecules can include N-(acetylaminocaproyl)-4-hydroxyprolinol (Hyp-C6-NHAc), N-(caproyl-4-hydroxyprolinol (Hyp-C6), N-(acetyl-4-hydroxyprolinol (Hyp-NHAc), thymidine-2′-O-deoxythymidine (ether), N-(aminocaproyl)-4-hydroxyprolinol (Hyp-C6-amino), 2-docosanoyl-uridine-3″-phosphate, inverted base dT(idT) and others. Disclosure of this modification can be found in PCT Publication No. WO 2011/005861.

    [0316] Other modifications of an iRNA of the invention include a 5′ phosphate or 5′ phosphate mimic, e.g., a 5′-terminal phosphate or phosphate mimic on the antisense strand of an RNAi agent. Suitable phosphate mimics are disclosed in, for example US Patent Publication No. 2012/0157511, the entire contents of which are incorporated herein by reference.

    [0317] In certain specific embodiments, an RNAi agent of the present invention is an agent that inhibits the expression of an LDHA gene which is selected from the group of agents listed in any one of Tables 2-5. In other embodiments, an RNAi agent of the present invention is an dual targeting iRNA agent that inhibits the expression of an LDHA gene and an HAO1, wherein the first dsRNA inhibits expression of an LDHA gene and is selected from the group of agents listed in any one of Tables 2-5, and and the first dsRNA inhibits expression of an HAO1 gene and is selected from the group of agents listed in any one of Tables 7-14. Any of these agents may further comprise a ligand.

    [0318] A. Modified iRNAs Comprising Motifs of the Invention

    [0319] In certain aspects of the invention, the double stranded RNAi agents of the invention include agents with chemical modifications as disclosed, for example, in WO 2013/075035, filed on Nov. 16, 2012, the entire contents of which are incorporated herein by reference.

    [0320] It is to be understood that, in embodiments in which a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1 are covalently attached (i.e., a dual targeting RNAi agent), the first agent may comprise any one or more of the motifs described below, the second agent may comprise any one or more of the motifs described below, or both the first agent and the second agent may independently comprise any one or more of the motifs described below.

    [0321] Accordingly, the invention provides double stranded RNAi agents capable of inhibiting the expression of a target gene (i.e., an LDHA gene or an LDHA gene and an HAO1 gene) in vivo. The RNAi agent comprises a sense strand and an antisense strand. Each strand of the RNAi agent may range from 12-30 nucleotides in length. For example, each strand may be between 14-30 nucleotides in length, 17-30 nucleotides in length, 25-30 nucleotides in length, 27-30 nucleotides in length, 17-23 nucleotides in length, 17-21 nucleotides in length, 17-19 nucleotides in length, 19-25 nucleotides in length, 19-23 nucleotides in length, 19-21 nucleotides in length, 21-25 nucleotides in length, or 21-23 nucleotides in length.

    [0322] The sense strand and antisense strand typically form a duplex double stranded RNA (“dsRNA”), also referred to herein as an “RNAi agent.” The duplex region of an RNAi agent may be 12-30 nucleotide pairs in length. For example, the duplex region can be between 14-30 nucleotide pairs in length, 17-30 nucleotide pairs in length, 27-30 nucleotide pairs in length, 17-23 nucleotide pairs in length, 17-21 nucleotide pairs in length, 17-19 nucleotide pairs in length, 19-25 nucleotide pairs in length, 19-23 nucleotide pairs in length, 19-21 nucleotide pairs in length, 21-25 nucleotide pairs in length, or 21-23 nucleotide pairs in length. In another example, the duplex region is selected from 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, and 27 nucleotides in length.

    [0323] In one embodiment, the RNAi agent may contain one or more overhang regions and/or capping groups at the 3′-end, 5′-end, or both ends of one or both strands. The overhang can be 1-6 nucleotides in length, for instance 2-6 nucleotides in length, 1-5 nucleotides in length, 2-5 nucleotides in length, 1-4 nucleotides in length, 2-4 nucleotides in length, 1-3 nucleotides in length, 2-3 nucleotides in length, or 1-2 nucleotides in length. The overhangs can be the result of one strand being longer than the other, or the result of two strands of the same length being staggered. The overhang can form a mismatch with the target mRNA or it can be complementary to the gene sequences being targeted or can be another sequence. The first and second strands can also be joined, e.g., by additional bases to form a hairpin, or by other non-base linkers.

    [0324] In one embodiment, the nucleotides in the overhang region of the RNAi agent can each independently be a modified or unmodified nucleotide including, but no limited to 2′-sugar modified, such as, 2-F, 2′-Omethyl, thymidine (T), 2′-O-methoxyethyl-5-methyluridine (Teo), 2′-O-methoxyethyladenosine (Aeo), 2′-O-methoxyethyl-5-methylcytidine (m5Ceo), and any combinations thereof. For example, TT can be an overhang sequence for either end on either strand. The overhang can form a mismatch with the target mRNA or it can be complementary to the gene sequences being targeted or can be another sequence.

    [0325] The 5′- or 3′-overhangs at the sense strand, antisense strand or both strands of the RNAi agent may be phosphorylated. In some embodiments, the overhang region(s) contains two nucleotides having a phosphorothioate between the two nucleotides, where the two nucleotides can be the same or different. In one embodiment, the overhang is present at the 3′-end of the sense strand, antisense strand, or both strands. In one embodiment, this 3′-overhang is present in the antisense strand. In one embodiment, this 3′-overhang is present in the sense strand.

    [0326] The RNAi agent may contain only a single overhang, which can strengthen the interference activity of the RNAi, without affecting its overall stability. For example, the single-stranded overhang may be located at the 3′-terminal end of the sense strand or, alternatively, at the 3′-terminal end of the antisense strand. The RNAi may also have a blunt end, located at the 5′-end of the antisense strand (or the 3′-end of the sense strand) or vice versa. Generally, the antisense strand of the RNAi has a nucleotide overhang at the 3′-end, and the 5′-end is blunt. While not wishing to be bound by theory, the asymmetric blunt end at the 5′-end of the antisense strand and 3′-end overhang of the antisense strand favor the guide strand loading into RISC process.

    [0327] In one embodiment, the RNAi agent is a double ended bluntmer of 19 nucleotides in length, wherein the sense strand contains at least one motif of three 2′-F modifications on three consecutive nucleotides at positions 7, 8, 9 from the 5′end. The antisense strand contains at least one motif of three 2′-O-methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5′end.

    [0328] In another embodiment, the RNAi agent is a double ended bluntmer of 20 nucleotides in length, wherein the sense strand contains at least one motif of three 2′-F modifications on three consecutive nucleotides at positions 8, 9, 10 from the 5′end. The antisense strand contains at least one motif of three 2′-O-methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5′end.

    [0329] In yet another embodiment, the RNAi agent is a double ended bluntmer of 21 nucleotides in length, wherein the sense strand contains at least one motif of three 2′-F modifications on three consecutive nucleotides at positions 9, 10, 11 from the 5′end. The antisense strand contains at least one motif of three 2′-O-methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5′end.

    [0330] In one embodiment, the RNAi agent comprises a 21 nucleotide sense strand and a 23 nucleotide antisense strand, wherein the sense strand contains at least one motif of three 2′-F modifications on three consecutive nucleotides at positions 9, 10, 11 from the 5′end; the antisense strand contains at least one motif of three 2′-O-methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5′end, wherein one end of the RNAi agent is blunt, while the other end comprises a 2 nucleotide overhang. Preferably, the 2 nucleotide overhang is at the 3′-end of the antisense strand.

    [0331] When the 2 nucleotide overhang is at the 3′-end of the antisense strand, there may be two phosphorothioate internucleotide linkages between the terminal three nucleotides, wherein two of the three nucleotides are the overhang nucleotides, and the third nucleotide is a paired nucleotide next to the overhang nucleotide. In one embodiment, the RNAi agent additionally has two phosphorothioate internucleotide linkages between the terminal three nucleotides at both the 5′-end of the sense strand and at the 5′-end of the antisense strand. In one embodiment, every nucleotide in the sense strand and the antisense strand of the RNAi agent, including the nucleotides that are part of the motifs are modified nucleotides. In one embodiment each residue is independently modified with a 2′-O-methyl or 3′-fluoro, e.g., in an alternating motif. Optionally, the RNAi agent further comprises a ligand (preferably GalNAc3).

    [0332] In one embodiment, the RNAi agent comprises a sense and an antisense strand, wherein the sense strand is 25-30 nucleotide residues in length, wherein starting from the 5′ terminal nucleotide (position 1) positions 1 to 23 of the first strand comprise at least 8 ribonucleotides; the antisense strand is 36-66 nucleotide residues in length and, starting from the 3′ terminal nucleotide, comprises at least 8 ribonucleotides in the positions paired with positions 1-23 of sense strand to form a duplex; wherein at least the 3′ terminal nucleotide of antisense strand is unpaired with sense strand, and up to 6 consecutive 3′ terminal nucleotides are unpaired with sense strand, thereby forming a 3′ single stranded overhang of 1-6 nucleotides; wherein the 5′ terminus of antisense strand comprises from 10-30 consecutive nucleotides which are unpaired with sense strand, thereby forming a 10-30 nucleotide single stranded 5′ overhang; wherein at least the sense strand 5′ terminal and 3′ terminal nucleotides are base paired with nucleotides of antisense strand when sense and antisense strands are aligned for maximum complementarity, thereby forming a substantially duplexed region between sense and antisense strands; and antisense strand is sufficiently complementary to a target RNA along at least 19 ribonucleotides of antisense strand length to reduce target gene expression when the double stranded nucleic acid is introduced into a mammalian cell; and wherein the sense strand contains at least one motif of three 2′-F modifications on three consecutive nucleotides, where at least one of the motifs occurs at or near the cleavage site. The antisense strand contains at least one motif of three 2′-O-methyl modifications on three consecutive nucleotides at or near the cleavage site.

    [0333] In one embodiment, the RNAi agent comprises sense and antisense strands, wherein the RNAi agent comprises a first strand having a length which is at least 25 and at most 29 nucleotides and a second strand having a length which is at most 30 nucleotides with at least one motif of three 2′-O-methyl modifications on three consecutive nucleotides at position 11, 12, 13 from the 5′ end; wherein the 3′ end of the first strand and the 5′ end of the second strand form a blunt end and the second strand is 1-4 nucleotides longer at its 3′ end than the first strand, wherein the duplex region region which is at least 25 nucleotides in length, and the second strand is sufficiently complementary to a target mRNA along at least 19 nucleotide of the second strand length to reduce target gene expression when the RNAi agent is introduced into a mammalian cell, and wherein dicer cleavage of the RNAi agent preferentially results in an siRNA comprising the 3′ end of the second strand, thereby reducing expression of the target gene in the mammal. Optionally, the RNAi agent further comprises a ligand.

    [0334] In one embodiment, the sense strand of the RNAi agent contains at least one motif of three identical modifications on three consecutive nucleotides, where one of the motifs occurs at the cleavage site in the sense strand.

    [0335] In one embodiment, the antisense strand of the RNAi agent can also contain at least one motif of three identical modifications on three consecutive nucleotides, where one of the motifs occurs at or near the cleavage site in the antisense strand.

    [0336] For an RNAi agent having a duplex region of 17-23 nucleotide in length, the cleavage site of the antisense strand is typically around the 10, 11 and 12 positions from the 5′-end. Thus the motifs of three identical modifications may occur at the 9, 10, 11 positions; 10, 11, 12 positions; 11, 12, 13 positions; 12, 13, 14 positions; or 13, 14, 15 positions of the antisense strand, the count starting from the 1′ nucleotide from the 5′-end of the antisense strand, or, the count starting from the 1 paired nucleotide within the duplex region from the 5′-end of the antisense strand. The cleavage site in the antisense strand may also change according to the length of the duplex region of the RNAi from the 5′-end.

    [0337] The sense strand of the RNAi agent may contain at least one motif of three identical modifications on three consecutive nucleotides at the cleavage site of the strand; and the antisense strand may have at least one motif of three identical modifications on three consecutive nucleotides at or near the cleavage site of the strand. When the sense strand and the antisense strand form a dsRNA duplex, the sense strand and the antisense strand can be so aligned that one motif of the three nucleotides on the sense strand and one motif of the three nucleotides on the antisense strand have at least one nucleotide overlap, i.e., at least one of the three nucleotides of the motif in the sense strand forms a base pair with at least one of the three nucleotides of the motif in the antisense strand. Alternatively, at least two nucleotides may overlap, or all three nucleotides may overlap.

    [0338] In one embodiment, the sense strand of the RNAi agent may contain more than one motif of three identical modifications on three consecutive nucleotides. The first motif may occur at or near the cleavage site of the strand and the other motifs may be a wing modification. The term “wing modification” herein refers to a motif occurring at another portion of the strand that is separated from the motif at or near the cleavage site of the same strand. The wing modification is either adjacent to the first motif or is separated by at least one or more nucleotides. When the motifs are immediately adjacent to each other then the chemistry of the motifs are distinct from each other and when the motifs are separated by one or more nucleotide than the chemistries can be the same or different. Two or more wing modifications may be present. For instance, when two wing modifications are present, each wing modification may occur at one end relative to the first motif which is at or near cleavage site or on either side of the lead motif.

    [0339] Like the sense strand, the antisense strand of the RNAi agent may contain more than one motifs of three identical modifications on three consecutive nucleotides, with at least one of the motifs occurring at or near the cleavage site of the strand. This antisense strand may also contain one or more wing modifications in an alignment similar to the wing modifications that may be present on the sense strand.

    [0340] In one embodiment, the wing modification on the sense strand or antisense strand of the RNAi agent typically does not include the first one or two terminal nucleotides at the 3′-end, 5′-end or both ends of the strand.

    [0341] In another embodiment, the wing modification on the sense strand or antisense strand of the RNAi agent typically does not include the first one or two paired nucleotides within the duplex region at the 3′-end, 5′-end or both ends of the strand.

    [0342] When the sense strand and the antisense strand of the RNAi agent each contain at least one wing modification, the wing modifications may fall on the same end of the duplex region, and have an overlap of one, two or three nucleotides.

    [0343] When the sense strand and the antisense strand of the RNAi agent each contain at least two wing modifications, the sense strand and the antisense strand can be so aligned that two modifications each from one strand fall on one end of the duplex region, having an overlap of one, two or three nucleotides; two modifications each from one strand fall on the other end of the duplex region, having an overlap of one, two or three nucleotides; two modifications one strand fall on each side of the lead motif, having an overlap of one, two or three nucleotides in the duplex region.

    [0344] In one embodiment, every nucleotide in the sense strand and antisense strand of the RNAi agent, including the nucleotides that are part of the motifs, may be modified. Each nucleotide may be modified with the same or different modification which can include one or more alteration of one or both of the non-linking phosphate oxygens and/or of one or more of the linking phosphate oxygens; alteration of a constituent of the ribose sugar, e.g., of the 2′ hydroxyl on the ribose sugar; wholesale replacement of the phosphate moiety with “dephospho” linkers; modification or replacement of a naturally occurring base; and replacement or modification of the ribose-phosphate backbone.

    [0345] As nucleic acids are polymers of subunits, many of the modifications occur at a position which is repeated within a nucleic acid, e.g., a modification of a base, or a phosphate moiety, or a non-linking O of a phosphate moiety. In some cases the modification will occur at all of the subject positions in the nucleic acid but in many cases it will not. By way of example, a modification may only occur at a 3′ or 5′ terminal position, may only occur in a terminal region, e.g., at a position on a terminal nucleotide or in the last 2, 3, 4, 5, or 10 nucleotides of a strand. A modification may occur in a double strand region, a single strand region, or in both. A modification may occur only in the double strand region of a RNA or may only occur in a single strand region of a RNA. For example, a phosphorothioate modification at a non-linking O position may only occur at one or both termini, may only occur in a terminal region, e.g., at a position on a terminal nucleotide or in the last 2, 3, 4, 5, or 10 nucleotides of a strand, or may occur in double strand and single strand regions, particularly at termini. The 5′ end or ends can be phosphorylated.

    [0346] It may be possible, e.g., to enhance stability, to include particular bases in overhangs, or to include modified nucleotides or nucleotide surrogates, in single strand overhangs, e.g., in a 5′ or 3′ overhang, or in both. For example, it can be desirable to include purine nucleotides in overhangs. In some embodiments all or some of the bases in a 3′ or 5′ overhang may be modified, e.g., with a modification described herein. Modifications can include, e.g., the use of modifications at the 2′ position of the ribose sugar with modifications that are known in the art, e.g., the use of deoxyribonucleotides, 2′-deoxy-2′-fluoro (2′-F) or 2′-O-methyl modified instead of the ribosugar of the nucleobase, and modifications in the phosphate group, e.g., phosphorothioate modifications. Overhangs need not be homologous with the target sequence.

    [0347] In one embodiment, each residue of the sense strand and antisense strand is independently modified with LNA, CRN, cET, UNA, HNA, CeNA, 2′-methoxyethyl, 2′-O-methyl, 2′-O-allyl, 2′-C— allyl, 2′-deoxy, 2′-hydroxyl, or 2′-fluoro. The strands can contain more than one modification. In one embodiment, each residue of the sense strand and antisense strand is independently modified with 2′-O-methyl or 2′-fluoro.

    [0348] At least two different modifications are typically present on the sense strand and antisense strand. Those two modifications may be the 2′-O-methyl or 2′-fluoro modifications, or others.

    [0349] In one embodiment, the N.sub.a and/or N.sub.b comprise modifications of an alternating pattern. The term “alternating motif” as used herein refers to a motif having one or more modifications, each modification occurring on alternating nucleotides of one strand. The alternating nucleotide may refer to one per every other nucleotide or one per every three nucleotides, or a similar pattern. For example, if A, B and C each represent one type of modification to the nucleotide, the alternating motif can be “ABABABABABAB . . . ,” “AABBAABBAABB . . . ,” “AABAABAABAAB . . . ,” “AAABAAABAAAB . . . ,” “AAABBBAAABBB . . . ,” or “ABCABCABCABC . . . ,” etc.

    [0350] The type of modifications contained in the alternating motif may be the same or different. For example, if A, B, C, D each represent one type of modification on the nucleotide, the alternating pattern, i.e., modifications on every other nucleotide, may be the same, but each of the sense strand or antisense strand can be selected from several possibilities of modifications within the alternating motif such as “ABABAB . . . ”, “ACACAC . . . ” “BDBDBD . . . ” or “CDCDCD . . . ,” etc.

    [0351] In one embodiment, the RNAi agent of the invention comprises the modification pattern for the alternating motif on the sense strand relative to the modification pattern for the alternating motif on the antisense strand is shifted. The shift may be such that the modified group of nucleotides of the sense strand corresponds to a differently modified group of nucleotides of the antisense strand and vice versa. For example, the sense strand when paired with the antisense strand in the dsRNA duplex, the alternating motif in the sense strand may start with “ABABAB” from 5′-3′ of the strand and the alternating motif in the antisense strand may start with “BABABA” from 5′-3′ of the strand within the duplex region. As another example, the alternating motif in the sense strand may start with “AABBAABB” from 5′-3′ of the strand and the alternating motif in the antisenese strand may start with “BBAABBAA” from 5′-3′ of the strand within the duplex region, so that there is a complete or partial shift of the modification patterns between the sense strand and the antisense strand.

    [0352] In one embodiment, the RNAi agent comprises the pattern of the alternating motif of 2′-O-methyl modification and 2′-F modification on the sense strand initially has a shift relative to the pattern of the alternating motif of 2′-O-methyl modification and 2′-F modification on the antisense strand initially, i.e., the 2′-O-methyl modified nucleotide on the sense strand base pairs with a 2′-F modified nucleotide on the antisense strand and vice versa. The 1 position of the sense strand may start with the 2′-F modification, and the 1 position of the antisense strand may start with the 2′-O-methyl modification.

    [0353] The introduction of one or more motifs of three identical modifications on three consecutive nucleotides to the sense strand and/or antisense strand interrupts the initial modification pattern present in the sense strand and/or antisense strand. This interruption of the modification pattern of the sense and/or antisense strand by introducing one or more motifs of three identical modifications on three consecutive nucleotides to the sense and/or antisense strand surprisingly enhances the gene silencing activity to the target gene.

    [0354] In one embodiment, when the motif of three identical modifications on three consecutive nucleotides is introduced to any of the strands, the modification of the nucleotide next to the motif is a different modification than the modification of the motif. For example, the portion of the sequence containing the motif is “ . . . N.sub.aYYYN.sub.b . . . ,” where “Y” represents the modification of the motif of three identical modifications on three consecutive nucleotide, and “N.sub.a” and “N.sub.b” represent a modification to the nucleotide next to the motif “YYY” that is different than the modification of Y, and where N.sub.a and N.sub.b can be the same or different modifications. Alternatively, N.sub.a and/or N.sub.b may be present or absent when there is a wing modification present.

    [0355] The RNAi agent may further comprise at least one phosphorothioate or methylphosphonate internucleotide linkage. The phosphorothioate or methylphosphonate internucleotide linkage modification may occur on any nucleotide of the sense strand or antisense strand or both strands in any position of the strand. For instance, the internucleotide linkage modification may occur on every nucleotide on the sense strand and/or antisense strand; each internucleotide linkage modification may occur in an alternating pattern on the sense strand and/or antisense strand; or the sense strand or antisense strand may contain both internucleotide linkage modifications in an alternating pattern. The alternating pattern of the internucleotide linkage modification on the sense strand may be the same or different from the antisense strand, and the alternating pattern of the internucleotide linkage modification on the sense strand may have a shift relative to the alternating pattern of the internucleotide linkage modification on the antisense strand. In one embodiment, a double-stranded RNAi agent comprises 6-8phosphorothioate internucleotide linkages. In one embodiment, the antisense strand comprises two phosphorothioate internucleotide linkages at the 5′-terminus and two phosphorothioate internucleotide linkages at the 3′-terminus, and the sense strand comprises at least two phosphorothioate internucleotide linkages at either the 5′-terminus or the 3′-terminus.

    [0356] In one embodiment, the RNAi comprises a phosphorothioate or methylphosphonate internucleotide linkage modification in the overhang region. For example, the overhang region may contain two nucleotides having a phosphorothioate or methylphosphonate internucleotide linkage between the two nucleotides. Internucleotide linkage modifications also may be made to link the overhang nucleotides with the terminal paired nucleotides within the duplex region. For example, at least 2, 3, 4, or all the overhang nucleotides may be linked through phosphorothioate or methylphosphonate internucleotide linkage, and optionally, there may be additional phosphorothioate or methylphosphonate internucleotide linkages linking the overhang nucleotide with a paired nucleotide that is next to the overhang nucleotide. For instance, there may be at least two phosphorothioate internucleotide linkages between the terminal three nucleotides, in which two of the three nucleotides are overhang nucleotides, and the third is a paired nucleotide next to the overhang nucleotide. These terminal three nucleotides may be at the 3′-end of the antisense strand, the 3′-end of the sense strand, the 5′-end of the antisense strand, and/or the 5′end of the antisense strand.

    [0357] In one embodiment, the 2 nucleotide overhang is at the 3′-end of the antisense strand, and there are two phosphorothioate internucleotide linkages between the terminal three nucleotides, wherein two of the three nucleotides are the overhang nucleotides, and the third nucleotide is a paired nucleotide next to the overhang nucleotide. Optionally, the RNAi agent may additionally have two phosphorothioate internucleotide linkages between the terminal three nucleotides at both the 5′-end of the sense strand and at the 5′-end of the antisense strand.

    [0358] In one embodiment, the RNAi agent comprises mismatch(es) with the target, within the duplex, or combinations thereof. The mismatch may occur in the overhang region or the duplex region. The base pair may be ranked on the basis of their propensity to promote dissociation or melting (e.g., on the free energy of association or dissociation of a particular pairing, the simplest approach is to examine the pairs on an individual pair basis, though next neighbor or similar analysis can also be used). In terms of promoting dissociation: A:U is preferred over G:C; G:U is preferred over G:C; and I:C is preferred over G:C (I=inosine). Mismatches, e.g., non-canonical or other than canonical pairings (as described elsewhere herein) are preferred over canonical (A:T, A:U, G:C) pairings; and pairings which include a universal base are preferred over canonical pairings.

    [0359] In one embodiment, the RNAi agent comprises at least one of the first 1, 2, 3, 4, or 5 base pairs within the duplex regions from the 5′-end of the antisense strand independently selected from the group of: A:U, G:U, I:C, and mismatched pairs, e.g., non-canonical or other than canonical pairings or pairings which include a universal base, to promote the dissociation of the antisense strand at the 5′-end of the duplex.

    [0360] In one embodiment, the nucleotide at the 1 position within the duplex region from the 5′-end in the antisense strand is selected from the group consisting of A, dA, dU, U, and dT. Alternatively, at least one of the first 1, 2 or 3 base pair within the duplex region from the 5′-end of the antisense strand is an AU base pair. For example, the first base pair within the duplex region from the 5′-end of the antisense strand is an AU base pair.

    [0361] In another embodiment, the nucleotide at the 3′-end of the sense strand is deoxy-thymine (dT). In another embodiment, the nucleotide at the 3′-end of the antisense strand is deoxy-thymine (dT). In one embodiment, there is a short sequence of deoxy-thymine nucleotides, for example, two dT nucleotides on the 3′-end of the sense and/or antisense strand.

    [0362] In one embodiment, the sense strand sequence may be represented by formula (I):


    5′n.sub.p-N.sub.a—(XXX).sub.i—N.sub.b—YYY—N.sub.b—(ZZZ).sub.j—N.sub.a-n.sub.q3′  (I)

    [0363] wherein:

    [0364] i and j are each independently 0 or 1;

    [0365] p and q are each independently 0-6; [0366] each N.sub.a independently represents an oligonucleotide sequence comprising 0-25 modified nucleotides, each sequence comprising at least two differently modified nucleotides; [0367] each N.sub.b independently represents an oligonucleotide sequence comprising 0-10 modified nucleotides; [0368] each n.sub.p and n.sub.q independently represent an overhang nucleotide; [0369] wherein Nb and Y do not have the same modification; and [0370] XXX, YYY and ZZZ each independently represent one motif of three identical modifications on three consecutive nucleotides. Preferably YYY is all 2′-F modified nucleotides.

    [0371] In one embodiment, the N.sub.a and/or N.sub.b comprise modifications of alternating pattern.

    [0372] In one embodiment, the YYY motif occurs at or near the cleavage site of the sense strand. For example, when the RNAi agent has a duplex region of 17-23 nucleotides in length, the YYY motif can occur at or the vicinity of the cleavage site (e.g.: can occur at positions 6, 7, 8, 7, 8, 9, 8, 9, 10, 9, 10, 11, 10, 11, 12 or 11, 12, 13) of—the sense strand, the count starting from the 1′ nucleotide, from the 5′-end; or optionally, the count starting at the 1 paired nucleotide within the duplex region, from the 5′-end.

    [0373] In one embodiment, i is 1 and j is 0, or i is 0 and j is 1, or both i and j are 1. The sense strand can therefore be represented by the following formulas:


    5′n.sub.p-N.sub.a—YYY—N.sub.b—ZZZ—N.sub.a-n.sub.q3′  (Ib);


    5′n.sub.p-N.sub.a—XXX—N.sub.b—YYY—N.sub.a-n.sub.q3′  (Ic); or


    5′n.sub.p-N.sub.a—XXX—N.sub.b—YYY—N.sub.b—ZZZ—N.sub.a-n.sub.q3′  (Id).

    [0374] When the sense strand is represented by formula (Ib), N.sub.b represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N.sub.a independently can represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

    [0375] When the sense strand is represented as formula (Ic), N.sub.b represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N.sub.a can independently represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

    [0376] When the sense strand is represented as formula (Id), each N.sub.b independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Preferably, N.sub.b is 0, 1, 2, 3, 4, 5 or 6. Each N.sub.a can independently represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

    [0377] Each of X, Y and Z may be the same or different from each other. [0378] In other embodiments, i is 0 and j is 0, and the sense strand may be represented by the formula:


    5′n.sub.p-N.sub.a—YYY—N.sub.a-n.sub.q3′  (Ia).

    [0379] When the sense strand is represented by formula (Ia), each N.sub.a independently can represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

    [0380] In one embodiment, the antisense strand sequence of the RNAi may be represented by formula (II):


    5′n.sub.q′-N.sub.a′—(Z′Z′Z′).sub.k—N.sub.b′—Y′Y′Y′—N.sub.b′—(X′X′X′).sub.l—N′.sub.a-n.sub.p′3′  (II)

    [0381] wherein:

    [0382] k and l are each independently 0 or 1;

    [0383] p′ and q′ are each independently 0-6; [0384] each N.sub.a′ independently represents an oligonucleotide sequence comprising 0-25 modified nucleotides, each sequence comprising at least two differently modified nucleotides; [0385] each N.sub.b′ independently represents an oligonucleotide sequence comprising 0-10 modified nucleotides; [0386] each n.sub.p′ and n.sub.q′ independently represent an overhang nucleotide; [0387] wherein N.sub.b′ and Y′ do not have the same modification; and [0388] X′X′X′, Y′Y′Y′ and Z′Z′Z′ each independently represent one motif of three identical modifications on three consecutive nucleotides.

    [0389] In one embodiment, the N.sub.a′ and/or N.sub.b′ comprise modifications of alternating pattern.

    [0390] The Y′Y′Y′ motif occurs at or near the cleavage site of the antisense strand. For example, when the RNAi agent has a duplex region of 17-23 nucleotide in length, the Y′Y′Y′ motif can occur at positions 9, 10, 11; 10, 11, 12; 11, 12, 13; 12, 13, 14; or 13, 14, 15 of the antisense strand, with the count starting from the 1′ nucleotide, from the 5′-end; or optionally, the count starting at the 1 paired nucleotide within the duplex region, from the 5′-end. Preferably, the Y′Y′Y′ motif occurs at positions 11, 12, 13.

    [0391] In one embodiment, Y′Y′Y′ motif is all 2′-OMe modified nucleotides.

    [0392] In one embodiment, k is 1 and l is 0, or k is 0 and l is 1, or both k and l are 1.

    [0393] The antisense strand can therefore be represented by the following formulas:


    5′n.sub.q′-N.sub.a′—Z′Z′Z′—N.sub.b′—Y′Y′Y′—N.sub.a′-n.sub.p′3′  (IIb);


    5′n.sub.q′-N.sub.a′—Y′Y′Y′—N.sub.b′—X′X′X′-n.sub.p′3′  (IIc); or


    5′n.sub.q′-N.sub.a′—Z′Z′Z′—N.sub.b′—Y′Y′Y′—N.sub.b′—X′X′X′—N.sub.a′-n.sub.p′3′  (IId).

    [0394] When the antisense strand is represented by formula (IIb), N.sub.b′ represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N.sub.a′ independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

    [0395] When the antisense strand is represented as formula (IIc), N.sub.b′ represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N.sub.a′ independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

    [0396] When the antisense strand is represented as formula (IId), each N.sub.b′ independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N.sub.a′ independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides. Preferably, N.sub.b is 0, 1, 2, 3, 4, 5 or 6.

    [0397] In other embodiments, k is 0 and l is 0 and the antisense strand may be represented by the formula:


    5′n.sub.p′-N.sub.a′—Y′Y′Y′—N.sub.a′-n.sub.q′3′  (Ia).

    [0398] When the antisense strand is represented as formula (IIa), each N.sub.a′ independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

    [0399] Each of X′, Y′ and Z′ may be the same or different from each other.

    [0400] Each nucleotide of the sense strand and antisense strand may be independently modified with LNA, CRN, UNA, cEt, HNA, CeNA, 2′-methoxyethyl, 2′-O-methyl, 2′-O-allyl, 2′-C— allyl, 2′-hydroxyl, or 2′-fluoro. For example, each nucleotide of the sense strand and antisense strand is independently modified with 2′-O-methyl or 2′-fluoro. Each X, Y, Z, X′, Y′ and Z′, in particular, may represent a 2′-O-methyl modification or a 2′-fluoro modification.

    [0401] In one embodiment, the sense strand of the RNAi agent may contain YYY motif occurring at 9, 10 and 11 positions of the strand when the duplex region is 21 nt, the count starting from the 1.sup.st nucleotide from the 5′-end, or optionally, the count starting at the 1.sup.st paired nucleotide within the duplex region, from the 5′-end; and Y represents 2′-F modification. The sense strand may additionally contain XXX motif or ZZZ motifs as wing modifications at the opposite end of the duplex region; and XXX and ZZZ each independently represents a 2′-OMe modification or 2′-F modification.

    [0402] In one embodiment the antisense strand may contain Y′Y′Y′ motif occurring at positions 11, 12, 13 of the strand, the count starting from the 1st nucleotide from the 5′ end, or optionally, the count starting at the 1st paired nucleotide within the duplex region, from the 5′-end; and Y′ represents 2′-O-methyl modification. The antisense strand may additionally contain X′X′X′ motif or Z′Z′Z′ motifs as wing modifications at the opposite end of the duplex region; and X′X′X′ and Z′Z′Z′ each independently represents a 2′-OMe modification or 2′-F modification.

    [0403] The sense strand represented by any one of the above formulas (Ia), (Ib), (Ic), and (Id) forms a duplex with a antisense strand being represented by any one of formulas (IIa), (IIb), (IIc), and (IId), respectively.

    [0404] Accordingly, the RNAi agents for use in the methods of the invention may comprise a sense strand and an antisense strand, each strand having 14 to 30 nucleotides, the RNAi duplex represented by formula (III):


    sense: 5′np-Na-(XXX)i-Nb-YYY—Nb-(ZZZ)j-Na-nq3′


    antisense: 3′np′-Na′-(X′X′X′)k-Nb′—Y′Y′Y′—Nb′—(Z′Z′Z′)l-Na′-nq′5′   (III)

    [0405] wherein:

    [0406] i, j, k, and l are each independently 0 or 1;

    [0407] p, p′, q, and q′ are each independently 0-6; [0408] each Na and Na′ independently represents an oligonucleotide sequence comprising 0-25 modified nucleotides, each sequence comprising at least two differently modified nucleotides; [0409] each Nb and Nb′ independently represents an oligonucleotide sequence comprising 0-10 modified nucleotides; [0410] wherein each np′, np, nq′, and nq, each of which may or may not be present, independently represents an overhang nucleotide; and [0411] XXX, YYY, ZZZ, X′X′X′, Y′Y′Y′, and Z′Z′Z′ each independently represent one motif of three identical modifications on three consecutive nucleotides.

    [0412] In one embodiment, i is 0 and j is 0; or i is 1 and j is 0; or i is 0 and j is 1; or both i and j are 0; or both i and j are 1. In another embodiment, k is 0 and l is 0; or k is 1 and l is 0; k is 0 and l is 1; or both k and l are 0; or both k and l are 1.

    [0413] Exemplary combinations of the sense strand and antisense strand forming a RNAi duplex include the formulas below:


    5′np-Na-YYY—Na-nq3′


    3′np′-Na′-Y′Y′Y′—Na′nq′5′   (IIIa)


    5′np-Na-YYY—Nb-ZZZ—Na-nq3′


    3′np′-Na′-Y′Y′Y′—Nb′-Z′Z′Z′—Na′nq′5′   (IIIb)


    5′np-Na-XXX—Nb-YYY—Na-nq3′


    3′np′-Na′-X′X′X′—Nb′-Y′Y′Y′—Na′-nq′5′   (IIIc)


    5′np-Na-XXX—Nb-YYY—Nb-ZZZ—Na-nq3′


    3′np′-Na′-X′X′X′—Nb′-Y′Y′Y′—Nb′-Z′Z′Z′—Na-nq′5′   (IIId)

    [0414] When the RNAi agent is represented by formula (IIIa), each Na independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

    [0415] When the RNAi agent is represented by formula (IIIb), each Nb independently represents an oligonucleotide sequence comprising 1-10, 1-7, 1-5 or 1-4 modified nucleotides. Each Na independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

    [0416] When the RNAi agent is represented as formula (IIIc), each Nb, Nb′ independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each Na independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

    [0417] When the RNAi agent is represented as formula (IIId), each Nb, Nb′ independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each Na, Na′ independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides. Each of Na, Na′, Nb and Nb′ independently comprises modifications of alternating pattern.

    [0418] Each of X, Y and Z in formulas (III), (IIIa), (IIIb), (IIIc), and (IIId) may be the same or different from each other.

    [0419] When the RNAi agent is represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId), at least one of the Y nucleotides may form a base pair with one of the Y′ nucleotides. Alternatively, at least two of the Y nucleotides form base pairs with the corresponding Y′ nucleotides; or all three of the Y nucleotides all form base pairs with the corresponding Y′ nucleotides.

    [0420] When the RNAi agent is represented by formula (IIIb) or (IIId), at least one of the Z nucleotides may form a base pair with one of the Z′ nucleotides. Alternatively, at least two of the Z nucleotides form base pairs with the corresponding Z′ nucleotides; or all three of the Z nucleotides all form base pairs with the corresponding Z′ nucleotides.

    [0421] When the RNAi agent is represented as formula (IIIc) or (IIId), at least one of the X nucleotides may form a base pair with one of the X′ nucleotides. Alternatively, at least two of the X nucleotides form base pairs with the corresponding X′ nucleotides; or all three of the X nucleotides all form base pairs with the corresponding X′ nucleotides.

    [0422] In one embodiment, the modification on the Y nucleotide is different than the modification on the Y′ nucleotide, the modification on the Z nucleotide is different than the modification on the Z′ nucleotide, and/or the modification on the X nucleotide is different than the modification on the X′ nucleotide.

    [0423] In one embodiment, when the RNAi agent is represented by formula (IIId), the Na modifications are 2′-O-methyl or 2′-fluoro modifications. In another embodiment, when the RNAi agent is represented by formula (IIId), the Na modifications are 2′-O-methyl or 2′-fluoro modifications and np′>0 and at least one np′ is linked to a neighboring nucleotide a via phosphorothioate linkage. In yet another embodiment, when the RNAi agent is represented by formula (IIId), the N.sub.a modifications are 2′-O-methyl or 2′-fluoro modifications, np′>0 and at least one np′ is linked to a neighboring nucleotide via phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives attached through a bivalent or trivalent branched linker (described below). In another embodiment, when the RNAi agent is represented by formula (IIId), the N.sub.a modifications are 2′-O-methyl or 2′-fluoro modifications, np′>0 and at least one np′ is linked to a neighboring nucleotide via phosphorothioate linkage, the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives attached through a bivalent or trivalent branched linker.

    [0424] In one embodiment, when the RNAi agent is represented by formula (IIIa), the Na modifications are 2′-O-methyl or 2′-fluoro modifications, np′>0 and at least one np′ is linked to a neighboring nucleotide via phosphorothioate linkage, the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives attached through a bivalent or trivalent branched linker.

    [0425] In one embodiment, the RNAi agent is a multimer containing at least two duplexes represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId), wherein the duplexes are connected by a linker. The linker can be cleavable or non-cleavable. Optionally, the multimer further comprises a ligand. Each of the duplexes can target the same gene or two different genes; or each of the duplexes can target same gene at two different target sites.

    [0426] In one embodiment, the RNAi agent is a multimer containing three, four, five, six or more duplexes represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId), wherein the duplexes are connected by a linker. The linker can be cleavable or non-cleavable. Optionally, the multimer further comprises a ligand. Each of the duplexes can target the same gene or two different genes; or each of the duplexes can target same gene at two different target sites.

    [0427] In one embodiment, two RNAi agents represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId) are linked to each other at the 5′ end, and one or both of the 3′ ends and are optionally conjugated to to a ligand. Each of the agents can target the same gene or two different genes; or each of the agents can target same gene at two different target sites.

    [0428] In certain embodiments, an RNAi agent of the invention may contain a low number of nucleotides containing a 2′-fluoro modification, e.g., 10 or fewer nucleotides with 2′-fluoro modification. For example, the RNAi agent may contain 10, 9, 8, 7, 6, 5, 4, 3, 2, 1 or 0 nucleotides with a 2′-fluoro modification. In a specific embodiment, the RNAi agent of the invention contains 10 nucleotides with a 2′-fluoro modification, e.g., 4 nucleotides with a 2′-fluoro modification in the sense strand and 6 nucleotides with a 2′-fluoro modification in the antisense strand. In another specific embodiment, the RNAi agent of the invention contains 6 nucleotides with a 2′-fluoro modification, e.g., 4 nucleotides with a 2′-fluoro modification in the sense strand and 2 nucleotides with a 2′-fluoro modification in the antisense strand.

    [0429] In other embodiments, an RNAi agent of the invention may contain an ultra low number of nucleotides containing a 2′-fluoro modification, e.g., 2 or fewer nucleotides containing a 2′-fluoro modification. For example, the RNAi agent may contain 2, 1 of 0 nucleotides with a 2′-fluoro modification. In a specific embodiment, the RNAi agent may contain 2 nucleotides with a 2′-fluoro modification, e.g., 0 nucleotides with a 2-fluoro modification in the sense strand and 2 nucleotides with a 2′-fluoro modification in the antisense strand.

    [0430] Various publications describe multimeric RNAi agents that can be used in the methods of the invention. Such publications include WO2007/091269, U.S. Pat. No. 7,858,769, WO2010/141511, WO2007/117686, WO2009/014887 and WO2011/031520 the entire contents of each of which are hereby incorporated herein by reference.

    [0431] As described in more detail below, the RNAi agent that contains conjugations of one or more carbohydrate moieties to a RNAi agent can optimize one or more properties of the RNAi agent. In many cases, the carbohydrate moiety will be attached to a modified subunit of the RNAi agent. For example, the ribose sugar of one or more ribonucleotide subunits of a dsRNA agent can be replaced with another moiety, e.g., a non-carbohydrate (preferably cyclic) carrier to which is attached a carbohydrate ligand. A ribonucleotide subunit in which the ribose sugar of the subunit has been so replaced is referred to herein as a ribose replacement modification subunit (RRMS). A cyclic carrier may be a carbocyclic ring system, i.e., all ring atoms are carbon atoms, or a heterocyclic ring system, i.e., one or more ring atoms may be a heteroatom, e.g., nitrogen, oxygen, sulfur. The cyclic carrier may be a monocyclic ring system, or may contain two or more rings, e.g. fused rings. The cyclic carrier may be a fully saturated ring system, or it may contain one or more double bonds.

    [0432] The ligand may be attached to the polynucleotide via a carrier. The carriers include (i) at least one “backbone attachment point,” preferably two “backbone attachment points” and (ii) at least one “tethering attachment point.” A “backbone attachment point” as used herein refers to a functional group, e.g. a hydroxyl group, or generally, a bond available for, and that is suitable for incorporation of the carrier into the backbone, e.g., the phosphate, or modified phosphate, e.g., sulfur containing, backbone, of a ribonucleic acid. A “tethering attachment point” (TAP) in some embodiments refers to a constituent ring atom of the cyclic carrier, e.g., a carbon atom or a heteroatom (distinct from an atom which provides a backbone attachment point), that connects a selected moiety. The moiety can be, e.g., a carbohydrate, e.g. monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide and polysaccharide. Optionally, the selected moiety is connected by an intervening tether to the cyclic carrier. Thus, the cyclic carrier will often include a functional group, e.g., an amino group, or generally, provide a bond, that is suitable for incorporation or tethering of another chemical entity, e.g., a ligand to the constituent ring.

    [0433] The RNAi agents may be conjugated to a ligand via a carrier, wherein the carrier can be cyclic group or acyclic group; preferably, the cyclic group is selected from pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [1,3]dioxolane, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuryl and and decalin; preferably, the acyclic group is selected from serinol backbone or diethanolamine backbone.

    [0434] In another embodiment of the invention, an iRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides. The RNAi agent may be represented by formula (L):

    ##STR00006##

    [0435] In formula (L), B1, B2, B3, B1′, B2′, B3′, and B4′ each are independently a nucleotide containing a modification selected from the group consisting of 2′-O-alkyl, 2′-substituted alkoxy, 2′-substituted alkyl, 2′-halo, ENA, and BNA/LNA. In one embodiment, B1, B2, B3, B1′, B2′, B3′, and B4′ each contain 2′-OMe modifications. In one embodiment, B1, B2, B3, B1′, B2′, B3′, and B4′ each contain 2′-OMe or 2′-F modifications. In one embodiment, at least one of B1, B2, B3, B1′, B2′, B3′, and B4′ contain 2′-O—N-methylacetamido (2′-O-NMA) modification.

    [0436] C1 is a thermally destabilizing nucleotide placed at a site opposite to the seed region of the antisense strand (i.e., at positions 2-8 of the 5′-end of the antisense strand). For example, C1 is at a position of the sense strand that pairs with a nucleotide at positions 2-8 of the 5′-end of the antisense strand. In one example, C1 is at position 15 from the 5′-end of the sense strand. C1 nucleotide bears the thermally destabilizing modification which can include abasic modification; mismatch with the opposing nucleotide in the duplex; and sugar modification such as 2′-deoxy modification or acyclic nucleotide e.g., unlocked nucleic acids (UNA) or glycerol nucleic acid (GNA). In one embodiment, C1 has thermally destabilizing modification selected from the group consisting of: i) mismatch with the opposing nucleotide in the antisense strand; ii) abasic modification selected from the group consisting of:

    ##STR00007##

    and iii) sugar modification selected from the group consisting of:

    ##STR00008##

    herein B is a modified or unmodified nucleobase, R.sup.1 and R.sup.2 independently are H, halogen, OR.sub.3, or alkyl; and R.sub.3 is H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or sugar. In one embodiment, the thermally destabilizing modification in C1 is a mismatch selected from the group consisting of G:G, G:A, G:U, G:T, A:A, A:C, C:C, C:U, C:T, U:U, T:T, and U:T; and optionally, at least one nucleobase in the mismatch pair is a 2′-deoxy nucleobase. In one example, the thermally destabilizing modification in C1 is GNA or

    ##STR00009##

    [0437] T1, T1′, T2′, and T3′ each independently represent a nucleotide comprising a modification providing the nucleotide a steric bulk that is less or equal to the steric bulk of a 2′-OMe modification. A steric bulk refers to the sum of steric effects of a modification. Methods for determining steric effects of a modification of a nucleotide are known to one skilled in the art. The modification can be at the 2′ position of a ribose sugar of the nucleotide, or a modification to a non-ribose nucleotide, acyclic nucleotide, or the backbone of the nucleotide that is similar or equivalent to the 2′ position of the ribose sugar, and provides the nucleotide a steric bulk that is less than or equal to the steric bulk of a 2′-OMe modification. For example, T1, T1′, T2′, and T3′ are each independently selected from DNA, RNA, LNA, 2′-F, and 2′-F-5′-methyl. In one embodiment, T1 is DNA. In one embodiment, T1′ is DNA, RNA or LNA. In one embodiment, T2′ is DNA or RNA. In one embodiment, T3′ is DNA or RNA.

    [0438] n.sup.1, n.sup.3, and q.sup.1 are independently 4 to 15 nucleotides in length.

    [0439] n.sup.5, q.sup.3, and q.sup.7 are independently 1-6 nucleotide(s) in length.

    [0440] n.sup.4, q.sup.2, and q.sup.6 are independently 1-3 nucleotide(s) in length; alternatively, n.sup.4 is 0.

    [0441] q.sup.5 is independently 0-10 nucleotide(s) in length.

    [0442] n.sup.2 and q.sup.4 are independently 0-3 nucleotide(s) in length.

    [0443] Alternatively, n.sup.4 is 0-3 nucleotide(s) in length.

    [0444] In one embodiment, n.sup.4 can be 0. In one example, n.sup.4 is 0, and q.sup.2 and q.sup.6 are 1. In another example, n.sup.4 is 0, and q.sup.2 and q.sup.6 are 1, with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand).

    [0445] In one embodiment, n.sup.4, q.sup.2, and q.sup.6 are each 1.

    [0446] In one embodiment, n.sup.2, n.sup.4, q.sup.2, q.sup.4, and q.sup.6 are each 1.

    [0447] In one embodiment, C1 is at position 14-17 of the 5′-end of the sense strand, when the sense strand is 19-22 nucleotides in length, and n.sup.4 is 1. In one embodiment, C1 is at position 15 of the 5′-end of the sense strand

    [0448] In one embodiment, T3′ starts at position 2 from the 5′ end of the antisense strand. In one example, T3′ is at position 2 from the 5′ end of the antisense strand and q.sup.6 is equal to 1.

    [0449] In one embodiment, T1′ starts at position 14 from the 5′ end of the antisense strand. In one example, T1′ is at position 14 from the 5′ end of the antisense strand and q.sup.2 is equal to 1.

    [0450] In an exemplary embodiment, T3′ starts from position 2 from the 5′ end of the antisense strand and T1′ starts from position 14 from the 5′ end of the antisense strand. In one example, T3′ starts from position 2 from the 5′ end of the antisense strand and q.sup.6 is equal to 1 and T1′ starts from position 14 from the 5′ end of the antisense strand and q.sup.2 is equal to 1.

    [0451] In one embodiment, T1′ and T3′ are separated by 11 nucleotides in length (i.e. not counting the T1′ and T3′ nucleotides).

    [0452] In one embodiment, T1′ is at position 14 from the 5′ end of the antisense strand. In one example, T1′ is at position 14 from the 5′ end of the antisense strand and q.sup.2 is equal to 1, and the modification at the 2′ position or positions in a non-ribose, acyclic or backbone that provide less steric bulk than a 2′-OMe ribose.

    [0453] In one embodiment, T3′ is at position 2 from the 5′ end of the antisense strand. In one example, T3′ is at position 2 from the 5′ end of the antisense strand and q.sup.6 is equal to 1, and the modification at the 2′ position or positions in a non-ribose, acyclic or backbone that provide less than or equal to steric bulk than a 2′-OMe ribose.

    [0454] In one embodiment, T1 is at the cleavage site of the sense strand. In one example, T1 is at position 11 from the 5′ end of the sense strand, when the sense strand is 19-22 nucleotides in length, and n.sup.2 is 1. In an exemplary embodiment, T1 is at the cleavage site of the sense strand at position 11 from the 5′ end of the sense strand, when the sense strand is 19-22 nucleotides in length, and n.sup.2 is 1,

    [0455] In one embodiment, T2′ starts at position 6 from the 5′ end of the antisense strand. In one example, T2′ is at positions 6-10 from the 5′ end of the antisense strand, and q.sup.4 is 1.

    [0456] In an exemplary embodiment, T1 is at the cleavage site of the sense strand, for instance, at position 11 from the 5′ end of the sense strand, when the sense strand is 19-22 nucleotides in length, and n.sup.2 is 1; T1′ is at position 14 from the 5′ end of the antisense strand, and q.sup.2 is equal to 1, and the modification to T1′ is at the 2′ position of a ribose sugar or at positions in a non-ribose, acyclic or backbone that provide less steric bulk than a 2′-OMe ribose; T2′ is at positions 6-10 from the 5′ end of the antisense strand, and q.sup.4 is 1; and T3′ is at position 2 from the 5′ end of the antisense strand, and q.sup.6 is equal to 1, and the modification to T3′ is at the 2′ position or at positions in a non-ribose, acyclic or backbone that provide less than or equal to steric bulk than a 2′-OMe ribose.

    [0457] In one embodiment, T2′ starts at position 8 from the 5′ end of the antisense strand. In one example, T2′ starts at position 8 from the 5′ end of the antisense strand, and q.sup.4 is 2.

    [0458] In one embodiment, T2′ starts at position 9 from the 5′ end of the antisense strand. In one example, T2′ is at position 9 from the 5′ end of the antisense strand, and q.sup.4 is 1.

    [0459] In one embodiment, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, T2′ is 2′-F, q.sup.4 is 1, B3′ is 2′-OMe or 2′-F, q.sup.5 is 6, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-OMe, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand).

    [0460] In one embodiment, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, T2′ is 2′-F, q.sup.4 is 1, B3′ is 2′-OMe or 2′-F, q.sup.5 is 6, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-OMe, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand).

    [0461] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, T2′ is 2′-F, q.sup.4 is 2, B3′ is 2′-OMe or 2′-F, q.sup.5 is 5, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-OMe, and q.sup.7 is 1.

    [0462] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, T2′ is 2′-F, q.sup.4 is 2, B3′ is 2′-OMe or 2′-F, q.sup.5 is 5, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-OMe, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand).

    [0463] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 6, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 7, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, T2′ is 2′-F, q.sup.4 is 2, B3′ is 2′-OMe or 2′-F, q.sup.5 is 5, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-OMe, and q.sup.7 is 1.

    [0464] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 6, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 7, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, T2′ is 2′-F, q.sup.4 is 2, B3′ is 2′-OMe or 2′-F, q.sup.5 is 5, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-OMe, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand).

    [0465] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, T2′ is 2′-F, q.sup.4 is 1, B3′ is 2′-OMe or 2′-F, q.sup.5 is 6, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-OMe, and q.sup.7 is 1.

    [0466] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, T2′ is 2′-F, q.sup.4 is 1, B3′ is 2′-OMe or 2′-F, q.sup.5 is 6, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-OMe, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand).

    [0467] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 5, T2′ is 2′-F, q.sup.4 is 1, B3′ is 2′-OMe or 2′-F, q.sup.5 is 5, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-OMe, and q.sup.7 is 1; optionally with at least 2 additional TT at the 3′-end of the antisense strand.

    [0468] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 5, T2′ is 2′-F, q.sup.4 is 1, B3′ is 2′-OMe or 2′-F, q.sup.5 is 5, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-OMe, and q.sup.7 is 1; optionally with at least 2 additional TT at the 3′-end of the antisense strand; with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand).

    [0469] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, q.sup.4 is 0, B3′ is 2′-OMe or 2′-F, q.sup.5 is 7, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′- OMe, and q.sup.7 is 1.

    [0470] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, q.sup.4 is 0, B3′ is 2′-OMe or 2′-F, q.sup.5 is 7, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′- OMe, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5′-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end).

    [0471] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, T2′ is 2′-F, q.sup.4 is 2, B3′ is 2′-OMe or 2′-F, q.sup.5 is 5, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-F, and q.sup.7 is 1.

    [0472] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, T2′ is 2′-F, q.sup.4 is 2, B3′ is 2′-OMe or 2′-F, q.sup.5 is 5, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-F, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand).

    [0473] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, q.sup.4 is 0, B3′ is 2′-OMe or 2′-F, q.sup.5 is 7, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-F, and q.sup.7 is 1.

    [0474] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, q.sup.4 is 0, B3′ is 2′-OMe or 2′-F, q.sup.5 is 7, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-F, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand).

    [0475] The RNAi agent can comprise a phosphorus-containing group at the 5′-end of the sense strand or antisense strand. The 5′-end phosphorus-containing group can be 5′-end phosphate (5′-P), 5′-end phosphorothioate (5′-PS), 5′-end phosphorodithioate (5′-PS.sub.2), 5′-end vinylphosphonate (5′-VP), 5′-end methylphosphonate (MePhos), or 5′-deoxy-5′-C-malonyl

    ##STR00010##

    When the 5′-end phosphorus-containing group is 5′-end vinylphosphonate (5′-VP), the 5′-VP can be either 5′-E-VP isomer (i.e., trans-vinylphosphate,

    ##STR00011##

    5′-Z-VP isomer (i.e., cis-vinylphosphate,

    ##STR00012##

    or mixtures thereof.

    [0476] In one embodiment, the RNAi agent comprises a phosphorus-containing group at the 5′-end of the sense strand. In one embodiment, the RNAi agent comprises a phosphorus-containing group at the 5′-end of the antisense strand.

    [0477] In one embodiment, the RNAi agent comprises a 5′-P. In one embodiment, the RNAi agent comprises a 5′-P in the antisense strand.

    [0478] In one embodiment, the RNAi agent comprises a 5′-PS. In one embodiment, the RNAi agent comprises a 5′-PS in the antisense strand.

    [0479] In one embodiment, the RNAi agent comprises a 5′-VP. In one embodiment, the RNAi agent comprises a 5′-VP in the antisense strand. In one embodiment, the RNAi agent comprises a 5′-E-VP in the antisense strand. In one embodiment, the RNAi agent comprises a 5′-Z-VP in the antisense strand.

    [0480] In one embodiment, the RNAi agent comprises a 5′-PS.sub.2. In one embodiment, the RNAi agent comprises a 5′-PS.sub.2 in the antisense strand.

    [0481] In one embodiment, the RNAi agent comprises a 5′-PS.sub.2. In one embodiment, the RNAi agent comprises a 5′-deoxy-5′-C-malonyl in the antisense strand.

    [0482] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, T2′ is 2′-F, q.sup.4 is 2, B3′ is 2′-OMe or 2′-F, q.sup.5 is 5, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-OMe, and q.sup.7 is 1. The RNAi agent also comprises a 5′-PS.

    [0483] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, T2′ is 2′-F, q.sup.4 is 2, B3′ is 2′-OMe or 2′-F, q.sup.5 is 5, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-OMe, and q.sup.7 is 1. The RNAi agent also comprises a 5′-P.

    [0484] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, T2′ is 2′-F, q.sup.4 is 2, B3′ is 2′-OMe or 2′-F, q.sup.5 is 5, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-OMe, and q.sup.7 is 1. The RNAi agent also comprises a 5′-VP. The 5′-VP may be 5′-E-VP, 5′-Z-VP, or combination thereof.

    [0485] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, T2′ is 2′-F, q.sup.4 is 2, B3′ is 2′-OMe or 2′-F, q.sup.5 is 5, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-OMe, and q.sup.7 is 1. The RNAi agent also comprises a 5′-PS.sub.2.

    [0486] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, T2′ is 2′-F, q.sup.4 is 2, B3′ is 2′-OMe or 2′-F, q.sup.5 is 5, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-OMe, and q.sup.7 is 1. The RNAi agent also comprises a 5′-deoxy-5′-C-malonyl.

    [0487] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, T2′ is 2′-F, q.sup.4 is 2, B3′ is 2′-OMe or 2′-F, q.sup.5 is 5, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-OMe, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-P.

    [0488] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, T2′ is 2′-F, q.sup.4 is 2, B3′ is 2′-OMe or 2′-F, q.sup.5 is 5, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-OMe, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-PS.

    [0489] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, T2′ is 2′-F, q.sup.4 is 2, B3′ is 2′-OMe or 2′-F, q.sup.5 is 5, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-OMe, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-VP. The 5′-VP may be 5′-E-VP, 5′-Z-VP, or combination thereof.

    [0490] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, T2′ is 2′-F, q.sup.4 is 2, B3′ is 2′-OMe or 2′-F, q.sup.5 is 5, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-OMe, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-PS.sub.2.

    [0491] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, T2′ is 2′-F, q.sup.4 is 2, B3′ is 2′-OMe or 2′-F, q.sup.5 is 5, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-OMe, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-deoxy-5′-C-malonyl.

    [0492] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, q.sup.4 is 0, B3′ is 2′-OMe or 2′-F, q.sup.5 is 7, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′- OMe, and q.sup.7 is 1. The RNAi agent also comprises a 5′-P.

    [0493] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, q.sup.4 is 0, B3′ is 2′-OMe or 2′-F, q.sup.5 is 7, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′- OMe, and q.sup.7 is 1. The dsRNA agent also comprises a 5′-PS.

    [0494] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, q.sup.4 is 0, B3′ is 2′-OMe or 2′-F, q.sup.5 is 7, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′- OMe, and q.sup.7 is 1. The RNAi agent also comprises a 5′-VP. The 5′-VP may be 5′-E-VP, 5′-Z-VP, or combination thereof.

    [0495] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, q.sup.4 is 0, B3′ is 2′-OMe or 2′-F, q.sup.5 is 7, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′- OMe, and q.sup.7 is 1. The RNAi agent also comprises a 5′-PS.sub.2.

    [0496] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, q.sup.4 is 0, B3′ is 2′-OMe or 2′-F, q.sup.5 is 7, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′- OMe, and q.sup.7 is 1. The RNAi agent also comprises a 5′-deoxy-5′-C-malonyl.

    [0497] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, q.sup.4 is 0, B3′ is 2′-OMe or 2′-F, q.sup.5 is 7, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′- OMe, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end). The RNAi agent also comprises a 5′-P.

    [0498] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, q.sup.4 is 0, B3′ is 2′-OMe or 2′-F, q.sup.5 is 7, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′- OMe, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end). The RNAi agent also comprises a 5′-PS.

    [0499] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, q.sup.4 is 0, B3′ is 2′-OMe or 2′-F, q.sup.5 is 7, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′- OMe, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end). The RNAi agent also comprises a 5′-VP. The 5′-VP may be 5′-E-VP, 5′-Z-VP, or combination thereof.

    [0500] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, q.sup.4 is 0, B3′ is 2′-OMe or 2′-F, q.sup.5 is 7, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′- OMe, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end). The RNAi agent also comprises a 5′-PS.sub.2.

    [0501] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, q.sup.4 is 0, B3′ is 2′-OMe or 2′-F, q.sup.5 is 7, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′- OMe, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end). The RNAi agent also comprises a 5′-deoxy-5′-C-malonyl.

    [0502] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, T2′ is 2′-F, q.sup.4 is 2, B3′ is 2′-OMe or 2′-F, q.sup.5 is 5, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-F, and q.sup.7 is 1. The RNAi agent also comprises a 5′-P.

    [0503] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, T2′ is 2′-F, q.sup.4 is 2, B3′ is 2′-OMe or 2′-F, q.sup.5 is 5, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-F, and q.sup.7 is 1. The RNAi agent also comprises a 5′-PS.

    [0504] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, T2′ is 2′-F, q.sup.4 is 2, B3′ is 2′-OMe or 2′-F, q.sup.5 is 5, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-F, and q.sup.7 is 1. The RNAi agent also comprises a 5′-VP. The 5′-VP may be 5′-E-VP, 5′-Z-VP, or combination thereof.

    [0505] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, T2′ is 2′-F, q.sup.4 is 2, B3′ is 2′-OMe or 2′-F, q.sup.5 is 5, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-F, and q.sup.7 is 1. The dsRNAi RNA agent also comprises a 5′-PS.sub.2.

    [0506] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, T2′ is 2′-F, q.sup.4 is 2, B3′ is 2′-OMe or 2′-F, q.sup.5 is 5, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-F, and q.sup.7 is 1. The RNAi agent also comprises a 5′-deoxy-5′-C-malonyl.

    [0507] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, T2′ is 2′-F, q.sup.4 is 2, B3′ is 2′-OMe or 2′-F, q.sup.5 is 5, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-F, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-P.

    [0508] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, T2′ is 2′-F, q.sup.4 is 2, B3′ is 2′-OMe or 2′-F, q.sup.5 is 5, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-F, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-PS.

    [0509] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, T2′ is 2′-F, q.sup.4 is 2, B3′ is 2′-OMe or 2′-F, q.sup.5 is 5, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-F, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-VP. The 5′-VP may be 5′-E-VP, 5′-Z-VP, or combination thereof.

    [0510] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, T2′ is 2′-F, q.sup.4 is 2, B3′ is 2′-OMe or 2′-F, q.sup.5 is 5, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-F, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-PS.sub.2.

    [0511] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, T2′ is 2′-F, q.sup.4 is 2, B3′ is 2′-OMe or 2′-F, q.sup.5 is 5, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-F, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-deoxy-5′-C-malonyl.

    [0512] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, q.sup.4 is 0, B3′ is 2′-OMe or 2′-F, q.sup.5 is 7, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-F, and q.sup.7 is 1. The RNAi agent also comprises a 5′-P.

    [0513] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, q.sup.4 is 0, B3′ is 2′-OMe or 2′-F, q.sup.5 is 7, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-F, and q.sup.7 is 1. The RNAi agent also comprises a 5′-PS.

    [0514] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, q.sup.4 is 0, B3′ is 2′-OMe or 2′-F, q.sup.5 is 7, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-F, and q.sup.7 is 1. The RNAi agent also comprises a 5′-VP. The 5′-VP may be 5′-E-VP, 5′-Z-VP, or combination thereof.

    [0515] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, q.sup.4 is 0, B3′ is 2′-OMe or 2′-F, q.sup.5 is 7, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-F, and q.sup.7 is 1. The RNAi agent also comprises a 5′-PS.sub.2.

    [0516] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, q.sup.4 is 0, B3′ is 2′-OMe or 2′-F, q.sup.5 is 7, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-F, and q.sup.7 is 1. The RNAi agent also comprises a 5′-deoxy-5′-C-malonyl.

    [0517] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, q.sup.4 is 0, B3′ is 2′-OMe or 2′-F, q.sup.5 is 7, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-F, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-P.

    [0518] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, q.sup.4 is 0, B3′ is 2′-OMe or 2′-F, q.sup.5 is 7, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-F, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-PS.

    [0519] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, q.sup.4 is 0, B3′ is 2′-OMe or 2′-F, q.sup.5 is 7, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-F, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-VP. The 5′-VP may be 5′-E-VP, 5′-Z-VP, or combination thereof.

    [0520] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, q.sup.4 is 0, B3′ is 2′-OMe or 2′-F, q.sup.5 is 7, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-F, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-PS.sub.2.

    [0521] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, q.sup.4 is 0, B3′ is 2′-OMe or 2′-F, q.sup.5 is 7, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-F, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-deoxy-5′-C-malonyl.

    [0522] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, T2′ is 2′-F, q.sup.4 is 2, B3′ is 2′-OMe or 2′-F, q.sup.5 is 5, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-OMe, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-P and a targeting ligand. In one embodiment, the 5′-P is at the 5′-end of the antisense strand, and the targeting ligand is at the 3′-end of the sense strand.

    [0523] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, T2′ is 2′-F, q.sup.4 is 2, B3′ is 2′-OMe or 2′-F, q.sup.5 is 5, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-OMe, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-PS and a targeting ligand. In one embodiment, the 5′-PS is at the 5′-end of the antisense strand, and the targeting ligand is at the 3′-end of the sense strand.

    [0524] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, T2′ is 2′-F, q.sup.4 is 2, B3′ is 2′-OMe or 2′-F, q.sup.5 is 5, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-OMe, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-VP (e.g., a 5′-E-VP, 5′-Z-VP, or combination thereof), and a targeting ligand. In one embodiment, the 5′-VP is at the 5′-end of the antisense strand, and the targeting ligand is at the 3′-end of the sense strand.

    [0525] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, T2′ is 2′-F, q.sup.4 is 2, B3′ is 2′-OMe or 2′-F, q.sup.5 is 5, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-OMe, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-PS.sub.2 and a targeting ligand. In one embodiment, the 5′-PS.sub.2 is at the 5′-end of the antisense strand, and the targeting ligand is at the 3′-end of the sense strand.

    [0526] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, T2′ is 2′-F, q.sup.4 is 2, B3′ is 2′-OMe or 2′-F, q.sup.5 is 5, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-OMe, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-deoxy-5′-C-malonyl and a targeting ligand. In one embodiment, the 5′-deoxy-5′-C-malonyl is at the 5′-end of the antisense strand, and the targeting ligand is at the 3′-end of the sense strand.

    [0527] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, q.sup.4 is 0, B3′ is 2′-OMe or 2′-F, q.sup.5 is 7, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′- OMe, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end). The RNAi agent also comprises a 5′-P and a targeting ligand. In one embodiment, the 5′-P is at the 5′-end of the antisense strand, and the targeting ligand is at the 3′-end of the sense strand.

    [0528] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, q.sup.4 is 0, B3′ is 2′-OMe or 2′-F, q.sup.5 is 7, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′- OMe, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end). The RNAi agent also comprises a 5′-PS and a targeting ligand. In one embodiment, the 5′-PS is at the 5′-end of the antisense strand, and the targeting ligand is at the 3′-end of the sense strand.

    [0529] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, q.sup.4 is 0, B3′ is 2′-OMe or 2′-F, q.sup.5 is 7, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′- OMe, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end). The RNAi agent also comprises a 5′-VP (e.g., a 5′-E-VP, 5′-Z-VP, or combination thereof) and a targeting ligand. In one embodiment, the 5′-VP is at the 5′-end of the antisense strand, and the targeting ligand is at the 3′-end of the sense strand.

    [0530] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, q.sup.4 is 0, B3′ is 2′-OMe or 2′-F, q.sup.5 is 7, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′- OMe, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end). The RNAi agent also comprises a 5′-PS.sub.2 and a targeting ligand. In one embodiment, the 5′-PS.sub.2 is at the 5′-end of the antisense strand, and the targeting ligand is at the 3′-end of the sense strand.

    [0531] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, q.sup.4 is 0, B3′ is 2′-OMe or 2′-F, q.sup.5 is 7, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′- OMe, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end). The RNAi agent also comprises a 5′-deoxy-5′-C-malonyl and a targeting ligand. In one embodiment, the 5′-deoxy-5′-C-malonyl is at the 5′-end of the antisense strand, and the targeting ligand is at the 3′-end of the sense strand.

    [0532] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, T2′ is 2′-F, q.sup.4 is 2, B3′ is 2′-OMe or 2′-F, q.sup.5 is 5, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-F, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-P and a targeting ligand. In one embodiment, the 5′-P is at the 5′-end of the antisense strand, and the targeting ligand is at the 3′-end of the sense strand.

    [0533] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, T2′ is 2′-F, q.sup.4 is 2, B3′ is 2′-OMe or 2′-F, q.sup.5 is 5, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-F, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-PS and a targeting ligand. In one embodiment, the 5′-PS is at the 5′-end of the antisense strand, and the targeting ligand is at the 3′-end of the sense strand.

    [0534] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, T2′ is 2′-F, q.sup.4 is 2, B3′ is 2′-OMe or 2′-F, q.sup.5 is 5, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-F, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-VP (e.g., a 5′-E-VP, 5′-Z-VP, or combination thereof) and a targeting ligand. In one embodiment, the 5′-VP is at the 5′-end of the antisense strand, and the targeting ligand is at the 3′-end of the sense strand.

    [0535] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, T2′ is 2′-F, q.sup.4 is 2, B3′ is 2′-OMe or 2′-F, q.sup.5 is 5, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-F, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-PS.sub.2 and a targeting ligand. In one embodiment, the 5′-PS.sub.2 is at the 5′-end of the antisense strand, and the targeting ligand is at the 3′-end of the sense strand.

    [0536] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, T2′ is 2′-F, q.sup.4 is 2, B3′ is 2′-OMe or 2′-F, q.sup.5 is 5, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-F, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-deoxy-5′-C-malonyl and a targeting ligand. In one embodiment, the 5′-deoxy-5′-C-malonyl is at the 5′-end of the antisense strand, and the targeting ligand is at the 3′-end of the sense strand.

    [0537] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, q.sup.4 is 0, B3′ is 2′-OMe or 2′-F, q.sup.5 is 7, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-F, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-P and a targeting ligand. In one embodiment, the 5′-P is at the 5′-end of the antisense strand, and the targeting ligand is at the 3′-end of the sense strand.

    [0538] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, q.sup.4 is 0, B3′ is 2′-OMe or 2′-F, q.sup.5 is 7, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-F, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-PS and a targeting ligand. In one embodiment, the 5′-PS is at the 5′-end of the antisense strand, and the targeting ligand is at the 3′-end of the sense strand.

    [0539] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, q.sup.4 is 0, B3′ is 2′-OMe or 2′-F, q.sup.5 is 7, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-F, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-VP (e.g., a 5′-E-VP, 5′-Z-VP, or combination thereof) and a targeting ligand. In one embodiment, the 5′-VP is at the 5′-end of the antisense strand, and the targeting ligand is at the 3′-end of the sense strand.

    [0540] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, q.sup.4 is 0, B3′ is 2′-OMe or 2′-F, q.sup.5 is 7, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-F, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-PS.sub.2 and a targeting ligand. In one embodiment, the 5′-PS.sub.2 is at the 5′-end of the antisense strand, and the targeting ligand is at the 3′-end of the sense strand.

    [0541] In one embodiment, B1 is 2′-OMe or 2′-F, n.sup.1 is 8, T1 is 2′F, n.sup.2 is 3, B2 is 2′-OMe, n.sup.3 is 7, n.sup.4 is 0, B3 is 2′-OMe, n.sup.5 is 3, B1′ is 2′-OMe or 2′-F, q.sup.1 is 9, T1′ is 2′-F, q.sup.2 is 1, B2′ is 2′-OMe or 2′-F, q.sup.3 is 4, q.sup.4 is 0, B3′ is 2′-OMe or 2′-F, q.sup.5 is 7, T3′ is 2′-F, q.sup.6 is 1, B4′ is 2′-F, and q.sup.7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5′-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end of the antisense strand). The RNAi agent also comprises a 5′-deoxy-5′-C-malonyl and a targeting ligand. In one embodiment, the 5′-deoxy-5′-C-malonyl is at the 5′-end of the antisense strand, and the targeting ligand is at the 3′-end of the sense strand.

    [0542] In a particular embodiment, an RNAi agent of the present invention comprises:

    (a) a sense strand having: [0543] (i) a length of 21 nucleotides; [0544] (ii) an ASGPR ligand attached to the 3′-end, wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker; and [0545] (iii) 2′-F modifications at positions 1, 3, 5, 7, 9 to 11, 13, 17, 19, and 21, and 2′-OMe modifications at positions 2, 4, 6, 8, 12, 14 to 16, 18, and 20 (counting from the 5′ end); [0546] and
    (b) an antisense strand having: [0547] (i) a length of 23 nucleotides; [0548] (ii) 2′-OMe modifications at positions 1, 3, 5, 9, 11 to 13, 15, 17, 19, 21, and 23, and 2′F modifications at positions 2, 4, 6 to 8, 10, 14, 16, 18, 20, and 22 (counting from the 5′ end); and [0549] (iii) phosphorothioate internucleotide linkages between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5′ end); [0550] wherein the dsRNA agents have a two nucleotide overhang at the 3′-end of the antisense strand, and a blunt end at the 5′-end of the antisense strand.

    [0551] In another particular embodiment, an RNAi agent of the present invention comprises:

    (a) a sense strand having: [0552] (i) a length of 21 nucleotides; [0553] (ii) an ASGPR ligand attached to the 3′-end, wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker; [0554] (iii) 2′-F modifications at positions 1, 3, 5, 7, 9 to 11, 13, 15, 17, 19, and 21, and 2′-OMe modifications at positions 2, 4, 6, 8, 12, 14, 16, 18, and 20 (counting from the 5′ end); and [0555] (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5′ end); [0556] and
    (b) an antisense strand having: [0557] (i) a length of 23 nucleotides; [0558] (ii) 2′-OMe modifications at positions 1, 3, 5, 7, 9, 11 to 13, 15, 17, 19, and 21 to 23, and 2′F modifications at positions 2, 4, 6, 8, 10, 14, 16, 18, and 20 (counting from the 5′ end); and [0559] (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5′ end);

    [0560] wherein the RNAi agents have a two nucleotide overhang at the 3′-end of the antisense strand, and a blunt end at the 5′-end of the antisense strand.

    [0561] In another particular embodiment, a RNAi agent of the present invention comprises:

    (a) a sense strand having: [0562] (i) a length of 21 nucleotides; [0563] (ii) an ASGPR ligand attached to the 3′-end, wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker; [0564] (iii) 2′-OMe modifications at positions 1 to 6, 8, 10, and 12 to 21, 2′-F modifications at positions 7, and 9, and a desoxy-nucleotide (e.g. dT) at position 11 (counting from the 5′ end); and [0565] (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5′ end); [0566] and
    (b) an antisense strand having: [0567] (i) a length of 23 nucleotides; [0568] (ii) 2′-OMe modifications at positions 1, 3, 7, 9, 11, 13, 15, 17, and 19 to 23, and 2′-F modifications at positions 2, 4 to 6, 8, 10, 12, 14, 16, and 18 (counting from the 5′ end); and [0569] (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5′ end);

    [0570] wherein the RNAi agents have a two nucleotide overhang at the 3′-end of the antisense strand, and a blunt end at the 5′-end of the antisense strand.

    [0571] In another particular embodiment, aRNAi agent of the present invention comprises:

    (a) a sense strand having: [0572] (i) a length of 21 nucleotides; [0573] (ii) an ASGPR ligand attached to the 3′-end, wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker; [0574] (iii) 2′-OMe modifications at positions 1 to 6, 8, 10, 12, 14, and 16 to 21, and 2′-F modifications at positions 7, 9, 11, 13, and 15; and [0575] (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5′ end); [0576] and
    (b) an antisense strand having: [0577] (i) a length of 23 nucleotides; [0578] (ii) 2′-OMe modifications at positions 1, 5, 7, 9, 11, 13, 15, 17, 19, and 21 to 23, and 2′-F modifications at positions 2 to 4, 6, 8, 10, 12, 14, 16, 18, and 20 (counting from the 5′ end); and [0579] (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5′ end);

    [0580] wherein the RNAi agents have a two nucleotide overhang at the 3′-end of the antisense strand, and a blunt end at the 5′-end of the antisense strand.

    [0581] In another particular embodiment, a RNAi agent of the present invention comprises:

    (a) a sense strand having: [0582] (i) a length of 21 nucleotides; [0583] (ii) an ASGPR ligand attached to the 3′-end, wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker; [0584] (iii) 2′-OMe modifications at positions 1 to 9, and 12 to 21, and 2′-F modifications at positions 10, and 11; and [0585] (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5′ end); [0586] and
    (b) an antisense strand having: [0587] (i) a length of 23 nucleotides; [0588] (ii) 2′-OMe modifications at positions 1, 3, 5, 7, 9, 11 to 13, 15, 17, 19, and 21 to 23, and 2′-F modifications at positions 2, 4, 6, 8, 10, 14, 16, 18, and 20 (counting from the 5′ end); and [0589] (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5′ end);

    [0590] wherein the RNAi agents have a two nucleotide overhang at the 3′-end of the antisense strand, and a blunt end at the 5′-end of the antisense strand.

    [0591] In another particular embodiment, a RNAi agent of the present invention comprises:

    (a) a sense strand having: [0592] (i) a length of 21 nucleotides; [0593] (ii) an ASGPR ligand attached to the 3′-end, wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker; [0594] (iii) 2′-F modifications at positions 1, 3, 5, 7, 9 to 11, and 13, and 2′-OMe modifications at positions 2, 4, 6, 8, 12, and 14 to 21; and [0595] (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5′ end); [0596] and
    (b) an antisense strand having: [0597] (i) a length of 23 nucleotides; [0598] (ii) 2′-OMe modifications at positions 1, 3, 5 to 7, 9, 11 to 13, 15, 17 to 19, and 21 to 23, and 2′-F modifications at positions 2, 4, 8, 10, 14, 16, and 20 (counting from the 5′ end); and [0599] (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5′ end);

    [0600] wherein the RNAi agents have a two nucleotide overhang at the 3′-end of the antisense strand, and a blunt end at the 5′-end of the antisense strand.

    [0601] In another particular embodiment, a RNAi agents of the present invention comprises:

    (a) a sense strand having: [0602] (i) a length of 21 nucleotides; [0603] (ii) an ASGPR ligand attached to the 3′-end, wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker; [0604] (iii) 2′-OMe modifications at positions 1, 2, 4, 6, 8, 12, 14, 15, 17, and 19 to 21, and 2′-F modifications at positions 3, 5, 7, 9 to 11, 13, 16, and 18; and [0605] (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5′ end); [0606] and
    (b) an antisense strand having: [0607] (i) a length of 25 nucleotides; [0608] (ii) 2′-OMe modifications at positions 1, 4, 6, 7, 9, 11 to 13, 15, 17, and 19 to 23, 2′-F modifications at positions 2, 3, 5, 8, 10, 14, 16, and 18, and desoxy-nucleotides (e.g. dT) at positions 24 and 25 (counting from the 5′ end); and [0609] (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5′ end);

    [0610] wherein the RNAi agents have a four nucleotide overhang at the 3′-end of the antisense strand, and a blunt end at the 5′-end of the antisense strand.

    [0611] In another particular embodiment, a RNAi agent of the present invention comprises:

    (a) a sense strand having: [0612] (i) a length of 21 nucleotides; [0613] (ii) an ASGPR ligand attached to the 3′-end, wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker; [0614] (iii) 2′-OMe modifications at positions 1 to 6, 8, and 12 to 21, and 2′-F modifications at positions 7, and 9 to 11; and [0615] (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5′ end); [0616] and
    (b) an antisense strand having: [0617] (i) a length of 23 nucleotides; [0618] (ii) 2′-OMe modifications at positions 1, 3 to 5, 7, 8, 10 to 13, 15, and 17 to 23, and 2′-F modifications at positions 2, 6, 9, 14, and 16 (counting from the 5′ end); and [0619] (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5′ end);

    [0620] wherein the RNAi agents have a two nucleotide overhang at the 3′-end of the antisense strand, and a blunt end at the 5′-end of the antisense strand.

    [0621] In another particular embodiment, a RNAi agent of the present invention comprises:

    [0622] (a) a sense strand having: [0623] (i) a length of 21 nucleotides; [0624] (ii) an ASGPR ligand attached to the 3′-end, wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker; [0625] (iii) 2′-OMe modifications at positions 1 to 6, 8, and 12 to 21, and 2′-F modifications at positions 7, and 9 to 11; and [0626] (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5′ end); [0627] and
    (b) an antisense strand having: [0628] (i) a length of 23 nucleotides; [0629] (ii) 2′-OMe modifications at positions 1, 3 to 5, 7, 10 to 13, 15, and 17 to 23, and 2′-F modifications at positions 2, 6, 8, 9, 14, and 16 (counting from the 5′ end); and [0630] (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5′ end);

    [0631] wherein the RNAi agents have a two nucleotide overhang at the 3′-end of the antisense strand, and a blunt end at the 5′-end of the antisense strand.

    [0632] In another particular embodiment, a RNAi agent of the present invention comprises:

    (a) a sense strand having: [0633] (i) a length of 19 nucleotides; [0634] (ii) an ASGPR ligand attached to the 3′-end, wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker; [0635] (iii) 2′-OMe modifications at positions 1 to 4, 6, and 10 to 19, and 2′-F modifications at positions 5, and 7 to 9; and [0636] (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5′ end); [0637] and
    (b) an antisense strand having: [0638] (i) a length of 21 nucleotides; [0639] (ii) 2′-OMe modifications at positions 1, 3 to 5, 7, 10 to 13, 15, and 17 to 21, and 2′-F modifications at positions 2, 6, 8, 9, 14, and 16 (counting from the 5′ end); and [0640] (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 19 and 20, and between nucleotide positions 20 and 21 (counting from the 5′ end);

    [0641] wherein the RNAi agents have a two nucleotide overhang at the 3′-end of the antisense strand, and a blunt end at the 5′-end of the antisense strand.

    IV. iRNAs Conjugated to Ligands

    [0642] Another modification of the RNA of an iRNA of the invention involves chemically linking to the RNA one or more ligands, moieties or conjugates that enhance the activity, cellular distribution or cellular uptake of the iRNA. Such moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., (1989) Proc. Natl. Acid. Sci. USA, 86: 6553-6556), cholic acid (Manoharan et al., (1994) Biorg. Med. Chem. Let., 4:1053-1060), a thioether, e.g., beryl-S-tritylthiol (Manoharan et al., (1992) Ann. N.Y. Acad. Sci., 660:306-309; Manoharan et al., (1993) Biorg. Med. Chem. Let., 3:2765-2770), a thiocholesterol (Oberhauser et al., (1992) Nucl. Acids Res., 20:533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., (1991) EMBO J, 10:1111-1118; Kabanov et al., (1990) FEBS Lett., 259:327-330; Svinarchuk et al., (1993) Biochimie, 75:49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-phosphonate (Manoharan et al., (1995) Tetrahedron Lett., 36:3651-3654; Shea et al., (1990) Nucl. Acids Res., 18:3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., (1995) Nucleosides & Nucleotides, 14:969-973), or adamantane acetic acid (Manoharan et al., (1995) Tetrahedron Lett., 36:3651-3654), a palmityl moiety (Mishra et al., (1995) Biochim. Biophys. Acta, 1264:229-237), or an octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke et al., (1996) J. Pharmacol. Exp. Ther., 277:923-937).

    [0643] In embodiments in which a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1 are covalently attached (i.e., a dual targeting RNAi agent described herein), one or both of the dsRNA agents may independently comprise one or more ligands.

    [0644] In one embodiment, a ligand alters the distribution, targeting or lifetime of an iRNA agent into which it is incorporated. In preferred embodiments a ligand provides an enhanced affinity for a selected target, e.g., molecule, cell or cell type, compartment, e.g., a cellular or organ compartment, tissue, organ or region of the body, as, e.g., compared to a species absent such a ligand. Preferred ligands will not take part in duplex pairing in a duplexed nucleic acid.

    [0645] Ligands can include a naturally occurring substance, such as a protein (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulin); carbohydrate (e.g., a dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, N-acetylglucosamine, N-acetylgalactosamine or hyaluronic acid); or a lipid. The ligand can also be a recombinant or synthetic molecule, such as a synthetic polymer, e.g., a synthetic polyamino acid. Examples of polyamino acids include polyamino acid is a polylysine (PLL), poly L-aspartic acid, poly L-glutamic acid, styrene-maleic acid anhydride copolymer, poly(L-lactide-co-glycolied) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymers, or polyphosphazine. Example of polyamines include: polyethylenimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipid, cationic porphyrin, quaternary salt of a polyamine, or an alpha helical peptide.

    [0646] Ligands can also include targeting groups, e.g., a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody, that binds to a specified cell type such as a kidney cell. A targeting group can be a thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, Mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-gulucosamine multivalent mannose, multivalent fucose, glycosylated polyaminoacids, multivalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, vitamin B12, vitamin A, biotin, or an RGD peptide or RGD peptide mimetic.

    [0647] Other examples of ligands include dyes, intercalating agents (e.g. acridines), cross-linkers (e.g. psoralene, mitomycin C), porphyrins (TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g. EDTA), lipophilic molecules, e.g., cholesterol, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-Bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine) and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g. biotin), transport/absorption facilitators (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl, HRP, or AP.

    [0648] Ligands can be proteins, e.g., glycoproteins, or peptides, e.g., molecules having a specific affinity for a co-ligand, or antibodies e.g., an antibody, that binds to a specified cell type such as a hepatic cell. Ligands can also include hormones and hormone receptors. They can also include non-peptidic species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-gulucosamine multivalent mannose, or multivalent fucose. The ligand can be, for example, a lipopolysaccharide, an activator of p38 MAP kinase, or an activator of NF-κB.

    [0649] The ligand can be a substance, e.g., a drug, which can increase the uptake of the iRNA agent into the cell, for example, by disrupting the cell's cytoskeleton, e.g., by disrupting the cell's microtubules, microfilaments, and/or intermediate filaments. The drug can be, for example, taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin.

    [0650] In some embodiments, a ligand attached to an iRNA as described herein acts as a pharmacokinetic modulator (PK modulator). PK modulators include lipophiles, bile acids, steroids, phospholipid analogues, peptides, protein binding agents, PEG, vitamins etc. Exemplary PK modulators include, but are not limited to, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglyceride, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin etc. Oligonucleotides that comprise a number of phosphorothioate linkages are also known to bind to serum protein, thus short oligonucleotides, e.g., oligonucleotides of about bases, 10 bases, 15 bases or 20 bases, comprising multiple of phosphorothioate linkages in the backbone are also amenable to the present invention as ligands (e.g. as PK modulating ligands). In addition, aptamers that bind serum components (e.g. serum proteins) are also suitable for use as PK modulating ligands in the embodiments described herein.

    [0651] Ligand-conjugated oligonucleotides of the invention may be synthesized by the use of an oligonucleotide that bears a pendant reactive functionality, such as that derived from the attachment of a linking molecule onto the oligonucleotide (described below). This reactive oligonucleotide may be reacted directly with commercially-available ligands, ligands that are synthesized bearing any of a variety of protecting groups, or ligands that have a linking moiety attached thereto.

    [0652] The oligonucleotides used in the conjugates of the present invention may be conveniently and routinely made through the well-known technique of solid-phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is also known to use similar techniques to prepare other oligonucleotides, such as the phosphorothioates and alkylated derivatives.

    [0653] In the ligand-conjugated oligonucleotides and ligand-molecule bearing sequence-specific linked nucleosides of the present invention, the oligonucleotides and oligonucleosides may be assembled on a suitable DNA synthesizer utilizing standard nucleotide or nucleoside precursors, or nucleotide or nucleoside conjugate precursors that already bear the linking moiety, ligand-nucleotide or nucleoside-conjugate precursors that already bear the ligand molecule, or non-nucleoside ligand-bearing building blocks.

    [0654] When using nucleotide-conjugate precursors that already bear a linking moiety, the synthesis of the sequence-specific linked nucleosides is typically completed, and the ligand molecule is then reacted with the linking moiety to form the ligand-conjugated oligonucleotide.

    [0655] In some embodiments, the oligonucleotides or linked nucleosides of the present invention are synthesized by an automated synthesizer using phosphoramidites derived from ligand-nucleoside conjugates in addition to the standard phosphoramidites and non-standard phosphoramidites that are commercially available and routinely used in oligonucleotide synthesis.

    [0656] A. Lipid Conjugates

    [0657] In one embodiment, the ligand or conjugate is a lipid or lipid-based molecule. Such a lipid or lipid-based molecule preferably binds a serum protein, e.g., human serum albumin (HSA). An HSA binding ligand allows for distribution of the conjugate to a target tissue, e.g., a non-kidney target tissue of the body. For example, the target tissue can be the liver, including parenchymal cells of the liver. Other molecules that can bind HSA can also be used as ligands. For example, naproxen or aspirin can be used. A lipid or lipid-based ligand can (a) increase resistance to degradation of the conjugate, (b) increase targeting or transport into a target cell or cell membrane, and/or (c) can be used to adjust binding to a serum protein, e.g., HSA.

    [0658] A lipid based ligand can be used to inhibit, e.g., control the binding of the conjugate to a target tissue. For example, a lipid or lipid-based ligand that binds to HSA more strongly will be less likely to be targeted to the kidney and therefore less likely to be cleared from the body. A lipid or lipid-based ligand that binds to HSA less strongly can be used to target the conjugate to the kidney.

    [0659] In a preferred embodiment, the lipid based ligand binds HSA. Preferably, it binds HSA with a sufficient affinity such that the conjugate will be preferably distributed to a non-kidney tissue. However, it is preferred that the affinity not be so strong that the HSA-ligand binding cannot be reversed.

    [0660] In another preferred embodiment, the lipid based ligand binds HSA weakly or not at all, such that the conjugate will be preferably distributed to the kidney. Other moieties that target to kidney cells can also be used in place of or in addition to the lipid based ligand.

    [0661] In another aspect, the ligand is a moiety, e.g., a vitamin, which is taken up by a target cell, e.g., a proliferating cell. These are particularly useful for treating disorders characterized by unwanted cell proliferation, e.g., of the malignant or non-malignant type, e.g., cancer cells. Exemplary vitamins include vitamin A, E, and K. Other exemplary vitamins include are B vitamin, e.g., folic acid, B12, riboflavin, biotin, pyridoxal or other vitamins or nutrients taken up by target cells such as liver cells. Also included are HSA and low density lipoprotein (LDL).

    [0662] B. Cell Permeation Agents

    [0663] In another aspect, the ligand is a cell-permeation agent, preferably a helical cell-permeation agent. Preferably, the agent is amphipathic. An exemplary agent is a peptide such as tat or antennopedia. If the agent is a peptide, it can be modified, including a peptidylmimetic, invertomers, non-peptide or pseudo-peptide linkages, and use of D-amino acids. The helical agent is preferably an alpha-helical agent, which preferably has a lipophilic and a lipophobic phase.

    [0664] The ligand can be a peptide or peptidomimetic. A peptidomimetic (also referred to herein as an oligopeptidomimetic) is a molecule capable of folding into a defined three-dimensional structure similar to a natural peptide. The attachment of peptide and peptidomimetics to iRNA agents can affect pharmacokinetic distribution of the iRNA, such as by enhancing cellular recognition and absorption. The peptide or peptidomimetic moiety can be about 5-50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long.

    [0665] A peptide or peptidomimetic can be, for example, a cell permeation peptide, cationic peptide, amphipathic peptide, or hydrophobic peptide (e.g., consisting primarily of Tyr, Trp or Phe). The peptide moiety can be a dendrimer peptide, constrained peptide or crosslinked peptide. In another alternative, the peptide moiety can include a hydrophobic membrane translocation sequence (MTS). An exemplary hydrophobic MTS-containing peptide is RFGF having the amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO: 2986). An RFGF analogue (e.g., amino acid sequence AALLPVLLAAP (SEQ ID NO: 2987) containing a hydrophobic MTS can also be a targeting moiety. The peptide moiety can be a “delivery” peptide, which can carry large polar molecules including peptides, oligonucleotides, and protein across cell membranes. For example, sequences from the HIV Tat protein (GRKKRRQRRRPPQ (SEQ ID NO: 2988) and the Drosophila Antennapedia protein (RQIKIWFQNRRMKWKK (SEQ ID NO: 2989) have been found to be capable of functioning as delivery peptides. A peptide or peptidomimetic can be encoded by a random sequence of DNA, such as a peptide identified from a phage-display library, or one-bead-one-compound (OBOC) combinatorial library (Lam et al., Nature, 354:82-84, 1991). Examples of a peptide or peptidomimetic tethered to a dsRNA agent via an incorporated monomer unit for cell targeting purposes is an arginine-glycine-aspartic acid (RGD)-peptide, or RGD mimic. A peptide moiety can range in length from about 5 amino acids to about 40 amino acids. The peptide moieties can have a structural modification, such as to increase stability or direct conformational properties. Any of the structural modifications described below can be utilized.

    [0666] An RGD peptide for use in the compositions and methods of the invention may be linear or cyclic, and may be modified, e.g., glycosylated or methylated, to facilitate targeting to a specific tissue(s). RGD-containing peptides and peptidiomimemtics may include D-amino acids, as well as synthetic RGD mimics. In addition to RGD, one can use other moieties that target the integrin ligand. Preferred conjugates of this ligand target PECAM-1 or VEGF.

    [0667] A “cell permeation peptide” is capable of permeating a cell, e.g., a microbial cell, such as a bacterial or fungal cell, or a mammalian cell, such as a human cell. A microbial cell-permeating peptide can be, for example, a α-helical linear peptide (e.g., LL-37 or Ceropin P1), a disulfide bond-containing peptide (e.g., α-defensin, β-defensin or bactenecin), or a peptide containing only one or two dominating amino acids (e.g., PR-39 or indolicidin). A cell permeation peptide can also include a nuclear localization signal (NLS). For example, a cell permeation peptide can be a bipartite amphipathic peptide, such as MPG, which is derived from the fusion peptide domain of HIV-1 gp41 and the NLS of SV40 large T antigen (Simeoni et al., Nucl. Acids Res. 31:2717-2724, 2003).

    [0668] C. Carbohydrate Conjugates

    [0669] In some embodiments of the compositions and methods of the invention, an iRNA oligonucleotide further comprises a carbohydrate. The carbohydrate conjugated iRNA are advantageous for the in vivo delivery of nucleic acids, as well as compositions suitable for in vivo therapeutic use, as described herein. As used herein, “carbohydrate” refers to a compound which is either a carbohydrate per se made up of one or more monosaccharide units having at least 6 carbon atoms (which can be linear, branched or cyclic) with an oxygen, nitrogen or sulfur atom bonded to each carbon atom; or a compound having as a part thereof a carbohydrate moiety made up of one or more monosaccharide units each having at least six carbon atoms (which can be linear, branched or cyclic), with an oxygen, nitrogen or sulfur atom bonded to each carbon atom. Representative carbohydrates include the sugars (mono-, di-, tri- and oligosaccharides containing from about 4, 5, 6, 7, 8, or 9 monosaccharide units), and polysaccharides such as starches, glycogen, cellulose and polysaccharide gums. Specific monosaccharides include C5 and above (e.g., C5, C6, C7, or C8) sugars; di- and trisaccharides include sugars having two or three monosaccharide units (e.g., C5, C6, C7, or C8).

    [0670] In embodiments in which a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1 are covalently attached (i.e., a dual targetingRNAi agent), one or both of the dsRNA agents may independently comprise one or more carbohydrate ligands.

    [0671] In one embodiment, a carbohydrate conjugate for use in the compositions and methods of the invention is selected from the group consisting of:

    ##STR00013## ##STR00014## ##STR00015## ##STR00016## ##STR00017## ##STR00018##

    wherein Y is O or S and n is 3-6 (Formula XXIV);

    ##STR00019##

    wherein Y is O or S and n is 3-6 (Formula XXV);

    ##STR00020##

    wherein X is O or S (Formula XXVII);

    ##STR00021## ##STR00022## ##STR00023##

    [0672] In another embodiment, a carbohydrate conjugate for use in the compositions and methods of the invention is a monosaccharide. In one embodiment, the monosaccharide is an N-acetylgalactosamine, such as

    ##STR00024##

    [0673] Another representative carbohydrate conjugate for use in the embodiments described herein includes, but is not limited to,

    ##STR00025##

    when one of X or Y is an oligonucleotide, the other is a hydrogen.

    [0674] In embodiments in which a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1 are covalently attached (i.e., a dual targetingRNAi agent), one or both of the dsRNA agents may independently comprise a GalNAc or GalNAc derivative ligand.

    [0675] In certain embodiments of the invention, the GalNAc or GalNAc derivative is attached to an iRNA agent of the invention via a monovalent linker. In some embodiments, the GalNAc or GalNAc derivative is attached to an iRNA agent of the invention via a bivalent linker. In yet other embodiments of the invention, the GalNAc or GalNAc derivative is attached to an iRNA agent of the invention via a trivalent linker.

    [0676] In one embodiment, the double stranded RNAi agents of the invention comprise one GalNAc or GalNAc derivative attached to the iRNA agent, e.g., the 5′end of the sense strand of a dsRNA agent, or the 5′ end of one or both sense strands of a dual targeting RNAi agent as described herein. In another embodiment, the double stranded RNAi agents of the invention, or one or both dsRNA agents of a dual targeting RNAi agent as described herein, comprise a plurality (e.g., 2, 3, 4, 5, or 6) GalNAc or GalNAc derivatives, each independently attached to a plurality of nucleotides of the double stranded RNAi agent through a plurality of monovalent linkers.

    [0677] In some embodiments, for example, when the two strands of an iRNA agent of the invention are part of one larger molecule connected by an uninterrupted chain of nucleotides between the 3′-end of one strand and the 5′-end of the respective other strand forming a hairpin loop comprising, a plurality of unpaired nucleotides, each unpaired nucleotide within the hairpin loop may independently comprise a GalNAc or GalNAc derivative attached via a monovalent linker.

    [0678] In some embodiments, the carbohydrate conjugate further comprises one or more additional ligands as described above, such as, but not limited to, a PK modulator and/or a cell permeation peptide.

    [0679] Additional carbohydrate conjugates (and linkers) suitable for use in the present invention include those described in PCT Publication Nos. WO 2014/179620 and WO 2014/179627, the entire contents of each of which are incorporated herein by reference.

    [0680] D. Linkers

    [0681] In some embodiments, the conjugate or ligand described herein can be attached to an iRNA oligonucleotide with various linkers that can be cleavable or non cleavable.

    [0682] The term “linker” or “linking group” means an organic moiety that connects two parts of a compound, e.g., covalently attaches two parts of a compound. Linkers typically comprise a direct bond or an atom such as oxygen or sulfur, a unit such as NR8, C(O), C(O)NH, SO, SO.sub.2, SO.sub.2NH or a chain of atoms, such as, but not limited to, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl, alkylarylalkenyl, alkylarylalkynyl, alkenylarylalkyl, alkenylarylalkenyl, alkenylarylalkynyl, alkynylarylalkyl, alkynylarylalkenyl, alkynylarylalkynyl, alkylheteroarylalkyl, alkylheteroarylalkenyl, alkylheteroarylalkynyl, alkenylheteroarylalkyl, alkenylheteroarylalkenyl, alkenylheteroarylalkynyl, alkynylheteroarylalkyl, alkynylheteroarylalkenyl, alkynylheteroarylalkynyl, alkylheterocyclylalkyl, alkylheterocyclylalkenyl, alkylhererocyclylalkynyl, alkenylheterocyclylalkyl, alkenylheterocyclylalkenyl, alkenylheterocyclylalkynyl, alkynylheterocyclylalkyl, alkynylheterocyclylalkenyl, alkynylheterocyclylalkynyl, alkylaryl, alkenylaryl, alkynylaryl, alkylheteroaryl, alkenylheteroaryl, alkynylhereroaryl, which one or more methylenes can be interrupted or terminated by O, S, S(O), SO.sub.2, N(R8), C(O), substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocyclic; where R8 is hydrogen, acyl, aliphatic or substituted aliphatic. In one embodiment, the linker is between about 1-24 atoms, 2-24, 3-24, 4-24, 5-24, 6-24, 6-18, 7-18, 8-18 atoms, 7-17, 8-17, 6-16, 7-17, or 8-16 atoms.

    [0683] A cleavable linking group is one which is sufficiently stable outside the cell, but which upon entry into a target cell is cleaved to release the two parts the linker is holding together. In a preferred embodiment, the cleavable linking group is cleaved at least about 10 times, 20, times, times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times or more, or at least about 100 times faster in a target cell or under a first reference condition (which can, e.g., be selected to mimic or represent intracellular conditions) than in the blood of a subject, or under a second reference condition (which can, e.g., be selected to mimic or represent conditions found in the blood or serum).

    [0684] Cleavable linking groups are susceptible to cleavage agents, e.g., pH, redox potential or the presence of degradative molecules. Generally, cleavage agents are more prevalent or found at higher levels or activities inside cells than in serum or blood. Examples of such degradative agents include: redox agents which are selected for particular substrates or which have no substrate specificity, including, e.g., oxidative or reductive enzymes or reductive agents such as mercaptans, present in cells, that can degrade a redox cleavable linking group by reduction; esterases; endosomes or agents that can create an acidic environment, e.g., those that result in a pH of five or lower; enzymes that can hydrolyze or degrade an acid cleavable linking group by acting as a general acid, peptidases (which can be substrate specific), and phosphatases.

    [0685] A cleavable linkage group, such as a disulfide bond can be susceptible to pH. The pH of human serum is 7.4, while the average intracellular pH is slightly lower, ranging from about 7.1-7.3. Endosomes have a more acidic pH, in the range of 5.5-6.0, and lysosomes have an even more acidic pH at around 5.0. Some linkers will have a cleavable linking group that is cleaved at a preferred p, thereby releasing a cationic lipid from the ligand inside the cell, or into the desired compartment of the cell.

    [0686] A linker can include a cleavable linking group that is cleavable by a particular enzyme. The type of cleavable linking group incorporated into a linker can depend on the cell to be targeted. For example, a liver-targeting ligand can be linked to a cationic lipid through a linker that includes an ester group. Liver cells are rich in esterases, and therefore the linker will be cleaved more efficiently in liver cells than in cell types that are not esterase-rich. Other cell-types rich in esterases include cells of the lung, renal cortex, and testis.

    [0687] Linkers that contain peptide bonds can be used when targeting cell types rich in peptidases, such as liver cells and synoviocytes.

    [0688] In general, the suitability of a candidate cleavable linking group can be evaluated by testing the ability of a degradative agent (or condition) to cleave the candidate linking group. It will also be desirable to also test the candidate cleavable linking group for the ability to resist cleavage in the blood or when in contact with other non-target tissue. Thus, one can determine the relative susceptibility to cleavage between a first and a second condition, where the first is selected to be indicative of cleavage in a target cell and the second is selected to be indicative of cleavage in other tissues or biological fluids, e.g., blood or serum. The evaluations can be carried out in cell free systems, in cells, in cell culture, in organ or tissue culture, or in whole animals. It can be useful to make initial evaluations in cell-free or culture conditions and to confirm by further evaluations in whole animals. In preferred embodiments, useful candidate compounds are cleaved at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood or serum (or under in vitro conditions selected to mimic extracellular conditions).

    [0689] i. Redox Cleavable Linking Groups

    [0690] In one embodiment, a cleavable linking group is a redox cleavable linking group that is cleaved upon reduction or oxidation. An example of reductively cleavable linking group is a disulphide linking group (—S—S—). To determine if a candidate cleavable linking group is a suitable “reductively cleavable linking group,” or for example is suitable for use with a particular iRNA moiety and particular targeting agent one can look to methods described herein. For example, a candidate can be evaluated by incubation with dithiothreitol (DTT), or other reducing agent using reagents know in the art, which mimic the rate of cleavage which would be observed in a cell, e.g., a target cell. The candidates can also be evaluated under conditions which are selected to mimic blood or serum conditions. In one, candidate compounds are cleaved by at most about 10% in the blood. In other embodiments, useful candidate compounds are degraded at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood (or under in vitro conditions selected to mimic extracellular conditions). The rate of cleavage of candidate compounds can be determined using standard enzyme kinetics assays under conditions chosen to mimic intracellular media and compared to conditions chosen to mimic extracellular media.

    [0691] ii. Phosphate-Based Cleavable Linking Groups

    [0692] In another embodiment, a cleavable linker comprises a phosphate-based cleavable linking group. A phosphate-based cleavable linking group is cleaved by agents that degrade or hydrolyze the phosphate group. An example of an agent that cleaves phosphate groups in cells are enzymes such as phosphatases in cells. Examples of phosphate-based linking groups are —O—P(O)(ORk)-O—, —O—P(S)(ORk)-O—, —O—P(S)(SRk)-O—, —S—P(O)(ORk)-O—, —O—P(O)(ORk)-S—, —S—P(O)(ORk)-S—, —O—P(S)(ORk)-S—, —S—P(S)(ORk)-O—, —O—P(O)(Rk)-O—, —O—P(S)(Rk)-O—, —S—P(O)(Rk)-O—, —S—P(S)(Rk)-O—, —S—P(O)(Rk)-S—, —O—P(S)(Rk)-S—. Preferred embodiments are —O—P(O)(OH)—O—, —O—P(S)(OH)—O—, —O—P(S)(SH)—O—, —S—P(O)(OH)—O—, —O—P(O)(OH)—S—, —S—P(O)(OH)—S—, —O—P(S)(OH)—S—, —S—P(S)(OH)—O—, —O—P(O)(H)—O—, —O—P(S)(H)—O—, —S—P(O)(H)—O—, —S—P(S)(H)—O—, —S—P(O)(H)—S—, —O—P(S)(H)—S—. A preferred embodiment is —O—P(O)(OH)—O—. These candidates can be evaluated using methods analogous to those described above.

    [0693] iii. Acid Cleavable Linking Groups

    [0694] In another embodiment, a cleavable linker comprises an acid cleavable linking group. An acid cleavable linking group is a linking group that is cleaved under acidic conditions. In preferred embodiments acid cleavable linking groups are cleaved in an acidic environment with a pH of about 6.5 or lower (e.g., about 6.0, 5.75, 5.5, 5.25, 5.0, or lower), or by agents such as enzymes that can act as a general acid. In a cell, specific low pH organelles, such as endosomes and lysosomes can provide a cleaving environment for acid cleavable linking groups. Examples of acid cleavable linking groups include but are not limited to hydrazones, esters, and esters of amino acids. Acid cleavable groups can have the general formula —C═NN—, C(O)O, or —OC(O). A preferred embodiment is when the carbon attached to the oxygen of the ester (the alkoxy group) is an aryl group, substituted alkyl group, or tertiary alkyl group such as dimethyl pentyl or t-butyl. These candidates can be evaluated using methods analogous to those described above.

    [0695] iv. Ester-Based Linking Groups

    [0696] In another embodiment, a cleavable linker comprises an ester-based cleavable linking group. An ester-based cleavable linking group is cleaved by enzymes such as esterases and amidases in cells. Examples of ester-based cleavable linking groups include but are not limited to esters of alkylene, alkenylene and alkynylene groups. Ester cleavable linking groups have the general formula —C(O)O—, or —OC(O)—. These candidates can be evaluated using methods analogous to those described above.

    [0697] v. Peptide-Based Cleaving Groups

    [0698] In yet another embodiment, a cleavable linker comprises a peptide-based cleavable linking group. A peptide-based cleavable linking group is cleaved by enzymes such as peptidases and proteases in cells. Peptide-based cleavable linking groups are peptide bonds formed between amino acids to yield oligopeptides (e.g., dipeptides, tripeptides etc.) and polypeptides. Peptide-based cleavable groups do not include the amide group (—C(O)NH—). The amide group can be formed between any alkylene, alkenylene or alkynelene. A peptide bond is a special type of amide bond formed between amino acids to yield peptides and proteins. The peptide based cleavage group is generally limited to the peptide bond (i.e., the amide bond) formed between amino acids yielding peptides and proteins and does not include the entire amide functional group. Peptide-based cleavable linking groups have the general formula —NHCHRAC(O)NHCHRBC(O)—, where RA and RB are the R groups of the two adjacent amino acids. These candidates can be evaluated using methods analogous to those described above.

    [0699] In one embodiment, an iRNA of the invention is conjugated to a carbohydrate through a linker. Non-limiting examples of iRNA carbohydrate conjugates with linkers of the compositions and methods of the invention include, but are not limited to,

    ##STR00026## ##STR00027## ##STR00028##

    when one of X or Y is an oligonucleotide, the other is a hydrogen.

    [0700] In certain embodiments of the compositions and methods of the invention, a ligand is one or more GalNAc (N-acetylgalactosamine) derivatives attached through a bivalent or trivalent branched linker.

    [0701] In embodiments in which a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1 are covalently attached (i.e., a dual targetingRNAi agent), one or both of the dsRNA agents may independently a ligand comprising one or more GalNAc (N-acetylgalactosamine) derivatives attached through a bivalent or trivalent branched linker.

    [0702] In one embodiment, a dsRNA of the invention is conjugated to a bivalent or trivalent branched linker selected from the group of structures shown in any of formula (XLV)-(XLVI):

    ##STR00029##

    wherein:
    q2A, q2B, q3A, q3B, q4A, q4B, q5A, q5B and q5C represent independently for each occurrence 0-20 and wherein the repeating unit can be the same or different;
    P.sup.2A, P.sup.2B, P.sup.3A P.sup.3B, P.sup.4A, P.sup.4B, P.sup.5A, P.sup.5B, P.sup.5C, T.sup.2A, T.sup.2B, T.sup.3A, T.sup.3B, T.sup.4A, T.sup.4B, T.sup.4A, T.sup.5B, T.sup.5C are each independently for each occurrence absent, CO, NH, O, S, OC(O), NHC(O), CH.sub.2, CH.sub.2NH or CH.sub.2O;
    Q.sup.2A, Q.sup.2B, Q.sup.3A, Q.sup.3B, Q.sup.4A, Q.sup.4B, Q.sup.5A, Q.sup.5B, Q.sup.5C are independently for each occurrence absent, alkylene, substituted alkylene wherein one or more methylenes can be interrupted or terminated by one or more of O, S, S(O), SO.sub.2, N(R.sup.N), C(R′)═C(R″), C≡C or C(O);
    R.sup.2A, R.sup.2B, R.sup.3A, R.sup.3B, R.sup.4A, R.sup.4B, R.sup.5A, R.sup.5B, R.sup.5C are each independently for each occurrence absent, NH, O, S, CH.sub.2, C(O)O, C(O)NH, NHCH(R.sup.a)C(O), —C(O)CH(R.sup.a)—NH—, CO, CH═N—O,

    ##STR00030##

    or heterocyclyl;

    [0703] L.sup.2A, L.sup.2B, L.sup.3A, L.sup.3B, L.sup.4A, L.sup.4B, L.sup.5A, L.sup.5B and L.sup.5C represent the ligand; i.e. each independently for each occurrence a monosaccharide (such as GalNAc), disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, or polysaccharide; and R.sup.a is H or amino acid side chain. Trivalent conjugating GalNAc derivatives are particularly useful for use with RNAi agents for inhibiting the expression of a target gene, such as those of formula (XLIX):

    ##STR00031## [0704] wherein L.sup.5A, L.sup.5B and L.sup.5C represent a monosaccharide, such as GalNAc derivative.

    [0705] Examples of suitable bivalent and trivalent branched linker groups conjugating GalNAc derivatives include, but are not limited to, the structures recited above as formulas II, VII, XI, X, and XIII.

    [0706] Representative U.S. patents that teach the preparation of RNA conjugates include, but are not limited to, U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941; 6,294,664; 6,320,017; 6,576,752; 6,783,931; 6,900,297; 7,037,646; 8,106,022, the entire contents of each of which are hereby incorporated herein by reference.

    [0707] It is not necessary for all positions in a given compound to be uniformly modified, and in fact more than one of the aforementioned modifications can be incorporated in a single compound or even at a single nucleoside within an iRNA. The present invention also includes iRNA compounds that are chimeric compounds.

    [0708] “Chimeric” iRNA compounds or “chimeras,” in the context of this invention, are iRNA compounds, preferably dsRNAs, which contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of a dsRNA compound. These iRNAs typically contain at least one region wherein the RNA is modified so as to confer upon the iRNA increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid. An additional region of the iRNA can serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of iRNA inhibition of gene expression. Consequently, comparable results can often be obtained with shorter iRNAs when chimeric dsRNAs are used, compared to phosphorothioate deoxy dsRNAs hybridizing to the same target region. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.

    [0709] In certain instances, the RNA of an iRNA can be modified by a non-ligand group. A number of non-ligand molecules have been conjugated to iRNAs in order to enhance the activity, cellular distribution or cellular uptake of the iRNA, and procedures for performing such conjugations are available in the scientific literature. Such non-ligand moieties have included lipid moieties, such as cholesterol (Kubo, T. et al., Biochem. Biophys. Res. Comm., 2007, 365(1):54-61; Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86:6553), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4:1053), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660:306; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3:2765), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10:111; Kabanov et al., FEBS Lett., 1990, 259:327; Svinarchuk et al., Biochimie, 1993, 75:49), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651; Shea et al., Nucl. Acids Res., 1990, 18:3777), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923). Representative United States patents that teach the preparation of such RNA conjugates have been listed above. Typical conjugation protocols involve the synthesis of an RNAs bearing an aminolinker at one or more positions of the sequence. The amino group is then reacted with the molecule being conjugated using appropriate coupling or activating reagents. The conjugation reaction can be performed either with the RNA still bound to the solid support or following cleavage of the RNA, in solution phase. Purification of the RNA conjugate by HPLC typically affords the pure conjugate.

    IV. Delivery of an iRNA of the Invention

    [0710] The delivery of an iRNA of the invention to a cell e.g., a cell within a subject, such as a human subject (e.g., a subject in need thereof, such as a subject having a disorder of lipid metabolism) can be achieved in a number of different ways. For example, delivery may be performed by contacting a cell with an iRNA of the invention either in vitro or in vivo. In vivo delivery may also be performed directly by administering a composition comprising an iRNA, e.g., a dsRNA, to a subject. Alternatively, in vivo delivery may be performed indirectly by administering one or more vectors that encode and direct the expression of the iRNA. These alternatives are discussed further below.

    [0711] In the methods of the invention which include a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1 are covalently attached (i.e., a dual targeting RNAi agent), the delivery of the first agent may be the same or different than the delivery of the second agent.

    [0712] In general, any method of delivering a nucleic acid molecule (in vitro or in vivo) can be adapted for use with an iRNA of the invention (see e.g., Akhtar S. and Julian R L., (1992) Trends Cell. Biol. 2(5):139-144 and WO94/02595, which are incorporated herein by reference in their entireties). For in vivo delivery, factors to consider in order to deliver an iRNA molecule include, for example, biological stability of the delivered molecule, prevention of non-specific effects, and accumulation of the delivered molecule in the target tissue. The non-specific effects of an iRNA can be minimized by local administration, for example, by direct injection or implantation into a tissue or topically administering the preparation. Local administration to a treatment site maximizes local concentration of the agent, limits the exposure of the agent to systemic tissues that can otherwise be harmed by the agent or that can degrade the agent, and permits a lower total dose of the iRNA molecule to be administered. Several studies have shown successful knockdown of gene products when an iRNA is administered locally. For example, intraocular delivery of a VEGF dsRNA by intravitreal injection in cynomolgus monkeys (Tolentino, M J. et al., (2004) Retina 24:132-138) and subretinal injections in mice (Reich, S J. et al. (2003)Mol. Vis. 9:210-216) were both shown to prevent neovascularization in an experimental model of age-related macular degeneration. In addition, direct intratumoral injection of a dsRNA in mice reduces tumor volume (Pille, J. et al. (2005) Mol. Ther. 11:267-274) and can prolong survival of tumor-bearing mice (Kim, W J. et al., (2006) Mol. Ther. 14:343-350; Li, S. et al., (2007)Mol. Ther. 15:515-523). RNA interference has also shown success with local delivery to the CNS by direct injection (Dorn, G. et al., (2004) Nucleic Acids 32:e49; Tan, P H. et al. (2005) Gene Ther. 12:59-66; Makimura, H. et al. (2002) BMC Neurosci. 3:18; Shishkina, G T., et al. (2004) Neuroscience 129:521-528; Thakker, E R., et al. (2004) Proc. Natl. Acad. Sci. U.S.A. 101:17270-17275; Akaneya, Y., et al. (2005) J. Neurophysiol. 93:594-602) and to the lungs by intranasal administration (Howard, K A. et al., (2006) Mol. Ther. 14:476-484; Zhang, X. et al., (2004) J. Biol. Chem. 279:10677-10684; Bitko, V. et al., (2005) Nat. Med. 11:50-55). For administering an iRNA systemically for the treatment of a disease, the RNA can be modified or alternatively delivered using a drug delivery system; both methods act to prevent the rapid degradation of the dsRNA by endo- and exo-nucleases in vivo. Modification of the RNA or the pharmaceutical carrier can also permit targeting of the iRNA composition to the target tissue and avoid undesirable off-target effects. iRNA molecules can be modified by chemical conjugation to lipophilic groups such as cholesterol to enhance cellular uptake and prevent degradation. For example, an iRNA directed against ApoB conjugated to a lipophilic cholesterol moiety was injected systemically into mice and resulted in knockdown of apoB mRNA in both the liver and jejunum (Soutschek, J. et al., (2004) Nature 432:173-178). Conjugation of an iRNA to an aptamer has been shown to inhibit tumor growth and mediate tumor regression in a mouse model of prostate cancer (McNamara, J O. et al., (2006) Nat. Biotechnol. 24:1005-1015). In an alternative embodiment, the iRNA can be delivered using drug delivery systems such as a nanoparticle, a dendrimer, a polymer, liposomes, or a cationic delivery system. Positively charged cationic delivery systems facilitate binding of an iRNA molecule (negatively charged) and also enhance interactions at the negatively charged cell membrane to permit efficient uptake of an iRNA by the cell. Cationic lipids, dendrimers, or polymers can either be bound to an iRNA, or induced to form a vesicle or micelle (see e.g., Kim S H. et al., (2008) Journal of Controlled Release 129(2):107-116) that encases an iRNA. The formation of vesicles or micelles further prevents degradation of the iRNA when administered systemically. Methods for making and administering cationic-iRNA complexes are well within the abilities of one skilled in the art (see e.g., Sorensen, D R., et al. (2003) J. Mol. Biol 327:761-766; Verma, U N. et al., (2003) Clin. Cancer Res. 9:1291-1300; Arnold, A S et al., (2007) J. Hypertens. 25:197-205, which are incorporated herein by reference in their entirety). Some non-limiting examples of drug delivery systems useful for systemic delivery of iRNAs include DOTAP (Sorensen, D R., et al (2003), supra; Verma, U N. et al., (2003), supra), Oligofectamine, “solid nucleic acid lipid particles” (Zimmermann, T S. et al., (2006) Nature 441:111-114), cardiolipin (Chien, P Y. et al., (2005) Cancer Gene Ther. 12:321-328; Pal, A. et al., (2005) Int J. Oncol. 26:1087-1091), polyethyleneimine (Bonnet M E. et al., (2008) Pharm. Res. August 16 Epub ahead of print; Aigner, A. (2006) J. Biomed. Biotechnol. 71659), Arg-Gly-Asp (RGD) peptides (Liu, S. (2006) Mol. Pharm. 3:472-487), and polyamidoamines (Tomalia, D A. et al., (2007) Biochem. Soc. Trans. 35:61-67; Yoo, H. et al., (1999) Pharm. Res. 16:1799-1804). In some embodiments, an iRNA forms a complex with cyclodextrin for systemic administration. Methods for administration and pharmaceutical compositions of iRNAs and cyclodextrins can be found in U.S. Pat. No. 7,427,605, which is herein incorporated by reference in its entirety.

    [0713] A. Vector Encoded iRNAs of the Invention

    [0714] iRNA targeting the LDHA gene and iRNA targeting LDHA and HAO1 can be expressed from transcription units inserted into DNA or RNA vectors (see, e.g., Couture, A, et al., TIG. (1996), 12:5-10; Skillern, A., et al., International PCT Publication No. WO 00/22113, Conrad, International PCT Publication No. WO 00/22114, and Conrad, U.S. Pat. No. 6,054,299). Expression can be transient (on the order of hours to weeks) or sustained (weeks to months or longer), depending upon the specific construct used and the target tissue or cell type. These transgenes can be introduced as a linear construct, a circular plasmid, or a viral vector, which can be an integrating or non-integrating vector. The transgene can also be constructed to permit it to be inherited as an extrachromosomal plasmid (Gassmann, et al., (1995) Proc. Natl. Acad. Sci. USA 92:1292).

    [0715] The individual strand or strands of an iRNA can be transcribed from a promoter on an expression vector. Where two separate strands are to be expressed to generate, for example, a dsRNA, two separate expression vectors can be co-introduced (e.g., by transfection or infection) into a target cell. Alternatively each individual strand of a dsRNA can be transcribed by promoters both of which are located on the same expression plasmid. In one embodiment, a dsRNA is expressed as inverted repeat polynucleotides joined by a linker polynucleotide sequence such that the dsRNA has a stem and loop structure.

    [0716] iRNA expression vectors are generally DNA plasmids or viral vectors. Expression vectors compatible with eukaryotic cells, preferably those compatible with vertebrate cells, can be used to produce recombinant constructs for the expression of an iRNA as described herein. Eukaryotic cell expression vectors are well known in the art and are available from a number of commercial sources. Typically, such vectors are provided containing convenient restriction sites for insertion of the desired nucleic acid segment. Delivery of iRNA expressing vectors can be systemic, such as by intravenous or intramuscular administration, by administration to target cells ex-planted from the patient followed by reintroduction into the patient, or by any other means that allows for introduction into a desired target cell.

    [0717] Viral vector systems which can be utilized with the methods and compositions described herein include, but are not limited to, (a) adenovirus vectors; (b) retrovirus vectors, including but not limited to lentiviral vectors, moloney murine leukemia virus, etc.; (c) adeno-associated virus vectors; (d) herpes simplex virus vectors; (e) SV 40 vectors; (f) polyoma virus vectors; (g) papilloma virus vectors; (h) picornavirus vectors; (i) pox virus vectors such as an orthopox, e.g., vaccinia virus vectors or avipox, e.g. canary pox or fowl pox; and (j) a helper-dependent or gutless adenovirus. Replication-defective viruses can also be advantageous. Different vectors will or will not become incorporated into the cells' genome. The constructs can include viral sequences for transfection, if desired. Alternatively, the construct can be incorporated into vectors capable of episomal replication, e.g. EPV and EBV vectors. Constructs for the recombinant expression of an iRNA will generally require regulatory elements, e.g., promoters, enhancers, etc., to ensure the expression of the iRNA in target cells. Other aspects to consider for vectors and constructs are known in the art.

    V. Pharmaceutical Compositions of the Invention

    [0718] The present invention also includes pharmaceutical compositions and formulations which include the iRNAs of the invention. Accordingly, in one embodiment, provided herein are pharmaceutical compositions comprising a double stranded ribonucleic acid (dsRNA) agent that inhibits expression of lactic acid dehydrogenase A (LDHA) in a cell, such as a liver cell, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO:1, and said antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO:2; and a pharmaceutically acceptable carrier.

    [0719] In another embodiment, provided herein are pharmaceutical compositions comprising a dsRNA agent that inhibits expression of lactic acid dehydrogenase A (LDHA) in a cell, such as a liver cell, wherein the dsRNA agent comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity which comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the antisense sequences listed in any one of Tables 2-5; and a pharmaceutically acceptable carrier.

    [0720] In one embodiment, provided herein are pharmaceutical compositions comprising a first double stranded ribonucleic acid (dsRNA) agent that inhibits expression of lactic acid dehydrogenase A (LDHA) in a cell, such as a liver cell, comprising a sense strand and an antisense strand, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO:1, and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO:2; and a second double stranded ribonucleic acid (dsRNA) agent that inhibits expression of hydroxyacid oxidase 1 (glycolate oxidase) (HAO1) in a cell, such as a liver cell, comprising a sense strand and an antisense strand, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO:21, and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO:22; and a pharmaceutically acceptable carrier.

    [0721] In another embodiment, provided herein are pharmaceutical compositions a first double stranded ribonucleic acid (dsRNA) agent that inhibits expression of lactic acid dehydrogenase A (LDHA) in a cell, such as a liver cell, comprising a sense strand and an antisense strand, the antisense strand comprising a region of complementarity which comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the antisense sequences listed in any one of Tables 2-5; and a second double stranded ribonucleic acid (dsRNA) agent that inhibits expression of hydroxyacid oxidase 1 (glycolate oxidase) (HAO1) in a cell, such as a liver cell, comprising a sense strand and an antisense strand, the antisense strand comprising a region of complementarity which comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the antisense sequences listed in any one of Tables 7-14.

    [0722] In yet another embodiment, the present invention provides pharmaceutical compositions and formulations comprising a dual targeting RNAi agent of the invention, and a pharmaceutically acceptable carrier.

    [0723] The pharmaceutical compositions containing the iRNA of the invention are useful for treating a disease or disorder associated with the expression or activity of an LDHA gene or an LDHA gene and an HAO1 gene, e.g., an oxalate pathway-associated disease, disorder, or condition.

    [0724] Such pharmaceutical compositions are formulated based on the mode of delivery. One example is compositions that are formulated for systemic administration via parenteral delivery, e.g., by intravenous (IV) or for subcutaneous delivery. Another example is compositions that are formulated for direct delivery into the liver, e.g., by infusion into the liver, such as by continuous pump infusion.

    [0725] The pharmaceutical compositions of the invention may be administered in dosages sufficient to inhibit expression of an LDHA gene or an LDHA gene and an HAO1 gene. In general, a suitable dose of an iRNA of the invention will be in the range of about 0.001 to about 200.0 milligrams per kilogram body weight of the recipient per day, generally in the range of about 1 to 50 mg per kilogram body weight per day. Typically, a suitable dose of an iRNA of the invention will be in the range of about 0.1 mg/kg to about 5.0 mg/kg, preferably about 0.3 mg/kg and about 3.0 mg/kg.

    [0726] In the methods of the invention which include a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1, the first agent and the second agent may be present in the same pharmaceutical formulation or separate pharmaceutical formulations.

    [0727] A repeat-dose regimen may include administration of a therapeutic amount of iRNA on a regular basis, such as every other day to once a year. In certain embodiments, the iRNA is administered about once per month to about once per quarter (i.e., about once every three months).

    [0728] After an initial treatment regimen, the treatments can be administered on a less frequent basis.

    [0729] The skilled artisan will appreciate that certain factors can influence the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and other diseases present. Moreover, treatment of a subject with a therapeutically effective amount of a composition can include a single treatment or a series of treatments. Estimates of effective dosages and in vivo half-lives for the individual iRNAs encompassed by the invention can be made using conventional methodologies or on the basis of in vivo testing using an appropriate animal model, as described elsewhere herein.

    [0730] Advances in mouse genetics have generated a number of mouse models for the study of various human diseases, such as an oxalate pathway-associated disease, disorder, or condition that would benefit from reduction in the expression of LDHA and/or LDHA and HAO1. Such models can be used for in vivo testing of iRNA, as well as for determining a therapeutically effective dose. Suitable mouse models are known in the art and include, for example, mouse models which may include mutations or deletions in the AGXT or GRHPR genes (see, e.g., Salido E C, et al. (2006) PNAS 103(48): 18249-18254 and Knight J, et al. (2012) Am. J. Physiol. Renal Physiol. 302: F688-F693); a PH3 mouse model (see, e.g., Li, et al. (2015) biochem Biophys Acta 1852(12):2700); and the ethylene glycol urolithiasis mouse model.

    [0731] The pharmaceutical compositions of the present invention can be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration can be topical (e.g., by a transdermal patch), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal, oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; subdermal, e.g., via an implanted device; or intracranial, e.g., by intraparenchymal, intrathecal or intraventricular, administration.

    [0732] The iRNA can be delivered in a manner to target a particular cell or tissue, such as the liver (e.g., the hepatocytes of the liver).

    [0733] Pharmaceutical compositions and formulations for topical administration can include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like can be necessary or desirable. Coated condoms, gloves and the like can also be useful. Suitable topical formulations include those in which the iRNAs featured in the invention are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants. Suitable lipids and liposomes include neutral (e.g., dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl choline) negative (e.g., dimyristoylphosphatidyl glycerol DMPG) and cationic (e.g., dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidyl ethanolamine DOTMA). iRNAs featured in the invention can be encapsulated within liposomes or can form complexes thereto, in particular to cationic liposomes. Alternatively, iRNAs can be complexed to lipids, in particular to cationic lipids. Suitable fatty acids and esters include but are not limited to arachidonic acid, oleic acid, eicosanoic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, 1-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or a C.sub.1-20 alkyl ester (e.g., isopropylmyristate IPM), monoglyceride, diglyceride or pharmaceutically acceptable salt thereof. Topical formulations are described in detail in U.S. Pat. No. 6,747,014, which is incorporated herein by reference.

    [0734] Compositions and formulations for oral administration include powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders can be desirable. In some embodiments, oral formulations are those in which dsRNAs featured in the invention are administered in conjunction with one or more penetration enhancer surfactants and chelators. Suitable surfactants include fatty acids and/or esters or salts thereof, bile acids and/or salts thereof. Suitable bile acids/salts include chenodeoxycholic acid (CDCA) and ursodeoxychenodeoxycholic acid (UDCA), cholic acid, dehydrocholic acid, deoxycholic acid, glucholic acid, glycholic acid, glycodeoxycholic acid, taurocholic acid, taurodeoxycholic acid, sodium tauro-24,25-dihydro-fusidate and sodium glycodihydrofusidate. Suitable fatty acids include arachidonic acid, undecanoic acid, oleic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, 1-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or a monoglyceride, a diglyceride or a pharmaceutically acceptable salt thereof (e.g., sodium). In some embodiments, combinations of penetration enhancers are used, for example, fatty acids/salts in combination with bile acids/salts. One exemplary combination is the sodium salt of lauric acid, capric acid and UDCA. Further penetration enhancers include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether. DsRNAs featured in the invention can be delivered orally, in granular form including sprayed dried particles, or complexed to form micro or nanoparticles. DsRNA complexing agents include poly-amino acids; polyimines; polyacrylates; polyalkylacrylates, polyoxethanes, polyalkylcyanoacrylates; cationized gelatins, albumins, starches, acrylates, polyethyleneglycols (PEG) and starches; polyalkylcyanoacrylates; DEAE-derivatized polyimines, pollulans, celluloses and starches. Suitable complexing agents include chitosan, N-trimethylchitosan, poly-L-lysine, polyhistidine, polyornithine, polyspermines, protamine, polyvinylpyridine, polythiodiethylaminomethylethylene P(TDAE), polyaminostyrene (e.g., p-amino), poly(methylcyanoacrylate), poly(ethylcyanoacrylate), poly(butylcyanoacrylate), poly(isobutylcyanoacrylate), poly(isohexylcynaoacrylate), DEAE-methacrylate, DEAE-hexylacrylate, DEAE-acrylamide, DEAE-albumin and DEAE-dextran, polymethylacrylate, polyhexylacrylate, poly(D,L-lactic acid), poly(DL-lactic-co-glycolic acid (PLGA), alginate, and polyethyleneglycol (PEG). Oral formulations for dsRNAs and their preparation are described in detail in U.S. Pat. No. 6,887,906, US Publn. No. 20030027780, and U.S. Pat. No. 6,747,014, each of which is incorporated herein by reference.

    [0735] Compositions and formulations for parenteral, intraparenchymal (into the brain), intrathecal, intraventricular or intrahepatic administration can include sterile aqueous solutions which can also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.

    [0736] Pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions can be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids and self-emulsifying semisolids. Particularly preferred are formulations that target the liver when treating hepatic disorders such as hepatic carcinoma.

    [0737] The pharmaceutical formulations of the present invention, which can conveniently be presented in unit dosage form, can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.

    [0738] The compositions of the present invention can be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas. The compositions of the present invention can also be formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions can further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension can also contain stabilizers.

    [0739] A. Additional Formulations

    [0740] i. Emulsions

    [0741] The compositions of the present invention can be prepared and formulated as emulsions. Emulsions are typically heterogeneous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1 μm in diameter (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., Volume 1, p. 245; Block in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 2, p. 335; Higuchi et al., in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 301). Emulsions are often biphasic systems comprising two immiscible liquid phases intimately mixed and dispersed with each other. In general, emulsions can be of either the water-in-oil (w/o) or the oil-in-water (o/w) variety. When an aqueous phase is finely divided into and dispersed as minute droplets into a bulk oily phase, the resulting composition is called a water-in-oil (w/o) emulsion. Alternatively, when an oily phase is finely divided into and dispersed as minute droplets into a bulk aqueous phase, the resulting composition is called an oil-in-water (o/w) emulsion. Emulsions can contain additional components in addition to the dispersed phases, and the active drug which can be present as a solution in either aqueous phase, oily phase or itself as a separate phase. Pharmaceutical excipients such as emulsifiers, stabilizers, dyes, and anti-oxidants can also be present in emulsions as needed. Pharmaceutical emulsions can also be multiple emulsions that are comprised of more than two phases such as, for example, in the case of oil-in-water-in-oil (o/w/o) and water-in-oil-in-water (w/o/w) emulsions. Such complex formulations often provide certain advantages that simple binary emulsions do not. Multiple emulsions in which individual oil droplets of an o/w emulsion enclose small water droplets constitute a w/o/w emulsion. Likewise a system of oil droplets enclosed in globules of water stabilized in an oily continuous phase provides an o/w/o emulsion.

    [0742] Emulsions are characterized by little or no thermodynamic stability. Often, the dispersed or discontinuous phase of the emulsion is well dispersed into the external or continuous phase and maintained in this form through the means of emulsifiers or the viscosity of the formulation. Either of the phases of the emulsion can be a semisolid or a solid, as is the case of emulsion-style ointment bases and creams. Other means of stabilizing emulsions entail the use of emulsifiers that can be incorporated into either phase of the emulsion. Emulsifiers can broadly be classified into four categories: synthetic surfactants, naturally occurring emulsifiers, absorption bases, and finely dispersed solids (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).

    [0743] Synthetic surfactants, also known as surface active agents, have found wide applicability in the formulation of emulsions and have been reviewed in the literature (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), Marcel Dekker, Inc., New York, N.Y., 1988, volume 1, p. 199). Surfactants are typically amphiphilic and comprise a hydrophilic and a hydrophobic portion. The ratio of the hydrophilic to the hydrophobic nature of the surfactant has been termed the hydrophile/lipophile balance (HLB) and is a valuable tool in categorizing and selecting surfactants in the preparation of formulations. Surfactants can be classified into different classes based on the nature of the hydrophilic group: nonionic, anionic, cationic and amphoteric (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y. Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285).

    [0744] Naturally occurring emulsifiers used in emulsion formulations include lanolin, beeswax, phosphatides, lecithin and acacia. Absorption bases possess hydrophilic properties such that they can soak up water to form w/o emulsions yet retain their semisolid consistencies, such as anhydrous lanolin and hydrophilic petrolatum. Finely divided solids have also been used as good emulsifiers especially in combination with surfactants and in viscous preparations. These include polar inorganic solids, such as heavy metal hydroxides, nonswelling clays such as bentonite, attapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum silicate and colloidal magnesium aluminum silicate, pigments and nonpolar solids such as carbon or glyceryl tristearate.

    [0745] A large variety of non-emulsifying materials are also included in emulsion formulations and contribute to the properties of emulsions. These include fats, oils, waxes, fatty acids, fatty alcohols, fatty esters, humectants, hydrophilic colloids, preservatives and antioxidants (Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 335; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).

    [0746] Hydrophilic colloids or hydrocolloids include naturally occurring gums and synthetic polymers such as polysaccharides (for example, acacia, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth), cellulose derivatives (for example, carboxymethylcellulose and carboxypropylcellulose), and synthetic polymers (for example, carbomers, cellulose ethers, and carboxyvinyl polymers). These disperse or swell in water to form colloidal solutions that stabilize emulsions by forming strong interfacial films around the dispersed-phase droplets and by increasing the viscosity of the external phase.

    [0747] Since emulsions often contain a number of ingredients such as carbohydrates, proteins, sterols and phosphatides that can readily support the growth of microbes, these formulations often incorporate preservatives. Commonly used preservatives included in emulsion formulations include methyl paraben, propyl paraben, quaternary ammonium salts, benzalkonium chloride, esters of p-hydroxybenzoic acid, and boric acid. Antioxidants are also commonly added to emulsion formulations to prevent deterioration of the formulation. Antioxidants used can be free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulfite, and antioxidant synergists such as citric acid, tartaric acid, and lecithin.

    [0748] The application of emulsion formulations via dermatological, oral and parenteral routes and methods for their manufacture have been reviewed in the literature (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). Emulsion formulations for oral delivery have been very widely used because of ease of formulation, as well as efficacy from an absorption and bioavailability standpoint (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). Mineral-oil base laxatives, oil-soluble vitamins and high fat nutritive preparations are among the materials that have commonly been administered orally as o/w emulsions.

    [0749] ii. Microemulsions

    [0750] In one embodiment of the present invention, the compositions of iRNAs and nucleic acids are formulated as microemulsions. A microemulsion can be defined as a system of water, oil and amphiphile which is a single optically isotropic and thermodynamically stable liquid solution (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245). Typically microemulsions are systems that are prepared by first dispersing an oil in an aqueous surfactant solution and then adding a sufficient amount of a fourth component, generally an intermediate chain-length alcohol to form a transparent system. Therefore, microemulsions have also been described as thermodynamically stable, isotropically clear dispersions of two immiscible liquids that are stabilized by interfacial films of surface-active molecules (Leung and Shah, in: Controlled Release of Drugs: Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH Publishers, New York, pages 185-215). Microemulsions commonly are prepared via a combination of three to five components that include oil, water, surfactant, cosurfactant and electrolyte. Whether the microemulsion is of the water-in-oil (w/o) or an oil-in-water (o/w) type is dependent on the properties of the oil and surfactant used and on the structure and geometric packing of the polar heads and hydrocarbon tails of the surfactant molecules (Schott, in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 271).

    [0751] The phenomenological approach utilizing phase diagrams has been extensively studied and has yielded a comprehensive knowledge, to one skilled in the art, of how to formulate microemulsions (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245; Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 335). Compared to conventional emulsions, microemulsions offer the advantage of solubilizing water-insoluble drugs in a formulation of thermodynamically stable droplets that are formed spontaneously.

    [0752] Surfactants used in the preparation of microemulsions include, but are not limited to, ionic surfactants, non-ionic surfactants, Brij 96, polyoxyethylene oleyl ethers, polyglycerol fatty acid esters, tetraglycerol monolaurate (ML310), tetraglycerol monooleate (MO310), hexaglycerol monooleate (PO310), hexaglycerol pentaoleate (PO500), decaglycerol monocaprate (MCA750), decaglycerol monooleate (MO750), decaglycerol sequioleate (SO750), decaglycerol decaoleate (DAO750), alone or in combination with cosurfactants. The cosurfactant, usually a short-chain alcohol such as ethanol, 1-propanol, and 1-butanol, serves to increase the interfacial fluidity by penetrating into the surfactant film and consequently creating a disordered film because of the void space generated among surfactant molecules. Microemulsions can, however, be prepared without the use of cosurfactants and alcohol-free self-emulsifying microemulsion systems are known in the art. The aqueous phase can typically be, but is not limited to, water, an aqueous solution of the drug, glycerol, PEG300, PEG400, polyglycerols, propylene glycols, and derivatives of ethylene glycol. The oil phase can include, but is not limited to, materials such as Captex 300, Captex 355, Capmul MCM, fatty acid esters, medium chain (C8-C12) mono, di, and tri-glycerides, polyoxyethylated glyceryl fatty acid esters, fatty alcohols, polyglycolized glycerides, saturated polyglycolized C8-C10 glycerides, vegetable oils and silicone oil.

    [0753] Microemulsions are particularly of interest from the standpoint of drug solubilization and the enhanced absorption of drugs. Lipid based microemulsions (both o/w and w/o) have been proposed to enhance the oral bioavailability of drugs, including peptides (see e.g., U.S. Pat. Nos. 6,191,105; 7,063,860; 7,070,802; 7,157,099; Constantinides et al., Pharmaceutical Research, 1994, 11, 1385-1390; Ritschel, Meth. Find. Exp. Clin. Pharmacol., 1993, 13, 205). Microemulsions afford advantages of improved drug solubilization, protection of drug from enzymatic hydrolysis, possible enhancement of drug absorption due to surfactant-induced alterations in membrane fluidity and permeability, ease of preparation, ease of oral administration over solid dosage forms, improved clinical potency, and decreased toxicity (see e.g., U.S. Pat. Nos. 6,191,105; 7,063,860; 7,070,802; 7,157,099; Constantinides et al., Pharmaceutical Research, 1994, 11, 1385; Ho et al., J. Pharm. Sci., 1996, 85, 138-143). Often microemulsions can form spontaneously when their components are brought together at ambient temperature. This can be particularly advantageous when formulating thermolabile drugs, peptides or iRNAs. Microemulsions have also been effective in the transdermal delivery of active components in both cosmetic and pharmaceutical applications. It is expected that the microemulsion compositions and formulations of the present invention will facilitate the increased systemic absorption of iRNAs and nucleic acids from the gastrointestinal tract, as well as improve the local cellular uptake of iRNAs and nucleic acids.

    [0754] Microemulsions of the present invention can also contain additional components and additives such as sorbitan monostearate (Grill 3), Labrasol, and penetration enhancers to improve the properties of the formulation and to enhance the absorption of the iRNAs and nucleic acids of the present invention. Penetration enhancers used in the microemulsions of the present invention can be classified as belonging to one of five broad categories-surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of these classes has been discussed above.

    [0755] iii. Microparticles

    [0756] an RNAi agent of the invention may be incorporated into a particle, e.g., a microparticle. Microparticles can be produced by spray-drying, but may also be produced by other methods including lyophilization, evaporation, fluid bed drying, vacuum drying, or a combination of these techniques.

    [0757] iv. Penetration Enhancers

    [0758] In one embodiment, the present invention employs various penetration enhancers to effect the efficient delivery of nucleic acids, particularly iRNAs, to the skin of animals. Most drugs are present in solution in both ionized and nonionized forms. However, usually only lipid soluble or lipophilic drugs readily cross cell membranes. It has been discovered that even non-lipophilic drugs can cross cell membranes if the membrane to be crossed is treated with a penetration enhancer. In addition to aiding the diffusion of non-lipophilic drugs across cell membranes, penetration enhancers also enhance the permeability of lipophilic drugs.

    [0759] Penetration enhancers can be classified as belonging to one of five broad categories, i.e., surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, N.Y., 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of the above mentioned classes of penetration enhancers are described below in greater detail.

    [0760] Surfactants (or “surface-active agents”) are chemical entities which, when dissolved in an aqueous solution, reduce the surface tension of the solution or the interfacial tension between the aqueous solution and another liquid, with the result that absorption of iRNAs through the mucosa is enhanced. In addition to bile salts and fatty acids, these penetration enhancers include, for example, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether)(see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, N.Y., 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92); and perfluorochemical emulsions, such as FC-43. Takahashi et al., J. Pharm. Pharmacol., 1988, 40, 252).

    [0761] Various fatty acids and their derivatives which act as penetration enhancers include, for example, oleic acid, lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein (1-monooleoyl-rac-glycerol), dilaurin, caprylic acid, arachidonic acid, glycerol 1-monocaprate, 1-dodecylazacycloheptan-2-one, acylcarnitines, acylcholines, C.sub.1-20 alkyl esters thereof (e.g., methyl, isopropyl and t-butyl), and mono- and di-glycerides thereof (i.e., oleate, laurate, caprate, myristate, palmitate, stearate, linoleate, etc.)(see e.g., Touitou, E., et al. Enhancement in Drug Delivery, CRC Press, Danvers, Mass., 2006; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; El Hariri et al., J. Pharm. Pharmacol., 1992, 44, 651-654).

    [0762] The physiological role of bile includes the facilitation of dispersion and absorption of lipids and fat-soluble vitamins (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, N.Y., 2002; Brunton, Chapter 38 in: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al. Eds., McGraw-Hill, New York, 1996, pp. 934-935). Various natural bile salts, and their synthetic derivatives, act as penetration enhancers. Thus the term “bile salts” includes any of the naturally occurring components of bile as well as any of their synthetic derivatives. Suitable bile salts include, for example, cholic acid (or its pharmaceutically acceptable sodium salt, sodium cholate), dehydrocholic acid (sodium dehydrocholate), deoxycholic acid (sodium deoxycholate), glucholic acid (sodium glucholate), glycholic acid (sodium glycocholate), glycodeoxycholic acid (sodium glycodeoxycholate), taurocholic acid (sodium taurocholate), taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic acid (sodium chenodeoxycholate), ursodeoxycholic acid (UDCA), sodium tauro-24,25-dihydro-fusidate (STDHF), sodium glycodihydrofusidate and polyoxyethylene-9-lauryl ether (POE) (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, N.Y., 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Swinyard, Chapter 39 In: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990, pages 782-783; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Yamamoto et al., J. Pharm. Exp. Ther., 1992, 263, 25; Yamashita et al., J. Pharm. Sci., 1990, 79, 579-583).

    [0763] Chelating agents, as used in connection with the present invention, can be defined as compounds that remove metallic ions from solution by forming complexes therewith, with the result that absorption of iRNAs through the mucosa is enhanced. With regards to their use as penetration enhancers in the present invention, chelating agents have the added advantage of also serving as DNase inhibitors, as most characterized DNA nucleases require a divalent metal ion for catalysis and are thus inhibited by chelating agents (Jarrett, J. Chromatogr., 1993, 618, 315-339). Suitable chelating agents include but are not limited to disodium ethylenediaminetetraacetate (EDTA), citric acid, salicylates (e.g., sodium salicylate, 5-methoxysalicylate and homovanilate), N-acyl derivatives of collagen, laureth-9 and N-amino acyl derivatives of beta-diketones (enaminesxsee e.g., Katdare, A. et al., Excipient development for pharmaceutical, biotechnology, and drug delivery, CRC Press, Danvers, Mass., 2006; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Buur et al., J. Control Rel., 1990, 14, 43-51).

    [0764] As used herein, non-chelating non-surfactant penetration enhancing compounds can be defined as compounds that demonstrate insignificant activity as chelating agents or as surfactants but that nonetheless enhance absorption of iRNAs through the alimentary mucosa (see e.g., Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33). This class of penetration enhancers includes, for example, unsaturated cyclic ureas, 1-alkyl- and 1-alkenylazacyclo-alkanone derivatives (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92); and non-steroidal anti-inflammatory agents such as diclofenac sodium, indomethacin and phenylbutazone (Yamashita et al., J. Pharm. Pharmacol., 1987, 39, 621-626).

    [0765] Agents that enhance uptake of iRNAs at the cellular level can also be added to the pharmaceutical and other compositions of the present invention. For example, cationic lipids, such as lipofectin (Junichi et al, U.S. Pat. No. 5,705,188), cationic glycerol derivatives, and polycationic molecules, such as polylysine (Lollo et al., PCT Application WO 97/30731), are also known to enhance the cellular uptake of dsRNAs. Examples of commercially available transfection reagents include, for example Lipofectamine™ (Invitrogen; Carlsbad, Calif.), Lipofectamine 2000™ (Invitrogen; Carlsbad, Calif.), 293Fectin™ (Invitrogen; Carlsbad, Calif.), Cellfectin™ (Invitrogen; Carlsbad, Calif.), DMRIE-C™ (Invitrogen; Carlsbad, Calif.), FreeStyle™ MAX (Invitrogen; Carlsbad, Calif.), Lipofectamine™ 2000 CD (Invitrogen; Carlsbad, Calif.), Lipofectamine™ (Invitrogen; Carlsbad, Calif.), RNAiMAX (Invitrogen; Carlsbad, Calif.), Oligofectamine™ (Invitrogen; Carlsbad, Calif.), Optifect™ (Invitrogen; Carlsbad, Calif.), X-tremeGENE Q2 Transfection Reagent (Roche; Grenzacherstrasse, Switzerland), DOTAP Liposomal Transfection Reagent (Grenzacherstrasse, Switzerland), DOSPER Liposomal Transfection Reagent (Grenzacherstrasse, Switzerland), or Fugene (Grenzacherstrasse, Switzerland), Transfectam® Reagent (Promega; Madison, Wis.), TransFast™ Transfection Reagent (Promega; Madison, Wis.), Tfx™-20 Reagent (Promega; Madison, Wis.), Tfx™-50 Reagent (Promega; Madison, Wis.), DreamFect™ (OZ Biosciences; Marseille, France), EcoTransfect (OZ Biosciences; Marseille, France), TransPass.sup.a D1 Transfection Reagent (New England Biolabs; Ipswich, Mass., USA), LyoVec™/LipoGen™ (Invitrogen; San Diego, Calif., USA), PerFectin Transfection Reagent (Genlantis; San Diego, Calif., USA), NeuroPORTER Transfection Reagent (Genlantis; San Diego, Calif., USA), GenePORTER Transfection reagent (Genlantis; San Diego, Calif., USA), GenePORTER 2 Transfection reagent (Genlantis; San Diego, Calif., USA), Cytofectin Transfection Reagent (Genlantis; San Diego, Calif., USA), BaculoPORTER Transfection Reagent (Genlantis; San Diego, Calif., USA), TroganPORTER™ transfection Reagent (Genlantis; San Diego, Calif., USA), RiboFect (Bioline; Taunton, Mass., USA), PlasFect (Bioline; Taunton, Mass., USA), UniFECTOR (B-Bridge International; Mountain View, Calif., USA), SureFECTOR (B-Bridge International; Mountain View, Calif., USA), or HiFect™ (B-Bridge International, Mountain View, Calif., USA), among others.

    [0766] Other agents can be utilized to enhance the penetration of the administered nucleic acids, including glycols such as ethylene glycol and propylene glycol, pyrrols such as 2-pyrrol, azones, and terpenes such as limonene and menthone.

    [0767] v. Carriers

    [0768] Certain compositions of the present invention also incorporate carrier compounds in the formulation. As used herein, “carrier compound” or “carrier” can refer to a nucleic acid, or analog thereof, which is inert (i.e., does not possess biological activity per se) but is recognized as a nucleic acid by in vivo processes that reduce the bioavailability of a nucleic acid having biological activity by, for example, degrading the biologically active nucleic acid or promoting its removal from circulation. The coadministration of a nucleic acid and a carrier compound, typically with an excess of the latter substance, can result in a substantial reduction of the amount of nucleic acid recovered in the liver, kidney or other extracirculatory reservoirs, presumably due to competition between the carrier compound and the nucleic acid for a common receptor. For example, the recovery of a partially phosphorothioate dsRNA in hepatic tissue can be reduced when it is coadministered with polyinosinic acid, dextran sulfate, polycytidic acid or 4-acetamido-4′isothiocyano-stilbene-2,2′-disulfonic acid (Miyao et al., DsRNA Res. Dev., 1995, 5, 115-121; Takakura et al., DsRNA & Nucl. Acid Drug Dev., 1996, 6, 177-183.

    [0769] vi. Excipients

    [0770] In contrast to a carrier compound, a “pharmaceutical carrier” or “excipient” is a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal. The excipient can be liquid or solid and is selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition. Typical pharmaceutical carriers include, but are not limited to, binding agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulphate, etc).

    [0771] Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration which do not deleteriously react with nucleic acids can also be used to formulate the compositions of the present invention. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.

    [0772] Formulations for topical administration of nucleic acids can include sterile and non-sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohols, or solutions of the nucleic acids in liquid or solid oil bases. The solutions can also contain buffers, diluents and other suitable additives. Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration which do not deleteriously react with nucleic acids can be used.

    [0773] Suitable pharmaceutically acceptable excipients include, but are not limited to, water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.

    [0774] vii. Other Components

    [0775] The compositions of the present invention can additionally contain other adjunct components conventionally found in pharmaceutical compositions, at their art-established usage levels. Thus, for example, the compositions can contain additional, compatible, pharmaceutically-active materials such as, for example, antipruritics, astringents, local anesthetics or anti-inflammatory agents, or can contain additional materials useful in physically formulating various dosage forms of the compositions of the present invention, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers. However, such materials, when added, should not unduly interfere with the biological activities of the components of the compositions of the present invention. The formulations can be sterilized and, if desired, mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings and/or aromatic substances and the like which do not deleteriously interact with the nucleic acid(s) of the formulation.

    [0776] Aqueous suspensions can contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension can also contain stabilizers.

    [0777] In some embodiments, pharmaceutical compositions featured in the invention include (a) one or more iRNA compounds and (b) one or more agents which function by a non-RNAi mechanism and which are useful in treating an oxalate pathway-associated disease, disorder, or condition. Examples of such agents include, but are not limited to pyridoxine, an ACE inhibitor (angiotensin converting enzyme inhibitors), e.g., benazepril (Lotensin); an angiotensin II receptor antagonist (ARB) (e.g., losartan potassium, such as Merck & Co.'s Cozaar®), e.g., Candesartan (Atacand); an HMG-CoA reductase inhibitor (e.g., a statin); dietary oxalate degrading compounds, e.g., Oxalate decarboxylase (Oxazyme); calcium binding agents, e.g., Sodium cellulose phosphate (Calcibind); diuretics, e.g., thiazide diuretics, such as hydrochlorothiazide (Microzide); phosphate binders, e.g., Sevelamer (Renagel); magnesium and Vitamin B6 supplements; potassium citrate; orthophosphates, bisphosphonates; oral phosphate and citrate solutions; high fluid intake, urinary tract endoscopy; extracorporeal shock wave lithotripsy; kidney dialysis; kidney stone removal (e.g., surgery); and kidney/liver transplant; or a combination of any of the foregoing.

    [0778] Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD.sub.50 (the dose lethal to 50% of the population) and the ED.sub.50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD.sub.50/ED.sub.50. Compounds that exhibit high therapeutic indices are preferred.

    [0779] The data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of compositions featured herein in the invention lies generally within a range of circulating concentrations that include the ED.sub.50 with little or no toxicity. The dosage can vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the methods featured in the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose can be formulated in animal models to achieve a circulating plasma concentration range of the compound or, when appropriate, of the polypeptide product of a target sequence (e.g., achieving a decreased concentration of the polypeptide) that includes the IC.sub.50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma can be measured, for example, by high performance liquid chromatography.

    [0780] In addition to their administration, as discussed above, the iRNAs featured in the invention can be administered in combination with other known agents effective in treatment of pathological processes mediated by LDHA or LDHA and HAO1 expression. In any event, the administering physician can adjust the amount and timing of iRNA administration on the basis of results observed using standard measures of efficacy known in the art or described herein.

    VI. Methods of the Invention

    [0781] The present invention also provides methods of using an iRNA of the invention and/or a composition of the invention to reduce and/or inhibit LDHA or LDHA and HAO1 expression in a cell, such as a cell in a subject. The methods include contacting the cell with a RNAi agent (or pharmaceutical composition comprising an iRNA agent) or pharmaceutical composition of the invention. In some embodiments, the cell is maintained for a time sufficient to obtain degradation of the mRNA transcript of an LDHA gene. In other embodiments, the cell is maintained for a time sufficient to obtain degradation of the mRNA transcript of an LDHA gene and an HAO1 gene in the cell.

    [0782] It should be noted that, although the compositions of the invention target LDHA, an enzyme involved in numerous cellular processes (see, e.g., FIGS. 1A and 1B), as demonstrated in the Examples below, contacting a cell with a composition of the invention, or administering a composition of the invention to a subject, does not result in adverse effects in either wild-type or diseased subjects, thereby demonstrating the safety of the compostions of the invention.

    [0783] Reduction in gene expression can be assessed by any methods known in the art. For example, a reduction in the expression of LDHA, and/or HAO1, and/or glycolate may be determined by determining the mRNA expression level of LDHA, and/or HAO1, and/or glycolate using methods routine to one of ordinary skill in the art, e.g., Northern blotting, qRT-PCR; by determining the protein level of LDHA, and/or HAO1, and/or glycolate using methods routine to one of ordinary skill in the art, such as Western blotting, immunological techniques. A reduction in the expression of LDHA, and/or HAO1, and/or glycolate may also be assessed indirectly by measuring a decrease in biological activity of LDHA, and/or HAO1, and/or glycolate, e.g., a decrease in the enzymatic activity of LDHA and/or a decrease in tissue or plasma oxalate, or urinary oxalate and/or glycolate excretion.

    [0784] In the methods of the invention the cell may be contacted in vitro or in vivo, i.e., the cell may be within a subject.

    [0785] A cell suitable for treatment using the methods of the invention may be any cell that expresses an LDHA gene, a cell that expresses an HAO1 gene, a cell that expresses a glycolate gene, a cell that expresses, an LDHA gene and a glycolate gene, a cell that expresses an HAO1gene and a glycolate gene, a cell that expresses an LDHA gene and an HAO1 gene, or a cell that expresses an LDHA gene, an HAO1 gene, and a glycolate gene. A cell suitable for use in the methods of the invention may be a mammalian cell, e.g., a primate cell (such as a human cell or a non-human primate cell, e.g., a monkey cell or a chimpanzee cell), a non-primate cell (such as a cow cell, a pig cell, a camel cell, a llama cell, a horse cell, a goat cell, a rabbit cell, a sheep cell, a hamster, a guinea pig cell, a cat cell, a dog cell, a rat cell, a mouse cell, a lion cell, a tiger cell, a bear cell, or a buffalo cell), a bird cell (e.g., a duck cell or a goose cell), or a whale cell. In one embodiment, the cell is a human cell, e.g., a human liver cell.

    [0786] LDHA expression is inhibited in the cell by at least about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or about 100%. In preferred embodiments, LDHA expression is inhibited by at least 20%.

    [0787] HAO1 expression may be inhibited in the cell by at least about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or about 100%. In preferred embodiments, HAO1 expression is inhibited by at least 20%.

    [0788] In embodiments in which a cell is contacted with a dual targeting RNAi agent of the invention, the level of inhibition of LDHA may be the same or different than the level of HAO1.

    [0789] In one embodiment, the in vivo methods of the invention may include administering to a subject a composition containing an iRNA, where the iRNA includes a nucleotide sequence that is complementary to at least a part of an RNA transcript of the LDHA gene of the mammal to be treated. In another embodiment, the in vivo methods of the invention may include administering to a subject a composition containing an iRNA, where the iRNA includes a nucleotide sequence that is complementary to at least a part of an RNA transcript of the LDHA gene and a nucleotide sequence that is complementary to at least a part of an RNA transcript of the HAO1 gene of the mammal to be treated.

    [0790] When the organism to be treated is a mammal such as a human, the composition can be administered by any means known in the art including, but not limited to oral, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal and intrathecal), intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), nasal, rectal, and topical (including buccal and sublingual) administration. In certain embodiments, the compositions are administered by intravenous infusion or injection. In certain embodiments, the compositions are administered by subcutaneous injection.

    [0791] In some embodiments, the administration is via a depot injection. A depot injection may release the iRNA in a consistent way over a prolonged time period. Thus, a depot injection may reduce the frequency of dosing needed to obtain a desired effect, e.g., a desired inhibition of LDHA, or a desired inhibition of both LDHA and HAO1, or a therapeutic or prophylactic effect. A depot injection may also provide more consistent serum concentrations. Depot injections may include subcutaneous injections or intramuscular injections. In preferred embodiments, the depot injection is a subcutaneous injection.

    [0792] In some embodiments, the administration is via a pump. The pump may be an external pump or a surgically implanted pump. In certain embodiments, the pump is a subcutaneously implanted osmotic pump. In other embodiments, the pump is an infusion pump. An infusion pump may be used for intravenous, subcutaneous, arterial, or epidural infusions. In preferred embodiments, the infusion pump is a subcutaneous infusion pump. In other embodiments, the pump is a surgically implanted pump that delivers the iRNA to the liver.

    [0793] An iRNA of the invention may be present in a pharmaceutical composition, such as in a suitable buffer solution. The buffer solution may comprise acetate, citrate, prolamine, carbonate, or phosphate, or any combination thereof. In one embodiment, the buffer solution is phosphate buffered saline (PBS). The pH and osmolarity of the buffer solution containing the iRNA can be adjusted such that it is suitable for administering to a subject.

    [0794] Alternatively, an iRNA of the invention may be administered as a pharmaceutical composition, such as a dsRNA liposomal formulation.

    [0795] The mode of administration may be chosen based upon whether local or systemic treatment is desired and based upon the area to be treated. The route and site of administration may be chosen to enhance targeting.

    [0796] In one aspect, the present invention also provides methods for inhibiting the expression of an LDHA gene in a mammal. The methods include administering to the mammal a composition comprising a dsRNA that targets an LDHA gene in a cell of the mammal, thereby inhibiting expression of the LDHA gene in the cell.

    [0797] In another aspect, the present invention also provides methods for inhibiting the expression of an LDHA gene and an HAO1 gene in a mammal. The methods include administering to the mammal a pharmaceutical composition comprising a dsRNA agent that targets an LDHA gene and a dsRNA agent that targets an HAO1 gene in a cell of the mammal, thereby inhibiting expression of the LDHA gene and the HAO1 gene in the mammal. In one aspect, the present invention provides methods for inhibiting the expression of an LDHA gene and an HAO1 gene in a mammal. The methods include administering to the mammal a dual targeting RNAi agent (or pharmaceutical composition comprising a dual targeting agent) that targets an LDHA gene and an HAO1 gene in a cell of the mammal, thereby inhibiting expression of the LDHA gene and the HAO1 gene in the subject.

    [0798] Reduction in gene expression can be assessed by any methods known it the art and by methods, e.g. qRT-PCR, described herein. Reduction in protein production can be assessed by any methods known it the art and by methods, e.g. ELISA, enzymatic activity, described herein.

    [0799] The present invention also provides therapeutic and prophylactic methods which include administering to a subject having, or prone to developing an oxalate-associate disease, disorder, or condition, the iRNA agents, pharmaceutical compositions comprising an iRNA agent, or vectors comprising an iRNA of the invention.

    [0800] In one aspect, the present invention provides methods of treating a subject having a disorder that would benefit from reduction in LDHA expression, e.g., an oxalate pathway-associated disease, disorder, or condition.

    [0801] The treatment methods (and uses) of the invention include administering to the subject, e.g., a human, a therapeutically effective amount of a dsRNA agent, a dual targeting iRNA agent or a pharmaceutical composition comprising a dsRNA, a pharmaceutical compositions comprising a dual targeting RNAi agent or pharmaceutical composition of the invention comprising a first dsRNA agent that inhibits expression of LDHA and a second dsRNA agent that inhibits expression of HAO1, thereby treating the subject.

    [0802] In one aspect, the invention provides methods of preventing at least one symptom in a subject having a disorder that would benefit from reduction in LDHA expression, e.g., an oxalate pathway-associated disease, disorder, or condition. The methods include administering to the subject a prophylactically effective amount of dsRNA agent, a dual targeting iRNA agent or a pharmaceutical composition comprising a dsRNA, a pharmaceutical compositions comprising a dual targeting RNAi agent or pharmaceutical composition of the invention comprising a first dsRNA agent that inhibits expression of LDHA and a second dsRNA agent that inhibits expression of HAO1, thereby preventing at least one symptom in the subject.

    [0803] Subjects that would benefit from a reduction and/or inhibition of an LDHA gene expression include subjects that would benefit from reduction in both LDHA and HAO1 gene expression.

    [0804] Therefore, in one embodiment, a subject that would benefit from reduction in the expression level of LDHA or a reduction in the expression of LDHA and HAO1, has normal urinary oxalate excretion levels, e.g., less than about 40 mg (440 μmol) in 24 hours (e.g., men have a normal urinary oxalate excretion level of less than about 43 mg/day and women have a normal urinary oxalate excretion level of less than about 32 mg/day). In another embodiment, a subject that would benefit from a reduction in the expression level of LDHA or a reduction in the expression of LDHA and HAO1 has mild hyperoxaluria (a urinary oxalate excretion level of about 40 to about 60 mg/day). In another embodiment, a subject that would benefit from reduction in the expression level of LDHA or a reduction in the expression of LDHA and HAO1 has high hyperoxaluria (a urinary oxalate excretion level of greater than about 60 mg/day).

    [0805] In one embodiment, a subject that would benefit from reduction in LDHA expression or LDHA and HAO1 expression is a human at risk of developing an oxalate pathway-associated disease, disorder, or condition. In one embodiment, a subject that would benefit from reduction in LDHA expression or LDHA and HAO1 expression is a human having an oxalate pathway-associated disease, disorder, or condition. In yet another embodiment, a subject that would benefit from reduction in LDHA expression or LDHA and HAO1 expression is a human being treated for an oxalate pathway-associated disease, disorder, or condition.

    [0806] In one embodiment, a subject having an oxalate pathway-associated disease, disorder, or condition has an oxalate-associated disease, disorder, or condition. Non-limiting examples of oxalate-associated disease, disorder, or condition include a kidney stone formation disease, disorder, or condition, or a calcium oxalate tissue deposition disease, disorder, or condition. The kidney stone formation disease, disorder, or condition may be a calcium oxalate stone formation disease, disorder, or condition or a non-calcium oxalate stone formation disease, disorder, or condition. The calcium oxalate stone formation disease, disorder, or condition may be a hyperoxaluria disease, disorder, or condition (e.g., mild hyperoxaluria (a urinary oxalate excretion level of about 40 to about 60 mg/day) or high hyperoxaluria (a urinary oxalate excretion level of greater than about 60 mg/day)); or a non-hyperoxaluria disease, disorder, or condition (i.e., a calcium oxalate stone formation disease without hyperoxaluria, e.g., normal urinary oxalate excretion levels, e.g., less than about 40 mg (440 μmol) in 24 hours (e.g., men have a normal urinary oxalate excretion level of less than about 43 mg/day and women have a normal urinary oxalate excretion level of less than about 32 mg/day).

    [0807] In one embodiment, the hyperoxaluria disease, disorder, or condition is selected from the group consisting of primary hyperoxaluria, enteric hyperoxaluria, dietary hyperoxaluria, and idiopathic hyperoxaluria.

    [0808] In one embodiment, the non-hyperoxaluria stone formation disease, disorder, or condition is hypercalciuria and/or hypocitraturia. In another embodiment, the non-hyperoxaluria stone formation disease, disorder, or condition is calcium oxalate or non-calcium oxalate kidney stone formation disease.

    [0809] In one embodiment, the calcium oxalate stone formation disease, disorder, or condition is an inherited disorder, such as a Primary Hyperoxaluria (PH), e.g., Primary Hyperoxaluria Type 1 (PH1); Primary Hyperoxaluria Type 2 (PH2); Primary Hyperoxaluria Type 3 (PH3); or Primary Hyperoxaluria Non-Type 1, Non-Type 2, Non-Type 3 (PH-Non-Type 1, Non-Type 2, Non-Type 3). PH1 is a hereditary disorder caused by mutations in alanine glyoxylate aminotransferase (AGT), PH2 is due to mutations in glyoxylate reductase/hydroxypyruvate reductase (GRHPR), and PH3 is caused by mutations in HOGA1 (formerly DHDPSL). Subjects having PH-Non-Type 1, Non-Type 2, Non-Type 3 have clinical characteristics indistinguishable from type 1, 2, and 3, but with normal AGT, GRHPR, and HOGA1 liver enzyme activity, yet the etiology of the marked hyperoxaluria in such subjects remains to be elucidated.

    [0810] A deficiency in either AGT or GRHPR activities results in an excess of glyoxylate and oxalate (see, e.g., Knight et al., (2011) Am J Physiol Renal Physiol 302(6): F688-F693). Therefore, inhibition of LDHA expression and/or activity will decrease the level of excess oxalate. In addition, the inhibition of glycolate oxidase (HAO1) will further reduce the level of glyoxylate. The buildup of oxalate in subjects having PH causes increased excretion of oxalate, which in turn results in renal and bladder stones. Stones cause urinary obstruction (often with severe and acute pain), secondary infection of urine and eventually kidney damage. Oxalate stones tend to be severe, resulting in relatively early kidney damage (e.g., onset in teenage years to early adulthood), which impairs the excretion of oxalate, leading to a further acceleration in accumulation of oxalate in the body. After the development of renal failure, patients may get deposits of oxalate in the bones, joints and bone marrow. Severe cases may develop haematological problems such as anaemia and thrombocytopaenia. The deposition of oxalate in the body is sometimes called “oxalosis” to be distinguished from “oxaluria” which refers to oxalate in the urine. Renal failure is a serious complication requiring treatment in its own right. Dialysis can control renal failure but tends to be inadequate to dispose of excess oxalate. Renal transplant is more effective and this is the primary treatment of severe hyperoxaluria. Liver transplantation (often in addition to renal transplant) may be able to control the disease by correcting the metabolic defect. In a proportion of patients with primary hyperoxaluria type 1, pyridoxine treatment (vitamin B6) may also decrease oxalate excretion and prevent kidney stone formation.

    [0811] As exemplified in Example 3, the level of endogenous oxalate excreted in the urine of an art recognized animal model of PH1, e.g., an Agxt deficient mouse, was reduced following administration of an LDHA-specific siRNA (see, e.g., FIG. 6). Accordingly, in one aspect, the present invention provides methods for treating a subject having PH1. The methods include administering to the subject a therapeutically effective amount of a dsRNA targeting an LDHA gene and/or an HAO1 gene, a pharmaceutical composition comprising a dsRNA agent that targets an LDHA gene and/or a dsRNA agent that targets an HAO1 gene.

    [0812] As also exemplified in Example 3, the level of endogenous oxalate excreted in the urine of an art recognized animal model of PH2, e.g., a Grhpr deficient mouse, was reduced following administration of an LDHA-specific siRNA (see, e.g., FIG. 6). Accordingly, in one aspect, the present invention provides methods for treating a subject having PH2. The methods include administering to the subject a therapeutically effective amount of a dsRNA targeting an LDHA gene and/or an HAO1 gene, a pharmaceutical composition comprising a dsRNA agent that targets an LDHA gene and/or a dsRNA agent that targets an HAO1 gene in a cell of the subject.

    [0813] In some embodiment, the methods for treating a subject having PH2 further include altering the diet of the subject (e.g., decreasing protein intake, decreasing sodium intake, decreasing ascorbic acid intake, moderating calcium intake, supplementing phosphate, supplementing magnesium, or pyridoxine treatment; or a combination of any of the foregoing) and/or transplanting a kidney in the subject

    [0814] In another embodiment, the calcium oxalate stone formation disease, disorder, or condition is enteric hyperoxaluria. Enteric hyperoxaluria is the formation of calcium oxalate calculi in the urinary tract due to excessive absorption of oxalate from the colon, occurring as a result of intestinal bacterial overgrowth syndromes, fat malabsorption, chronic biliary or pancreatic disease, various intestinal surgical procedures, gastric bypass surgery, inflammatory bowel disease, or any medical condition that causes chronic diarrhea, e.g., Crohn's disease or ulcerative colitis).

    [0815] In another embodiment, the calcium oxalate stone formation disease, disorder, or condition is dietary hyperoxaluria, e.g., hyperoxaluria as a result of too much oxalate in the diet, e.g., from too much spinach, rhubarb, almonds, bulgur, millet, corn grits, soy flour, cornmeal, navy beans, etc.

    [0816] In another embodiment, the calcium oxalate stone formation disease, disorder, or condition is idiopathic hyperoxaluria. Subjects having idiopathic hyperoxaluria have above normal levels of urinary oxalate of unknown cause, but still develop stones. Subjects at risk of developing idiopathic hyperoxaluria include diabetics and obese subjects. For example, epidemiological data has demonstrated that as body mass index (BMI) increases, urinary oxalate excretion increases and subjects having diabetes have increases urinary oxalate levels.

    [0817] In one embodiment, the non-calcium oxalate stone formation disease, disorder, or condition is hypercalciuria (hypercalcinuria). Hypercalciuria is a condition of elevated calcium in the urine. Chronic hypercalcinuria may lead to impairment of renal function, nephrocalcinosis, and renal insufficiency. Subjects at risk of developing hypercalciuria include subjects having Dent's disease, absorptive hypercalciuria, and primary hyperparathyroid.

    [0818] In another embodiment, the non-calcium oxalate stone formation disease, disorder, or condition is hypocitraturia. In one embodiment, the hypocitraturia is severe hypocitraturia, e.g., citrate excretion of less than 100 mg per day. In another embodiment, the hypocitraturia is mild to moderate hypocitraturi, e.g., citrate excretion of 100-320 mg per day.

    [0819] In one embodiment, a non-calcium oxalate stone formation disease, disorder, or condition is a disease, disorder, or condition, such as a ureterolithiasis or a nephrocalcinosis, of calcium stones; struvite (magnesium ammonium phosphate) stones; uric acid stones; or cystine stones. Although the primary component of the stones in such diseases, disorders, and conditions is other than oxalate, oxalate may still be present and form a nidus for further growth of the stones. Accordingly, subjects having a disease, disorder, or condition of calcium stones, struvite (magnesium ammonium phosphate) stones, uric acid stones, or cystine stones would benefit from the methods of the invention.

    [0820] In one embodiment, an oxalate-associated disease, disorder, or condition is a calcium oxalate tissue deposition disease, disorder, or condition. For example, when glomerular filtration rate (GFR) drops below about 30-40 mL/min per 1.73 m.sup.2, renal capacity to excrete calcium oxalate is significantly impaired. At this stage, calcium oxalate starts to deposit in extrarenal tissues. Calcium oxalate deposits may occur in the thyroid, breasts, kidneys, bones, and bone marrow, myocardium, cardiac conduction system. This leads to cardiomyopathy, heart block and other cardiac conduction defects, vascular disease, retinopathy, synovitis, oxalate osteopathy and anemia that is noted to be resistant to treatment. The deposition of calcium oxalate mat be systemic or tissue specific. For example, subjects having arthritis, sarcoidosis, end-stage renal disease are at risk of developing systemic calcium oxalate tissue deposition disease, disorder, or condition. Subjects at risk of developing tissue specific depositions in the kidney, for example, include subjects having medullary sponge kidney, nephrocalcinosis, renal tubular acidosis (RTA), and transplant recipients, e.g., kidney transplant recipients.

    [0821] In one embodiment, an oxalate pathway-associated disease, disorder, or condition is a lactate dehydrogenase-associated disease, disorder, or condition. Non-limiting examples of lactate dehydrogenase-associated diseases, disorders, or conditions include cancer, e.g., cancer, e.g., hepatocellular carcinoma, fatty liver (steatosis), nonalcoholic steatohepatitis (NASH), cirrhosis of the liver, accumulation of fat in the liver, inflammation of the liver, hepatocellular necrosis, liver fibrosis, and nonalcoholic fatty liver disease (NAFLD).

    [0822] A diagnosis of nonalcoholic fatty liver disease (NAFLD) requires that (a) there is evidence of hepatic steatosis, either by imaging or by histology and (b) there are no causes for secondary hepatic fat accumulation such as significant alcohol consumption, use of steatogenic medication or hereditary disorders. In the majority of patients, NAFLD is associated with metabolic risk factors such as obesity, diabetes mellitus, and dyslipidemia. NAFLD is histologically further categorized into nonalcoholic fatty liver (NAFL) and nonalcoholic steatohepatitis (NASH). NAFL is defined as the presence of hepatic steatosis with no evidence of hepatocellular injury in the form of ballooning of the hepatocytes. NASH is defined as the presence of hepatic steatosis and inflammation with hepatocyte injury (ballooning) with or without fibrosis (Chalasani et al., Hepatol. 55:2005-2023, 2012). It is generally agreed that patients with simple steatosis have very slow, if any, histological progression, while patients with NASH can exhibit histological progression to cirrhotic-stage disease. The long term outcomes of patients with NAFLD and NASH have been reported in several studies.

    [0823] LHDA is required for the initiation, maintenance and progression of tumors (Shi and Pinto, PLOS ONE 2014, 9(1), e86365; Le et al. Proc Natl Acad Sci USA 107: 2037-2042) and up-regulation of LDHA is a characteristic of many cancer types (Goldman R D et al., Cancer Res 24: 389-399; Koukourakis M I, et al, Br J Cancer 89: 877-885; Koukourakis M I, et al, L J Clin Oncol 24: 4301-4308; Kolev Y, et al, Ann Surg Oncol 15: 2336-2344; Zhuang L, et al, Mod Pathol 23: 45-53), including, e.g., breast cancer, lymphoma, renal cancer (including renal cell cancer tumors), hereditary leiomyomatosis, pancreatic cancer, liver cancer (including hepatocellular carcinoma), and other forms of cancer.

    [0824] In another aspect, the present invention provides uses of a therapeutically effective amount of a dsRNA agent, a dual targeting iRNA agent or a pharmaceutical composition comprising a dsRNA, a pharmaceutical compositions comprising a dual targeting RNAi agent or pharmaceutical composition of the invention comprising a first dsRNA agent that inhibits expression of LDHA and a second dsRNA agent that inhibits expression of HAO1 for treating a subject, e.g., a subject that would benefit from a reduction and/or inhibition of LDHA expression or LDHA and HAO1 expression, e.g., an oxalate pathway-associated disease, disorder, or condition.

    [0825] In a further aspect, the present invention provides uses of a dual targeting iRNA agent or a pharmaceutical composition comprising of a dsRNA agent, a dual targeting iRNA agent or a pharmaceutical composition comprising a dsRNA, a pharmaceutical composition comprising a dual targeting RNAi agent or pharmaceutical composition of the invention comprising a first dsRNA agent that inhibits expression of LDHA and a second dsRNA agent that inhibits expression of HAO1 in the manufacture of a medicament for treating a subject, e.g., a subject that would benefit from a reduction and/or inhibition of LDHA expression or LDHA and HAO1 expression, e.g., an oxalate pathway-associated disease, disorder, or condition.

    [0826] In the methods (and uses) of the invention which comprise administering to a subject a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1, the first and second dsRNA agents may be formulated in the same composition or different compositions and may administered to the subject in the same composition or in separate compositions.

    [0827] The dsRNA agent may be administered to the subject at a dose of about 0.1 mg/kg to about 50 mg/kg. Typically, a suitable dose will be in the range of about 0.1 mg/kg to about 5.0 mg/kg, preferably about 0.3 mg/kg and about 3.0 mg/kg. In addition, the

    [0828] The dual targeting RNAi agent may be administered to the subject at a dose of about 0.1 mg/kg to about 50 mg/kg. Typically, a suitable dose will be in the range of about 0.1 mg/kg to about 5.0 mg/kg, preferably about 0.3 mg/kg and about 3.0 mg/kg. In addition, the first dsRNA agent and the second dsRNA agent may be each independently administered to the subject at a dose of about 0.5 mg/kg to about 50 mg/kg, e.g., in the range of about 0.1 mg/kg to about 5.0 mg/kg, preferably about 0.3 mg/kg and about 3.0 mg/kg.

    [0829] In the methods (and uses) of the invention which comprise administering to a subject a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1, the first and second dsRNA agents may be administered to a subject at the same dose or different doses.

    [0830] The iRNA can be administered by intravenous infusion over a period of time, on a regular basis. In certain embodiments, after an initial treatment regimen, the treatments can be administered on a less frequent basis.

    [0831] Administration of the iRNA can reduce LDHA levels, e.g., in a cell, tissue, blood, urine or other compartment of the patient by at least about 5%, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 39, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or at least about 99% or more. In a preferred embodiment, administration of the iRNA can reduce LDHA levels, e.g., in a cell, tissue, blood, urine or other compartment of the patient by at least 20%.

    [0832] Administration of the iRNA can reduce HAO1 levels, e.g., in a cell, tissue, blood, urine or other compartment of the patient by at least about 5%, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 39, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or at least about 99% or more. In a preferred embodiment, administration of the iRNA can reduce HAO1 levels, e.g., in a cell, tissue, blood, urine or other compartment of the patient by at least 20%.

    [0833] In the methods (and uses) of the invention which comprise administering to a subject a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1, the level of inhibition of LDHA may be the same or different that the level of inhibition of HAO1.

    [0834] In the methods (and uses) of the invention which comprise administering to a subject a dual targeting RNAi agent, the dual targeting RNAi agent may inhibit expression of the LDHA gene and the HAO1 gene to a level substantially the same as the level of inhibition of expression obtained by the contacting of a cell with both dsRNA agents individually, or the dual targeting RNAi agent may inhibit expression of the LDHA gene and the HAO1 gene to a level higher than the level of inhibition of expression obtained by the contacting of a cell with both dsRNA agents individually.

    [0835] Before administration of a full dose of the iRNA, patients can be administered a smaller dose, such as a 5% infusion reaction, and monitored for adverse effects, such as an allergic reaction. In another example, the patient can be monitored for unwanted immunostimulatory effects, such as increased cytokine (e.g., TNF-alpha or INF-alpha) levels.

    [0836] Alternatively, the iRNA can be administered subcutaneously, i.e., by subcutaneous injection. One or more injections may be used to deliver the desired daily dose of iRNA to a subject. The injections may be repeated over a period of time. The administration may be repeated on a regular basis. In certain embodiments, after an initial treatment regimen, the treatments can be administered on a less frequent basis. A repeat-dose regimen may include administration of a therapeutic amount of iRNA on a regular basis, such as every other day or to once a year. In certain embodiments, the iRNA is administered about once per month to about once per quarter (i.e., about once every three months).

    [0837] In one embodiment, the method includes administering a composition featured herein such that expression of the target LDHA gene and/or the target HAO1 gene is decreased, such as for about 1, 2, 3, 4, 5, 6, 7, 8, 12, 16, 18, 24 hours, 28, 32, or about 36 hours. In one embodiment, expression of the target LDHA gene and the HAO1 gene is decreased for an extended duration, e.g., at least about two, three, four days or more, e.g., about one week, two weeks, three weeks, or four weeks or longer.

    [0838] Preferably, the iRNAs useful for the methods and compositions featured herein specifically target RNAs (primary or processed) of the target LDHA and HAO1 genes. Compositions and methods for inhibiting the expression of these genes using iRNAs can be prepared and performed as described herein.

    [0839] Administration of the dsRNA according to the methods of the invention may result in a reduction of the severity, signs, symptoms, and/or markers of such diseases or disorders in a patient with a disorder of lipid metabolism. By “reduction” in this context is meant a statistically significant decrease in such level. The reduction can be, for example, at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or about 100%.

    [0840] Efficacy of treatment or prevention of disease can be assessed, for example by measuring disease progression, disease remission, symptom severity, reduction in pain, quality of life, dose of a medication required to sustain a treatment effect, level of a disease marker or any other measurable parameter appropriate for a given disease being treated or targeted for prevention. It is well within the ability of one skilled in the art to monitor efficacy of treatment or prevention by measuring any one of such parameters, or any combination of parameters. For example, efficacy of treatment of a disorder of lipid metabolism may be assessed, for example, by periodic monitoring of one or more serum lipid levels, e.g., triglyceride levels. Comparisons of the later readings with the initial readings provide a physician an indication of whether the treatment is effective. It is well within the ability of one skilled in the art to monitor efficacy of treatment or prevention by measuring any one of such parameters, or any combination of parameters. In connection with the administration of an iRNA or pharmaceutical composition thereof, “effective against” a disorder of lipid metabolism indicates that administration in a clinically appropriate manner results in a beneficial effect for at least a statistically significant fraction of patients, such as a improvement of symptoms, a cure, a reduction in disease, extension of life, improvement in quality of life, or other effect generally recognized as positive by medical doctors familiar with treating disorder of lipid metabolisms and the related causes.

    [0841] A treatment or preventive effect is evident when there is a statistically significant improvement in one or more parameters of disease status, or by a failure to worsen or to develop symptoms where they would otherwise be anticipated. As an example, a favorable change of at least 10% in a measurable parameter of disease, and preferably at least 20%, 30%, 40%, 50% or more can be indicative of effective treatment. Efficacy for a given iRNA drug or formulation of that drug can also be judged using an experimental animal model for the given disease as known in the art.

    [0842] The invention further provides methods for the use of a iRNA agent or a pharmaceutical composition of the invention, e.g., for treating a subject that would benefit from reduction and/or inhibition of LDHA expression or LDHA and HAO1 expression, e.g., a subject having an oxalate pathway-associated disease, disorder, or condition, in combination with other pharmaceuticals and/or other therapeutic methods, e.g., with known pharmaceuticals and/or known therapeutic methods, such as, for example, those which are currently employed for treating these disorders. For example, in certain embodiments, an iRNA agent or pharmaceutical composition of the invention is administered in combination with, e.g., pyridoxine, an ACE inhibitor (angiotensin converting enzyme inhibitors), e.g., benazepril (Lotensin); an angiotensin II receptor antagonist (ARB) (e.g., losartan potassium, such as Merck & Co.'s Cozaar®), e.g., Candesartan (Atacand); an HMG-CoA reductase inhibitor (e.g., a statin); dietary oxalate degrading compounds, e.g., Oxalate decarboxylase (Oxazyme); calcium binding agents, e.g., Sodium cellulose phosphate (Calcibind); diuretics, e.g., thiazide diuretics, such as hydrochlorothiazide (Microzide); phosphate binders, e.g., Sevelamer (Renagel); magnesium and Vitamin B6 supplements; potassium citrate; orthophosphates, bisphosphonates; oral phosphate and citrate solutions; high fluid intake, urinary tract endoscopy; extracorporeal shock wave lithotripsy; kidney dialysis; kidney stone removal (e.g., surgery); and kidney/liver transplant; or a combination of any of the foregoing.

    [0843] In certain embodiments, an iRNA agent as described herein is administered in combination with an iRNA agent targeting hydroxyproline dehydrogenase (HYPDH; also known as HPOX or PRODH2) (see, e.g., Li, et al. (Biochem Biophys Acta (2016) 1862:233-239) or an inhibitory analog of HYPDH (see, e.g., Summitt, et al. (Biochem J (2015) 466:273-281).

    [0844] The iRNA agent and an additional therapeutic agent and/or treatment may be administered at the same time and/or in the same combination, e.g., subcutaneously, or the additional therapeutic agent can be administered as part of a separate composition or at separate times and/or by another method known in the art or described herein.

    VII. Kits

    [0845] The present invention also provides kits for performing any of the methods of the invention. Such kits include one or more RNAi agent(s) and instructions for use, e.g., instructions for inhibiting expression of a LDHA or LDHA and HAO1 in a cell by contacting the cell with an RNAi agent or pharmaceutical composition of the invention in an amount effective to inhibit expression of the LDHA or LDHA and HAO1. The kits may optionally further comprise means for contacting the cell with the RNAi agent (e.g., an injection device), or means for measuring the inhibition of LDHA and/or HAO1 (e.g., means for measuring the inhibition of LDHA and/or HAO1 mRNA and/or LDHA and/or HAO1 protein). Such means for measuring the inhibition of LDHA and/or HAO1 may comprise a means for obtaining a sample from a subject, such as, e.g., a plasma sample. The kits of the invention may optionally further comprise means for administering the RNAi agent(s) to a subject or means for determining the therapeutically effective or prophylactically effective amount.

    [0846] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the iRNAs and methods featured in the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

    EXAMPLES

    Example 1. iRNA Design, Synthesis, Selection, and In Vitro Evaluation

    Source of Reagents

    [0847] Where the source of a reagent is not specifically given herein, such reagent can be obtained from any supplier of reagents for molecular biology at a quality/purity standard for application in molecular biology.

    Transcripts

    [0848] A set of iRNAs targeting LDHA that cross-react with mouse and rat Ldha (human NCBI refseqID: NM_010699.2) were designed using custom R and Python scripts. The mouse Ldha, variant 1 REFSEQ mRNA has a length of 1,661 bases.

    [0849] An additional set of iRNAs targeting LDHA (human: NCBI refseqID NM_005566.3; NCBI GeneID: 3939) as well as toxicology-species LDHA orthologs (cynomolgus monkey: NM_001283551.1) was designed using custom Rand Python scripts. The human NM_005566 REFSEQ mRNA, version 3, has a length of 2226 bases.

    [0850] A detailed list of the unmodified mouse/rat cross-reactive LDHA sense and antisense strand sequences is shown in Table 2. A detailed list of the modified mouse/rat cross-reactive LDHA sense and antisense strand sequences is shown in Table 3.

    [0851] A detailed list of the unmodified human/Cynomolgus cross-reactive LDHA sense and antisense strand sequences is shown in Table 4. A detailed list of the modified human/Cynomolgus cross-reactive LDHA sense and antisense strand sequences is shown in Table 5.

    [0852] As described in PCT Publication, WO 2016/057893 (the entire contents of which is incorporated herein by reference), a set of iRNAs targeting HAO1 were also designed. Design used the following transcripts from the NCBI RefSeq collection: human (Homo sapiens) HAO1 mRNA is NM_017545.2; cynomolgus monkey (Macaca fascicularis) HAO1 mRNA is XM_005568381.1; Mouse (Mus musculus) HAO1 mRNA is NM_010403.2; Rat (Rattus norvegicus) HAO1 mRNA is XM_006235096.1.

    [0853] Tables 7 and 8 provide the modified sense and antisense strand sequences of duplexes targeting HAO1. Tables 9, 10, 11, 14, and 15 provide the unmodified sense and antisense strand sequences of duplexes targeting HAO1. Tables 12, 13, and 16 provide the unmodified and modified sense and antisense strand sequences of duplexes targeting HAO1.

    [0854] When known, the species of HAO1 that is inhibited by the duplex is noted: Hs indicates that the agent inhibits the expression of human HAO1; Mm indicates that the agent inhibits the expression of mouse HAO1; and Hs/Mm indicates that the agent inhibits expression of both human and mouse HAO.

    In Vitro Screening:

    [0855] Cell Culture and Transfections

    [0856] Primary Mouse Hepatocyte cells (PMH) (MSCP10, Lot #MC613) were transfected by adding 4.9 μl of Opti-MEM plus 0.1 μl of Lipofectamine RNAiMax per well (Invitrogen, Carlsbad Calif. cat #13778-150) to 5l of siRNA duplexes per well into a 384-well plate and incubated at room temperature for 15 minutes. Forty μl of DMEM (Hep3b) of William's E Medium (PMH) containing about 5×10.sup.3 cells was then added to the siRNA mixture. Cells were incubated for 24 hours prior to RNA purification. Single dose experiments were performed at 10 nM and 0.1 nM final duplex concentration.

    [0857] Hep3b cells (ATCC) were transfected by adding 4.9 μl of Opti-MEM plus 0.1 μl of Lipofectamine RNAiMax per well (Invitrogen, Carlsbad Calif. cat #13778-150) to 5l of siRNA duplexes per well into a 384-well plate and incubated at room temperature for 15 minutes. Forty ul of Eagle's Minimal Essential Medium (Life Tech) containing ˜5×10.sup.3 cells were then added to the siRNA mixture. Cells were incubated for 24 hours prior to RNA purification. Single dose experiments were performed at 10 nM.

    [0858] Total RNA Isolation Using DYNABEADS mRNA Isolation Kit (Invitrogen Part #: 610-12)

    [0859] Cells were lysed in 75 μl of Lysis/Binding Buffer containing 3 μL of beads per well and mixed for 10 minutes on an electrostatic shaker. The washing steps were automated on a Biotek EL406, using a magnetic plate support. Beads were washed (90 μL) once in Buffer A, once in Buffer B, and twice in Buffer E, with aspiration steps in between. Following a final aspiration, complete 10 μL RT mixture was added to each well, as described below.

    [0860] cDNA Synthesis Using ABI High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, Calif., Cat #4368813)

    [0861] A master mix of 1 μl 10× Buffer, 0.4 μl 25×dNTPs, 1 μl Random primers, 0.5 μl Reverse Transcriptase, 0.5 μl RNase inhibitor and 6.6 μl of H2O per reaction was added per well. Plates were sealed, agitated for 10 minutes on an electrostatic shaker, and then incubated at 37° C. for 2 hours. Following this, the plates were agitated at 80° C. for 8 minutes.

    [0862] Real Time PCR

    [0863] Two μl of cDNA was added to a master mix containing 0.5 μl of human GAPDH TaqMan Probe (4326317E), 0.5 μl human LDHA, 2 μl nuclease-free water and 5 μl Lightcycler 480 probe master mix (Roche Cat #04887301001) per well in a 384 well plates (Roche cat #04887301001). Real time PCR was performed in a LightCycler480 Real Time PCR system (Roche) using the ΔΔCt(RQ) assay. Each duplex was tested in at least two independent transfections, unless otherwise noted in the summary tables.

    [0864] To calculate relative fold change, real time data was analyzed using the ΔΔCt method and normalized to assays performed with cells transfected with 10 nM nonspecific siRNA, or mock transfected cells.

    [0865] Table 6A shows the results of a single dose screen in primary mouse hepatocytes transfected with the indicated GalNAC conjugated modified iRNAs. Data are expressed as percent of message remaining relative to untreated cells.

    [0866] Table 6B shows the results of a single dose screen in primary mouse hepatocytes transfected with the indicated GalNAC conjugated modified iRNAs. Data are expressed as percent of message remaining relative to untreated cells.

    TABLE-US-00001 TABLE 1 Abbreviations of nucleotide monomers used in nucleic acid sequence representation. It will be understood that these monomers, when present in an oligonucleotide, are mutually linked by 5′-3′-phosphodiester bonds. Abbreviation Nucleotide(s) A Adenosine-3′-phosphate Ab beta-L-adenosine-3′-phosphate Abs beta-L-adenosine-3′-phosphorothioate Af 2′-fluoroadenosine-3′-phosphate Afs 2′-fluoroadenosine-3′-phosphorothioate As adenosine-3′-phosphorothioate C cytidine-3′-phosphate Cb beta-L-cytidine-3′-phosphate Cbs beta-L-cytidine-3′-phosphorothioate Cf 2′-fluorocytidine-3′-phosphate Cfs 2′-fluorocytidine-3′-phosphorothioate Cs cytidine-3′-phosphorothioate G guanosine-3′-phosphate Gb beta-L-guanosine-3′-phosphate Gbs beta-L-guanosine-3′-phosphorothioate Gf 2′-fluoroguanosine-3′-phosphate Gfs 2′-fluoroguanosine-3′-phosphorothioate Gs guanosine-3′-phosphorothioate T 5′-methyluridine-3′-phosphate Tf 2′-fluoro-5-methyluridine-3′-phosphate Tfs 2′-fluoro-5-methyluridine-3′-phosphorothioate Ts 5-methyluridine-3′-phosphorothioate U Uridine-3′-phosphate Uf 2′-fluorouridine-3′-phosphate Ufs 2′-fluorouridine-3′-phosphorothioate Us uridine-3′-phosphorothioate N any nucleotide (G, A, C, T or U) a 2′-O-methyladenosine-3′-phosphate as 2′-O-methyladenosine-3′-phosphorothioate c 2′-O-methylcytidine-3′-phosphate cs 2′-O-methylcytidine-3′-phosphorothioate g 2′-O-methylguanosine-3′-phosphate gs 2′-O-methylguanosine-3′-phosphorothioate t 2′-O-methyl-5-methyluridine-3′-phosphate ts 2′-O-methyl-5-methyluridine-3′-phosphorothioate u 2′-O-methyluridine-3′-phosphate us 2′-O-methyluridine-3′-phosphorothioate s phosphorothioate linkage L96 N-[tris(GalNAc-alkyl)-amidodecanoyl)]-4-hydroxyprolinol Hyp-(GalNAc-alkyl)3 Y34 2-hydroxymethyl-tetrahydrofurane-4-methoxy-3-phosphate (abasic 2′-OMe furanose) Y44 inverted abasic DNA (2-hydroxymethyl-tetrahydrofurane- 5-phosphate) (Agn) Adenosine-glycol nucleic acid (GNA) (Cgn) Cytidine-glycol nucleic acid (GNA) (Ggn) Guanosine-glycol nucleic acid (GNA) (Tgn) Thymidine-glycol nucleic acid (GNA) S-Isomer P Phosphate VP Vinyl-phosphate (Aam) 2′-O-(N-methylacetamide)adenosine-3′-phosphate (Aams) 2′-O-(N-methylacetamide)adenosine-3′-phosphorothioate (Gam) 2′-O-(N-methylacetamide)guanosine-3′-phosphate (Gams) 2′-O-(N-methylacetamide)guanosine-3′-phosphorothioate (Tam) 2′-O-(N-methylacetamide)thymidine-3′-phosphate (Tams) 2′-O-(N-methylacetamide)thymidine-3′-phosphorothioate dA 2′-deoxyadenosine-3′-phosphate dAs 2′-deoxyadenosine-3′-phosphorothioate dC 2′-deoxycytidine-3′-phosphate dCs 2′-deoxycytidine-3′-phosphorothioate dG 2′-deoxyguanosine-3′-phosphate dGs 2′-deoxyguanosine-3′-phosphorothioate dT 2′-deoxythymidine-3′-phosphate dTs 2′-deoxythymidine-3′-phosphorothioate dU 2′-deoxyuridine dUs 2′-deoxyuridine-3′-phosphorothioate (Aeo) 2′-O-methoxyethyladenosine-3′-phosphate (Aeos) 2′-O-methoxyethyladenosine-3′-phosphorothioate (Geo) 2′-O-methoxyethylguanosine-3′-phosphate (Geos) 2′-O-methoxyethylguanosine-3′-phosphorothioate (Teo) 2′-O-methoxyethyl-5-methyluridine-3′-phosphate (Teos) 2′-O-methoxyethyl-5-methyluridine-3′-phosphorothioate (m5Ceo) 2′-O-methoxyethyl-5-methylcytidine-3′-phosphate (m5Ceos) 2′-O-methoxyethyl-5-methylcytidine-3′-phosphorothioate (A3m) 3′-O-methyladenosine-2′-phosphate (A3mx) 3′-O-methyl-xylofuranosyladenosine-2′-phosphate (G3m) 3′-O-methylguanosine-2′-phosphate (G3mx) 3′-O-methyl-xylofuranosylguanosine-2′-phosphate (C3m) 3′-O-methylcytidine-2′-phosphate (C3mx) 3′-O-methyl-xylofuranosylcytidine-2′-phosphate (U3m) 3′-O-methyluridine-2′-phosphate (U3mx) 3′-O-methyl-xylofuranosyluridine-2′-phosphate (m5Cam) 2′-O-(N-methylacetamide)-5-methylcytidine-3′-phosphate (m5Cams) 2′-O-(N-methylacetamide)-5-methylcytidine-3′- phosphorothioate (Chd) 2′-O-hexadecyl-cytidine-3′-phosphate (Chds) 2′-O-hexadecyl-cytidine-3′-phosphorothioate (Uhd) 2′-O-hexadecyl-uridine-3′-phosphate (Uhds) 2′-O-hexadecyl-uridine-3′-phosphorothioate (pshe) Hydroxyethylphosphorothioate

    TABLE-US-00002 TABLE 2 UNMODIFIED MOUSE/RAT CROSS-REACTIVE LDHA iRNA SEQUENCES Sense Sense  SEQ Range  Antisense Antisense SEQ Range Duplex Oligo Sequence ID in Oligo Sequence ID in Name Name 5′ to 3′ NO NM_010699.2 Name 5′ to 3′ NO NM_010699.2 AD-84747 A-169171 AACACCAA 2990 357-377 A-169172 UUGGAGACA 3034 355-377 AAAUUGUC AUUUUUGGU UCCAA GUUUU AD-84748 A-169173 AAACCGAG 2991 603-623 A-169174 UCACUUCCA 3035 601-623 UAAUUGGA AUUACUCGG AGUGA UUUUU AD-84749 A-169175 AAAUCAGU 2992 584-604 A-169176 UUUUGGGAA 3036 582-604 GGCUUUCC AGCCACUGA CAAAA UUUUC AD-84750 A-169177 UCCCAACA 2993 501-521 A-169178 UUGUACUUG 3037 499-521 UUGUCAAG ACAAUGUUG UACAA GGAAU AD-84751 A-169179 UGUGCCA 2994 241-261 A-169180 UAUUAAGAU 3038 239-261 UCAGUAU ACUGAUGGC CUUAAUA ACAAG AD-84752 A-169181 AAAUUGU 2995 365-385 A-169182 AGUCUUUGC 3039 363-385 CUCCAGC UGGAGACAA AAAGACU UUUUU AD-84753 A-169183 ACCUUGA 2996 1610-1630 A-169184 UUUUUUUUC 3040 1608-1630 ACAGUGA ACUGUUCAA AAAAAAA GGUUU AD-84754 A-169185 AAAACAC 2997 355-375 A-169186 UGAGACAAU 3041 353-375 CAAAAAU UUUUGGUGU UGUCUCA UUUAA AD-84755 A-169187 ACCAAAA 2998 360-380 A-169188 UUGCUGGAG 3042 358-380 AUUGUCU ACAAUUUUU CCAGCAA GGUGU AD-84756 A-169189 CAAGUUC 2999 489-509 A-169190 AUGUUGGGA 3043 487-509 AUCAUUC AUGAUGAAC CCAACAU UUGAA AD-84757 A-169191 GCAAUAU 3000 1538-1558 A-169192 UUACAUCUC 3044 1536-1558 UAUGUGA ACAUAAUAU GAUGUAA UGCAA AD-84758 A-169193 GUCUCAA 3001 115-135 A-169194 UGACUUUGA 3045 113-135 AAGAUUC AUCUUUUGA AAAGUCA GACCG AD-84759 A-169195 CAUUCCC 3002 498-518 A-169196 UACUUGACA 3046 496-518 AACAUUG AUGUUGGGA UCAAGUA AUGAU AD-84760 A-169197 AAACCUU 3003 1608-1628 A-169198 UUUUUUCAC 3047 1606-1628 GAACAGU UGUUCAAGG GAAAAAA UUUUA AD-84761 A-169199 UCAAAAG 3004 118-138 A-169200 UUUGGACUU 3048 116-138 AUUCAAA UGAAUCUUU GUCCAAA UGAGA AD-84762 A-169203 ACAUCUU 3005 482-502 A-169204 UAAUGAUGA 3049 480-502 CAAGUUC ACUUGAAGA AUCAUUA UGUUC AD-84763 A-169205 CAGCUGA 3006 157-177 A-169206 AAGAAGAUU 3050 155-177 UUGUGAA CACAAUCAG UCUUCUU CUGGU AD-84764 A-169207 CUCAAAA 3007 117-137 A-169208 UUGGACUUU 3051 115-137 GAUUCAA GAAUCUUUU AGUCCAA GAGAC AD-84765 A-169209 AAAACCG 3008 602-622 A-169210 UACUUCCAA 3052 600-622 AGUAAUU UUACUCGGU GGAAGUA UUUUG AD-84766 A-169213 UGAUGCA 3009 1469-1489 A-169214 UUAUGCACA 3053 1467-1489 UAUCUUG AGAUAUGCA UGCAUAA UCAUG AD-84767 A-169215 CCAUCAG 3010 245-265 A-169216 UCUUCAUUA 3054 243-265 UAUCUUA AGAUACUGA AUGAAGA UGGCA AD-84768 A-169217 AAUCAGU 3011 585-605 A-169218 UUUUUGGGA 3055 583-605 GGCUUUC AAGCCACUG CCAAAAA AUUUU AD-84769 A-169219 UUAAAAC 3012 353-373 A-169220 AGACAAUUU 3056 351-373 ACCAAAA UUGGUGUUU AUUGUCU UAAGG AD-84770 A-169221 CUGAUUG 3013 160-180 A-169222 UUUAAGAAG 3057 158-180 UGAAUCU AUUCACAAU UCUUAAA CAGCU AD-84771 A-169223 AUAAAAC 3014 1605-1625 A-169224 UUUCACUGU 3058 1603-1625 CUUGAAC UCAAGGUUU AGUGAAA UAUUU AD-84772 A-169225 AGUGUCA 3015 1592-1612 A-169226 UGUUUUAUU 3059 1590-1612 UGCCAAA UGGCAUGAC UAAAACA ACUUG AD-84773 A-169227 ACACCAA 3016 358-378 A-169228 UCUGGAGAC 3060 356-378 AAAUUGU AAUUUUUGG CUCCAGA UGUUU AD-84774 A-169229 GCAUUGC 3017 1533-1553 A-169230 UCUCACAUA 3061 1531-1553 AAUAUUA AUAUUGCAA UGUGAGA UGCAC AD-84775 A-169231 GUCAUGC 3018 1595-1615 A-169232 UAAGGUUUU 3062 1593-1615 CAAAUAA AUUUGGCAU AACCUUA GACAC AD-84776 A-169233 AUAUCUU 3019 1475-1495 A-169234 UAACAUUUA 3063 1473-1495 GUGCAUA UGCACAAGA AAUGUUA UAUGC AD-84777 A-169235 AAACACC 3020 356-376 A-169236 UGGAGACAA 3064 354-376 AAAAAUU UUUUUGGUG GUCUCCA UUUUA AD-84778 A-169237 UAACCUG 3021 1443-1463 A-169238 UUACACACU 3065 1441-1463 GCUCCAG GGAGCCAGG UGUGUAA UUAUA AD-84779 A-169239 UGCAUAU 3022 1472-1492 A-169240 UAUUUAUGC 3066 1470-1492 CUUGUGC ACAAGAUAU AUAAAUA GCAUC AD-84780 A-169241 ACAUUGU 3023 506-526 A-169242 UUGGACUGU 3067 504-526 CAAGUAC ACUUGACAA AGUCCAA UGUUG AD-84781 A-169243 AACCUUG 3024 1609-1629 A-169244 UUUUUUUCA 3068 1607-1629 AACAGUG CUGUUCAAG AAAAAAA GUUUU AD-84782 A-169245 GUGUGCA 3025 1529-1549 A-169246 ACAUAAUAU 3069 1527-1549 UUGCAAU UGCAAUGCA AUUAUGU CACUA AD-84783 A-169247 CCAAAAA 3026 599-619 A-169248 UUCCAAUUA 3070 597-619 CCGAGUA CUCGGUUUU AUUGGAA UGGGA AD-84784 A-169249 CAAAAAC 3027 600-620 A-169250 UUUCCAAUU 3071 598-620 CGAGUAA ACUCGGUUU UUGGAAA UUGGG AD-84785 A-169251 CCAAGUG 3028 1285-1305 A-169252 UACUACACA 3072 1283-1305 GUACUUG AGUACCACU UGUAGUA UGGCA AD-84786 A-169253 CAGCGAA 3029 469-489 A-169254 UAAGAUGUU 3073 467-489 ACGUGAA CACGUUUCG CAUCUUA CUGGA AD-84787 A-169255 UGAUUGU 3030 161-181 A-169256 UCUUAAGAA 3074 159-181 GAAUCUU GAUUCACAA CUUAAGA UCAGC AD-84788 A-169257 CUUCAAG 3031 486-506 A-169258 UUGGGAAUG 3075 484-506 UUCAUCA AUGAACUUG UUCCCAA AAGAU AD-84789 A-169259 GGACCAG 3032 153-173 A-169260 AGAUUCACA 3076 151-173 CUGAUUG AUCAGCUGG UGAAUCU UCCUU AD-84790 A-169261 AUGCCAA 3033 1598-1618 A-169262 UUUCAAGGU 3077 1596-1618 AUAAAAC UUUAUUUGG CUUGAAA CAUGA

    TABLE-US-00003 TABLE 3  MODIFIED MOUSE/RAT CROSS-REACTIVE LDHA iRNA SEQUENCES Sense SEQ Antisense SEQ SEQ Duplex Sequence ID Sequence ID mRNA target ID Name 5′ to 3′ NO 5′ to 3′ NO sequence NO AD-84747 asascaccA 3078 usUfsggaG 3122 AAAACACCAAA 3166 faAfAfAfu faCfAfauuu AAUUGUCUCCAG ugucuccaa UfuGfguguu L96 susu AD-84748 asasaccgA 3079 usCfsacuUf 3123 AAAAACCGAGUA 3167 fgUfAfAfu cCfAfauuaC AUUGGAAGUGG uggaaguga fuCfgguuus L96 usu AD-84749 asasaucaG 3080 usUfsuugGf 3124 GAAAAUCAGUGG 3168 fuGfGfCfu gAfAfagccA CUUUCCCAAAA uucccaaaa fcUfgauuus L96 usc AD-84750 uscsccaaC 3081 usUfsguaCfu 3125 AUUCCCAACAUU 3169 faUfUfGfu UfGfacaaUfg GUCAAGUACAG caaguacaa Ufugggasasu L96 AD-84751 usgsugccA 3082 usAfsuuaAfg 3126 CUUGUGCCAUCA 3170 fuCfAfGfu AfUfacugAfu GUAUCUUAAUG aucuuaaua Gfgcacasasg L96 AD-84752 asasauugU 3083 asGfsucuUfu 3127 AAAAAUUGUCUC 3171 fcUfCfCfa GfCfuggaGfa CAGCAAAGACU gcaaagacu Cfaauuususu L96 AD-84753 ascscuugA 3084 usUfsuuuUfu 3128 AAACCUUGAACA 3172 faCfAfGfu UfCfacugUfu GUGAAAAAAAA gaaaaaaaa Cfaaggususu L96 AD-84754 asasaacaC 3085 usGfsagaCfa 3129 UUAAAACACCAA 3173 fcAfAfAfa AfUfuuuuGfg AAAUUGUCUCC auugucuca Ufguuuusasa L96 AD-84755 ascscaaaA 3086 usUfsgcuGfg 3130 ACACCAAAAAUU 3174 faUfUfGfu AfGfacaaUfu GUCUCCAGCAA cuccagcaa Ufuuggusgsu L96 AD-84756 csasaguuC 3087 asUfsguuGfg 3131 UUCAAGUUCAUC 3175 faUfCfAfu GfAfaugaUfg AUUCCCAACAU ucccaacau Afacuugsasa L96 AD-84757 gscsaauaU 3088 usUfsacaUfc 3132 UUGCAAUAUUAU 3176 fuAfUfGfu UfCfacauAfa GUGAGAUGUAA gagauguaa Ufauugcsasa L96 AD-84758 gsuscucaA 3089 usGfsacuUfu 3133 CGGUCUCAAAAG 3177 faAfGfAfu GfAfaucuUfu AUUCAAAGUCC ucaaaguca Ufgagacscsg L96 AD-84759 csasuuccC 3090 usAfscuuGfa 3134 AUCAUUCCCAAC 3178 faAfCfAfu CfAfauguUfg AUUGUCAAGUA ugucaagua Gfgaaugsasu L96 AD-84760 asasaccuU 3091 usUfsuuuUfc 3135 UAAAACCUUGAA 3179 fgAfAfCfa AfCfuguuCfa CAGUGAAAAAA gugaaaaaa Afgguuususa L96 AD-84761 uscsaaaaG 3092 usUfsuggAfc 3136 UCUCAAAAGAUU 3180 faUfUfCfa UfUfugaaUfc CAAAGUCCAAG aaguccaaa Ufuuugasgsa L96 AD-84762 ascsaucuU 3093 usAfsaugAfu 3137 GAACAUCUUCAA 3181 fcAfAfGfu GfAfacuuGfa GUUCAUCAUUC ucaucauua Afgaugususc L96 AD-84763 csasgcugA 3094 asAfsgaaGfa 3138 ACCAGCUGAUU 3182 fuUfGfUfg UfUfcacaAfu GUGAAUCUUCUU aaucuucuu Cfagcugsgsu L96 AD-84764 csuscaaaA 3095 usUfsggaCfu 3139 GUCUCAAAAGA 3183 fgAfUfUfc UfUfgaauCfu UUCAAAGUCCAA aaaguccaa Ufuugagsasc L96 AD-84765 asasaaccG 3096 usAfscuuCfc 3140 CAAAAACCGAGU 3184 faGfUfAfa AfAfuuacUfc AAUUGGAAGUG uuggaagua Gfguuuususg L96 AD-84766 usgsaugcA 3097 usUfsaugCfa 3141 CAUGAUGCAUA 3185 fuAfUfCfu CfAfagauAfu UCUUGUGCAUAA ugugcauaa Gfcaucasusg L96 AD-84767 cscsaucaG 3098 usCfsuucAfu 3142 UGCCAUCAGUAU 3186 fuAfUfCfu UfAfagauAfc CUUAAUGAAGG uaaugaaga Ufgauggscsa L96 AD-84768 asasucagU 3099 usUfsuuuGfg 3143 AAAAUCAGUGG 3187 fgGfCfUfu GfAfaagcCfa CUUUCCCAAAAA ucccaaaaa Cfugauususu L96 AD-84769 ususaaaaC 3100 asGfsacaAfu 3144 CCUUAAAACACC 3188 faCfCfAfa UfUfuuggUfg AAAAAUUGUCU aaauugucu Ufuuuaasgsg L96 AD-84770 csusgauuG 3101 usUfsuaaGfa 3145 AGCUGAUUGUG 3189 fuGfAfAfu AfGfauucAfc AAUCUUCUUAAG cuucuuaaa Afaucagscsu L96 AD-84771 asusaaaaC 3102 usUfsucaCfu 3146 AAAUAAAACCU 3190 fcUfUfGfa GfUfucaaGfg UGAACAGUGAAA acagugaaa Ufuuuaususu L96 AD-84772 asgsugucA 3103 usGfsuuuUfa 3147 CAAGUGUCAUGC 3191 fuGfCfCfa UfUfuggcAfu CAAAUAAAACC aauaaaaca Gfacacususg L96 AD-84773 ascsaccaA 3104 usCfsuggAfg 3148 AAACACCAAAAA 3192 faAfAfUfu AfCfaauuUfu UUGUCUCCAGC gucuccaga Ufggugususu L96 AD-84774 gscsauugC 3105 usCfsucaCfa 3149 GUGCAUUGCAAU 3193 faAfUfAfu UfAfauauUfg AUUAUGUGAGA uaugugaga Cfaaugcsasc L96 AD-84775 gsuscaugC 3106 usAfsaggUfu 3150 GUGUCAUGCCA 3194 fcAfAfAfu UfUfauuuGfg AAUAAAACCUUG aaaaccuua Cfaugacsasc L96 AD-84776 asusaucuU 3107 usAfsacaUfu 3151 GCAUAUCUUGU 3195 fgUfGfCfa UfAfugcaCfa GCAUAAAUGUUG uaaauguua Afgauausgsc L96 AD-84777 asasacacC 3108 usGfsgagAfc 3152 UAAAACACCAAA 3196 faAfAfAfa AfAfuuuuUfg AAUUGUCUCCA uugucucca Gfuguuususa L96 AD-84778 usasaccuG 3109 usUfsacaCfa 3153 UAUAACCUGGCU 3197 fgCfUfCfc CfUfggagCfc CCAGUGUGUAC aguguguaa Afgguuasusa L96 AD-84779 usgscauaU 3110 usAfsuuuAfu 3154 GAUGCAUAUCUU 3198 fcUfUfGfu GfCfacaaGfa GUGCAUAAAUG gcauaaaua Ufaugcasusc L96 AD-84780 ascsauugU 3111 usUfsggaCfu 3155 CAACAUUGUCAA 3199 fcAfAfGfu GfUfacuuGfa GUACAGUCCAC acaguccaa Cfaaugususg L96 AD-84781 asasccuuG 3112 usUfsuuuUfu 3156 AAAACCUUGAA 3200 faAfCfAfg CfAfcuguUfc CAGUGAAAAAAA ugaaaaaaa Afagguususu L96 AD-84782 gsusgugcA 3113 asCfsauaAfu 3157 UAGUGUGCAUU 3201 fuUfGfCfa AfUfugcaAfu GCAAUAUUAUGU auauuaugu Gfcacacsusa L96 AD-84783 cscsaaaaA 3114 usUfsccaAfu 3158 UCCCAAAAACCG 3202 fcCfGfAfg UfAfcucgGfu AGUAAUUGGAA uaauuggaa Ufuuuggsgsa L96 AD-84784 csasaaaaC 3115 usUfsuccAfa 3159 CCCAAAAACCGA 3203 fcGfAfGfu UfUfacucGfg GUAAUUGGAAG aauuggaaa Ufuuuugsgsg L96 AD-84785 cscsaaguG 3116 usAfscuaCfa 3160 UGCCAAGUGGUA 3204 fgUfAfCfu CfAfaguaCfc CUUGUGUAGUG uguguagua Afcuuggscsa L96 AD-84786 csasgcgaA 3117 usAfsagaUfg 3161 UCCAGCGAAACG 3205 faCfGfUfg UfUfcacgUfu UGAACAUCUUC aacaucuua Ufcgcugsgsa L96 AD-84787 usgsauugU 3118 usCfsuuaAfg 3162 GCUGAUUGUGAA 3206 fgAfAfUfc AfAfgauuCfa UCUUCUUAAGG uucuuaaga Cfaaucasgsc L96 AD-84788 csusucaaG 3119 usUfsgggAfa 3163 AUCUUCAAGUUC 3207 fuUfCfAfu UfGfaugaAfc AUCAUUCCCAA cauucccaa Ufugaagsasu L96 AD-84789 gsgsaccaG 3120 asGfsauuCfa 3164 AAGGACCAGCUG 3208 fcUfGfAfu CfAfaucaGfc AUUGUGAAUCU ugugaaucu Ufgguccsusu L96 AD-84790 asusgccaA 3121 usUfsucaAfg 3165 UCAUGCCAAAUA 3209 faUfAfAfa GfUfuuuaUfu AAACCUUGAAC accuugaaa Ufggcausgsa L96

    TABLE-US-00004 TABLE 4 UNMODIFIED HUMAN/CYNOMOLGUS CROSS-REACTIVE LDHA iRNA SEQUENCES Sense Sense SEQ Position Antisense Antisense SEQ Position Duplex  Oligo Sequence  ID in Oligo  Sequence ID in Name Name 5′ to 3′ NO NM_005566.3 Name 5′ to 3 NO NM_ 005566.3 AD-159469 A-314810 UUUAUCUGAUC 3210 1347-1367 A-314811 UUUAAUCACAGA 3396 1345-1367 UGUGAUUAAA UCAGAUAAAAA AD-159607 A-315086 ACUGGUUAGUG 3211 1489-1509 A-315087 AACUAUUUCACA 3397 1487-1509 UGAAAUAGUU CUAACCAGUUG AD-159713 A-315298 AACAUGCCUAG 3212 1615-1635 A-315299 AAAUGUUGGACU 3398 1613-1635 UCCAACAUUU AGGCAUGUUCA AD-158504 A-312881 CAAGUCCAAUA 3213 263-283 A-312882 AGAGUUGCCAUA 3399 261-283 UGGCAACUCU UUGGACUUGGA AD-159233 A-314338 UCCACCAUGAU 3214 1092-1112 A-314339 AAGACCCUUAAU 3400 1090-1112 UAAGGGUCUU CAUGGUGGAAA AD-159411 A-314694 UCAUUUCACUG 3215 1289-1309 A-314695 UUAGCCUAGACA 3401 1287-1309 UCUAGGCUAA GUGAAAUGAUA AD-159462 A-314796 UGUCCUUUUUA 3216 1340-1360 A-314797 ACAGAUCAGAUA 3402 1338-1360 UCUGAUCUGU AAAAGGACAAC AD-159742 A-315356 CCAGUGUAUAA 3217 1662-1682 A-315357 UAUAUUGGAUUU 3403 1660-1682 AUCCAAUAUA AUACACUGGAU AD-159863 A-315598 UCCAAGUGUUA 3218 1791-1811 A-315599 UUAGUUGGUAUA 3404 1789-1811 UACCAACUAA ACACUUGGAUA AD-158626 A-313124 GUCAUCGAAGA 3219 429-449 A-313125 UUUCAAUUUGUC 3405 427-449 CAAAUUGAAA UUCGAUGACAU AD-158687 A-313246 GAACACCAAAG 3220 490-510 A-313247 UAGAGACAAUCU 3406 488-510 AUUGUCUCUA UUGGUGUUCUA AD-158688 A-313248 AACACCAAAGA 3221 491-511 A-313249 UCAGAGACAAUC 3407 489-511 UUGUCUCUGA UUUGGUGUUCU AD-159458 A-314788 AUGUUGUCCUU 3222 1336-1356 A-314789 AUCAGAUAAAAA 3408 1334-1356 UUUAUCUGAU GGACAACAUGC AD-159519 A-314910 UCAACUCCUGA 3223 1401-1421 A-314911 AUUUCUAACUUC 3409 1399-1421 AGUUAGAAAU AGGAGUUGAUG AD-159858 A-315588 AACUAUCCAAG 3224 1786-1806 A-315589 UGGUAUAACACU 3410 1784-1806 UGUUAUACCA UGGAUAGUUGG AD-158681 A-313234 UCCUUAGAACA 3225 484-504 A-313235 UAAUCUUUGGUG 3411 482-504 CCAAAGAUUA UUCUAAGGAAA AD-159583 A-315038 GGUAUUAAUCU 3226 1465-1485 A-315039 AGACUACACAAG 3412 1463-1485 UGUGUAGUCU AUUAAUACCAU AD-159700 A-315272 GGCUCCUUCAC 3227 1602-1622 A-315273 UGCAUGUUCAGU 3413 1600-1622 UGAACAUGCA GAAGGAGCCAG AD-159807 A-315486 UAUCAGUAGUG 3228 1728-1748 A-315487 UGGUAAUGUACA 3414 1726-1748 UACAUUACCA CUACUGAUAUA AD-158673 A-313218 CAGCCUUUUCC 3229 476-496 A-313219 UGUGUUCUAAGG 3415 474-496 UUAGAACACA AAAAGGCUGCC AD-159608 A-315088 CUGGUUAGUGU 3230 1490-1510 A-315089 UAACUAUUUCAC 3416 1488-1510 GAAAUAGUUA ACUAACCAGUU AD-159803 A-315478 ACUAUAUCAGU 3231 1724-1744 A-315479 AAUGUACACUAC 3417 1722-1744 AGUGUACAUU UGAUAUAGUUC AD-159805 A-315482 UAUAUCAGUAG 3232 1726-1746 A-315483 UUAAUGUACACU 3418 1724-1746 UGUACAUUAA ACUGAUAUAGU AD-159489 A-314850 GUAAUAUUUUA 3233 1371-1391 A-314851 UAGUCCAUCUUA 3419 1369-1391 AGAUGGACUA AAAUAUUACUG AD-159495 A-314862 UUUUAAGAUGG 3234 1377-1397 A-314863 UUUUCCCAGUCC 3420 1375-1397 ACUGGGAAAA AUCUUAAAAUA AD-159609 A-315090 UGGUUAGUGUG 3235 1491-1511 A-315091 AGAACUAUUUCA 3421 1489-1511 AAAUAGUUCU CACUAACCAGU AD-159706 A-315284 UUCACUGAACA 3236 1608-1628 A-315285 UGACUAGGCAUG 3422 1606-1628 UGCCUAGUCA UUCAGUGAAGG AD-159855 A-315582 ACCAACUAUCC 3237 1783-1803 A-315583 UAUAACACUUGG 3423 1781-1803 AAGUGUUAUA AUAGUUGGUUG AD-159864 A-315600 CCAAGUGUUAU 3238 1792-1812 A-315601 UUUAGUUGGUAU 3424 1790-1812 ACCAACUAAA AACACUUGGAU AD-158491 A-312855 UUCCUUUUGGU 3239 250-270 A-312856 UGGACUUGGAAC 3425 248-270 UCCAAGUCCA CAAAAGGAAUC AD-158672 A-313216 GCAGCCUUUUC 3240 475-495 A-313217 UUGUUCUAAGGA 3426 473-495 CUUAGAACAA AAAGGCUGCCA AD-159488 A-314848 AGUAAUAUUUU 3241 1370-1390 A-314849 AGUCCAUCUUAA 3427 1368-1390 AAGAUGGACU AAUAUUACUGC AD-159553 A-314978 AAAAUCCACAG 3242 1435-1455 A-314979 UAGGAUAUAGCU 3428 1433-1455 CUAUAUCCUA GUGGAUUUUAC AD-159703 A-315278 UCCUUCACUGA 3243 1605-1625 A-315279 UUAGGCAUGUUC 3429 1603-1625 ACAUGCCUAA AGUGAAGGAGC AD-159708 A-315288 CACUGAACAUG 3244 1610-1630 A-315289 UUGGACUAGGCA 3430 1608-1630 CCUAGUCCAA UGUUCAGUGAA AD-159866 A-315604 AAGUGUUAUAC 3245 1794-1814 A-315605 GUUUUAGUUGGU 3431 1792-1814 CAACUAAAAC AUAACACUUGG AD-159232 A-314336 UUCCACCAUGA 3246 1091-1111 A-314337 AGACCCUUAAUC 3432 1089-1111 UUAAGGGUCU AUGGUGGAAAC AD-159712 A-315296 GAACAUGCCUA 3247 1614-1634 A-315297 AAUGUUGGACUA 3433 1612-1634 GUCCAACAUU GGCAUGUUCAG AD-159808 A-315488 AUCAGUAGUGU 3248 1729-1749 A-315489 AUGGUAAUGUAC 3434 1727-1749 ACAUUACCAU ACUACUGAUAU AD-159862 A-315596 AUCCAAGUGUU 3249 1790-1810 A-315597 UAGUUGGUAUAA 3435 1788-1810 AUACCAACUA CACUUGGAUAG AD-158503 A-312879 CCAAGUCCAAU 3250 262-282 A-312880 UAGUUGCCAUAU 3436 260-282 AUGGCAACUA UGGACUUGGAA AD-159311 A-314494 AUCUCAGACCU 3251 1170-1190 A-314495 UACCUUCACAAG 3437 1168-1190 UGUGAAGGUA GUCUGAGAUUC AD-159412 A-314696 CAUUUCACUGU 3252 1290-1310 A-314697 UGUAGCCUAGAC 3438 1288-1310 CUAGGCUACA AGUGAAAUGAU AD-159558 A-314988 CCACAGCUAUA 3253 1440-1460 A-314989 AGCAUCAGGAUA 3439 1438-1460 UCCUGAUGCU UAGCUGUGGAU AD-159705 A-315282 CUUCACUGAAC 3254 1607-1627 A-315283 UACUAGGCAUGU 3440 1605-1627 AUGCCUAGUA UCAGUGAAGGA AD-159113 A-314098 GUGGUUGAGAG 3255 972-992 A-314099 UUCAUAAGCACU 3441 970-992 UGCUUAUGAA CUCAACCACCU AD-159139 A-314150 CAAACUCAAAG 3256 998-1018 A-314151 UAUGUGUAGCCU 3442 996-1018 GCUACACAUA UUGAGUUUGAU AD-159806 A-315484 AUAUCAGUAGU 3257 1727-1747 A-315485 UGUAAUGUACAC 3443 1725-1747 GUACAUUACA UACUGAUAUAG AD-159853 A-315578 CAACCAACUAU 3258 1781-1801 A-315579 UAACACUUGGAU 3444 1779-1801 CCAAGUGUUA AGUUGGUUGCA AD-158627 A-313126 UCAUCGAAGAC 3259 430-450 A-313127 UCUUCAAUUUGU 3445 428-450 AAAUUGAAGA CUUCGAUGACA AD-159182 A-314236 GCAGAUUUGGC 3260 1041-1061 A-314237 UAUACUCUCUGC 3446 1039-1061 AGAGAGUAUA CAAAUCUGCUA AD-159702 A-315276 CUCCUUCACUG 3261 1604-1624 A-315277 UAGGCAUGUUCA 3447 1602-1624 AACAUGCCUA GUGAAGGAGCC AD-159715 A-315302 CAUGCCUAGUC 3262 1617-1637 A-315303 AAAAAUGUUGGA 3448 1615-1637 CAACAUUUUU CUAGGCAUGUU AD-158575 A-313022 UGCCAUCAGUA 3263 377-397 A-313023 UUCAUUAAGAUA 3449 375-397 UCUUAAUGAA CUGAUGGCACA AD-158576 A-313024 GCCAUCAGUAU 3264 378-398 A-313025 UUUCAUUAAGAU 3450 376-398 CUUAAUGAAA ACUGAUGGCAC AD-158684 A-313240 UUAGAACACCA 3265 487-507 A-313241 AGACAAUCUUUG 3451 485-507 AAGAUUGUCU GUGUUCUAAGG AD-159410 A-314692 AUCAUUUCACU 3266 1288-1308 A-314693 UAGCCUAGACAG 3452 1286-1308 GUCUAGGCUA UGAAAUGAUAU AD-159416 A-314704 UCACUGUCUAG 3267 1294-1314 A-314705 UUGUUGUAGCCU 3453 1292-1314 GCUACAACAA AGACAGUGAAA AD-159738 A-315348 GGAUCCAGUGU 3268 1658-1678 A-315349 UUGGAUUUAUAC 3454 1656-1678 AUAAAUCCAA ACUGGAUCCCA AD-159857 A-315586 CAACUAUCCAA 3269 1785-1805 A-315587 UGUAUAACACUU 3455 1783-1805 GUGUUAUACA GGAUAGUUGGU AD-158497 A-312867 UUGGUUCCAAG 3270 256-276 A-312868 UCAUAUUGGACU 3456 254-276 UCCAAUAUGA UGGAACCAAAA AD-159124 A-314120 UGCUUAUGAGG 3271 983-1003 A-314121 AGUUUGAUCACC 3457 981-1003 UGAUCAAACU UCAUAAGCACU AD-159140 A-314152 AAACUCAAAGG 3272 999-1019 A-314153 UGAUGUGUAGCC 3458 997-1019 CUACACAUCA UUUGAGUUUGA AD-159312 A-314496 UCUCAGACCUU 3273 1171-1191 A-314497 UCACCUUCACAA 3459 1169-1191 GUGAAGGUGA GGUCUGAGAUU AD-159552 A-314976 UAAAAUCCACA 3274 1434-1454 A-314977 AGGAUAUAGCUG 3460 1432-1454 GCUAUAUCCU UGGAUUUUACA AD-159704 A-315280 CCUUCACUGAA 3275 1606-1626 A-315281 ACUAGGCAUGUU 3461 1604-1626 CAUGCCUAGU CAGUGAAGGAG AD-159737 A-315346 GGGAUCCAGUG 3276 1657-1677 A-315347 UGGAUUUAUACA 3462 1655-1677 UAUAAAUCCA CUGGAUCCCAG AD-159869 A-315610 CAAUAAACCUU 3277 1818-1838 A-315611 UUCACUGUUCAA 3463 1816-1838 GAACAGUGAA GGUUUAUUGGG AD-158570 A-313012 GGCCUGUGCCA 3278 371-391 A-313013 AAGAUACUGAUG 3464 369-391 UCAGUAUCUU GCACAGGCCAU AD-158618 A-313108 UUGUUGAUGUC 3279 421-441 A-313109 UGUCUUCGAUGA 3465 419-441 AUCGAAGACA CAUCAACAAGA AD-159788 A-315448 GGAUCUUAUUU 3280 1708-1728 A-315449 AUAGUUCACAAA 3466 1706-1728 UGUGAACUAU AUAAGAUCCUU AD-159786 A-315444 AAGGAUCUUAU 3281 1706-1726 A-315445 AGUUCACAAAAU 3467 1704-1726 UUUGUGAACU AAGAUCCUUUG AD-159760 A-315392 AUCAUGUCUUG 3282 1680-1700 A-315393 UAAUUAUGCACA 3468 1678-1700 UGCAUAAUUA AGACAUGAUAU AD-159404 A-314680 UGUCAUAUCAU 3283 1282-1302 A-314681 AGACAGUGAAAU 3469 1280-1302 UUCACUGUCU GAUAUGACAUC AD-159406 A-314684 UCAUAUCAUUU 3284 1284-1304 A-314685 UUAGACAGUGAA 3470 1282-1304 CACUGUCUAA AUGAUAUGACA AD-158536 A-312944 AUUUAUAAUCU 3285 297-317 A-312945 UUCCUUUAGAAG 3471 295-317 UCUAAAGGAA AUUAUAAAUCA AD-159545 A-314962 UGGUUUGUAAA 3286 1427-1447 A-314963 AGCUGUGGAUUU 3472 1425-1447 AUCCACAGCU UACAAACCAUU AD-159574 A-315020 AUGCUGGAUGG 3287 1456-1476 A-315021 AAGAUUAAUACC 3473 1454-1476 UAUUAAUCUU AUCCAGCAUCA AD-159802 A-315476 AACUAUAUCAG 3288 1723-1743 A-315477 AUGUACACUACU 3474 1721-1743 UAGUGUACAU GAUAUAGUUCA AD-159518 A-314908 AUCAACUCCUG 3289 1400-1420 A-314909 UUUCUAACUUCA 3475 1398-1420 AAGUUAGAAA GGAGUUGAUGU AD-159577 A-315026 CUGGAUGGUAU 3290 1459-1479 A-315027 UACAAGAUUAAU 3476 1457-1479 UAAUCUUGUA ACCAUCCAGCA AD-159409 A-314690 UAUCAUUUCAC 3291 1287-1307 A-314691 AGCCUAGACAGU 3477 1285-1307 UGUCUAGGCU GAAAUGAUAUG AD-159551 A-314974 GUAAAAUCCAC 3292 1433-1453 A-314975 UGAUAUAGCUGU 3478 1431-1453 AGCUAUAUCA GGAUUUUACAA AD-159276 A-314424 UCCUUAGUGUU 3293 1135-1155 A-314425 AAAUGCAAGGAA 3479 1133-1155 CCUUGCAUUU CACUAAGGAAG AD-159407 A-314686 CAUAUCAUUUC 3294 1285-1305 A-314687 UCUAGACAGUGA 3480 1283-1305 ACUGUCUAGA AAUGAUAUGAC AD-159515 A-314902 AACAUCAACUC 3295 1397-1417 A-314903 UUAACUUCAGGA 3481 1395-1417 CUGAAGUUAA GUUGAUGUUUU AD-159570 A-315012 CCUGAUGCUGG 3296 1452-1472 A-315013 UUAAUACCAUCC 3482 1450-1472 AUGGUAUUAA AGCAUCAGGAU AD-159849 A-315570 AAUGCAACCAA 3297 1777-1797 A-315571 ACUUGGAUAGUU 3483 1775-1797 CUAUCCAAGU GGUUGCAUUGU AD-159252 A-314376 UUUACGGAAUA 3298 1111-1131 A-314377 UAUCAUCCUUUA 3484 1109-1131 AAGGAUGAUA UUCCGUAAAGA AD-159275 A-314422 UUCCUUAGUGU 3299 1134-1154 A-314423 AAUGCAAGGAAC 3485 1132-1154 UCCUUGCAUU ACUAAGGAAGA AD-159848 A-315568 CAAUGCAACCA 3300 1776-1796 A-315569 UUUGGAUAGUUG 3486 1774-1796 ACUAUCCAAA GUUGCAUUGUU AD-159184 A-314240 AGAUUUGGCAG 3301 1043-1063 A-314241 AUUAUACUCUCU 3487 1041-1063 AGAGUAUAAU GCCAAAUCUGC AD-159231 A-314334 UUUCCACCAUG 3302 1090-1110 A-314335 UACCCUUAAUCA 3488 1088-1110 AUUAAGGGUA UGGUGGAAACU AD-159607 A-315086 ACUGGUUAGUG 3303 1489-1509 A-315087 AACUAUUUCACA 3489 1487-1509 UGAAAUAGUU CUAACCAGUUG AD-158504 A-312881 CAAGUCCAAUA 3304 263-283 A-312882 AGAGUUGCCAUA 3490 261-283 UGGCAACUCU UUGGACUUGGA AD-159233 A-314338 UCCACCAUGAU 3305 1092-1112 A-314339 AAGACCCUUAAU 3491 1090-1112 UAAGGGUCUU CAUGGUGGAAA AD-159411 A-314694 UCAUUUCACUG 3306 1289-1309 A-314695 UUAGCCUAGACA 3492 1287-1309 UCUAGGCUAA GUGAAAUGAUA AD-159462 A-314796 UGUCCUUUUUA 3307 1340-1360 A-314797 ACAGAUCAGAUA 3493 1338-1360 UCUGAUCUGU AAAAGGACAAC AD-159742 A-315356 CCAGUGUAUAA 3308 1662-1682 A-315357 UAUAUUGGAUUU 3494 1660-1682 AUCCAAUAUA AUACACUGGAU AD-159863 A-315598 UCCAAGUGUUA 3309 1791-1811 A-315599 UUAGUUGGUAUA 3495 1789-1811 UACCAACUAA ACACUUGGAUA AD-158687 A-313246 GAACACCAAAG 3310 490-510 A-313247 UAGAGACAAUCU 3496 488-510 AUUGUCUCUA UUGGUGUUCUA AD-158688 A-313248 AACACCAAAGA 3311 491-511 A-313249 UCAGAGACAAUC 3497 489-511 UUGUCUCUGA UUUGGUGUUCU AD-159458 A-314788 AUGUUGUCCUU 3312 1336-1356 A-314789 AUCAGAUAAAAA 3498 1334-1356 UUUAUCUGAU GGACAACAUGC AD-159519 A-314910 UCAACUCCUGA 3313 1401-1421 A-314911 AUUUCUAACUUC 3499 1399-1421 AGUUAGAAAU AGGAGUUGAUG AD-159858 A-315588 AACUAUCCAAG 3314 1786-1806 A-315589 UGGUAUAACACU 3500 1784-1806 UGUUAUACCA UGGAUAGUUGG AD-159583 A-315038 GGUAUUAAUCU 3315 1465-1485 A-315039 AGACUACACAAG 3501 1463-1485 UGUGUAGUCU AUUAAUACCAU AD-159700 A-315272 GGCUCCUUCAC 3316 1602-1622 A-315273 UGCAUGUUCAGU 3502 1600-1622 UGAACAUGCA GAAGGAGCCAG AD-159807 A-315486 UAUCAGUAGUG 3317 1728-1748 A-315487 UGGUAAUGUACA 3503 1726-1748 UACAUUACCA CUACUGAUAUA AD-158673 A-313218 CAGCCUUUUCC 3318 476-496 A-313219 UGUGUUCUAAGG 3504 474-496 UUAGAACACA AAAAGGCUGCC AD-159608 A-315088 CUGGUUAGUGU 3319 1490-1510 A-315089 UAACUAUUUCA 3505 1488-1510 GAAAUAGUUA CACUAACCAGUU AD-159803 A-315478 ACUAUAUCAGU 3320 1724-1744 A-315479 AAUGUACACUAC 3506 1722-1744 AGUGUACAUU UGAUAUAGUUC AD-159805 A-315482 UAUAUCAGUAG 3321 1726-1746 A-315483 UUAAUGUACACU 3507 1724-1746 UGUACAUUAA ACUGAUAUAGU AD-159489 A-314850 GUAAUAUUUUA 3322 1371-1391 A-314851 UAGUCCAUCUUA 3508 1369-1391 AGAUGGACUA AAAUAUUACUG AD-159495 A-314862 UUUUAAGAUGG 3323 1377-1397 A-314863 UUUUCCCAGUCC 3509 1375-1397 ACUGGGAAAA AUCUUAAAAUA AD-159706 A-315284 UUCACUGAACA 3324 1608-1628 A-315285 UGACUAGGCAUG 3510 1606-1628 UGCCUAGUCA UUCAGUGAAGG AD-159855 A-315582 ACCAACUAUCC 3325 1783-1803 A-315583 UAUAACACUUGG 3511 1781-1803 AAGUGUUAUA AUAGUUGGUUG AD-159864 A-315600 CCAAGUGUUAU 3326 1792-1812 A-315601 UUUAGUUGGUAU 3512 1790-1812 ACCAACUAAA AACACUUGGAU AD-159488 A-314848 AGUAAUAUUUU 3327 1370-1390 A-314849 AGUCCAUCUUAA 3513 1368-1390 AAGAUGGACU AAUAUUACUGC AD-159553 A-314978 AAAAUCCACAG 3328 1435-1455 A-314979 UAGGAUAUAGCU 3514 1433-1455 CUAUAUCCUA GUGGAUUUUAC AD-159703 A-315278 UCCUUCACUGA 3329 1605-1625 A-315279 UUAGGCAUGUUC 3515 1603-1625 ACAUGCCUAA AGUGAAGGAGC AD-159708 A-315288 CACUGAACAUG 3330 1610-1630 A-315289 UUGGACUAGGCA 3516 1608-1630 CCUAGUCCAA UGUUCAGUGAA AD-159866 A-315604 AAGUGUUAUAC 3331 1794-1814 A-315605 GUUUUAGUUGGU 3517 1792-1814 CAACUAAAAC AUAACACUUGG AD-159232 A-314336 UUCCACCAUGA 3332 1091-1111 A-314337 AGACCCUUAAUC 3518 1089-1111 UUAAGGGUCU AUGGUGGAAAC AD-159712 A-315296 GAACAUGCCUA 3333 1614-1634 A-315297 AAUGUUGGACUA 3519 1612-1634 GUCCAACAUU GGCAUGUUCAG AD-159808 A-315488 AUCAGUAGUGU 3334 1729-1749 A-315489 AUGGUAAUGUAC 3520 1727-1749 ACAUUACCAU ACUACUGAUAU AD-159862 A-315596 AUCCAAGUGUU 3335 1790-1810 A-315597 UAGUUGGUAUAA 3521 1788-1810 AUACCAACUA CACUUGGAUAG AD-158503 A-312879 CCAAGUCCAAU 3336 262-282 A-312880 UAGUUGCCAUAU 3522 260-282 AUGGCAACUA UGGACUUGGAA AD-159412 A-314696 CAUUUCACUGU 3337 1290-1310 A-314697 UGUAGCCUAGAC 3523 1288-1310 CUAGGCUACA AGUGAAAUGAU AD-159558 A-314988 CCACAGCUAUA 3338 1440-1460 A-314989 AGCAUCAGGAUA 3524 1438-1460 UCCUGAUGCU UAGCUGUGGAU AD-159705 A-315282 CUUCACUGAAC 3339 1607-1627 A-315283 UACUAGGCAUGU 3525 1605-1627 AUGCCUAGUA UCAGUGAAGGA AD-159113 A-314098 GUGGUUGAGAG 3340 972-992 A-314099 UUCAUAAGCACU 3526 970-992 UGCUUAUGAA CUCAACCACCU AD-159806 A-315484 AUAUCAGUAGU 3341 1727-1747 A-315485 UGUAAUGUACAC 3527 1725-1747 GUACAUUACA UACUGAUAUAG AD-159853 A-315578 CAACCAACUAU 3342 1781-1801 A-315579 UAACACUUGGAU 3528 1779-1801 CCAAGUGUUA AGUUGGUUGCA AD-159182 A-314236 GCAGAUUUGGC 3343 1041-1061 A-314237 UAUACUCUCUGC 3529 1039-1061 AGAGAGUAUA CAAAUCUGCUA AD-159702 A-315276 CUCCUUCACUG 3344 1604-1624 A-315277 UAGGCAUGUUCA 3530 1602-1624 AACAUGCCUA GUGAAGGAGCC AD-159715 A-315302 CAUGCCUAGUC 3345 1617-1637 A-315303 AAAAAUGUUGGA 3531 1615-1637 CAACAUUUUU CUAGGCAUGUU AD-158575 A-313022 UGCCAUCAGUA 3346 377-397 A-313023 UUCAUUAAGAUA 3532 375-397 UCUUAAUGAA CUGAUGGCACA AD-158576 A-313024 GCCAUCAGUAU 3347 378-398 A-313025 UUUCAUUAAGAU 3533 376-398 CUUAAUGAAA ACUGAUGGCAC AD-158684 A-313240 UUAGAACACCA 3348 487-507 A-313241 AGACAAUCUUUG 3534 485-507 AAGAUUGUCU GUGUUCUAAGG AD-159410 A-314692 AUCAUUUCACU 3349 1288-1308 A-314693 UAGCCUAGACAG 3535 1286-1308 GUCUAGGCUA UGAAAUGAUAU AD-159416 A-314704 UCACUGUCUAG 3350 1294-1314 A-314705 UUGUUGUAGCCU 3536 1292-1314 GCUACAACAA AGACAGUGAAA AD-159857 A-315586 CAACUAUCCAA 3351 1785-1805 A-315587 UGUAUAACACUU 3537 1783-1805 GUGUUAUACA GGAUAGUUGGU AD-158497 A-312867 UUGGUUCCAAG 3352 256-276 A-312868 UCAUAUUGGACU 3538 254-276 UCCAAUAUGA UGGAACCAAAA AD-159124 A-314120 UGCUUAUGAGG 3353 983-1003 A-314121 AGUUUGAUCACC 3539 981-1003 UGAUCAAACU UCAUAAGCACU AD-159312 A-314496 UCUCAGACCUU 3354 1171-1191 A-314497 UCACCUUCACAA 3540 1169-1191 GUGAAGGUGA GGUCUGAGAUU AD-159552 A-314976 UAAAAUCCACA 3355 1434-1454 A-314977 AGGAUAUAGCUG 3541 1432-1454 GCUAUAUCCU UGGAUUUUACA AD-159704 A-315280 CCUUCACUGAA 3356 1606-1626 A-315281 ACUAGGCAUGUU 3542 1604-1626 CAUGCCUAGU CAGUGAAGGAG AD-159737 A-315346 GGGAUCCAGUG 3357 1657-1677 A-315347 UGGAUUUAUACA 3543 1655-1677 UAUAAAUCCA CUGGAUCCCAG AD-159869 A-315610 CAAUAAACCUU 3358 1818-1838 A-315611 UUCACUGUUCAA 3544 1816-1838 GAACAGUGAA GGUUUAUUGGG AD-158570 A-313012 GGCCUGUGCCA 3359 371-391 A-313013 AAGAUACUGAUG 3545 369-391 UCAGUAUCUU GCACAGGCCAU AD-158618 A-313108 UUGUUGAUGUC 3360 421-441 A-313109 UGUCUUCGAUGA 3546 419-441 AUCGAAGACA CAUCAACAAGA AD-159184 A-314240 AGAUUUGGCAG 3361 1043-1063 A-314241 AUUAUACUCUCU 3547 1041-1063 AGAGUAUAAU GCCAAAUCUGC AD-159231 A-314334 UUUCCACCAUG 3362 1090-1110 A-314335 UACCCUUAAUCA 3548 1088-1110 AUUAAGGGUA UGGUGGAAACU AD-159423 A-314718 CUAGGCUACAA 3363 1301-1321 A-314719 UAGAAUCCUGUU 3549 1299-1321 CAGGAUUCUA GUAGCCUAGAC AD-159446 A-314764 UGGAGGUUGUG 3364 1324-1344 A-314765 UGACAACAUGCA 3550 1322-1344 CAUGUUGUCA CAACCUCCACC AD-159701 A-315274 GCUCCUUCACU 3365 1603-1623 A-315275 AGGCAUGUUCAG 3551 1601-1623 GAACAUGCCU UGAAGGAGCCA AD-158494 A-312861 CUUUUGGUUCC 3366 253-273 A-312862 UAUUGGACUUGG 3552 251-273 AAGUCCAAUA AACCAAAAGGA AD-158571 A-313014 GCCUGUGCCAU 3367 372-392 A-313015 UAAGAUACUGAU 3553 370-392 CAGUAUCUUA GGCACAGGCCA AD-159125 A-314122 GCUUAUGAGGU 3368 984-1004 A-314123 UAGUUUGAUCAC 3554 982-1004 GAUCAAACUA CUCAUAAGCAC AD-159126 A-314124 CUUAUGAGGUG 3369 985-1005 A-314125 UGAGUUUGAUCA 3555 983-1005 AUCAAACUCA CCUCAUAAGCA AD-159287 A-314446 CCUUGCAUUUU 3370 1146-1166 A-314447 AUUCUGUCCCAA 3556 1144-1166 GGGACAGAAU AAUGCAAGGAA AD-158499 A-312871 GGUUCCAAGUC 3371 258-278 A-312872 UGCCAUAUUGGA 3557 256-278 CAAUAUGGCA CUUGGAACCAA AD-159417 A-314706 CACUGUCUAGG 3372 1295-1315 A-314707 UCUGUUGUAGC 3558 1293-1315 CUACAACAGA CUAGACAGUGAA AD-159418 A-314708 ACUGUCUAGGC 3373 1296-1316 A-314709 UCCUGUUGUAG 3559 1294-1316 UACAACAGGA CCUAGACAGUGA AD-158550 A-312972 AAUAAGAUUAC 3374 333-353 A-312973 UCCAACAACUGU 3560 331-353 AGUUGUUGGA AAUCUUAUUCU AD-159116 A-314104 GUUGAGAGUGC 3375 975-995 A-314105 UACCUCAUAAGC 3561 973-995 UUAUGAGGUA ACUCUCAACCA AD-159421 A-314714 GUCUAGGCUAC 3376 1299-1319 A-314715 UAAUCCUGUUGU 3562 1297-1319 AACAGGAUUA AGCCUAGACAG AD-159422 A-314716 UCUAGGCUACA 3377 1300-1320 A-314717 AGAAUCCUGUUG 3563 1298-1320 ACAGGAUUCU UAGCCUAGACA AD-159445 A-314762 GUGGAGGUUGU 3378 1323-1343 A-314763 UACAACAUGCAC 3564 1321-1343 GCAUGUUGUA AACCUCCACCU AD-159130 A-314132 UGAGGUGAUCA 3379 989-1009 A-314133 UCUUUGAGUUUG 3565 987-1009 AACUCAAAGA AUCACCUCAUA AD-159134 A-314140 GUGAUCAAACU 3380 993-1013 A-314141 UUAGCCUUUGAG 3566 991-1013 CAAAGGCUAA UUUGAUCACCU AD-159343 A-314558 UGAGGAAGAGG 3381 1202-1222 A-314559 UUCAAACGGGCC 3567 1200-1222 CCCGUUUGAA UCUUCCUCAGA AD-159105 A-314082 ACAAGCAGGUG 3382 964-984 A-314083 UACUCUCAACCA 3568 962-984 GUUGAGAGUA CCUGCUUGUGA AD-159183 A-314238 CAGAUUUGGCA 3383 1042-1062 A-314239 UUAUACUCUCUG 3569 1040-1062 GAGAGUAUAA CCAAAUCUGCU AD-159123 A-314118 GUGCUUAUGAG 3384 982-1002 A-314119 GUUUGAUCACCU 3570 980-1002 GUGAUCAAAC CAUAAGCACUC AD-159181 A-314234 AGCAGAUUUGG 3385 1040-1060 A-314235 AUACUCUCUGCC 3571 1038-1060 CAGAGAGUAU AAAUCUGCUAC AD-159186 A-314244 AUUUGGCAGAG 3386 1045-1065 A-314245 UCAUUAUACUCU 3572 1043-1065 AGUAUAAUGA CUGCCAAAUCU AD-159187 A-314246 UUUGGCAGAGA 3387 1046-1066 A-314247 UUCAUUAUACUC 3573 1044-1066 GUAUAAUGAA UCUGCCAAAUC AD-159288 A-314448 CUUGCAUUUUG 3388 1147-1167 A-314449 UAUUCUGUCCCA 3574 1145-1167 GGACAGAAUA AAAUGCAAGGA AD-159306 A-314484 AUGGAAUCUCA 3389 1165-1185 A-314485 UCACAAGGUCUG 3575 1163-1185 GACCUUGUGA AGAUUCCAUUC AD-159559 A-314990 CACAGCUAUAU 3390 1441-1461 A-314991 UAGCAUCAGGAU 3576 1439-1461 CCUGAUGCUA AUAGCUGUGGA AD-159344 A-314560 GAGGAAGAGGC 3391 1203-1223 A-314561 UUUCAAACGGGC 3577 1201-1223 CCGUUUGAAA CUCUUCCUCAG AD-159341 A-314554 UCUGAGGAAGA 3392 1200-1220 A-314555 UAAACGGGCCUC 3578 1198-1220 GGCCCGUUUA UUCCUCAGAAG AD-159729 A-315330 CACAUCCUGGG 3393 1649-1669 A-315331 UACACUGGAUCC 3579 1647-1669 AUCCAGUGUA CAGGAUGUGAC AD-158674 A-313220 AGCCUUUUCCU 3394 477-497 A-313221 UGGUGUUCUAAG 3580 475-497 UAGAACACCA GAAAAGGCUGC AD-159604 A-315080 UCAACUGGUUA 3395 1486-1506 A-315081 UAUUUCACACUA 3581 1484-1506 GUGUGAAAUA ACCAGUUGAAG

    TABLE-US-00005 TABLE 5 MODIFIED HUMAN/CYNOMOLGUS CROSS-REACTIVE LDHA iRNA SEQUENCES Sense Antisense  SEQ Duplex Sequence  SEQ ID Sequence SEQ ID mRNA target ID Name 5′to 3′ NO 5′to 3′ NO sequence NO AD-159469 ususuaucUfg 3582 usUfsuaaUfc 3768 UUUUUAUCUGAUCUGUGAUUAAA 3954 AfUfCfuguga AfCfagauCfa uuaaaL96 Gfauaaasasa AD-159607 ascsugguUfa 3583 asAfscuaUfu 3769 CAACUGGUUAGUGUGAAAUAGUU 3955 GfUfGfugaaa UfCfacacUfa uaguuL96 Afccagususg AD-159713 asascaugCfc 3584 asAfsaugUfu 3770 UGAACAUGCCUAGUCCAACAUUU 3956 UfAfGfuccaa GfGfacuaGfg cauuuL96 Cfauguuscsa AD-158504 csasagucCfa 3585 asGfsaguUfg 3771 UCCAAGUCCAAUAUGGCAACUCU 3957 AfUfAfuggca CfCfauauUfg acucuL96 Gfacuugsgsa AD-159233 uscscaccAfu 3586 asAfsgacCfc 3772 UUUCCACCAUGAUUAAGGGUCUU 3958 GfAfUfuaagg UfUfaaucAfu gucuuL96 Gfguggasusu AD-159411 uscsauuuCfa 3587 usUfsagcCfu 3773 UAUCAUUUCACUGUCUAGGCUAC 3959 CfUfGfucuag AfGfacagUfg gcuaaL96 Afaaugasusa AD-159462 usgsuccuUfu 3588 asCfsagaUfc 3774 GUUGUCCUUUUUAUCUGAUCUGU 3960 UfUfAfucuga AfGfauaaAfa ucuguL96 Afggacasasc AD-159742 cscsagugUfa 3589 usAfsuauUfg 3775 AUCCAGUGUAUAAAUCCAAUAUC 3961 UfAfAfaucca GfAfuuuaUfa auauaL96 Cfacuggsasu AD-159863 uscscaagUfg 3590 usUfsaguUfg 3776 UAUCCAAGUGUUAUACCAACUAA 3962 UfUfAfuacca GfUfatmaCfa acuaaL96 Cfuuggasusa AD-158626 gsuscaucGfa 3591 usUfsucaAfu 3777 AUGUCAUCGAAGACAAAUUGAAG 3963 AfGfAfcaaau UfUfgucuUfc ugaaaL96 Gfaugacsasu AD-158687 gsasacacCfa 3592 usAfsgagAfc 3778 UAGAACACCAAAGAUUGUCUCUG 3964 AfAfGfauugu AfAfucuuUfg cucuaL96 Gfuguucsusa AD-158688 asascaccAfa 3593 usCfsagaGfa 3779 AGAACACCAAAGAUUGUCUCUGG 3965 AfGfAfuuguc CfAfaucuUfu ucugaL96 Gfguguuscsu AD-159458 asusguugUfc 3594 asUfscagAfu 3780 GCAUGUUGUCCUUUUUAUCUGAU 3966 CfUfUfuuuau AfAfaaagGfa cugauL96 Cfaacausgsc AD-159519 uscsaacuCfc 3595 asUfsuucUfa 3781 CAUCAACUCCUGAAGUUAGAAAU 3967 UfGfAfaguua AfCfuucaGfg gaaauL96 Afguugasusg AD-159858 asascuauCfc 3596 usGfsguaUfa 3782 CCAACUAUCCAAGUGUUAUACCA 3968 AfAfGfuguua AfCfacuuGfg uaccaL96 Afuaguusgsg AD-158681 uscscuuaGfa 3597 usAfsaucUfu 3783 UUUCCUUAGAACACCAAAGAUUG 3969 AfCfAfccaaa UfGfguguUfc gauuaL96 Ufaaggasasa AD-159583 gsgsuauuAfa 3598 asGfsacuAfc 3784 AUGGUAUUAAUCUUGUGUAGUCU 3970 UfCfUfugugu AfCfaagaUfu agucuL96 Afauaccsasu AD-159700 gsgscuccUfu 3599 usGfscauGfu 3785 CUGGCUCCUUCACUGAACAUGCC 3971 CfAfCfugaac UfCfagugAfa augcaL96 Gfgagccsasg AD-159807 usasucagUfa 3600 usGfsguaAfu 3786 UAUAUCAGUAGUGUACAUUACCA 3972 GfUfGfuacau GfUfacacUfa uaccaL96 Cfugauasusa AD-158673 csasgccuUfu 3601 usGfsuguUfc 3787 GGCAGCCUUUUCCUUAGAACACC 3973 UfCfCfuuaga UfAfaggaAfa acacaL96 Afggcugscsc AD-159608 csusgguuAfg 3602 usAfsacuAfu 3788 AACUGGUUAGUGUGAAAUAGUUC 3974 UfGfUfgaaau UfUfcacaCfu aguuaL96 Afaccagsusu AD-159803 ascsuauaUfc 3603 asAfsuguAfc 3789 GAACUAUAUCAGUAGUGUACAUU 3975 AfGfUfagugu AfCfuacuGfa acauuL96 Ufauagususc AD-159805 usasuaucAfg 3604 usUfsaauGfu 3790 ACUAUAUCAGUAGUGUACAUUAC 3976 UfAfGfuguac AfCfacuaCfu auuaaL96 Gfauauasgsu AD-159489 gsusaauaUfu 3605 usAfsgucCfa 3791 CAGUAAUAUUUUAAGAUGGACUG 3977 UfUfAfagaug UfCfuuaaAfa gacuaL96 Ufauuacsusg AD-159495 ususuuaaGfa 3606 usUfsuucCfc 3792 UAUUUUAAGAUGGACUGGGAAAA 3978 UfGfGfacugg AfGfuccaUfc gaaaaL96 Ufuaaaasusa AD-159609 usgsguuaGfu 3607 asGfsaacUfa 3793 ACUGGUUAGUGUGAAAUAGUUCU 3979 GfUfGfaaaua UfUfucacAfc guucuL96 Ufaaccasgsu AD-159706 ususcacuGfa 3608 usGfsacuAfg 3794 CCUUCACUGAACAUGCCUAGUCC 3980 AfCfAfugccu GfCfauguUfc agucaL96 Afgugaasgsg AD-159855 ascscaacUfa 3609 usAfsuaaCfa 3795 CAACCAACUAUCCAAGUGUUAUA 3981 UfCfCfaagug CfUfuggaUfa uuauaL96 Gfuuggususg AD-159864 cscsaaguGfu 3610 usUfsuagUfu 3796 AUCCAAGUGUUAUACCAACUAAA 3982 UfAfUfaccaa GfGfuauaAfc cuaaaL96 Afcuuggsasu AD-158491 ususccuuUfu 3611 usGfsgacUfu 3797 GAUUCCUUUUGGUUCCAAGUCCA 3983 GfGfUfuccaa GfGfaaccAfa guccaL96 Afaggaasusc AD-158672 gscsagccUfu 3612 usUfsguuCfu 3798 UGGCAGCCUUUUCCUUAGAACAC 3984 UfUfCfcuuag AfAfggaaAfa aacaaL96 Gfgcugcscsa AD-159488 asgsuaauAfu 3613 asGfsuccAfu 3799 GCAGUAAUAUUUUAAGAUGGACU 3985 UfUfUfaagau CfUfuaaaAfu ggacuL96 Afuuacusgsc AD-159553 asasaaucCfa 3614 usAfsggaUfa 3800 GUAAAAUCCACAGCUAUAUCCUG 3986 CfAfGfcuaua UfAfgcugUfg uccuaL96 Gfauuuusasc AD-159703 uscscuucAfc 3615 usUfsaggCfa 3801 GCUCCUUCACUGAACAUGCCUAG 3987 UfGfAfacaug UfGfuucaGfu ccuaaL96 Gfaaggasgsc AD-159708 csascugaAfc 3616 usUfsggaCfu 3802 UUCACUGAACAUGCCUAGUCCAA 3988 AfUfGfccuag AfGfgcauGfu uccaaL96 Ufcagugsasa AD-159866 asasguguUfa 3617 gsUfsuuuAfg 3803 CCAAGUGUUAUACCAACUAAAAC 3989 UfAfCfcaacu UfUfgguaUfa aaaacL96 Afcacuusgsg AD-159232 ususccacCfa 3618 asGfsaccCfu 3804 GUUUCCACCAUGAUUAAGGGUCU 3990 UfGfAfuuaag UfAfaucaUfg ggucuL96 Gfuggaasasc AD-159712 gsasacauGfc 3619 asAfsuguUfg 3805 CUGAACAUGCCUAGUCCAACAUU 3991 CfUfAfgucca GfAfcuagGfc acauuL96 Afuguucsasg AD-159808 asuscaguAfg 3620 asUfsgguAfa 3806 AUAUCAGUAGUGUACAUUACCAU 3992 UfGfUfacauu UfGfuacaCfu accauL96 Afcugausasu AD-159862 asusccaaGfu 3621 usAfsguuGfg 3807 CUAUCCAAGUGUUAUACCAACUA 3993 GfUfUfauacc UfAfuaacAfc aacuaL96 Ufuggausasg AD-158503 cscsaaguCfc 3622 usAfsguuGfc 3808 UUCCAAGUCCAAUAUGGCAACUC 3994 AfAfUfauggc CfAfuauuGfg aacuaL96 Afcuuggsasa AD-159311 asuscucaGfa 3623 usAfsccuUfc 3809 GAAUCUCAGACCUUGUGAAGGUG 3995 CfCfUfuguga AfCfaaggUfc agguaL96 Ufgagaususc AD-159412 csasuuucAfc 3624 usGfsuagCfc 3810 AUCAUUUCACUGUCUAGGCUACA 3996 UfGfUfcuagg UfAfgacaGfu cuacaL96 Gfaaaugsasu AD-159558 cscsacagCfu 3625 asGfscauCfa 3811 AUCCACAGCUAUAUCCUGAUGCU 3997 AfUfAfuccug GfGfauauAfg augcuL96 Cfuguggsasu AD-159705 csusucacUfg 3626 usAfscuaGfg 3812 UCCUUCACUGAACAUGCCUAGUC 3998 AfAfCfaugcc CfAfuguuCfa uaguaL96 Gfugaagsgsa AD-159113 gsusgguuGfa 3627 usUfscauAfa 3813 AGGUGGUUGAGAGUGCUUAUGAG 3999 GfAfGfugcuu GfCfacucUfc augaaL96 Afaccacscsu AD-159139 csasaacuCfa 3628 usAfsuguGfu 3814 AUCAAACUCAAAGGCUACACAUC 4000 AfAfGfgcuac AfGfccuuUfg acauaL96 Afguuugsasu AD-159806 asusaucaGfu 3629 usGfsuaaUfg 3815 CUAUAUCAGUAGUGUACAUUACC 4001 AfGfUfguaca UfAfcacuAfc uuacaL96 Ufgauausasg AD-159853 csasaccaAfc 3630 usAfsacaCfu 3816 UGCAACCAACUAUCCAAGUGUUA 4002 UfAfUfccaag UfGfgauaGfu uguuaL96 Ufgguugscsa AD-158627 uscsaucgAfa 3631 usCfsuucAfa 3817 UGUCAUCGAAGACAAAUUGAAGG 4003 GfAfCfaaauu UfUfugucUfu gaagaL96 Cfgaugascsa AD-159182 gscsagauUfu 3632 usAfsuacUfc 3818 UAGCAGAUUUGGCAGAGAGUAUA 4004 GfGfCfagaga UfCfugccAfa guauaL96 Afucugcsusa AD-159702 csusccuuCfa 3633 usAfsggcAfu 3819 GGCUCCUUCACUGAACAUGCCUA 4005 CfUfGfaacau GfUfucagUfg gccuaL96 Afaggagscsc AD-159715 csasugccUfa 3634 asAfsaaaUfg 3820 AACAUGCCUAGUCCAACAUUUUU 4006 GfUfCfcaaca UfUfggacUfa uuuuuL96 Gfgcaugsusu AD-158575 usgsccauCfa 3635 usUfscauUfa 3821 UGUGCCAUCAGUAUCUUAAUGAA 4007 GfUfAfucuua AfGfauacUfg augaaL96 Afuggcascsa AD-158576 gscscaucAfg 3636 usUfsucaUfu 3822 GUGCCAUCAGUAUCUUAAUGAAG 4008 UfAfUfcuuaa AfAfgauaCfu ugaaaL96 Gfauggcsasc AD-158684 ususagaaCfa 3637 asGfsacaAfu 3823 CCUUAGAACACCAAAGAUUGUCU 4009 CfCfAfaagau CfUfuuggUfg ugucuL96 Ufucuaasgsg AD-159410 asuscauuUfc 3638 usAfsgccUfa 3824 AUAUCAUUUCACUGUCUAGGCUA 4010 AfCfUfgucua GfAfcaguGfa ggcuaL96 Afaugausasu AD-159416 uscsacugUfc 3639 usUfsguuGfu 3825 UUUCACUGUCUAGGCUACAACAG 4011 UfAfGfgcuac AfGfccuaGfa aacaaL96 Cfagugasasa AD-159738 gsgsauccAfg 3640 usUfsggaUfu 3826 UGGGAUCCAGUGUAUAAAUCCAA 4012 UfGfUfauaaa UfAfuacaCfu uccaaL96 Gfgauccscsa AD-159857 csasacuaUfc 3641 usGfsuauAfa 3827 ACCAACUAUCCAAGUGUUAUACC 4013 CfAfAfguguu CfAfcuugGfa auacaL96 Ufaguugsgsu AD-158497 ususgguuCf 3642 usCfsauaUfu 3828 UUUUGGUUCCAAGUCCAAUAUGG 4014 cAfAfGfucc GfGfacuuGfg aauaugaL96 Afaccaasasa AD-159124 usgscuuaUf 3643 asGfsuuuGfa 3829 AGUGCUUAUGAGGUGAUCAAACU 4015 gAfGfGfuga UfCfaccuCfa ucaaacuL96 Ufaagcascsu AD-159141 asasacucAf 3644 usGfsaugUfg 3830 UCAAACUCAAAGGCUACACAUCC 4016 aAfGfGfcua UfAfgccuUfu cacaucaL96 Gfaguuusgsa AD-159312 uscsucagAf 3645 usCfsaccUfu 3831 AAUCUCAGACCUUGUGAAGGUGA 4017 cCfUfUfgug CfAfcaagGfu aaggugaL96 Cfugagasusu AD-159552 usasaaauCf 3646 asGfsgauAfu 3832 UGUAAAAUCCACAGCUAUAUCCU 4018 cAfCfAfgcu AfGfcuguGfg auauccuL96 Afuuuuascsa AD-159704 cscsuucaCf 3647 asCfsuagGfc 3833 CUCCUUCACUGAACAUGCCUAGU 4019 uGfAfAfcau AfUfguucAfg gccuaguL96 Ufgaaggsasg AD-159737 gsgsgaucCf 3648 usGfsgauUfu 3834 CUGGGAUCCAGUGUAUAAAUCCA 4020 aGfUfGfuau AfUfacacUfg aaauccaL96 Gfaucccsasg AD-159869 csasauaaAf 3649 usUfscacUfg 3835 CCCAAUAAACCUUGAACAGUGAC 4021 cCfUfUfgaa UfUfcaagGfu cagugaaL96 Ufuauugsgsg AD-158570 gsgsccugUf 3650 asAfsgauAfc 3836 AUGGCCUGUGCCAUCAGUAUCUU 4022 gCfCfAfuca UfGfauggCfa guaucuuL96 Cfaggccsasu AD-158618 ususguugAf 3651 usGfsucuUfc 3837 UCUUGUUGAUGUCAUCGAAGACA 4023 uGfUfCfauc GfAfugacAfu gaagacaL96 Cfaacaasgsa AD-159788 gsgsaucuUf 3652 asUfsaguUfc 3838 AAGGAUCUUAUUUUGUGAACUAU 4024 aUfUfUfugu AfCfaaaaUfa gaacuauL96 Afgauccsusu AD-159786 asasggauCf 3653 asGfsuucAfc 3839 CAAAGGAUCUUAUUUUGUGAACU 4025 uUfAfUfuuu AfAfaauaAfg gugaacuL96 Afuccuususg AD-159760 asuscaugUf 3654 usAfsauuAfu 3840 AUAUCAUGUCUUGUGCAUAAUUC 4026 cUfUfGfugc GfCfacaaGfa auaauuaL96 Cfaugausasu AD-159404 usgsucauAf 3655 asGfsacaGfu 3841 GAUGUCAUAUCAUUUCACUGUCU 4027 uCfAfUfuuc GfAfaaugAfu acugucuL96 Afugacasusc AD-159406 uscsauauCf 3656 usUfsagaCfa 3842 UGUCAUAUCAUUUCACUGUCUAG 4028 aUfUfUfcac GfUfgaaaUfg ugucuaaL96 Afuaugascsa AD-158536 asusuuauAf 3657 usUfsccuUfu 3843 UGAUUUAUAAUCUUCUAAAGGAA 4029 aUfCfUfucu AfGfaagaUfu aaaggaaL96 Afuaaauscsa AD-159545 usgsguuuGf 3658 asGfscugUfg 3844 AAUGGUUUGUAAAAUCCACAGCU 4030 uAfAfAfauc GfAfuuuuAfc cacagcuL96 Afaaccasusu AD-159574 asusgcugGf 3659 asAfsgauUfa 3845 UGAUGCUGGAUGGUAUUAAUCUU 4031 aUfGfGfuau AfUfaccaUfc uaaucuuL96 Cfagcauscsa AD-159802 asascuauAf 3660 asUfsguaCfa 3846 UGAACUAUAUCAGUAGUGUACAU 4032 uCfAfGfuag CfUfacugAfu uguacauL96 Afuaguuscsa AD-159518 asuscaacUf 3661 usUfsucuAfa 3847 ACAUCAACUCCUGAAGUUAGAAA 4033 cCfUfGfaag CfUfucagGfa uuagaaaL96 Gfuugausgsu AD-159577 csusggauGf 3662 usAfscaaGfa 3848 UGCUGGAUGGUAUUAAUCUUGUG 4034 gUfAfUfuaa UfUfaauaCfc ucuuguaL96 Afuccagscsa AD-159409 usasucauUf 3663 asGfsccuAfg 3849 CAUAUCAUUUCACUGUCUAGGCU 4035 uCfAfCfugu AfCfagugAfa cuaggcuL96 Afugauasusg AD-159551 gsusaaaaUf 3664 usGfsauaUfa 3850 UUGUAAAAUCCACAGCUAUAUCC 4036 cCfAfCfagc GfCfugugGfa uauaucaL96 Ufuuuacsasa AD-159276 uscscuuaGf 3665 asAfsaugCfa 3851 CUUCCUUAGUGUUCCUUGCAUUU 4037 uGfUfUfccu AfGfgaacAfc ugcauuuL96 Ufaaggasasg AD-159407 csasuaucAf 3666 usCfsuagAfc 3852 GUCAUAUCAUUUCACUGUCUAGG 4038 uUfUfCfacu AfGfugaaAfu gucuagaL96 Gfauaugsasc AD-159515 asascaucAf 3667 usUfsaacUfu 3853 AAAACAUCAACUCCUGAAGUUAG 4039 aCfUfCfcug CfAfggagUfu aaguuaaL96 Gfauguususu AD-159570 cscsugauGf 3668 usUfsaauAfc 3854 AUCCUGAUGCUGGAUGGUAUUAA 4040 cUfGfGfaug CfAfuccaGfc guauuaaL96 Afucaggsasu AD-159849 asasugcaAf 3669 asCfsuugGfa 3855 ACAAUGCAACCAACUAUCCAAGU 4041 cCfAfAfcua UfAfguugGfu uccaaguL96 Ufgcauusgsu AD-159252 ususuacgGf 3670 usAfsucaUfc 3856 UCUUUACGGAAUAAAGGAUGAUG 4042 aAfUfAfaag CfUfuuauUfc gaugauaL96 Cfguaaasgsa AD-159275 ususccuuAf 3671 asAfsugcAfa 3857 UCUUCCUUAGUGUUCCUUGCAUU 4043 gUfGfUfucc GfGfaacaCfu uugcauuL96 Afaggaasgsa AD-159848 csasaugcAf 3672 usUfsuggAfu 3858 AACAAUGCAACCAACUAUCCAAG 4044 aCfCfAfacu AfGfuuggUfu auccaaaL96 Gfcauugsusu AD-159184 asgsauuuGf 3673 asUfsuauAfc 3859 GCAGAUUUGGCAGAGAGUAUAAU 4045 gCfAfGfaga UfCfucugCfc guauaauL96 Afaaucusgsc AD-159231 ususuccaCf 3674 usAfscccUfu 3860 AGUUUCCACCAUGAUUAAGGGUC 4046 cAfUfGfauu AfAfucauGfg aaggguaL96 Ufggaaascsu AD-159607 ascsugguUf 3675 asAfscuaUfu 3861 CAACUGGUUAGUGUGAAAUAGUU 4047 aGfUfGfuga UfCfacacUfa aauaguuL96 Afccagususg AD-158504 csasagucCf 3676 asGfsaguUfg 3862 UCCAAGUCCAAUAUGGCAACUCU 4048 aAfUfAfugg CfCfauauUfg caacucuL96 Gfacuugsgsa AD-159233 uscscaccAf 3677 asAfsgacCfc 3863 UUUCCACCAUGAUUAAGGGUCUU 4049 uGfAfUfuaa UfUfaaucAfu gggucuuL96 Gfguggasasa AD-159411 uscsauuuCf 3678 usUfsagcCfu 3864 UAUCAUUUCACUGUCUAGGCUAC 4050 aCfUfGfucu AfGfacagUfg aggcuaaL96 Afaaugasusa AD-150462 usgsuccuUf 3679 asCfsagaUfc 3865 GUUGUCCUUUUUAUCUGAUCUGU 4051 uUfUfAfucu AfGfauaaAfa gaucuguL96 Afggacasasc AD-159742 cscsagugUf 3680 usAfsuauUfg 3866 AUCCAGUGUAUAAAUCCAAUAUC 4052 aUfATAfauc GfAfuuuaUfa caauauaL96 Cfacuggsasu AD-159863 uscscaagUf 3681 usUfsaguUfg 3867 UAUCCAAGUGUUAUACCAACUAA 4053 gUfUfAfuac GfUfauaaCfa caacuaaL96 Cfuuggasusa AD-158687 gsasacacCf 3682 usAfsgagAfc 3868 UAGAACACCAAAGAUUGUCUCUG 4054 aAfATGfauu AfAfucuuUfg gucucuaL96 Gfuguucsusa AD-158688 asascaccAf 3683 usCfsagaGfa 3869 AGAACACCAAAGAUUGUCUCUGG 4055 aAfGfAfuug CfAfaucuUfu ucucugaL96 Gfguguuscsu AD-159458 asusguugUf 3684 asUfscagAfu 3870 GCAUGUUGUCCUUUUUAUCUGAU 4056 cCfUfUfuuu AfAfaaagGfa aucugauL96 Cfaacausgsc AD-159519 uscsaacuCf 3685 asUfsuucUfa 3871 CAUCAACUCCUGAAGUUAGAAAU 4057 cUfGfAfagu AfCfuucaGfg uagaaauL96 Afguugasusg AD-159858 asascuauCf 3686 usGfsguaUfa 3872 CCAACUAUCCAAGUGUUAUACCA 4058 cAfAfGfugu AfCfacuuGfg uauaccaL96 Afuaguusgsg AD-159583 gsgsuauuAf 3687 asGfsacuAfc 3873 AUGGUAUUAAUCUUGUGUAGUCU 4059 aUfCfUfugu AfCfaagaUfu guagucuL96 Afauaccsasu AD-159700 gsgscuccUf 3688 usGfscauGfu 3874 CUGGCUCCUUCACUGAACAUGCC 4060 uCfAfCfuga UfCfagugAfa acaugcaL96 Gfgagccsasg AD-159807 usasucagUf 3689 usGfsguaAfu 3875 UAUAUCAGUAGUGUACAUUACCA 4061 aGfUfGfuac GfUfacacUfa auuaccaL96 Cfugauasusa AD-158673 csasgccuUf 3690 usGfsuguUfc 3876 GGCAGCCUUUUCCUUAGAACACC 4062 uUfCfCfuua UfAfaggaAfa gaacacaL96 Afggcugscsc AD-159608 csusgguuAf 3691 usAfsacuAfu 3877 AACUGGUUAGUGUGAAAUAGUUC 4063 gUfGfUfgaa UfUfcacaCfu auaguuaL96 Afaccagsusu AD-159803 ascsuauaUf 3692 asAfsuguAfc 3878 GAACUAUAUCAGUAGUGUACAUU 4064 cAfGfUfagu AfCfuacuGfa guacauuL96 Ufauagususc AD-159805 usasuaucAf 3693 usUfsaauGfu 3879 ACUAUAUCAGUAGUGUACAUUAC 4065 gUfAfGfugu AfCfacuaCfu acauuaaL96 Gfauauasgsu AD-159489 gsusaauaUf 3694 usAfsgucCfa 3880 CAGUAAUAUUUUAAGAUGGACUG 4066 uUfUfAfaga UfCfuuaaAfa uggacuaL96 Ufauuacsusg AD-159495 ususuuaaGf 3695 usUfsuucCfc 3881 UAUUUUAAGAUGGACUGGGAAAA 4067 aUfGfGfacu AfGfuccaUfc gggaaaaL96 Ufuaaaasusa AD-159706 ususcacuGf 3696 usGfsacuAfg 3882 CCUUCACUGAACAUGCCUAGUCC 4068 aAfCfAfugc GfCfauguUfc cuagucaL96 Afgugaasgsg AD-159855 ascscaacUf 3697 usAfsuaaCfa 3883 CAACCAACUAUCCAAGUGUUAUA 4069 aUfCfCfaag CfUfuggaUfa uguuauaL96 Gfuuggususg AD-159864 cscsaaguGf 3698 usUfsuagUfu 3884 AUCCAAGUGUUAUACCAACUAAA 4070 uUfAfUfacc GfGfuauaAfc aacuaaaL96 Afcuuggsasu AD-159488 asgsuaauAf 3699 asGfsuccAfu 3885 GCAGUAAUAUUUUAAGAUGGACU 4071 uUfUfUfaag CfUfuaaaAfu auggacuL96 Afuuacusgsc AD-159553 asasaaucCf 3700 usAfsggaUfa 3886 GUAAAAUCCACAGCUAUAUCCUG 4072 aCfAfGfcua UfAfgcugUfg uauccuaL96 Gfauuuusasc AD-159703 uscscuucAf 3701 usUfsaggCfa 3887 GCUCCUUCACUGAACAUGCCUAG 4073 cUfGfAfaca UfGfuucaGfu ugccuaaL96 Gfaaggasgsc AD-159708 csascugaAf 3702 usUfsggaCfu 3888 UUCACUGAACAUGCCUAGUCCAA 4074 cAfUfGfccu AfGfgcauGfu aguccaaL96 Ufcagugsasa AD-159866 asasguguUf 3703 gsUfsuuuAfg 3889 CCAAGUGUUAUACCAACUAAAAC 4075 aUfAfCfcaa UfUfgguaUfa cuaaaacL96 Afcacuusgsg AD-159232 ususccacCf 3704 asGfsaccCfu 3890 GUUUCCACCAUGAUUAAGGGUCU 4076 aUfGfAfuua UfAfaucaUfg agggucuL96 Gfuggaasasc AD-159712 gsasacauGf 3705 asAfsuguUfg 3891 CUGAACAUGCCUAGUCCAACAUU 4077 cCfUfAfguc GfAfcuagGfc caacauuL96 Afuguucsasg AD-159808 asuscaguAf 3706 asUfsgguAfa 3892 AUAUCAGUAGUGUACAUUACCAU 4078 gUfGfUfaca UfGfuacaCfu uuaccauL96 Afcugausasu AD-159862 asusccaaGf 3707 usAfsguuGfg 3893 CUAUCCAAGUGUUAUACCAACUA 4079 uGfUfUfaua UfAfuaacAfc ccaacuaL96 Ufuggausasg AD-158503 cscsaaguCf 3708 usAfsguuGfc 3894 UUCCAAGUCCAAUAUGGCAACUC 4080 cAfAfUfaug CfAfuauuGfg gcaacuaL96 Afcuuggsasa AD-159412 csasuuucAf 3709 usGfsuagCfc 3895 AUCAUUUCACUGUCUAGGCUACA 4081 cUfGfUfcua UfAfgacaGfu ggcuacaL96 Gfaaaugsasu AD-159558 cscsacagCf 3710 asGfscauCfa 3896 AUCCACAGCUAUAUCCUGAUGCU 4082 uAfUfAfucc GfGfauauAfg ugaugcuL96 Cfuguggsasu AD-159705 csusucacUf 3711 usAfscuaGfg 3897 UCCUUCACUGAACAUGCCUAGUC 4083 gAfAfCfaug CfAfuguuCfa ccuaguaL96 Gfugaagsgsa AD-159113 gsusgguuGf 3712 usUfscauAfa 3898 AGGUGGUUGAGAGUGCUUAUGAG 4084 aGfAfGfugc GfCfacucUfc uuaugaaL96 Afaccacscsu AD-159806 asusaucaGf 3713 usGfsuaaUfg 3899 CUAUAUCAGUAGUGUACAUUACC 4085 uAfGfUfgua UfAfcacuAfc cauuacaL96 Ufgauausasg AD-159853 csasaccaAf 3714 usAfsacaCfu 3900 UGCAACCAACUAUCCAAGUGUUA 4086 cUfAfUfcca UfGfgauaGfu aguguuaL96 Ufgguugscsa AD-159182 gscsagauUf 3715 usAfsuacUfc 3901 UAGCAGAUUUGGCAGAGAGUAUA 4087 uGfGfCfaga UfCfugccAfa gaguauaL96 Afucugcsusa AD-159702 csusccuuCf 3716 usAfsggcAfu 3902 GGCUCCUUCACUGAACAUGCCUA 4088 aCfUfGfaac GfUfucagUfg augccuaL96 Afaggagscsc AD-159715 csasugccUf 3717 asAfsaaaUfg 3903 AACAUGCCUAGUCCAACAUUUUU 4089 aGfUfCfcaa UfUfggacUfa cauuuuuL96 Gfgcaugsusu AD-158575 usgsccauCf 3718 usUfscauUfa 3904 UGUGCCAUCAGUAUCUUAAUGAA 4090 aGfUfAfucu AfGfauacUfg uaaugaaL96 Afuggcascsa AD-158576 gscscaucAf 3719 usUfsucaUfu 3905 GUGCCAUCAGUAUCUUAAUGAAG 4091 gUfAfUfcuu AfAfgauaCfu aaugaaaL96 Gfauggcsasc AD-158684 ususagaaCf 3720 asGfsacaAfu 3906 CCUUAGAACACCAAAGAUUGUCU 4092 aCfCfAfaag CfUfuuggUfg auugucuL96 Ufucuaasgsg AD-159410 asuscauuUf 3721 usAfsgccUfa 3907 AUAUCAUUUCACUGUCUAGGCUA 4093 cAfCfUfguc GfAfcaguGfa uaggcuaL96 Afaugausasu AD-159416 uscsacugUf 3722 usUfsguuGfu 3908 UUUCACUGUCUAGGCUACAACAG 4094 cUfAfGfgcu AfGfccuaGfa acaacaaL96 Cfagugasasa AD-159857 csasacuaUf 3723 usGfsuauAfa 3909 ACCAACUAUCCAAGUGUUAUACC 4095 cCfAfAfgug CfAfcuugGfa uuauacaL96 Ufaguugsgsu AD-158497 ususgguuCf 3724 usCfsauaUfu 3910 UUUUGGUUCCAAGUCCAAUAUGG 4096 cAfAfGfucc GfGfacuuGfg aauaugaL96 Afaccaasasa AD-159124 usgscuuaUf 3725 asGfsuuuGfa 3911 AGUGCUUAUGAGGUGAUCAAACU 4097 gAfGfGfuga UfCfaccuCfa ucaaacuL96 Ufaagcascsu AD-159312 uscsucagAf 3726 usCfsaccUfu 3912 AAUCUCAGACCUUGUGAAGGUGA 4098 cCfUfUfgug CfAfcaagGfu aaggugaL96 Cfugagasusu AD-159552 usasaaauCf 3727 asGfsgauAfu 3913 UGUAAAAUCCACAGCUAUAUCCU 4099 cAfCfAfgcu AfGfcuguGfg auauccuL96 Afuuuuascsa AD-159704 cscsuucaCf 3728 asCfsuagGfc 3914 CUCCUUCACUGAACAUGCCUAGU 4100 uGfAfAfcau AfUfguucAfg gccuaguL96 Ufgaaggsasg AD-159737 gsgsgaucCf 3729 usGfsgauUfu 3915 CUGGGAUCCAGUGUAUAAAUCCA 4101 aGfUfGfuau AfUfacacUfg aaauccaL96 Gfaucccsasg AD-159869 csasauaaAf 3730 usUfscacUfg 3916 CCCAAUAAACCUUGAACAGUGAC 4102 cCfUfUfgaa UfUfcaagGfu cagugaaL96 Ufuauugsgsg AD-158570 gsgsccugUf 3731 asAfsgauAfc 3917 AUGGCCUGUGCCAUCAGUAUCUU 4103 gCfCfAfuca UfGfauggCfa guaucuuL96 Cfaggccsasu AD-158618 ususguugAf 3732 usGfsucuUfc 3918 UCUUGUUGAUGUCAUCGAAGACA 4104 uGfUfCfauc GfAfugacAfu gaagacaL96 Cfaacaasgsa AD-159184 asgsauuuGf 3733 asUfsuauAfc 3919 GCAGAUUUGGCAGAGAGUAUAAU 4105 gCfAfGfaga UfCfucugCfc guauaauL96 Afaaucusgsc AD-159231 ususuccaCf 3734 usAfscccUfu 3920 AGUUUCCACCAUGAUUAAGGGUC 4106 cAfUfGfauu AfAfucauGfg aaggguaL96 Ufggaaascsu AD-159423 csusaggcUf 3735 usAfsgaaUfc 3921 GUCUAGGCUACAACAGGAUUCUA 4107 aCfAfAfcag CfUfguugUfa gauucuaL96 Gfccuagsasc AD-159446 usgsgaggUf 3736 usGfsacaAfc 3922 GGUGGAGGUUGUGCAUGUUGUCC 4108 uGfUfGfcau AfUfgcacAfa guugucaL96 Cfcuccascsc AD-159701 gscsuccuUf 3737 asGfsgcaUfg 3923 UGGCUCCUUCACUGAACAUGCCU 4109 cAfCfUfgaa UfUfcaguGfa caugccuL96 Afggagcscsa AD-158494 csusuuugGf 3738 usAfsuugGfa 3924 UCCUUUUGGUUCCAAGUCCAAUA 4110 uUfCfCfaag CfUfuggaAfc uccaauaL96 Cfaaaagsgsa AD-158571 gscscuguGf 3739 usAfsagaUfa 3925 UGGCCUGUGCCAUCAGUAUCUUA 4111 cCfAfUfcag CfUfgaugGfc uaucuuaL96 Afcaggcscsa AD-159125 gscsuuauGf 3740 usAfsguuUfg 3926 GUGCUUAUGAGGUGAUCAAACUC 4112 aGfGfUfgau AfUfcaccUfc caaacuaL96 Afuaagcsasc AD-159126 csusuaugAf 3741 usGfsaguUfu 3927 UGCUUAUGAGGUGAUCAAACUCA 4113 gGfUfGfauc GfAfucacCfu aaacucaL96 Cfauaagscsa AD-159287 cscsuugcAf 3742 asUfsucuGfu 3928 UUCCUUGCAUUUUGGGACAGAAU 4114 uUfUfUfggg CfCfcaaaAfu acagaauL96 Gfcaaggsasa AD-158499 gsgsuuccAf 3743 usGfsccaUfa 3929 UUGGUUCCAAGUCCAAUAUGGCA 4115 aGfUfCfcaa UfUfggacUfu uauggcaL96 Gfgaaccsasa AD-159417 csascuguCf 3744 usCfsuguUfg 3930 UUCACUGUCUAGGCUACAACAGG 4116 uAfGfGfcua UfAfgccuAfg caacagaL96 Afcagugsasa AD-159418 ascsugucUf 3745 usCfscugUfu 3931 UCACUGUCUAGGCUACAACAGGA 4117 aGfGfCfuac GfUfagccUfa aacaggaL96 Gfacagusgsa AD-158550 asasuaagAf 3746 usCfscaaCfa 3932 AGAAUAAGAUUACAGUUGUUGGG 4118 uUfAfCfagu AfCfuguaAfu uguuggaL96 Cfuuauuscsu AD-159116 gsusugagAf 3747 usAfsccuCfa 3933 UGGUUGAGAGUGCUUAUGAGGUG 4119 gUfGfCfuua UfAfagcaCfu ugagguaL96 Cfucaacscsa AD-159421 gsuscuagGf 3748 usAfsaucCfu 3934 CUGUCUAGGCUACAACAGGAUUC 4120 cUfAfCfaac GfUfuguaGfc aggauuaL96 Cfuagacsasg AD-159422 uscsuaggCf 3749 asGfsaauCfc 3935 UGUCUAGGCUACAACAGGAUUCU 4121 uAfCfAfaca UfGfuuguAfg ggauucuL96 Cfcuagascsa AD-159445 gsusggagGf 3750 usAfscaaCfa 3936 AGGUGGAGGUUGUGCAUGUUGUC 4122 uUfGfUfgca UfGfcacaAfc uguuguaL96 Cfuccacscsu AD-159130 usgsagguGf 3751 usCfsuuuGfa 3937 UAUGAGGUGAUCAAACUCAAAGG 4123 aUfCfAfaac GfUfuugaUfc ucaaagaL96 Afccucasusa AD-159134 gsusgaucAf 3752 usUfsagcCfu 3938 AGGUGAUCAAACUCAAAGGCUAC 4124 aAfCfUfcaa UfUfgaguUfu aggcuaaL96 Gfaucacscsu AD-159343 usgsaggaAf 3753 usUfscaaAfc 3939 UCUGAGGAAGAGGCCCGUUUGAA 4125 gAfGfGfccc GfGfgccuCfu guuugaaL96 Ufccucasgsa AD-159105 ascsaagcAf 3754 usAfscucUfc 3940 UCACAAGCAGGUGGUUGAGAGUG 4126 gGfUfGfguu AfAfccacCfu gagaguaL96 Gfcuugusgsa AD-159183 csasgauuUf 3755 usUfsauaCfu 3941 AGCAGAUUUGGCAGAGAGUAUAA 4127 gGfCfAfgag CfUfcugcCfa aguauaaL96 Afaucugscsu AD-159123 gsusgcuuAf 3756 gsUfsuugAfu 3942 GAGUGCUUAUGAGGUGAUCAAAC 4128 uGfAfGfgug CfAfccucAfu aucaaacL96 Afagcacsusc AD-159181 asgscagaUf 3757 asUfsacuCfu 3943 GUAGCAGAUUUGGCAGAGAGUAU 4129 uUfGfGfcag CfUfgccaAfa agaguauL96 Ufcugcusasc AD-159186 asusuuggCf 3758 usCfsauuAfu 3944 AGAUUUGGCAGAGAGUAUAAUGA 4130 aGfAfGfagu AfCfucucUfg auaaugaL96 Cfcaaauscsu AD-159187 ususuggcAf 3759 usUfscauUfa 3945 GAUUUGGCAGAGAGUAUAAUGAA 4131 gAfGfAfgua UfAfcucuCfu uaaugaaL96 Gfccaaasusc AD-159288 csusugcaUf 3760 usAfsuucUfg 3946 UCCUUGCAUUUUGGGACAGAAUG 4132 uUfUfGfgga UfCfccaaAfa cagaauaL96 Ufgcaagsgsa AD-159306 asusggaaUf 3761 usCfsacaAfg 3947 GAAUGGAAUCUCAGACCUUGUGA 4133 cUfCfAfgac GfUfcugaGfa cuugugaL96 Ufuccaususc AD-159559 csascagcUf 3762 usAfsgcaUfc 3948 UCCACAGCUAUAUCCUGAUGCUG 4134 aUfAfUfccu AfGfgauaUfa gaugcuaL96 Gfcugugsgsa AD-159344 gsasggaaGf 3763 usUfsucaAfa 3949 CUGAGGAAGAGGCCCGUUUGAAG 4135 aGfGfCfccg CfGfggccUfc uuugaaaL96 Ufuccucsasg AD-159341 uscsugagGf 3764 usAfsaacGfg 3950 CUUCUGAGGAAGAGGCCCGUUUG 4136 aAfGfAfggc GfCfcucuUfc ccguuuaL96 Cfucagasasg AD-159729 csascaucCf 3765 usAfscacUfg 3951 GUCACAUCCUGGGAUCCAGUGUA 4137 uGfGfGfauc GfAfucccAfg caguguaL96 Gfaugugsasc AD-158674 asgsccuuUf 3766 usGfsgugUfu 3952 GCAGCCUUUUCCUUAGAACACCA 4138 uCfCfUfuag CfUfaaggAfa aacaccaL96 Afaggcusgsc AD-159604 uscsaacuGf 3767 usAfsuuuCfa 3953 CUUCAACUGGUUAGUGUGAAAUA 4139 gUfUfAfgug CfAfcuaaCfc ugaaauaL96 Afguugasasg

    TABLE-US-00006 TABLE 6A Single dose screen in Primary Mouse Hepatocytes Duplex Name 10 nM STDEV 0.1 nM STDEV AD-84747 8.1 1.8 38.6 4.1 AD-84748 58.2 11.9 77.0 14.5 AD-84749 12.0 1.6 33.7 8.3 AD-84750 9.9 1.4 38.1 9.7 AD-84751 22.7 8.0 67.2 11.8 AD-84752 23.6 3.5 54.5 21.7 AD-84753 8.2 1.4 26.2 11.4 AD-84754 29.7 7.3 41.7 2.9 AD-84755 24.5 9.3 61.7 9.9 AD-84756 5.2 0.8 32.8 15.6 AD-84757 10.4 0.5 60.5 9.0 AD-84758 18.7 5.8 49.9 20.9 AD-84759 14.9 2.7 68.2 23.8 AD-84760 39.2 4.8 53.3 19.5 AD-84761 5.3 1.3 23.5 8.0 AD-84762 5.4 1.0 24.4 2.5 AD-84763 9.4 1.9 48.3 18.5 AD-84764 9.3 1.5 46.8 19.3 AD-84765 15.8 3.3 81.1 24.6 AD-84766 35.6 5.9 77.6 36.9 AD-84767 46.1 9.5 112.5 21.9 AD-84768 14.4 3.2 73.2 33.0 AD-84769 8.3 3.6 29.9 2.7 AD-84770 8.1 3.1 35.0 4.8 AD-84771 22.3 9.5 90.9 28.2 AD-84772 11.4 5.4 56.4 11.3 AD-84773 35.6 16.7 104.8 20.3 AD-84774 40.5 16.0 98.4 35.0 AD-84775 16.0 6.2 66.6 17.2 AD-84776 26.6 13.9 82.9 26.3 AD-84777 18.1 1.7 54.2 14.7 AD-84778 21.9 7.2 92.5 30.9 AD-84779 31.9 8.6 99.5 39.5 AD-84780 15.4 2.7 53.8 35.9 AD-84781 13.2 2.4 61.8 2.7 AD-84782 14.4 4.1 67.9 33.3 AD-84783 20.8 5.5 89.0 31.1 AD-84784 15.6 3.0 50.3 19.4 AD-84785 12.3 12.3 23.5 23.5 AD-84786 4.7 4.7 35.3 35.3 AD-84787 12.4 12.4 45.5 45.5 AD-84788 2.3 2.3 7.8 7.8 AD-84789 9.4 9.4 45.7 45.7 AD-84790 2.5 2.5 12.8 12.8

    TABLE-US-00007 TABLE 6B Single dose screen in Hep3b % of Human Duplex Message Name Remaining STDEV AD-159469 16.97 6.86 AD-159607 25.01 8.34 AD-159713 25.91 11.30 AD-158504 21.90 8.34 AD-159233 25.16 10.01 AD-159411 22.65 8.86 AD-159462 31.26 10.89 AD-159742 26.31 4.08 AD-159863 22.44 5.86 AD-158626 11.06 9.33 AD-158687 17.11 9.55 AD-158688 16.22 11.59 AD-159458 16.59 9.47 AD-159519 16.60 2.85 AD-159858 31.03 12.43 AD-158681 12.52 5.04 AD-159583 30.63 8.04 AD-159700 60.23 11.10 AD-159807 12.17 4.73 AD-158673 7.41 0.92 AD-159608 19.93 9.83 AD-159803 29.79 8.75 AD-159805 31.27 12.09 AD-159489 50.07 7.60 AD-159495 22.72 2.15 AD-159609 17.39 9.56 AD-159706 25.44 3.75 AD-159855 16.67 12.67 AD-159864 8.09 1.09 AD-158491 29.16 14.26 AD-158672 29.36 10.12 AD-159488 31.40 6.20 AD-159553 24.36 7.63 AD-159703 16.04 4.80 AD-159708 100.96 26.91 AD-159866 26.91 5.95 AD-159232 21.82 8.62 AD-159712 30.31 3.10 AD-159808 47.72 11.27 AD-159862 18.26 6.31 AD-158503 32.70 7.50 AD-159311 18.45 3.39 AD-159412 24.28 10.07 AD-159558 34.02 4.51 AD-159705 28.29 4.65 AD-159113 17.03 7.27 AD-159139 33.24 8.38 AD-159806 25.80 17.42 AD-159853 28.52 3.85 AD-158627 35.28 9.47 AD-159182 29.66 7.88 AD-159702 37.01 11.07 AD-159715 22.32 6.78 AD-158575 18.91 11.44 AD-158576 37.74 18.73 AD-158684 15.69 9.50 AD-159410 30.98 3.65 AD-159416 42.29 20.80 AD-159738 20.66 2.83 AD-159857 28.70 8.69 AD-158497 22.79 4.43 AD-159124 16.84 7.19 AD-159140 30.90 7.50 AD-159312 70.66 21.57 AD-159552 29.86 7.83 AD-159704 44.45 7.57 AD-159737 29.05 8.48 AD-159869 28.46 9.39 AD-158570 31.18 7.43 AD-158618 27.03 8.54 AD-159788 19.87 9.21 AD-159786 31.83 27.17 AD-159760 32.68 18.79 AD-159404 47.91 22.88 AD-159406 23.84 10.41 AD-158536 30.88 20.74 AD-159545 84.72 26.81 AD-159574 29.96 20.03 AD-159802 24.57 9.29 AD-159518 29.06 16.06 AD-159577 34.39 12.83 AD-159409 50.02 25.26 AD-159551 33.79 11.99 AD-159276 40.09 13.96 AD-159407 37.47 9.59 AD-159515 41.82 19.54 AD-159570 12.41 3.87 AD-159849 25.67 14.76 AD-159252 14.25 4.14 AD-159275 22.30 13.03 AD-159848 34.58 13.52 AD-159184 30.50 8.60 AD-159231 103.27 9.11 AD-159607 16.73 1.97 AD-158504 11.46 1.78 AD-159233 15.90 3.55 AD-159411 9.04 1.84 AD-159462 16.08 7.18 AD-159742 10.92 3.23 AD-159863 8.82 2.51 AD-158687 14.93 6.23 AD-158688 15.77 5.03 AD-159458 14.85 9.10 AD-159519 20.25 9.24 AD-159858 22.20 14.11 AD-159583 20.01 1.53 AD-159700 56.12 12.02 AD-159807 16.73 7.03 AD-158673 6.01 2.09 AD-159608 13.52 6.68 AD-159803 30.47 10.26 AD-159805 10.28 1.16 AD-159489 24.20 2.91 AD-159495 22.32 13.94 AD-159706 30.61 17.66 AD-159855 9.32 1.46 AD-159864 10.64 2.41 AD-159488 19.16 6.42 AD-159553 21.69 13.77 AD-159703 12.05 1.69 AD-159708 68.53 3.86 AD-159866 32.03 21.42 AD-159232 11.99 1.77 AD-159712 37.95 11.97 AD-159808 15.66 5.30 AD-159862 14.03 6.78 AD-158503 38.82 12.61 AD-159412 34.58 22.60 AD-159558 44.20 9.58 AD-159705 29.96 11.90 AD-159113 9.61 0.94 AD-159806 11.45 1.10 AD-159853 18.04 5.87 AD-159182 11.32 2.80 AD-159702 16.90 2.27 AD-159715 18.48 10.27 AD-158575 12.02 1.74 AD-158576 20.78 6.11 AD-158684 11.37 7.57 AD-159410 29.86 7.02 AD-159416 46.73 11.03 AD-159857 24.36 5.16 AD-158497 30.17 3.74 AD-159124 25.97 4.90 AD-159312 70.74 5.44 AD-159552 41.03 6.19 AD-159704 35.64 15.41 AD-159737 20.64 4.47 AD-159869 32.80 5.77 AD-158570 30.61 6.04 AD-158618 23.25 8.74 AD-159184 25.44 9.61 AD-159231 84.40 6.16 AD-159423 14.14 2.24 AD-159446 24.93 8.57 AD-159701 50.20 3.80 AD-158494 11.88 2.84 AD-158571 46.81 7.47 AD-159125 15.81 2.66 AD-159126 29.28 8.63 AD-159287 25.25 2.91 AD-158499 29.76 5.51 AD-159417 32.69 6.45 AD-159418 24.84 7.31 AD-158550 28.87 4.53 AD-159116 26.12 2.58 AD-159421 22.32 3.28 AD-159422 24.24 7.34 AD-159445 33.50 10.14 AD-159130 24.80 4.33 AD-159134 10.46 1.12 AD-159343 34.97 8.91 AD-159105 92.74 4.56 AD-159183 41.08 12.03 AD-159123 33.69 9.55 AD-159181 32.21 14.92 AD-159186 24.30 1.21 AD-159187 46.71 2.58 AD-159288 21.07 2.58 AD-159306 30.47 5.46 AD-159559 34.55 6.09 AD-159344 14.12 7.20 AD-159341 19.39 9.18 AD-159729 49.48 4.73 AD-158674 15.18 2.82 AD-159604 23.15 13.21

    TABLE-US-00008 Table 7  Modified Human/Mouse/Cyno/Rat, Mouse, Mouse/Rat, and Human/Cyno Cross-Reactive HAO1 iRNA Sequences Sense Antisense Strand SEQ Strand SEQ Duplex Sequence  ID Sequence ID Name 5′ to 3′ NO: 5′ to 3′ NO: Species AD-62933 GfsasAfuGfuGfaAfAfGfuCfaUfcGfaCfaAfL96 4140 usUfsgUfcGfaUfgAfcuuUfcAfcAfuUfcsusg 89 Hs/Mm AD-62939 UfsusUfuCfaAfuGfGfGfuGfuCfcUfaGfgAfL96 4141 usCfscUfaGfgAfcAfcccAfuUfgAfaAfasgsu 90 Hs/Mm AD-62944 GfsasAfaGfuCfaUfCfGfaCfaAfgAfcAfuUfL96 4142 asAfsuGfuCfuUfgUfcgaUfgAfcUfuUfcsasc 91 Hs/Mm AD-62949 UfscsAfuCfgAfcAfAfGfaCfaUfuGfgUfgAfL96 4143 usCfsaCfcAfaUfgUfcuuGfuCfgAfuGfascsu 92 Hs/Mm AD-62954 UfsusUfcAfaUfgGfGfUfgUfcCfuAfgGfaAfL96 4144 usUfscCfuAfgGfaCfaccCfaUfuGfaAfasasg 93 Hs/Mm AD-62959 AfsasUfgGfgUfgUfCfCfuAfgGfaAfcCfuUfL96 4145 asAfsgGfuUfcCfuAfggaCfaCfcCfaUfusgsa 94 Hs/Mm AD-62964 GfsasCfaGfuGfcAfCfAfaUfaUfuUfuCfcAfL96 4146 usGfsgAfaAfaUfaUfuguGfcAfcUfgUfcsasg 95 Hs/Mm AD-62969 AfscsUfuUfuCfaAfUfGfgGfuGfuCfcUfaAfL96 4147 usUfsaGfgAfcAfcCfcauUfgAfaAfaGfuscsa 96 Hs/Mm AD-62934 AfsasGfuCfaUfcGfAfCfaAfgAfcAfuUfgAfL96 4148 usCfsaAfuGfuCfuUfgucGfaUfgAfcUfususc 97 Hs/Mm AD-62940 AfsusCfgAfcAfaGfAfCfaUfuGfgUfgAfgAfL96 4149 usCfsuCfaCfcAfaUfgucUfuGfuCfgAfusgsa 98 Hs/Mm AD-62945 GfsgsGfaGfaAfaGfGfUfgUfuCfaAfgAfuAfL96 4150 usAfsuCfuUfgAfaCfaccUfuUfcUfcCfcscsc 99 Hs/Mm AD-62950 CfsusUfuUfcAfaUfGfGfgUfgUfcCfuAfgAfL96 29 usCfsuAfgGfaCfaCfccaUfuGfaAfaAfgsusc 100 Hs/Mm AD-62955 UfscsAfaUfgGfgUfGfUfcCfuAfgGfaAfcAfL96 30 usGfsuUfcCfuAfgGfacaCfcCfaUfuGfasasa 101 Hs/Mm AD-62960 UfsusGfaCfuUfuUfCfAfaUfgGfgUfgUfcAfL96 31 usGfsaCfaCfcCfaUfugaAfaAfgUfcAfasasa 102 Hs/Mm AD-62965 AfsasAfgUfcAfuCfGfAfcAfaGfaCfaUfuAfL96 32 usAfsaUfgUfcUfuGfucgAfuGfaCfuUfuscsa 103 Hs/Mm AD-62970 CfsasGfgGfgGfaGfAfAfaGfgUfgUfuCfaAfL96 33 usUfsgAfaCfaCfcUfuucUfcCfcCfcUfgsgsa 104 Hs/Mm AD-62935 CfsasUfuGfgUfgAfGfGfaAfaAfaUfcCfuUfL96 34 asAfsgGfaUfuUfuUfccuCfaCfcAfaUfgsusc 105 Hs/Mm AD-62941 AfscsAfuUfgGfuGfAfGfgAfaAfaAfuCfcUfL96 35 asGfsgAfuUfuUfuCfcucAfcCfaAfuGfuscsu 106 Hs/Mm AD-62946 AfsgsGfgGfgAfgAfAfAfgGfuGfuUfcAfaAfL96 36 usUfsuGfaAfcAfcCfuuuCfuCfcCfcCfusgsg 107 Hs/Mm AD-62951 AfsusGfgUfgGfuAfAfUfuUfgUfgAfuUfuUfL96 37 asAfsaAfuCfaCfaAfauuAfcCfaCfcAfuscsc 108 Hs AD-62956 GfsasCfuUfgCfaUfCfCfuGfgAfaAfuAfuAfL96 38 usAfsuAfuUfuCfcAfggaUfgCfaAfgUfcscsa 109 Hs AD-62961 GfsgsAfaGfgGfaAfGfGfuAfgAfaGfuCfuUfL96 39 asAfsgAfcUfuCfuAfccuUfcCfcUfuCfcsasc 110 Hs AD-62966 UfsgsUfcUfuCfuGfUfUfuAfgAfuUfuCfcUfL96 40 asGfsgAfaAfuCfuAfaacAfgAfaGfaCfasgsg 111 Hs AD-62971 CfsusUfuGfgCfuGfUfUfuCfcAfaGfaUfcUfL96 41 asGfsaUfcUfuGfgAfaacAfgCfcAfaAfgsgsa 112 Hs AD-62936 AfsasUfgUfgUfuUfGfGfgCfaAfcGfuCfaUfL96 42 asUfsgAfcGfuUfgCfccaAfaCfaCfaUfususu 113 Hs AD-62942 UfsgsUfgAfcUfgUfGfGfaCfaCfcCfcUfuAfL96 43 usAfsaGfgGfgUfgUfccaCfaGfuCfaCfasasa 114 Hs AD-62947 GfsasUfgGfgGfuGfCfCfaGfcUfaCfuAfuUfL96 44 asAfsuAfgUfaGfcUfggcAfcCfcCfaUfcscsa 115 Hs AD-62952 GfsasAfaAfuGfuGfUfUfuGfgGfcAfaCfgUfL96 45 asCfsgUfuGfcCfcAfaacAfcAfuUfuUfcsasa 116 Hs AD-62957 GfsgsCfuGfuUfuCfCfAfaGfaUfcUfgAfcAfL96 46 usGfsuCfaGfaUfcUfuggAfaAfcAfgCfcsasa 117 Hs AD-62962 UfscsCfaAfcAfaAfAfUfaGfcCfaCfcCfcUfL96 47 asGfsgGfgUfgGfcUfauuUfuGfuUfgGfasasa 118 Hs AD-62967 GfsusCfuUfcUfgUfUfUfaGfaUfuUfcCfuUfL96 48 asAfsgGfaAfaUfcUfaaaCfaGfaAfgAfcsasg 119 Hs AD-62972 UfsgsGfaAfgGfgAfAfGfgUfaGfaAfgUfcUfL96 49 asGfsaCfuUfcUfaCfcuuCfcCfuUfcCfascsa 120 Hs AD-62937 UfscsCfuUfuGfgCfUfGfuUfuCfcAfaGfaUfL96 50 asUfscUfuGfgAfaAfcagCfcAfaAfgGfasusu 121 Hs AD-62943 CfsasUfcUfcUfcAfGfCfuGfgGfaUfgAfuAfL96 51 usAfsuCfaUfcCfcAfgcuGfaGfaGfaUfgsgsg 122 Hs AD-62948 GfsgsGfgUfgCfcAfGfCfuAfcUfaUfuGfaUfL96 52 asUfscAfaUfaGfuAfgcuGfgCfaCfcCfcsasu 123 Hs AD-62953 AfsusGfuGfuUfuGfGfGfcAfaCfgUfcAfuAfL96 53 usAfsuGfaCfgUfuGfcccAfaAfcAfcAfususu 124 Hs AD-62958 CfsusGfuUfuAfgAfUfUfuCfcUfuAfaGfaAfL96 54 usUfscUfuAfaGfgAfaauCfuAfaAfcAfgsasa 125 Hs AD-62963 AfsgsAfaAfgAfaAfUfGfgAfcUfuGfcAfuAfL96 55 usAfsuGfcAfaGfuCfcauUfuCfuUfuCfusasg 126 Hs AD-62968 GfscsAfuCfcUfgGfAfAfaUfaUfaUfuAfaAfL96 56 usUfsuAfaUfaUfaUfuucCfaGfgAfuGfcsasa 127 Hs AD-62973 CfscsUfgUfcAfgAfCfCfaUfgGfgAfaCfuAfL96 57 usAfsgUfuCfcCfaUfgguCfuGfaCfaGfgscsu 128 Hs AD-62938 AfsasAfcAfuGfgUfGfUfgGfaUfgGfgAfuAfL96 58 usAfsuCfcCfaUfcCfacaCfcAfuGfuUfusasa 129 Hs AD-62974 CfsusCfaGfgAfuGfAfAfaAfaUfuUfuGfaAfL96 59 usUfscAfaAfaUfuUfuucAfuCfcUfgAfgsusu 130 Hs AD-62978 CfsasGfcAfuGfuAfUfUfaCfuUfgAfcAfaAfL96 60 usUfsuGfuCfaAfgUfaauAfcAfuGfcUfgsasa 131 Hs AD-62982 UfsasUfgAfaCfaAfCfAfuGfcUfaAfaUfcAfL96 61 usGfsaUfuUfaGfcAfuguUfgUfuCfaUfasasu 132 Hs AD-62986 AfsusAfuAfuCfcAfAfAfuGfuUfuUfaGfgAfL96 62 usCfscUfaAfaAfcAfuuuGfgAfuAfuAfususc 133 Hs AD-62990 CfscsAfgAfuGfgAfAfGfcUfgUfaUfcCfaAfL96 63 usUfsgGfaUfaCfaGfcuuCfcAfuCfuGfgsasa 134 Hs AD-62994 GfsasCfuUfuCfaUfCfCfuGfgAfaAfuAfuAfL96 64 usAfsuAfuUfuCfcAfggaUfgAfaAfgUfcscsa 135 Hs AD-62998 CfscsCfcGfgCfuAfAfUfuUfgUfaUfcAfaUfL96 65 asUfsuGfaUfaCfaAfauuAfgCfcGfgGfgsgsa 136 Hs AD-63002 UfsusAfaAfcAfuGfGfCfuUfgAfaUfgGfgAfL96 66 usCfscCfaUfuCfaAfgccAfuGfuUfuAfascsa 137 Hs AD-62975 AfsasUfgUfgUfuUfAfGfaCfaAfcGfuCfaUfL96 67 asUfsgAfcGfuUfgUfcuaAfaCfaCfaUfususu 138 Mm AD-62979 AfscsUfaAfaGfgAfAfGfaAfuUfcCfgGfuUfL96 68 asAfscCfgGfaAfuUfcuuCfcUfuUfaGfusasu 139 Mm AD-62983 UfsasUfaUfcCfaAfAfUfgUfuUfuAfgGfaUfL96 69 asUfscCfuAfaAfaCfauuUfgGfaUfaUfasusu 140 Mm AD-62987 GfsusGfcGfgAfaAfGfGfcAfcUfgAfuGfuUfL96 70 asAfscAfuCfaGfuGfccuUfuCfcGfcAfcsasc 141 Mm AD-62991 UfsasAfaAfcAfgUfGfGfuUfcUfuAfaAfuUfL96 71 asAfsuUfuAfaGfaAfccaCfuGfuUfuUfasasa 142 Mm AD-62995 AfsusGfaAfaAfaUfUfUfuGfaAfaCfcAfgUfL96 72 asCfsuGfgUfuUfcAfaaaUfuUfuUfcAfuscsc 143 Mm AD-62999 AfsasCfaAfaAfuAfGfCfaAfuCfcCfuUfuUfL96 73 asAfsaAfgGfgAfuUfgcuAfuUfuUfgUfusgsg 144 Mm AD-63003 CfsusGfaAfaCfaGfAfUfcUfgUfcGfaCfuUfL96 74 asAfsgUfcGfaCfaGfaucUfgUfuUfcAfgscsa 145 Mm AD-62976 UfsusGfuUfgCfaAfAfGfgGfcAfuUfuUfgAfL96 75 usCfsaAfaAfuGfcCfcuuUfgCfaAfcAfasusu 146 Mm AD-62980 CfsusCfaUfuGfuUfUfAfuUfaAfcCfuGfuAfL96 76 usAfscAfgGfuUfaAfuaaAfcAfaUfgAfgsasu 147 Mm AD-62984 CfsasAfcAfaAfaUfAfGfcAfaUfcCfcUfuUfL96 77 asAfsaGfgGfaUfuGfcuaUfuUfuGfuUfgsgsa 148 Mm AD-62992 CfsasUfuGfuUfuAfUfUfaAfcCfuGfuAfuUfL96 78 asAfsuAfcAfgGfuUfaauAfaAfcAfaUfgsasg 149 Mm AD-62996 UfsasUfcAfgCfuGfGfGfaAfgAfuAfuCfaAfL96 79 usUfsgAfuAfuCfuUfcccAfgCfuGfaUfasgsa 150 Mm AD-63000 UfsgsUfcCfuAfgGfAfAfcCfuUfuUfaGfaAfL96 80 usUfscUfaAfaAfgGfuucCfuAfgGfaCfascsc 151 Mm AD-63004 UfscsCfaAfcAfaAfAfUfaGfcAfaUfcCfcUfL96 81 asGfsgGfaUfuGfcUfauuUfuGfuUfgGfasasa 152 Mm AD-62977 GfsgsUfgUfgCfgGfAfAfaGfgCfaCfuGfaUfL96 82 asUfscAfgUfgCfcUfuucCfgCfaCfaCfcscsc 153 Mm AD-62981 UfsusGfaAfaCfcAfGfUfaCfuUfuAfuCfaUfL96 83 asUfsgAfuAfaAfgUfacuGfgUfuUfcAfasasa 154 Mm AD-62985 UfsasCfuUfcCfaAfAfGfuCfuAfuAfuAfuAfL96 84 usAfsuAfuAfuAfgAfcuuUfgGfaAfgUfascsu 155 Mm AD-62989 UfscsCfuAfgGfaAfCfCfuUfuUfaGfaAfaUfL96 85 asUfsuUfcUfaAfaAfgguUfcCfuAfgGfascsa 156 Mm AD-62993 CfsusCfcUfgAfgGfAfAfaAfuUfuUfgGfaAfL96 86 usUfscCfaAfaAfuUfuucCfuCfaGfgAfgsasa 157 Mm AD-62997 GfscsUfcCfgGfaAfUfGfuUfgCfuGfaAfaUfL96 87 asUfsuUfcAfgCfaAfcauUfcCfgGfaGfcsasu 158 Mm AD-63001 GfsusGfuUfuGfuGfGfGfgAfgAfcCfaAfuAfL96 88 usAfsuUfgGfuCfuCfcccAfcAfaAfcAfcsasg 159 Mm

    TABLE-US-00009 TABLE 8 Additional Modified Human/Mouse/Cyno/Rat, Human/Mouse/Rat, Human/Mouse/Cyno, Mouse, Mouse/Rat, and Human/Cyno Cross-Reactive HAO1 iRNA Sequences SEQ SEQ Duplex ID ID Spe- Name Sense Strand Sequence 5′ to 3′ NO: Antisense Strand Sequence 5′ to 3′ NO: cies AD-62933.2 GfsasAfuGfuGfaAfAfGfuCfaUfcGfaCfaAfL96 4140 usUfsgUfcGfaUfgAfcuuUfcAfcAfuUfcsusg 89 Hs/Mm AD-62939.2 UfsusUfuCfaAfuGfGfGfuGfuCfcUfaGfgAfL96 4141 usCfscUfaGfgAfcAfcccAfuUfgAfaAfasgsu 90 Hs/Mm AD-62944.2 GfsasAfaGfuCfaUfCfGfaCfaAfgAfcAfuUfL96 4142 asAfsuGfuCfuUfgUfcgaUfgAfcUfuUfcsasc 91 Hs/Mm AD-62949.2 UfscsAfuCfgAfcAfAfGfaCfaUfuGfgUfgAfL96 4143 usCfsaCfcAfaUfgUfcuuGfuCfgAfuGfascsu 92 Hs/Mm AD-62954.2 UfsusUfcAfaUfgGfGfUfgUfcCfuAfgGfaAfL96 4144 usUfscCfuAfgGfaCfaccCfaUfuGfaAfasasg 93 Hs/Mm AD-62959.2 AfsasUfgGfgUfgUfCfCfuAfgGfaAfcCfuUfL96 4145 asAfsgGfuUfcCfuAfggaCfaCfcCfaUfusgsa 94 Hs/Mm AD-62964.2 GfsasCfaGfuGfcAfCfAfaUfaUfuUfuCfcAfL96 4146 usGfsgAfaAfaUfaUfuguGfcAfcUfgUfcsasg 95 Hs/Mm AD-62969.2 AfscsUfuUfuCfaAfUfGfgGfuGfuCfcUfaAfL96 4147 usUfsaGfgAfcAfcCfcauUfgAfaAfaGfuscsa 96 Hs/Mm AD-62934.2 AfsasGfuCfaUfcGfAfCfaAfgAfcAfuUfgAfL96 4148 usCfsaAfuGfuCfuUfgucGfaUfgAfcUfususc 97 Hs/Mm AD-62940.2 AfsusCfgAfcAfaGfAfCfaUfuGfgUfgAfgAfL96 4149 usCfsuCfaCfcAfaUfgucUfuGfuCfgAfusgsa 98 Hs/Mm AD-62945.2 GfsgsGfaGfaAfaGfGfUfgUfuCfaAfgAfuAfL96 4150 usAfsuCfuUfgAfaCfaccUfuUfcUfcCfcscsc 99 Hs/Mm AD-62950.2 CfsusUfuUfcAfaUfGfGfgUfgUfcCfuAfgAfL96 29 usCfsuAfgGfaCfaCfccaUfuGfaAfaAfgsusc 100 Hs/Mm AD-62955.2 UfscsAfaUfgGfgUfGfUfcCfuAfgGfaAfcAfL96 30 usGfsuUfcCfuAfgGfacaCfcCfaUfuGfasasa 101 Hs/Mm AD-62960.2 UfsusGfaCfuUfuUfCfAfaUfgGfgUfgUfcAfL96 31 usGfsaCfaCfcCfaUfugaAfaAfgUfcAfasasa 102 Hs/Mm AD-62965.2 AfsasAfgUfcAfuCfGfAfcAfaGfaCfaUfuAfL96 32 usAfsaUfgUfcUfuGfucgAfuGfaCfuUfuscsa 103 Hs/Mm AD-62970.2 CfsasGfgGfgGfaGfAfAfaGfgUfgUfuCfaAfL96 33 usUfsgAfaCfaCfcUfuucUfcCfcCfcUfgsgsa 104 Hs/Mm AD-62935.2 CfsasUfuGfgUfgAfGfGfaAfaAfaUfcCfuUfL96 34 asAfsgGfaUfuUfuUfccuCfaCfcAfaUfgsusc 105 Hs/Mm AD-62941.2 AfscsAfuUfgGfuGfAfGfgAfaAfaAfuCfcUfL96 35 asGfsgAfuUfuUfuCfcucAfcCfaAfuGfuscsu 106 Hs/Mm AD-62946.2 AfsgsGfgGfgAfgAfAfAfgGfuGfuUfcAfaAfL96 36 usUfsuGfaAfcAfcCfuuuCfuCfcCfcCfusgsg 107 Hs/Mm AD-62951.2 AfsusGfgUfgGfuAfAfUfuUfgUfgAfuUfuUfL96 37 asAfsaAfuCfaCfaAfauuAfcCfaCfcAfuscsc 108 Hs AD-62956.2 GfsasCfuUfgCfaUfCfCfuGfgAfaAfuAfuAfL96 38 usAfsuAfuUfuCfcAfggaUfgCfaAfgUfcscsa 109 Hs AD-62961.2 GfsgsAfaGfgGfaAfGfGfuAfgAfaGfuCfuUfL96 39 asAfsgAfcUfuCfuAfccuUfcCfcUfuCfcsasc 110 Hs AD-62966.2 UfsgsUfcUfuCfuGfUfUfuAfgAfuUfuCfcUfL96 40 asGfsgAfaAfuCfuAfaacAfgAfaGfaCfasgsg 111 Hs AD-62971.2 CfsusUfuGfgCfuGfUfUfuCfcAfaGfaUfcUfL96 41 asGfsaUfcUfuGfgAfaacAfgCfcAfaAfgsgsa 112 Hs AD-62936.2 AfsasUfgUfgUfuUfGfGfgCfaAfcGfuCfaUfL96 42 asUfsgAfcGfuUfgCfccaAfaCfaCfaUfususu 113 Hs AD-62942.2 UfsgsUfgAfcUfgUfGfGfaCfaCfcCfcUfuAfL96 43 usAfsaGfgGfgUfgUfccaCfaGfuCfaCfasasa 114 Hs AD-62947.2 GfsasUfgGfgGfuGfCfCfaGfcUfaCfuAfuUfL96 44 asAfsuAfgUfaGfcUfggcAfcCfcCfaUfcscsa 115 Hs AD-62952.2 GfsasAfaAfuGfuGfUfUfuGfgGfcAfaCfgUfL96 45 asCfsgUfuGfcCfcAfaacAfcAfuUfuUfcsasa 116 Hs AD-62957.2 GfsgsCfuGfuUfuCfCfAfaGfaUfcUfgAfcAfL96 46 usGfsuCfaGfaUfcUfuggAfaAfcAfgCfcsasa 117 Hs AD-62962.2 UfscsCfaAfcAfaAfAfUfaGfcCfaCfcCfcUfL96 47 asGfsgGfgUfgGfcUfauuUfuGfuUfgGfasasa 118 Hs AD-62967.2 GfsusCfuUfcUfgUfUfUfaGfaUfuUfcCfuUfL96 48 asAfsgGfaAfaUfcUfaaaCfaGfaAfgAfcsasg 119 Hs AD-62972.2 UfsgsGfaAfgGfgAfAfGfgUfaGfaAfgUfcUfL96 49 asGfsaCfuUfcUfaCfcuuCfcCfuUfcCfascsa 120 Hs AD-62937.2 UfscsCfuUfuGfgCfUfGfuUfuCfcAfaGfaUfL96 50 asUfscUfuGfgAfaAfcagCfcAfaAfgGfasusu 121 Hs AD-62943.2 CfsasUfcUfcUfcAfGfCfuGfgGfaUfgAfuAfL96 51 usAfsuCfaUfcCfcAfgcuGfaGfaGfaUfgsgsg 122 Hs AD-62948.2 GfsgsGfgUfgCfcAfGfCfuAfcUfaUfuGfaUfL96 52 asUfscAfaUfaGfuAfgcuGfgCfaCfcCfcsasu 123 Hs AD-62953.2 AfsusGfuGfuUfuGfGfGfcAfaCfgUfcAfuAfL96 53 usAfsuGfaCfgUfuGfcccAfaAfcAfcAfususu 124 Hs AD-62958.2 CfsusGfuUfuAfgAfUfUfuCfcUfuAfaGfaAfL96 54 usUfscUfuAfaGfgAfaauCfuAfaAfcAfgsasa 125 Hs AD-62963.2 AfsgsAfaAfgAfaAfUfGfgAfcUfuGfcAfuAfL96 55 usAfsuGfcAfaGfuCfcauUfuCfuUfuCfusasg 126 Hs AD-62968.2 GfscsAfuCfcUfgGfAfAfaUfaUfaUfuAfaAfL96 56 usUfsuAfaUfaUfaUfuucCfaGfgAfuGfcsasa 127 Hs AD-62973.2 CfscsUfgUfcAfgAfCfCfaUfgGfgAfaCfuAfL96 57 usAfsgUfuCfcCfaUfgguCfuGfaCfaGfgscsu 128 Hs AD-62938.2 AfsasAfcAfuGfgUfGfUfgGfaUfgGfgAfuAfL96 58 usAfsuCfcCfaUfcCfacaCfcAfuGfuUfusasa 129 Hs AD-62974.2 CfsusCfaGfgAfuGfAfAfaAfaUfuUfuGfaAfL96 59 usUfscAfaAfaUfuUfuucAfuCfcUfgAfgsusu 130 Hs AD-62978.2 CfsasGfcAfuGfuAfUfUfaCfuUfgAfcAfaAfL96 60 usUfsuGfuCfaAfgUfaauAfcAfuGfcUfgsasa 131 Hs AD-62982.2 UfsasUfgAfaCfaAfCfAfuGfcUfaAfaUfcAfL96 61 usGfsaUfuUfaGfcAfuguUfgUfuCfaUfasasu 132 Hs AD-62986.2 AfsusAfuAfuCfcAfAfAfuGfuUfuUfaGfgAfL96 62 usCfscUfaAfaAfcAfuuuGfgAfuAfuAfususc 133 Hs AD-62990.2 CfscsAfgAfuGfgAfAfGfcUfgUfaUfcCfaAfL96 63 usUfsgGfaUfaCfaGfcuuCfcAfuCfuGfgsasa 134 Hs AD-62994.2 GfsasCfuUfuCfaUfCfCfuGfgAfaAfuAfuAfL96 64 usAfsuAfuUfuCfcAfggaUfgAfaAfgUfcscsa 135 Hs AD-62998.2 CfscsCfcGfgCfuAfAfUfuUfgUfaUfcAfaUfL96 65 asUfsuGfaUfaCfaAfauuAfgCfcGfgGfgsgsa 136 Hs AD-63002.2 UfsusAfaAfcAfuGfGfCfuUfgAfaUfgGfgAfL96 66 usCfscCfaUfuCfaAfgccAfuGfuUfuAfascsa 137 Hs AD-62975.2 AfsasUfgUfgUfuUfAfGfaCfaAfcGfuCfaUfL96 67 asUfsgAfcGfuUfgUfcuaAfaCfaCfaUfususu 138 Mm AD-62979.2 AfscsUfaAfaGfgAfAfGfaAfuUfcCfgGfuUfL96 68 asAfscCfgGfaAfuUfcuuCfcUfuUfaGfusasu 139 Mm AD-62983.2 UfsasUfaUfcCfaAfAfUfgUfuUfuAfgGfaUfL96 69 asUfscCfuAfaAfaCfauuUfgGfaUfaUfasusu 140 Mm AD-62987.2 GfsusGfcGfgAfaAfGfGfcAfcUfgAfuGfuUfL96 70 asAfscAfuCfaGfuGfccuUfuCfcGfcAfcsasc 141 Mm AD-62991.2 UfsasAfaAfcAfgUfGfGfuUfcUfuAfaAfuUfL96 71 asAfsuUfuAfaGfaAfccaCfuGfuUfuUfasasa 142 Mm AD-62995.2 AfsusGfaAfaAfaUfUfUfuGfaAfaCfcAfgUfL96 72 asCfsuGfgUfuUfcAfaaaUfuUfuUfcAfuscsc 143 Mm AD-62999.2 AfsasCfaAfaAfuAfGfCfaAfuCfcCfuUfuUfL96 73 asAfsaAfgGfgAfuUfgcuAfuUfuUfgUfusgsg 144 Mm AD-63003.2 CfsusGfaAfaCfaGfAfUfcUfgUfcGfaCfuUfL96 74 asAfsgUfcGfaCfaGfaucUfgUfuUfcAfgscsa 145 Mm AD-62976.2 UfsusGfuUfgCfaAfAfGfgGfcAfuUfuUfgAfL96 75 usCfsaAfaAfuGfcCfcuuUfgCfaAfcAfasusu 146 Mm AD-62980.2 CfsusCfaUfuGfuUfUfAfuUfaAfcCfuGfuAfL96 76 usAfscAfgGfuUfaAfuaaAfcAfaUfgAfgsasu 147 Mm AD-62984.2 CfsasAfcAfaAfaUfAfGfcAfaUfcCfcUfuUfL96 77 asAfsaGfgGfaUfuGfcuaUfuUfuGfuUfgsgsa 148 Mm AD-62992.2 CfsasUfuGfuUfuAfUfUfaAfcCfuGfuAfuUfL96 78 asAfsuAfcAfgGfuUfaauAfaAfcAfaUfgsasg 149 Mm AD-62996.2 UfsasUfcAfgCfuGfGfGfaAfgAfuAfuCfaAfL96 79 usUfsgAfuAfuCfuUfcccAfgCfuGfaUfasgsa 150 Mm AD-63000.2 UfsgsUfcCfuAfgGfAfAfcCfuUfuUfaGfaAfL96 80 usUfscUfaAfaAfgGfuucCfuAfgGfaCfascsc 151 Mm AD-63004.2 UfscsCfaAfcAfaAfAfUfaGfcAfaUfcCfcUfL96 81 asGfsgGfaUfuGfcUfauuUfuGfuUfgGfasasa 152 Mm AD-62977.2 GfsgsUfgUfgCfgGfAfAfaGfgCfaCfuGfaUfL96 82 asUfscAfgUfgCfcUfuucCfgCfaCfaCfcscsc 153 Mm AD-62981.2 UfsusGfaAfaCfcAfGfUfaCfuUfuAfuCfaUfL96 83 asUfsgAfuAfaAfgUfacuGfgUfuUfcAfasasa 154 Mm AD-62985.2 UfsasCfuUfcCfaAfAfGfuCfuAfuAfuAfuAfL96 84 usAfsuAfuAfuAfgAfcuuUfgGfaAfgUfascsu 155 Mm AD-62989.2 UfscsCfuAfgGfaAfCfCfuUfuUfaGfaAfaUfL96 85 asUfsuUfcUfaAfaAfgguUfcCfuAfgGfascsa 156 Mm AD-62993.2 CfsusCfcUfgAfgGfAfAfaAfuUfuUfgGfaAfL96 86 usUfscCfaAfaAfuUfuucCfuCfaGfgAfgsasa 157 Mm AD-62997.2 GfscsUfcCfgGfaAfUfGfuUfgCfuGfaAfaUfL96 87 asUfsuUfcAfgCfaAfcauUfcCfgGfaGfcsasu 158 Mm AD-63001.2 GfsusGfuUfuGfuGfGfGfgAfgAfcCfaAfuAfL96 88 usAfsuUfgGfuCfuCfcccAfcAfaAfcAfcsasg 159 Mm AD-62933.1 GfsasAfuGfuGfaAfAfGfuCfaUfcGfaCfaAfL96 160 usUfsgUfcGfaUfgAfcuuUfcAfcAfuUfcsusg 277 AD-65630.1 Y44gsasAfuGfuGfaAfAfGfuCfaUfcGfaCfaAfL 161 PusUfsgUfcGfaUfgAfcuuUfcAfcAfuUfcsus 278 96 g AD-65636.1 gsasauguGfaAfAfGfucauCfgacaaL96 162 usUfsgUfcGfaUfgAfcuuUfcAfcAfuUfcsusg 279 AD-65642.1 gsasauguGfaAfAfGfucaucgacaaL96 163 usUfsgUfcGfaUfgAfcuuUfcAfcAfuUfcsusg 280 AD-65647.1 gsasauguGfaaAfGfucaucgacaaL96 164 usUfsgUfcGfaUfgAfcuuUfcAfcAfuUfcsusg 281 AD-65652.1 gsasauguGfaaaGfucaucGfacaaL96 165 usUfsgUfcGfaUfgAfcuuUfcAfcAfuUfcsusg 282 AD-65657.1 gsasaugugaaaGfucaucGfacaaL96 166 usUfsgUfcGfaUfgAfcuuUfcAfcAfuUfcsusg 283 AD-65662.1 gsasauguGfaaaGfucaucgacaaL96 167 usUfsgUfcGfaUfgAfcuuUfcAfcAfuUfcsusg 284 AD-65625.1 AfsusGfuGfaAfAfGfuCfaUfcGfaCfaAfL96 168 usUfsgUfcGfaUfgAfcuuUfcAfcAfususc 285 AD-65631.1 asusguGfaAfAfGfucaucgacaaL96 169 usUfsgucGfaugacuuUfcAfcaususc 286 AD-65637.1 GfsasAfuGfuGfaAfAfGfuCfaUfcGfaCfaAfL96 170 usUfsgucGfaUfgAfcuuUfcAfcauucsusg 287 AD-65643.1 GfsasAfuGfuGfaAfAfGfuCfaUfcGfaCfaAfL96 171 usUfsgucGfaUfGfacuuUfcAfcauucsusg 288 AD-65648.1 GfsasAfuGfuGfaAfAfGfuCfaUfcGfaCfaAfL96 172 usUfsgucGfaugacuuUfcAfcauucsusg 289 AD-65653.1 GfsasAfuGfuGfaAfAfGfuCfaUfcGfaCfaAfL96 173 usUfsgucGfaugacuuUfcacauucsusg 290 AD-65658.1 GfsasAfuGfuGfaAfAfGfuCfaUfcGfaCfaAfL96 174 usUfsgucgaugacuuUfcacauucsusg 291 AD-65663.1 gsasauguGfaAfAfGfucaucgacaaL96 175 usUfsgucGfaUfgAfcuuUfcAfcauucsusg 292 AD-65626.1 gsasauguGfaAfAfGfucaucgacaaL96 176 usUfsgucGfaUfGfacuuUfcAfcauucsusg 293 AD-65638.1 gsasauguGfaaAfGfucaucgacaaL96 177 usUfsgucGfaUfgAfcuuUfcAfcauucsusg 294 AD-65644.1 gsasauguGfaaAfGfucaucgacaaL96 178 usUfsgucGfaUfGfacuuUfcAfcauucsusg 295 AD-65649.1 gsasauguGfaaAfGfucaucgacaaL96 179 usUfsgucGfaugacuuUfcAfcauucsusg 296 AD-65654.1 gsasaugugaaagucau(Cgn)gacaaL96 180 usUfsgUfcGfaUfgAfcuuUfcAfcAfuUfcsusg 297 AD-65659.1 gsasaugdTgaaagucau(Cgn)gacaaL96 181 usUfsgUfcGfaUfgAfcuuUfcAfcAfuUfcsusg 298 AD-65627.1 gsasaudGugaaadGucau(Cgn)gacaaL96 182 usUfsgUfcGfaUfgAfcuuUfcAfcAfuUfcsusg 299 AD-65633.1 gsasaugdTgaaadGucau(Cgn)gacaaL96 183 usUfsgUfcGfaUfgAfcuuUfcAfcAfuUfcsusg 300 AD-65639.1 gsasaugudGaaadGucau(Cgn)gacaaL96 184 usUfsgUfcGfaUfgAfcuuUfcAfcAfuUfcsusg 301 AD-65645.1 gsasaugugaaadGucaucdGacaaL96 185 usUfsgUfcGfaUfgAfcuuUfcAfcAfuUfcsusg 302 AD-65650.1 gsasaugugaaadGucaucdTacaaL96 186 usUfsgUfcGfaUfgAfcuuUfcAfcAfuUfcsusg 303 AD-65655.1 gsasaugugaaadGucaucY34acaaL96 187 usUfsgUfcGfaUfgAfcuuUfcAfcAfuUfcsusg 304 AD-65660.1 gsasaugugaaadGucadTcdTacaaL96 188 usUfsgUfcGfaUfgAfcuuUfcAfcAfuUfcsusg 305 AD-65665.1 gsasaugugaaadGucaucdGadCaaL96 189 usUfsgUfcGfaUfgAfcuuUfcAfcAfuUfcsusg 306 AD-65628.1 gsasaugugaaadGucaucdTadCaaL96 190 usUfsgUfcGfaUfgAfcuuUfcAfcAfuUfcsusg 307 AD-65634.1 gsasaugugaaadGucaucY34adCaaL96 191 usUfsgUfcGfaUfgAfcuuUfcAfcAfuUfcsusg 308 AD-65646.1 GfsasAfuGfuGfaAfAfGfuCfaUfcGfaCfaAfL96 192 usdTsgucgaugdAcuudTcacauucsusg 309 AD-65656.1 GfsasAfuGfuGfaAfAfGfuCfaUfcGfaCfaAfL96 193 usUsgucgaugacuudTcacauucsusg 310 AD-65661.1 GfsasAfuGfuGfaAfAfGfuCfaUfcGfaCfaAfL96 194 usdTsgucdGaugacuudTcacauucsusg 311 AD-65666.1 GfsasAfuGfuGfaAfAfGfuCfaUfcGfaCfaAfL96 195 usUsgucdGaugacuudTcacauucsusg 312 AD-65629.1 GfsasAfuGfuGfaAfAfGfuCfaUfcGfaCfaAfL96 196 usdTsgucgaugacuudTcdAcauucsusg 313 AD-65635.1 GfsasAfuGfuGfaAfAfGfuCfaUfcGfaCfaAfL96 197 usdTsgucdGaugacuudTcdAcauucsusg 314 AD-65641.1 gsasaugugaaadGucau(Cgn)gacaaL96 198 usdTsgucgaugdAcuudTcacauucsusg 315 AD-62994.1 GfsasCfuUfuCfaUfCfCfuGfgAfaAfuAfuAfL96 199 usAfsuAfuUfuCfcAfggaUfgAfaAfgUfcscsa 316 AD-65595.1 gsascuuuCfaUfCfCfuggaAfauauaL96 200 usAfsuAfuUfuCfcAfggaUfgAfaAfgUfcscsa 317 AD-65600.1 gsascuuuCfaUfCfCfuggaaauauaL96 201 usAfsuAfuUfuCfcAfggaUfgAfaAfgUfcscsa 318 AD-65610.1 gsascuuuCfaucCfuggaaAfuauaL96 202 usAfsuAfuUfuCfcAfggaUfgAfaAfgUfcscsa 319 AD-65615.1 gsascuuucaucCfuggaaAfuauaL96 203 usAfsuAfuUfuCfcAfggaUfgAfaAfgUfcscsa 320 AD-65620.1 gsascuuuCfaucCfuggaaauauaL96 204 usAfsuAfuUfuCfcAfggaUfgAfaAfgUfcscsa 321 AD-65584.1 CfsusUfuCfaUfCfCfuGfgAfaAfuAfuAfL96 205 usAfsuAfuUfuCfcAfggaUfgAfaAfgsusc 322 AD-65590.1 csusuuCfaUfCfCfuggaaauauaL96 206 usAfsuauUfuccaggaUfgAfaagsusc 323 AD-65596.1 GfsasCfuUfuCfaUfCfCfuGfgAfaAfuAfuAfL96 207 usAfsuauUfuCfcAfggaUfgAfaagucscsa 324 AD-65601.1 GfsasCfuUfuCfaUfCfCfuGfgAfaAfuAfuAfL96 208 usAfsuauUfuCfCfaggaUfgAfaagucscsa 325 AD-65606.1 GfsasCfuUfuCfaUfCfCfuGfgAfaAfuAfuAfL96 209 usAfsuauUfuccaggaUfgAfaagucscsa 326 AD-65611.1 GfsasCfuUfuCfaUfCfCfuGfgAfaAfuAfuAfL96 210 usAfsuauUfuccaggaUfgaaagucscsa 327 AD-65616.1 GfsasCfuUfuCfaUfCfCfuGfgAfaAfuAfuAfL96 211 usAfsuauuuccaggaUfgaaagucscsa 328 AD-65621.1 gsascuuuCfaUfCfCfuggaaauauaL96 212 usAfsuauUfuCfcAfggaUfgAfaagucscsa 329 AD-65585.1 gsascuuuCfaUfCfCfuggaaauauaL96 213 usAfsuauUfuCfCfaggaUfgAfaagucscsa 330 AD-65591.1 gsascuuuCfaUfCfCfuggaaauauaL96 214 usAfsuauUfuccaggaUfgAfaagucscsa 331 AD-65597.1 gsascuuuCfauCfCfuggaaauauaL96 215 usAfsuauUfuCfcAfggaUfgAfaagucscsa 332 AD-65602.1 gsascuuuCfauCfCfuggaaauauaL96 216 usAfsuauUfuCfCfaggaUfgAfaagucscsa 333 AD-65607.1 gsascuuuCfauCfCfuggaaauauaL96 217 usAfsuauUfuccaggaUfgAfaagucscsa 334 AD-65612.1 gsascuuucauccuggaa(Agn)uauaL96 218 usAfsuAfuUfuCfcAfggaUfgAfaAfgUfcscsa 335 AD-65622.1 gsascuuucaucdCuggaa(Agn)uauaL96 219 usAfsuAfuUfuCfcAfggaUfgAfaAfgUfcscsa 336 AD-65586.1 gsascudTucaucdCuggaa(Agn)uauaL96 220 usAfsuAfuUfuCfcAfggaUfgAfaAfgUfcscsa 337 AD-65592.1 gsascuudTcaucdCuggaa(Agn)uauaL96 221 usAfsuAfuUfuCfcAfggaUfgAfaAfgUfcscsa 338 AD-65598.1 gsascuuudCaucdCuggaa(Agn)uauaL96 222 usAfsuAfuUfuCfcAfggaUfgAfaAfgUfcscsa 339 AD-65603.1 gsascuuucaucdCuggaadAuauaL96 223 usAfsuAfuUfuCfcAfggaUfgAfaAfgUfcscsa 340 AD-65608.1 gsascuuucaucdCuggaadTuauaL96 224 usAfsuAfuUfuCfcAfggaUfgAfaAfgUfcscsa 341 AD-65613.1 gsascuuucaucdCuggaaY34uauaL96 225 usAfsuAfuUfuCfcAfggaUfgAfaAfgUfcscsa 342 AD-65618.1 gsascuuucaucdCuggdAadTuauaL96 226 usAfsuAfuUfuCfcAfggaUfgAfaAfgUfcscsa 343 AD-65623.1 gsascuuucaucdCuggaadTudAuaL96 227 usAfsuAfuUfuCfcAfggaUfgAfaAfgUfcscsa 344 AD-65587.1 gsascuuucaucdCuggaa(Agn)udAuaL96 228 usAfsuAfuUfuCfcAfggaUfgAfaAfgUfcscsa 345 AD-65593.1 gsascuudTcaucdCuggaadAudAuaL96 229 usAfsuAfuUfuCfcAfggaUfgAfaAfgUfcscsa 346 AD-65599.1 GfsasCfuUfuCfaUfCfCfuGfgAfaAfuAfuAfL96 230 usdAsuauuuccdAggadTgaaagucscsa 347 AD-65604.1 GfsasCfuUfuCfaUfCfCfuGfgAfaAfuAfuAfL96 231 usdAsuauuuccaggadTgaaagucscsa 348 AD-65609.1 GfsasCfuUfuCfaUfCfCfuGfgAfaAfuAfuAfL96 232 usAsuauuuccaggadTgaaagucscsa 349 AD-65614.1 GfsasCfuUfuCfaUfCfCfuGfgAfaAfuAfuAfL96 233 usdAsuaudTuccaggadTgaaagucscsa 350 AD-65619.1 GfsasCfuUfuCfaUfCfCfuGfgAfaAfuAfuAfL96 234 usAsuaudTuccaggadTgaaagucscsa 351 AD-65624.1 GfsasCfuUfuCfaUfCfCfuGfgAfaAfuAfuAfL96 235 usdAsuauuuccaggadTgdAaagucscsa 352 AD-65588.1 GfsasCfuUfuCfaUfCfCfuGfgAfaAfuAfuAfL96 236 usdAsuaudTuccaggadTgdAaagucscsa 353 AD-65594.1 gsascuuucaucdCuggaa(Agn)uauaL96 237 usdAsuauuuccdAggadTgaaagucscsa 354 AD-68309.1 asgsaaagGfuGfUfUfcaagaugucaL96 238 usGfsacaUfcUfUfgaacAfcCfuuucuscsc 355 AD-68303.1 csasuccuGfgAfAfAfuauauuaacuL96 239 asGfsuuaAfuAfUfauuuCfcAfggaugsasa 356 AD-65626.5 gsasauguGfaAfAfGfucaucgacaaL96 240 usUfsgucGfaUfGfacuuUfcAfcauucsusg 357 AD-68295.1 asgsugcaCfaAfUfAfuuuucccauaL96 241 usAfsuggGfaAfAfauauUfgUfgcacusgsu 358 AD-68273.1 gsasaaguCfaUfCfGfacaagacauuL96 242 asAfsuguCfuUfGfucgaUfgAfcuuucsasc 359 AD-68297.1 asasugugAfaAfGfUfcaucgacaaaL96 243 usUfsuguCfgAfUfgacuUfuCfacauuscsu 360 AD-68287.1 csusggaaAfuAfUfAfuuaacuguuaL96 244 usAfsacaGfuUfAfauauAfuUfuccagsgsa 361 AD-68300.1 asusuuucCfcAfUfCfuguauuauuuL96 245 asAfsauaAfuAfCfagauGfgGfaaaausasu 362 AD-68306.1 usgsucguUfcUfUfUfuccaacaaaaL96 246 usUfsuugUfuGfGfaaaaGfaAfcgacascsc 363 AD-68292.1 asusccugGfaAfAfUfauauuaacuaL96 247 usAfsguuAfaUfAfuauuUfcCfaggausgsa 364 AD-68298.1 gscsauuuUfgAfGfAfggugaugauaL96 248 usAfsucaUfcAfCfcucuCfaAfaaugcscsc 365 AD-68277.1 csasggggGfaGfAfAfagguguucaaL96 249 usUfsgaaCfaCfCfuuucUfcCfcccugsgsa 366 AD-68289.1 gsgsaaauAfuAfUfUfaacuguuaaaL96 250 usUfsuaaCfaGfUfuaauAfuAfuuuccsasg 367 AD-68272.1 csasuuggUfgAfGfGfaaaaauccuuL96 251 asAfsggaUfuUfUfuccuCfaCfcaaugsusc 368 AD-68282.1 gsgsgagaAfaGfGfUfguucaagauaL96 252 usAfsucuUfgAfAfcaccUfuUfcucccscsc 369 AD-68285.1 gsgscauuUfuGfAfGfaggugaugauL96 253 asUfscauCfaCfCfucucAfaAfaugccscsu 370 AD-68290.1 usascaaaGfgGfUfGfucguucuuuuL96 254 asAfsaagAfaCfGfacacCfcUfuuguasusu 371 AD-68296.1 usgsggauCfuUfGfGfugucgaaucaL96 255 usGfsauuCfgAfCfaccaAfgAfucccasusu 372 AD-68288.1 csusgacaGfuGfCfAfcaauauuuuaL96 256 usAfsaaaUfaUfUfgugcAfcUfgucagsasu 373 AD-68299.1 csasgugcAfcAfAfUfauuuucccauL96 257 asUfsgggAfaAfAfuauuGfuGfcacugsusc 374 AD-68275.1 ascsuuuuCfaAfUfGfgguguccuaaL96 258 usUfsaggAfcAfCfccauUfgAfaaaguscsa 375 AD-68274.1 ascsauugGfuGfAfGfgaaaaauccuL96 259 asGfsgauUfuUfUfccucAfcCfaauguscsu 376 AD-68294.1 ususgcuuUfuGfAfCfuuuucaaugaL96 260 usCfsauuGfaAfAfagucAfaAfagcaasusg 377 AD-68302.1 csasuuuuGfaGfAfGfgugaugaugaL96 261 usCfsaucAfuCfAfccucUfcAfaaaugscsc 378 AD-68279.1 ususgacuUfuUfCfAfaugggugucaL96 262 usGfsacaCfcCfAfuugaAfaAfgucaasasa 379 AD-68304.1 csgsacuuCfuGfUfUfuuaggacagaL96 263 usCfsuguCfcUfAfaaacAfgAfagucgsasc 380 AD-68286.1 csuscugaGfuGfGfGfugccagaauaL96 264 usAfsuucUfgGfCfacccAfcUfcagagscsc 381 AD-68291.1 gsgsgugcCfaGfAfAfugugaaaguaL96 265 usAfscuuUfcAfCfauucUfgGfcacccsasc 382 AD-68283.1 uscsaaugGfgUfGfUfccuaggaacaL96 266 usGfsuucCfuAfGfgacaCfcCfauugasasa 383 AD-68280.1 asasagucAfuCfGfAfcaagacauuaL96 267 usAfsaugUfcUfUfgucgAfuGfacuuuscsa 384 AD-68293.1 asusuuugAfgAfGfGfugaugaugcaL96 268 usGfscauCfaUfCfaccuCfuCfaaaausgsc 385 AD-68276.1 asuscgacAfaGfAfCfauuggugagaL96 269 usCfsucaCfcAfAfugucUfuGfucgausgsa 386 AD-68308.1 gsgsugccAfgAfAfUfgugaaagucaL96 270 usGfsacuUfuCfAfcauuCfuGfgcaccscsa 387 AD-68278.1 gsascaguGfcAfCfAfauauuuuccaL96 271 usGfsgaaAfaUfAfuuguGfcAfcugucsasg 388 AD-68307.1 ascsaaagAfgAfCfAfcugugcagaaL96 272 usUfscugCfaCfAfguguCfuCfuuuguscsa 389 AD-68284.1 ususuucaAfuGfGfGfuguccuaggaL96 273 usCfscuaGfgAfCfacccAfuUfgaaaasgsu 390 AD-68301.1 cscsguuuCfcAfAfGfaucugacaguL96 274 asCfsuguCfaGfAfucuuGfgAfaacggscsc 391 AD-68281.1 asgsggggAfgAfAfAfgguguucaaaL96 275 usUfsugaAfcAfCfcuuuCfuCfccccusgsg 392 AD-68305.1 asgsucauCfgAfCfAfagacauugguL96 276 asCfscaaUfgUfCfuuguCfgAfugacususu 393

    TABLE-US-00010 TABLE 9 Unmodified Human/Mouse/Cyno/Rat, Human/Mouse/Cyno, and Human/Cyno Cross-Reactive HAO1 iRNA Sequences SEQ SEQ Duplex ID ID Position in Name NO: Sense Strand Sequence 5′ to 3′ NO: Antisense Strand Sequence 5′ to 3′ NM_017545.2 AD-62933 394 GAAUGUGAAAGUCAUCGACAA 443 UUGUCGAUGACUUUCACAUUCUG 1072-1094 AD-62939 395 UUUUCAAUGGGUGUCCUAGGA 444 UCCUAGGACACCCAUUGAAAAGU 1302-1324 AD-62944 396 GAAAGUCAUCGACAAGACAUU 445 AAUGUCUUGUCGAUGACUUUCAC 1078-1100 AD-62949 397 UCAUCGACAAGACAUUGGUGA 446 UCACCAAUGUCUUGUCGAUGACU 1083-1105 AD-62954 398 UUUCAAUGGGUGUCCUAGGAA 447 UUCCUAGGACACCCAUUGAAAAG 1303-1325 AD-62959 399 AAUGGGUGUCCUAGGAACCUU 448 AAGGUUCCUAGGACACCCAUUGA 1307-1329 AD-62964 400 GACAGUGCACAAUAUUUUCCA 449 UGGAAAAUAUUGUGCACUGUCAG 1134-1156_C21A AD-62969 401 ACUUUUCAAUGGGUGUCCUAA 450 UUAGGACACCCAUUGAAAAGUCA 1300-1322_G21A AD-62934 402 AAGUCAUCGACAAGACAUUGA 451 UCAAUGUCUUGUCGAUGACUUUC 1080-1102_G21A AD-62940 403 AUCGACAAGACAUUGGUGAGA 452 UCUCACCAAUGUCUUGUCGAUGA 1085-1107_G21A AD-62945 404 GGGAGAAAGGUGUUCAAGAUA 453 UAUCUUGAACACCUUUCUCCCCC  996-1018_G21A AD-62950 405 CUUUUCAAUGGGUGUCCUAGA 454 UCUAGGACACCCAUUGAAAAGUC 1301-1323_G21A AD-62955 406 UCAAUGGGUGUCCUAGGAACA 455 UGUUCCUAGGACACCCAUUGAAA 1305-1327_C21A AD-62960 407 UUGACUUUUCAAUGGGUGUCA 456 UGACACCCAUUGAAAAGUCAAAA 1297-1319_C21A AD-62965 408 AAAGUCAUCGACAAGACAUUA 457 UAAUGUCUUGUCGAUGACUUUCA 1079-1101_G21A AD-62970 409 CAGGGGGAGAAAGGUGUUCAA 458 UUGAACACCUUUCUCCCCCUGGA  992-1014 AD-62935 410 CAUUGGUGAGGAAAAAUCCUU 459 AAGGAUUUUUCCUCACCAAUGUC 1095-1117 AD-62941 411 ACAUUGGUGAGGAAAAAUCCU 460 AGGAUUUUUCCUCACCAAUGUCU 1094-1116 AD-62946 412 AGGGGGAGAAAGGUGUUCAAA 461 UUUGAACACCUUUCUCCCCCUGG  993-1015_G21A AD-62974 413 CUCAGGAUGAAAAAUUUUGAA 462 UUCAAAAUUUUUCAUCCUGAGUU  563-585 AD-62978 414 CAGCAUGUAUUACUUGACAAA 463 UUUGUCAAGUAAUACAUGCUGAA 1173-1195 AD-62982 415 UAUGAACAACAUGCUAAAUCA 464 UGAUUUAGCAUGUUGUUCAUAAU   53-75 AD-62986 416 AUAUAUCCAAAUGUUUUAGGA 465 UCCUAAAACAUUUGGAUAUAUUC 1679-1701 AD-62990 417 CCAGAUGGAAGCUGUAUCCAA 466 UUGGAUACAGCUUCCAUCUGGAA  156-178 AD-62994 418 GACUUUCAUCCUGGAAAUAUA 467 UAUAUUUCCAGGAUGAAAGUCCA 1341-1363 AD-62998 419 CCCCGGCUAAUUUGUAUCAAU 468 AUUGAUACAAAUUAGCCGGGGGA   29-51 AD-63002 420 UUAAACAUGGCUUGAAUGGGA 469 UCCCAUUCAAGCCAUGUUUAACA  765-787 AD-62975 421 AAUGUGUUUAGACAACGUCAU 470 AUGACGUUGUCUAAACACAUUUU 1388-1410 AD-62979 422 ACUAAAGGAAGAAUUCCGGUU 471 AACCGGAAUUCUUCCUUUAGUAU 1027-1049 AD-62983 423 UAUAUCCAAAUGUUUUAGGAU 472 AUCCUAAAACAUUUGGAUAUAUU 1680-1702 AD-62987 424 GUGCGGAAAGGCACUGAUGUU 473 AACAUCAGUGCCUUUCCGCACAC  902-924 AD-62991 425 UAAAACAGUGGUUCUUAAAUU 474 AAUUUAAGAACCACUGUUUUAAA 1521-1543 AD-62995 426 AUGAAAAAUUUUGAAACCAGU 475 ACUGGUUUCAAAAUUUUUCAUCC  569-591 AD-62999 427 AACAAAAUAGCAAUCCCUUUU 476 AAAAGGGAUUGCUAUUUUGUUGG 1264-1286 AD-63003 428 CUGAAACAGAUCUGUCGACUU 477 AAGUCGACAGAUCUGUUUCAGCA  195-217 AD-62976 429 UUGUUGCAAAGGGCAUUUUGA 478 UCAAAAUGCCCUUUGCAACAAUU  720-742 AD-62980 430 CUCAUUGUUUAUUAACCUGUA 479 UACAGGUUAAUAAACAAUGAGAU 1483-1505 AD-62984 431 CAACAAAAUAGCAAUCCCUUU 480 AAAGGGAUUGCUAUUUUGUUGGA 1263-1285 AD-62992 432 CAUUGUUUAUUAACCUGUAUU 481 AAUACAGGUUAAUAAACAAUGAG 1485-1507 AD-62996 433 UAUCAGCUGGGAAGAUAUCAA 482 UUGAUAUCUUCCCAGCUGAUAGA  670-692 AD-63000 434 UGUCCUAGGAACCUUUUAGAA 483 UUCUAAAAGGUUCCUAGGACACC 1313-1335 AD-63004 435 UCCAACAAAAUAGCAAUCCCU 484 AGGGAUUGCUAUUUUGUUGGAAA 1261-1283 AD-62977 436 GGUGUGCGGAAAGGCACUGAU 485 AUCAGUGCCUUUCCGCACACCCC  899-921 AD-62981 437 UUGAAACCAGUACUUUAUCAU 486 AUGAUAAAGUACUGGUUUCAAAA  579-601 AD-62985 438 UACUUCCAAAGUCUAUAUAUA 487 UAUAUAUAGACUUUGGAAGUACU   75-97_G21A AD-62989 439 UCCUAGGAACCUUUUAGAAAU 488 AUUUCUAAAAGGUUCCUAGGACA 1315-1337_G21U AD-62993 440 CUCCUGAGGAAAAUUUUGGAA 489 UUCCAAAAUUUUCCUCAGGAGAA  603-625_G21A AD-62997 441 GCUCCGGAAUGUUGCUGAAAU 490 AUUUCAGCAACAUUCCGGAGCAU  181-203_C21U AD-63001 442 GUGUUUGUGGGGAGACCAAUA 491 UAUUGGUCUCCCCACAAACACAG  953-975_C21A

    TABLE-US-00011 TABLE 10 Unmodified Mouse and Mouse/Rat HAO1 iRNA Sequences SEQ SEQ Duplex ID ID Position in Name NO: Sense strand sequence 5′ to 3′ NO: Antisense strand sequence 5′ to 3′ NM_010403.2 AD-62951 492 AUGGUGGUAAUUUGUGAUUUU 514 AAAAUCACAAAUUACCACCAUCC 1642-1664 AD-62956 493 GACUUGCAUCCUGGAAAUAUA 515 UAUAUUUCCAGGAUGCAAGUCCA 1338-1360 AD-62961 494 GGAAGGGAAGGUAGAAGUCUU 516 AAGACUUCUACCUUCCCUUCCAC  864-886 AD-62966 495 UGUCUUCUGUUUAGAUUUCCU 517 AGGAAAUCUAAACAGAAGACAGG 1506-1528 AD-62971 496 CUUUGGCUGUUUCCAAGAUCU 518 AGAUCUUGGAAACAGCCAAAGGA 1109-1131 AD-62936 497 AAUGUGUUUGGGCAACGUCAU 519 AUGACGUUGCCCAAACACAUUUU 1385-1407 AD-62942 498 UGUGACUGUGGACACCCCUUA 520 UAAGGGGUGUCCACAGUCACAAA  486-508 AD-62947 499 GAUGGGGUGCCAGCUACUAUU 521 AAUAGUAGCUGGCACCCCAUCCA  814-836 AD-62952 500 GAAAAUGUGUUUGGGCAACGU 522 ACGUUGCCCAAACACAUUUUCAA 1382-1404 AD-62957 501 GGCUGUUUCCAAGAUCUGACA 523 UGUCAGAUCUUGGAAACAGCCAA 1113-1135 AD-62962 502 UCCAACAAAAUAGCCACCCCU 524 AGGGGUGGCUAUUUUGUUGGAAA 1258-1280 AD-62967 503 GUCUUCUGUUUAGAUUUCCUU 525 AAGGAAAUCUAAACAGAAGACAG 1507-1529 AD-62972 504 UGGAAGGGAAGGUAGAAGUCU 526 AGACUUCUACCUUCCCUUCCACA  863-885 AD-62937 505 UCCUUUGGCUGUUUCCAAGAU 527 AUCUUGGAAACAGCCAAAGGAUU 1107-1129 AD-62943 506 CAUCUCUCAGCUGGGAUGAUA 528 UAUCAUCCCAGCUGAGAGAUGGG  662-684 AD-62948 507 GGGGUGCCAGCUACUAUUGAU 529 AUCAAUAGUAGCUGGCACCCCAU  817-839 AD-62953 508 AUGUGUUUGGGCAACGUCAUA 530 UAUGACGUUGCCCAAACACAUUU 1386-1408_C21A AD-62958 509 CUGUUUAGAUUUCCUUAAGAA 531 UUCUUAAGGAAAUCUAAACAGAA 1512-1534_C21A AD-62963 510 AGAAAGAAAUGGACUUGCAUA 532 UAUGCAAGUCCAUUUCUUUCUAG 1327-1349_C21A AD-62968 511 GCAUCCUGGAAAUAUAUUAAA 533 UUUAAUAUAUUUCCAGGAUGCAA 1343-1365_C21A AD-62973 512 CCUGUCAGACCAUGGGAACUA 534 UAGUUCCCAUGGUCUGACAGGCU  308-330_G21A AD-62938 513 AAACAUGGUGUGGAUGGGAUA 535 UAUCCCAUCCACACCAUGUUUAA  763-785_C21A

    TABLE-US-00012 TABLE 11 Additional Unmodified Human/Cyno/Mouse/Rat, Human/Mouse/Cyno, Human/Cyno, and Mouse/Rat SEQ SEQ ID ID Antisense strand Position in Duplex Name NO: Sense strand sequence 5′ to 3′ NO: sequence 5′ to 3′ NM_017545.2 AD-62933.2 394 GAAUGUGAAAGUCAUCGACAA 443 UUGUCGAUGACUUUCACAUUCUG 1072-1094 AD-62939.2 395 UUUUCAAUGGGUGUCCUAGGA 444 UCCUAGGACACCCAUUGAAAAGU 1302-1324 AD-62944.2 396 GAAAGUCAUCGACAAGACAUU 445 AAUGUCUUGUCGAUGACUUUCAC 1078-1100 AD-62949.2 397 UCAUCGACAAGACAUUGGUGA 446 UCACCAAUGUCUUGUCGAUGACU 1083-1105 AD-62954.2 398 UUUCAAUGGGUGUCCUAGGAA 447 UUCCUAGGACACCCAUUGAAAAG 1303-1325 AD-62959.2 399 AAUGGGUGUCCUAGGAACCUU 448 AAGGUUCCUAGGACACCCAUUGA 1307-1329 AD-62964.2 400 GACAGUGCACAAUAUUUUCCA 449 UGGAAAAUAUUGUGCACUGUCAG 1134-1156_C21A AD-62969.2 401 ACUUUUCAAUGGGUGUCCUAA 450 UUAGGACACCCAUUGAAAAGUCA 1300-1322_G21A AD-62934.2 402 AAGUCAUCGACAAGACAUUGA 451 UCAAUGUCUUGUCGAUGACUUUC 1080-1102_G21A AD-62940.2 403 AUCGACAAGACAUUGGUGAGA 452 UCUCACCAAUGUCUUGUCGAUGA 1085-1107_G21A AD-62945.2 404 GGGAGAAAGGUGUUCAAGAUA 453 UAUCUUGAACACCUUUCUCCCCC  996-1018_G21A AD-62950.2 405 CUUUUCAAUGGGUGUCCUAGA 454 UCUAGGACACCCAUUGAAAAGUC 1301-1323_G21A AD-62955.2 406 UCAAUGGGUGUCCUAGGAACA 455 UGUUCCUAGGACACCCAUUGAAA 1305-1327_C21A AD-62960.2 407 UUGACUUUUCAAUGGGUGUCA 456 UGACACCCAUUGAAAAGUCAAAA 1297-1319_C21A AD-62965.2 408 AAAGUCAUCGACAAGACAUUA 457 UAAUGUCUUGUCGAUGACUUUCA 1079-1101_G21A AD-62970.2 409 CAGGGGGAGAAAGGUGUUCAA 458 UUGAACACCUUUCUCCCCCUGGA  992-1014 AD-62935.2 410 CAUUGGUGAGGAAAAAUCCUU 459 AAGGAUUUUUCCUCACCAAUGUC 1095-1117 AD-62941.2 411 ACAUUGGUGAGGAAAAAUCCU 460 AGGAUUUUUCCUCACCAAUGUCU 1094-1116 AD-62946.2 412 AGGGGGAGAAAGGUGUUCAAA 461 UUUGAACACCUUUCUCCCCCUGG  993-1015_G21A AD-62974.2 413 CUCAGGAUGAAAAAUUUUGAA 462 UUCAAAAUUUUUCAUCCUGAGUU  563-585 AD-62978.2 414 CAGCAUGUAUUACUUGACAAA 463 UUUGUCAAGUAAUACAUGCUGAA 1173-1195 AD-62982.2 415 UAUGAACAACAUGCUAAAUCA 464 UGAUUUAGCAUGUUGUUCAUAAU   53-75 AD-62986.2 416 AUAUAUCCAAAUGUUUUAGGA 465 UCCUAAAACAUUUGGAUAUAUUC 1679-1701 AD-62990.2 417 CCAGAUGGAAGCUGUAUCCAA 466 UUGGAUACAGCUUCCAUCUGGAA  156-178 AD-62994.2 418 GACUUUCAUCCUGGAAAUAUA 467 UAUAUUUCCAGGAUGAAAGUCCA 1341-1363 AD-62998.2 419 CCCCGGCUAAUUUGUAUCAAU 468 AUUGAUACAAAUUAGCCGGGGGA   29-51 AD-63002.2 420 UUAAACAUGGCUUGAAUGGGA 469 UCCCAUUCAAGCCAUGUUUAACA  765-787 AD-62975.2 421 AAUGUGUUUAGACAACGUCAU 470 AUGACGUUGUCUAAACACAUUUU 1388-1410 AD-62979.2 422 ACUAAAGGAAGAAUUCCGGUU 471 AACCGGAAUUCUUCCUUUAGUAU 1027-1049 AD-62983.2 423 UAUAUCCAAAUGUUUUAGGAU 472 AUCCUAAAACAUUUGGAUAUAUU 1680-1702 AD-62987.2 424 GUGCGGAAAGGCACUGAUGUU 473 AACAUCAGUGCCUUUCCGCACAC  902-924 AD-62991.2 425 UAAAACAGUGGUUCUUAAAUU 474 AAUUUAAGAACCACUGUUUUAAA 1521-1543 AD-62995.2 426 AUGAAAAAUUUUGAAACCAGU 475 ACUGGUUUCAAAAUUUUUCAUCC  569-591 AD-62999.2 427 AACAAAAUAGCAAUCCCUUUU 476 AAAAGGGAUUGCUAUUUUGUUGG 1264-1286 AD-63003.2 428 CUGAAACAGAUCUGUCGACUU 477 AAGUCGACAGAUCUGUUUCAGCA  195-217 AD-62976.2 429 UUGUUGCAAAGGGCAUUUUGA 478 UCAAAAUGCCCUUUGCAACAAUU  720-742 AD-62980.2 430 CUCAUUGUUUAUUAACCUGUA 479 UACAGGUUAAUAAACAAUGAGAU 1483-1505 AD-62984.2 431 CAACAAAAUAGCAAUCCCUUU 480 AAAGGGAUUGCUAUUUUGUUGGA 1263-1285 AD-62992.2 432 CAUUGUUUAUUAACCUGUAUU 481 AAUACAGGUUAAUAAACAAUGAG 1485-1507 AD-62996.2 433 UAUCAGCUGGGAAGAUAUCAA 482 UUGAUAUCUUCCCAGCUGAUAGA  670-692 AD-63000.2 434 UGUCCUAGGAACCUUUUAGAA 483 UUCUAAAAGGUUCCUAGGACACC 1313-1335 AD-63004.2 435 UCCAACAAAAUAGCAAUCCCU 484 AGGGAUUGCUAUUUUGUUGGAAA 1261-1283 AD-62977.2 436 GGUGUGCGGAAAGGCACUGAU 485 AUCAGUGCCUUUCCGCACACCCC  899-921 AD-62981.2 437 UUGAAACCAGUACUUUAUCAU 486 AUGAUAAAGUACUGGUUUCAAAA  579-601 AD-62985.2 438 UACUUCCAAAGUCUAUAUAUA 487 UAUAUAUAGACUUUGGAAGUACU   75-97_G21A AD-62989.2 439 UCCUAGGAACCUUUUAGAAAU 488 AUUUCUAAAAGGUUCCUAGGACA 1315-1337_G21U AD-62993.2 440 CUCCUGAGGAAAAUUUUGGAA 489 UUCCAAAAUUUUCCUCAGGAGAA  603-625_G21A AD-62997.2 441 GCUCCGGAAUGUUGCUGAAAU 490 AUUUCAGCAACAUUCCGGAGCAU  181-203_C21U AD-63001.2 442 GUGUUUGUGGGGAGACCAAUA 491 UAUUGGUCUCCCCACAAACACAG  953-975_C21A AD-62951.2 492 AUGGUGGUAAUUUGUGAUUUU 514 AAAAUCACAAAUUACCACCAUCC 1642-1664 AD-62956.2 493 GACUUGCAUCCUGGAAAUAUA 515 UAUAUUUCCAGGAUGCAAGUCCA 1338-1360 AD-62961.2 494 GGAAGGGAAGGUAGAAGUCUU 516 AAGACUUCUACCUUCCCUUCCAC  864-886 AD-62966.2 495 UGUCUUCUGUUUAGAUUUCCU 517 AGGAAAUCUAAACAGAAGACAGG 1506-1528 AD-62971.2 496 CUUUGGCUGUUUCCAAGAUCU 518 AGAUCUUGGAAACAGCCAAAGGA 1109-1131 AD-62936.2 497 AAUGUGUUUGGGCAACGUCAU 519 AUGACGUUGCCCAAACACAUUUU 1385-1407 AD-62942.2 498 UGUGACUGUGGACACCCCUUA 520 UAAGGGGUGUCCACAGUCACAAA  486-508 AD-62947.2 499 GAUGGGGUGCCAGCUACUAUU 521 AAUAGUAGCUGGCACCCCAUCCA  814-836 AD-62952.2 500 GAAAAUGUGUUUGGGCAACGU 522 ACGUUGCCCAAACACAUUUUCAA 1382-1404 AD-62957.2 501 GGCUGUUUCCAAGAUCUGACA 523 UGUCAGAUCUUGGAAACAGCCAA 1113-1135 AD-62962.2 502 UCCAACAAAAUAGCCACCCCU 524 AGGGGUGGCUAUUUUGUUGGAAA 1258-1280 AD-62967.2 503 GUCUUCUGUUUAGAUUUCCUU 525 AAGGAAAUCUAAACAGAAGACAG 1507-1529 AD-62972.2 504 UGGAAGGGAAGGUAGAAGUCU 526 AGACUUCUACCUUCCCUUCCACA  863-885 AD-62937.2 505 UCCUUUGGCUGUUUCCAAGAU 527 AUCUUGGAAACAGCCAAAGGAUU 1107-1129 AD-62943.2 506 CAUCUCUCAGCUGGGAUGAUA 528 UAUCAUCCCAGCUGAGAGAUGGG  662-684 AD-62948.2 507 GGGGUGCCAGCUACUAUUGAU 529 AUCAAUAGUAGCUGGCACCCCAU  817-839 AD-62953.2 508 AUGUGUUUGGGCAACGUCAUA 530 UAUGACGUUGCCCAAACACAUUU 1386-1408_C21A AD-62958.2 509 CUGUUUAGAUUUCCUUAAGAA 531 UUCUUAAGGAAAUCUAAACAGAA 1512-1534_C21A AD-62963.2 510 AGAAAGAAAUGGACUUGCAUA 532 UAUGCAAGUCCAUUUCUUUCUAG 1327-1349_C21A AD-62968.2 511 GCAUCCUGGAAAUAUAUUAAA 533 UUUAAUAUAUUUCCAGGAUGCAA 1343-1365_C21A AD-62973.2 512 CCUGUCAGACCAUGGGAACUA 534 UAGUUCCCAUGGUCUGACAGGCU  308-330_G21A AD-62938.2 513 AAACAUGGUGUGGAUGGGAUA 535 UAUCCCAUCCACACCAUGUUUAA  763-785_C21A AD-62933.1 536 GAAUGUGAAAGUCAUCGACAA 653 UUGUCGAUGACUUUCACAUUCUG 1072-1094 AD-65630.1 537 GAAUGUGAAAGUCAUCGACAA 654 UUGUCGAUGACUUUCACAUUCUG 1072-1094 AD-65636.1 538 GAAUGUGAAAGUCAUCGACAA 655 UUGUCGAUGACUUUCACAUUCUG 1072-1094 AD-65642.1 539 GAAUGUGAAAGUCAUCGACAA 656 UUGUCGAUGACUUUCACAUUCUG 1072-1094 AD-65647.1 540 GAAUGUGAAAGUCAUCGACAA 657 UUGUCGAUGACUUUCACAUUCUG 1072-1094 AD-65652.1 541 GAAUGUGAAAGUCAUCGACAA 658 UUGUCGAUGACUUUCACAUUCUG 1072-1094 AD-65657.1 542 GAAUGUGAAAGUCAUCGACAA 659 UUGUCGAUGACUUUCACAUUCUG 1072-1094 AD-65662.1 543 GAAUGUGAAAGUCAUCGACAA 660 UUGUCGAUGACUUUCACAUUCUG 1072-1094 AD-65625.1 544 AUGUGAAAGUCAUCGACAA 661 UUGUCGAUGACUUUCACAUUC 1072-1094 AD-65631.1 545 AUGUGAAAGUCAUCGACAA 662 UUGUCGAUGACUUUCACAUUC 1072-1094 AD-65637.1 546 GAAUGUGAAAGUCAUCGACAA 663 UUGUCGAUGACUUUCACAUUCUG 1072-1094 AD-65643.1 547 GAAUGUGAAAGUCAUCGACAA 664 UUGUCGAUGACUUUCACAUUCUG 1072-1094 AD-65648.1 548 GAAUGUGAAAGUCAUCGACAA 665 UUGUCGAUGACUUUCACAUUCUG 1072-1094 AD-65653.1 549 GAAUGUGAAAGUCAUCGACAA 666 UUGUCGAUGACUUUCACAUUCUG 1072-1094 AD-65658.1 550 GAAUGUGAAAGUCAUCGACAA 667 UUGUCGAUGACUUUCACAUUCUG 1072-1094 AD-65663.1 551 GAAUGUGAAAGUCAUCGACAA 668 UUGUCGAUGACUUUCACAUUCUG 1072-1094 AD-65626.1 552 GAAUGUGAAAGUCAUCGACAA 669 UUGUCGAUGACUUUCACAUUCUG 1072-1094 AD-65638.1 553 GAAUGUGAAAGUCAUCGACAA 670 UUGUCGAUGACUUUCACAUUCUG 1072-1094 AD-65644.1 554 GAAUGUGAAAGUCAUCGACAA 671 UUGUCGAUGACUUUCACAUUCUG 1072-1094 AD-65649.1 555 GAAUGUGAAAGUCAUCGACAA 672 UUGUCGAUGACUUUCACAUUCUG 1072-1094 AD-65654.1 556 GAAUGUGAAAGUCAUCGACAA 673 UUGUCGAUGACUUUCACAUUCUG 1072-1094 AD-65659.1 557 GAAUGTGAAAGUCAUCGACAA 674 UUGUCGAUGACUUUCACAUUCUG 1072-1094 AD-65627.1 558 GAAUGUGAAAGUCAUCGACAA 675 UUGUCGAUGACUUUCACAUUCUG 1072-1094 AD-65633.1 559 GAAUGTGAAAGUCAUCGACAA 676 UUGUCGAUGACUUUCACAUUCUG 1072-1094 AD-65639.1 560 GAAUGUGAAAGUCAUCGACAA 677 UUGUCGAUGACUUUCACAUUCUG 1072-1094 AD-65645.1 561 GAAUGUGAAAGUCAUCGACAA 678 UUGUCGAUGACUUUCACAUUCUG 1072-1094 AD-65650.1 562 GAAUGUGAAAGUCAUCTACAA 679 UUGUCGAUGACUUUCACAUUCUG 1072-1094 AD-65655.1 563 GAAUGUGAAAGUCAUCACAA 680 UUGUCGAUGACUUUCACAUUCUG 1072-1094 AD-65660.1 564 GAAUGUGAAAGUCATCTACAA 681 UUGUCGAUGACUUUCACAUUCUG 1072-1094 AD-65665.1 565 GAAUGUGAAAGUCAUCGACAA 682 UUGUCGAUGACUUUCACAUUCUG 1072-1094 AD-65628.1 566 GAAUGUGAAAGUCAUCTACAA 683 UUGUCGAUGACUUUCACAUUCUG 1072-1094 AD-65634.1 567 GAAUGUGAAAGUCAUCACAA 684 UUGUCGAUGACUUUCACAUUCUG 1072-1094 AD-65646.1 568 GAAUGUGAAAGUCAUCGACAA 685 UTGUCGAUGACUUTCACAUUCUG 1072-1094 AD-65656.1 569 GAAUGUGAAAGUCAUCGACAA 686 UUGUCGAUGACUUTCACAUUCUG 1072-1094 AD-65661.1 570 GAAUGUGAAAGUCAUCGACAA 687 UTGUCGAUGACUUTCACAUUCUG 1072-1094 AD-65666.1 571 GAAUGUGAAAGUCAUCGACAA 688 UUGUCGAUGACUUTCACAUUCUG 1072-1094 AD-65629.1 572 GAAUGUGAAAGUCAUCGACAA 689 UTGUCGAUGACUUTCACAUUCUG 1072-1094 AD-65635.1 573 GAAUGUGAAAGUCAUCGACAA 690 UTGUCGAUGACUUTCACAUUCUG 1072-1094 AD-65641.1 574 GAAUGUGAAAGUCAUCGACAA 691 UTGUCGAUGACUUTCACAUUCUG 1072-1094 AD-62994.1 575 GACUUUCAUCCUGGAAAUAUA 692 UAUAUUUCCAGGAUGAAAGUCCA 1341-1363 AD-65595.1 576 GACUUUCAUCCUGGAAAUAUA 693 UAUAUUUCCAGGAUGAAAGUCCA 1341-1363 AD-65600.1 577 GACUUUCAUCCUGGAAAUAUA 694 UAUAUUUCCAGGAUGAAAGUCCA 1341-1363 AD-65610.1 578 GACUUUCAUCCUGGAAAUAUA 695 UAUAUUUCCAGGAUGAAAGUCCA 1341-1363 AD-65615.1 579 GACUUUCAUCCUGGAAAUAUA 696 UAUAUUUCCAGGAUGAAAGUCCA 1341-1363 AD-65620.1 580 GACUUUCAUCCUGGAAAUAUA 697 UAUAUUUCCAGGAUGAAAGUCCA 1341-1363 AD-65584.1 581 CUUUCAUCCUGGAAAUAUA 698 UAUAUUUCCAGGAUGAAAGUC 1341-1361 AD-65590.1 582 CUUUCAUCCUGGAAAUAUA 699 UAUAUUUCCAGGAUGAAAGUC 1341-1361 AD-65596.1 583 GACUUUCAUCCUGGAAAUAUA 700 UAUAUUUCCAGGAUGAAAGUCCA 1341-1363 AD-65601.1 584 GACUUUCAUCCUGGAAAUAUA 701 UAUAUUUCCAGGAUGAAAGUCCA 1341-1363 AD-65606.1 585 GACUUUCAUCCUGGAAAUAUA 702 UAUAUUUCCAGGAUGAAAGUCCA 1341-1363 AD-65611.1 586 GACUUUCAUCCUGGAAAUAUA 703 UAUAUUUCCAGGAUGAAAGUCCA 1341-1363 AD-65616.1 587 GACUUUCAUCCUGGAAAUAUA 704 UAUAUUUCCAGGAUGAAAGUCCA 1341-1363 AD-65621.1 588 GACUUUCAUCCUGGAAAUAUA 705 UAUAUUUCCAGGAUGAAAGUCCA 1341-1363 AD-65585.1 589 GACUUUCAUCCUGGAAAUAUA 706 UAUAUUUCCAGGAUGAAAGUCCA 1341-1363 AD-65591.1 590 GACUUUCAUCCUGGAAAUAUA 707 UAUAUUUCCAGGAUGAAAGUCCA 1341-1363 AD-65597.1 591 GACUUUCAUCCUGGAAAUAUA 708 UAUAUUUCCAGGAUGAAAGUCCA 1341-1363 AD-65602.1 592 GACUUUCAUCCUGGAAAUAUA 709 UAUAUUUCCAGGAUGAAAGUCCA 1341-1363 AD-65607.1 593 GACUUUCAUCCUGGAAAUAUA 710 UAUAUUUCCAGGAUGAAAGUCCA 1341-1363 AD-65612.1 594 GACUUUCAUCCUGGAAAUAUA 711 UAUAUUUCCAGGAUGAAAGUCCA 1341-1363 AD-65622.1 595 GACUUUCAUCCUGGAAAUAUA 712 UAUAUUUCCAGGAUGAAAGUCCA 1341-1363 AD-65586.1 596 GACUTUCAUCCUGGAAAUAUA 713 UAUAUUUCCAGGAUGAAAGUCCA 1341-1363 AD-65592.1 597 GACUUTCAUCCUGGAAAUAUA 714 UAUAUUUCCAGGAUGAAAGUCCA 1341-1363 AD-65598.1 598 GACUUUCAUCCUGGAAAUAUA 715 UAUAUUUCCAGGAUGAAAGUCCA 1341-1363 AD-65603.1 599 GACUUUCAUCCUGGAAAUAUA 716 UAUAUUUCCAGGAUGAAAGUCCA 1341-1363 AD-65608.1 600 GACUUUCAUCCUGGAATUAUA 717 UAUAUUUCCAGGAUGAAAGUCCA 1341-1363 AD-65613.1 601 GACUUUCAUCCUGGAAUAUA 718 UAUAUUUCCAGGAUGAAAGUCCA 1341-1363 AD-65618.1 602 GACUUUCAUCCUGGAATUAUA 719 UAUAUUUCCAGGAUGAAAGUCCA 1341-1363 AD-65623.1 603 GACUUUCAUCCUGGAATUAUA 720 UAUAUUUCCAGGAUGAAAGUCCA 1341-1363 AD-65587.1 604 GACUUUCAUCCUGGAAAUAUA 721 UAUAUUUCCAGGAUGAAAGUCCA 1341-1363 AD-65593.1 605 GACUUTCAUCCUGGAAAUAUA 722 UAUAUUUCCAGGAUGAAAGUCCA 1341-1363 AD-65599.1 606 GACUUUCAUCCUGGAAAUAUA 723 UAUAUUUCCAGGATGAAAGUCCA 1341-1363 AD-65604.1 607 GACUUUCAUCCUGGAAAUAUA 724 UAUAUUUCCAGGATGAAAGUCCA 1341-1363 AD-65609.1 608 GACUUUCAUCCUGGAAAUAUA 725 UAUAUUUCCAGGATGAAAGUCCA 1341-1363 AD-65614.1 609 GACUUUCAUCCUGGAAAUAUA 726 UAUAUTUCCAGGATGAAAGUCCA 1341-1363 AD-65619.1 610 GACUUUCAUCCUGGAAAUAUA 727 UAUAUTUCCAGGATGAAAGUCCA 1341-1363 AD-65624.1 611 GACUUUCAUCCUGGAAAUAUA 728 UAUAUUUCCAGGATGAAAGUCCA 1341-1363 AD-65588.1 612 GACUUUCAUCCUGGAAAUAUA 729 UAUAUTUCCAGGATGAAAGUCCA 1341-1363 AD-65594.1 613 GACUUUCAUCCUGGAAAUAUA 730 UAUAUUUCCAGGATGAAAGUCCA 1341-1363 AD-68309.1 614 AGAAAGGUGUUCAAGAUGUCA 731 UGACAUCUUGAACACCUUUCUCC 1001-1022_C21A AD-68303.1 615 CAUCCUGGAAAUAUAUUAACU 732 AGUUAAUAUAUUUCCAGGAUGAA 1349-1370 AD-65626.5 616 GAAUGUGAAAGUCAUCGACAA 733 UUGUCGAUGACUUUCACAUUCUG 1072-1094 AD-68295.1 617 AGUGCACAAUAUUUUCCCAUA 734 UAUGGGAAAAUAUUGUGCACUGU 1139-1160_C21A AD-68273.1 618 GAAAGUCAUCGACAAGACAUU 735 AAUGUCUUGUCGAUGACUUUCAC 1080-1100 AD-68297.1 619 AAUGUGAAAGUCAUCGACAAA 736 UUUGUCGAUGACUUUCACAUUCU 1075-1096_G21A AD-68287.1 620 CUGGAAAUAUAUUAACUGUUA 737 UAACAGUUAAUAUAUUUCCAGGA 1353-1374 AD-68300.1 621 AUUUUCCCAUCUGUAUUAUUU 738 AAAUAAUACAGAUGGGAAAAUAU 1149-1170 AD-68306.1 622 UGUCGUUCUUUUCCAACAAAA 739 UUUUGUUGGAAAAGAACGACACC 1252-1273 AD-68292.1 623 AUCCUGGAAAUAUAUUAACUA 740 UAGUUAAUAUAUUUCCAGGAUGA 1350-1371_G21A AD-68298.1 624 GCAUUUUGAGAGGUGAUGAUA 741 UAUCAUCACCUCUCAAAAUGCCC  734-755_G21A AD-68277.1 625 CAGGGGGAGAAAGGUGUUCAA 742 UUGAACACCUUUCUCCCCCUGGA  994-1014 AD-68289.1 626 GGAAAUAUAUUAACUGUUAAA 743 UUUAACAGUUAAUAUAUUUCCAG 1355-1376 AD-68272.1 627 CAUUGGUGAGGAAAAAUCCUU 744 AAGGAUUUUUCCUCACCAAUGUC 1097-1117 AD-68282.1 628 GGGAGAAAGGUGUUCAAGAUA 745 UAUCUUGAACACCUUUCUCCCCC  998-1018_G21A AD-68285.1 629 GGCAUUUUGAGAGGUGAUGAU 746 AUCAUCACCUCUCAAAAUGCCCU  733-754 AD-68290.1 630 UACAAAGGGUGUCGUUCUUUU 747 AAAAGAACGACACCCUUUGUAUU 1243-1264 AD-68296.1 631 UGGGAUCUUGGUGUCGAAUCA 748 UGAUUCGACACCAAGAUCCCAUU  783-804 AD-68288.1 632 CUGACAGUGCACAAUAUUUUA 749 UAAAAUAUUGUGCACUGUCAGAU 1134-1155_C21A AD-68299.1 633 CAGUGCACAAUAUUUUCCCAU 750 AUGGGAAAAUAUUGUGCACUGUC 1138-1159 AD-68275.1 634 ACUUUUCAAUGGGUGUCCUAA 751 UUAGGACACCCAUUGAAAAGUCA 1302-1322_G21A AD-68274.1 635 ACAUUGGUGAGGAAAAAUCCU 752 AGGAUUUUUCCUCACCAAUGUCU 1096-1116 AD-68294.1 636 UUGCUUUUGACUUUUCAAUGA 753 UCAUUGAAAAGUCAAAAGCAAUG 1293-1314_G21A AD-68302.1 637 CAUUUUGAGAGGUGAUGAUGA 754 UCAUCAUCACCUCUCAAAAUGCC  735-756_C21A AD-68279.1 638 UUGACUUUUCAAUGGGUGUCA 755 UGACACCCAUUGAAAAGUCAAAA 1299-1319_C21A AD-68304.1 639 CGACUUCUGUUUUAGGACAGA 756 UCUGUCCUAAAACAGAAGUCGAC  212-233 AD-68286.1 640 CUCUGAGUGGGUGCCAGAAUA 757 UAUUCUGGCACCCACUCAGAGCC 1058-1079_G21A AD-68291.1 641 GGGUGCCAGAAUGUGAAAGUA 758 UACUUUCACAUUCUGGCACCCAC 1066-1087_C21A AD-68283.1 642 UCAAUGGGUGUCCUAGGAACA 759 UGUUCCUAGGACACCCAUUGAAA 1307-1327_C21A AD-68280.1 643 AAAGUCAUCGACAAGACAUUA 760 UAAUGUCUUGUCGAUGACUUUCA 1081-1101_G21A AD-68293.1 644 AUUUUGAGAGGUGAUGAUGCA 761 UGCAUCAUCACCUCUCAAAAUGC  736-757_C21A AD-68276.1 645 AUCGACAAGACAUUGGUGAGA 762 UCUCACCAAUGUCUUGUCGAUGA 1087-1107_G21A AD-68308.1 646 GGUGCCAGAAUGUGAAAGUCA 763 UGACUUUCACAUUCUGGCACCCA 1067-1088 AD-68278.1 647 GACAGUGCACAAUAUUUUCCA 764 UGGAAAAUAUUGUGCACUGUCAG 1136-1156_C21A AD-68307.1 648 ACAAAGAGACACUGUGCAGAA 765 UUCUGCACAGUGUCUCUUUGUCA 1191-1212_G21A AD-68284.1 649 UUUUCAAUGGGUGUCCUAGGA 766 UCCUAGGACACCCAUUGAAAAGU 1304-1324 AD-68301.1 650 CCGUUUCCAAGAUCUGACAGU 767 ACUGUCAGAUCUUGGAAACGGCC 1121-1142 AD-68281.1 651 AGGGGGAGAAAGGUGUUCAAA 768 UUUGAACACCUUUCUCCCCCUGG  995-1015_G21A AD-68305.1 652 AGUCAUCGACAAGACAUUGGU 769 ACCAAUGUCUUGUCGAUGACUUU 1083-1104

    TABLE-US-00013 TABLE 12 Additional Human/Mouse/Cyno HAO1 Modified and Unmodified Sense Strand iRNA Sequences Unmodified sense strand sequence Duplex Name Modified sense strand sequence 5′ to 3′ 5′ to 3′ SEQ ID NO: AD-40257.1 uucAAuGGGuGuccuAGGAdTsdT UUCAAUGGGUGUCCUAGGA 770 & 771 AD-40257.2 uucAAuGGGuGuccuAGGAdTsdT UUCAAUGGGUGUCCUAGGA 770 & 771 AD-63102.1 AcAAcuGGAGGGAcAucGudTsdT ACAACUGGAGGGACAUCGU 772 & 773 AD-63102.2 AcAAcuGGAGGGAcAucGudTsdT ACAACUGGAGGGACAUCGU 772 & 773 AD-63102.3 AcAAcuGGAGGGAcAucGudTsdT ACAACUGGAGGGACAUCGU 772 & 773

    TABLE-US-00014 TABLE 13 Additional Human/Mouse/Cyno HAO1 Modified and Unmodified Antisense Strand iRNA Sequences Modified antisense strand sequence 5′ Unmodified antisense strand Duplex Name to 3′ sequence 5′ to 3′ SEQ ID NO: AD-40257.1 UCCuAGGAcACCcAUUGAAdTsdT UCCUAGGACACCCAUUGAA 774 & 775 AD-40257.2 UCCuAGGAcACCcAUUGAAdTsdT UCCUAGGACACCCAUUGAA 774 & 775 AD-63102.1 ACGAUGUCCCUCcAGUUGUdTsdT ACGAUGUCCCUCCAGUUGU 776 & 777 AD-63102.2 ACGAUGUCCCUCcAGUUGUdTsdT ACGAUGUCCCUCCAGUUGU 776 & 777 AD-63102.3 ACGAUGUCCCUCcAGUUGUdTsdT ACGAUGUCCCUCCAGUUGU 776 & 777

    TABLE-US-00015 TABLE 14 Additional Human/Cyno/Mouse/Rat and Human/Cyno/Rat HAO1 Modified Sense Strand iRNA Sequences Duplex Name Modified sense strand sequence SEQ ID NO: AD-62989.2 UfscsCfuAfgGfaAfCfCfuUfuUfaGfaAfaUfL96 778 AD-62994.2 GfsasCfuUfuCfaUfCfCfuGfgAfaAfuAfuAfL96 779 AD-62933.2 GfsasAfuGfuGfaAfAfGfuCfaUfcGfaCfaAfL96 780 AD-62935.2 CfsasUfuGfgUfgAfGfGfaAfaAfaUfcCfuUfL96 781 AD-62940.2 AfsusCfgAfcAfaGfAfCfaUfuGfgUfgAfgAfL96 782 AD-62941.2 AfscsAfuUfgGfuGfAfGfgAfaAfaAfuCfcUfL96 783 AD-62944.2 GfsasAfaGfuCfaUfCfGfaCfaAfgAfcAfuUfL96 784 AD-62965.2 AfsasAfgUfcAfuCfGfAfcAfaGfaCfaUfuAfL96 785

    TABLE-US-00016 TABLE 15 Additional Human/Cyno/Mouse/Rat and Human/Cyno/Rat HAO1 Modified Antisense Strand iRNA Sequences Duplex Name Modified antisense strand SEQ ID NO: AD-62989.2 asUfsuUfcUfaAfaAfgguUfcCfuAfgGfascsa 786 AD-62994.2 usAfsuAfuUfuCfcAfggaUfgAfaAfgUfcscsa 787 AD-62933.2 usUfsgUfcGfaUfgAfcuuUfcAfcAfuUfcsusg 788 AD-62935.2 asAfsgGfaUfuUfuUfccuCfaCfcAfaUfgsusc 789 AD-62940.2 usCfsuCfaCfcAfaUfgucUfuGfuCfgAfusgsa 790 AD-62941.2 asGfsgAfuUfuUfuCfcucAfcCfaAfuGfuscsu 791 AD-62944.2 asAfsuGfuCfuUfgUfcgaUfgAfcUfuUfcsasc 792 AD-62965.2 usAfsaUfgUfcUfuGfucgAfuGfaCfuUfuscsa 793

    TABLE-US-00017 TABLE 16 Additional Human Unmodified and Modifieded Sense and Antisense Strand HAO1 iRNA Sequences Targeting NM_017545.2 SEQ ID SEQ ID Unmodified sequence 5′ to 3′ NO: Modified sequence 5′ to 3′ NO: Strand Length AUGUAUGUUACUUCUUAGAGA 794 asusguauGfuUfAfCfuucuuagagaL96 1890 sense 21 UCUCUAAGAAGUAACAUACAUCC 795 usCfsucuAfaGfAfaguaAfcAfuacauscsc 1891 antisense 23 UGUAUGUUACUUCUUAGAGAG 796 usgsuaugUfuAfCfUfucuuagagagL96 1892 sense 21 CUCUCUAAGAAGUAACAUACAUC 797 csUfscucUfaAfGfaaguAfaCfauacasusc 1893 antisense 23 UAGGAUGUAUGUUACUUCUUA 798 usasggauGfuAfUfGfuuacuucuuaL96 1894 sense 21 UAAGAAGUAACAUACAUCCUAAA 799 usAfsagaAfgUfAfacauAfcAfuccuasasa 1895 antisense 23 UUAGGAUGUAUGUUACUUCUU 800 ususaggaUfgUfAfUfguuacuucuuL96 1896 sense 21 AAGAAGUAACAUACAUCCUAAAA 801 asAfsgaaGfuAfAfcauaCfaUfccuaasasa 1897 antisense 23 AGAAAGGUGUUCAAGAUGUCC 802 asgsaaagGfuGfUfUfcaagauguccL96 1898 sense 21 GGACAUCUUGAACACCUUUCUCC 803 gsGfsacaUfcUfUfgaacAfcCfuuucuscsc 1899 antisense 23 GAAAGGUGUUCAAGAUGUCCU 804 gsasaaggUfgUfUfCfaagauguccuL96 1900 sense 21 AGGACAUCUUGAACACCUUUCUC 805 asGfsgacAfuCfUfugaaCfaCfcuuucsusc 1901 antisense 23 GGGGAGAAAGGUGUUCAAGAU 806 gsgsggagAfaAfGfGfuguucaagauL96 1902 sense 21 AUCUUGAACACCUUUCUCCCCCU 807 asUfscuuGfaAfCfaccuUfuCfuccccscsu 1903 antisense 23 GGGGGAGAAAGGUGUUCAAGA 808 gsgsgggaGfaAfAfGfguguucaagaL96 1904 sense 21 UCUUGAACACCUUUCUCCCCCUG 809 usCfsuugAfaCfAfccuuUfcUfcccccsusg 1905 antisense 23 AGAAACUUUGGCUGAUAAUAU 810 asgsaaacUfuUfGfGfcugauaauauL96 1906 sense 21 AUAUUAUCAGCCAAAGUUUCUUC 811 asUfsauuAfuCfAfgccaAfaGfuuucususc 1907 antisense 23 GAAACUUUGGCUGAUAAUAUU 812 gsasaacuUfuGfGfCfugauaauauuL96 1908 sense 21 AAUAUUAUCAGCCAAAGUUUCUU 813 asAfsuauUfaUfCfagccAfaAfguuucsusu 1909 antisense 23 AUGAAGAAACUUUGGCUGAUA 814 asusgaagAfaAfCfUfuuggcugauaL96 1910 sense 21 UAUCAGCCAAAGUUUCUUCAUCA 815 usAfsucaGfcCfAfaaguUfuCfuucauscsa 1911 antisense 23 GAUGAAGAAACUUUGGCUGAU 816 gsasugaaGfaAfAfCfuuuggcugauL96 1912 sense 21 AUCAGCCAAAGUUUCUUCAUCAU 817 asUfscagCfcAfAfaguuUfcUfucaucsasu 1913 antisense 23 AAGGCACUGAUGUUCUGAAAG 818 asasggcaCfuGfAfUfguucugaaagL96 1914 sense 21 CUUUCAGAACAUCAGUGCCUUUC 819 csUfsuucAfgAfAfcaucAfgUfgccuususc 1915 antisense 23 AGGCACUGAUGUUCUGAAAGC 820 asgsgcacUfgAfUfGfuucugaaagcL96 1916 sense 21 GCUUUCAGAACAUCAGUGCCUUU 821 gsCfsuuuCfaGfAfacauCfaGfugccususu 1917 antisense 23 CGGAAAGGCACUGAUGUUCUG 822 csgsgaaaGfgCfAfCfugauguucugL96 1918 sense 21 CAGAACAUCAGUGCCUUUCCGCA 823 csAfsgaaCfaUfCfagugCfcUfuuccgscsa 1919 antisense 23 GCGGAAAGGCACUGAUGUUCU 824 gscsggaaAfgGfCfAfcugauguucuL96 1920 sense 21 AGAACAUCAGUGCCUUUCCGCAC 825 asGfsaacAfuCfAfgugcCfuUfuccgcsasc 1921 antisense 23 AGAAGACUGACAUCAUUGCCA 826 asgsaagaCfuGfAfCfaucauugccaL96 1922 sense 21 UGGCAAUGAUGUCAGUCUUCUCA 827 usGfsgcaAfuGfAfugucAfgUfcuucuscsa 1923 antisense 23 GAAGACUGACAUCAUUGCCAA 828 gsasagacUfgAfCfAfucauugccaaL96 1924 sense 21 UUGGCAAUGAUGUCAGUCUUCUC 829 usUfsggcAfaUfGfauguCfaGfucuucsusc 1925 antisense 23 GCUGAGAAGACUGACAUCAUU 830 gscsugagAfaGfAfCfugacaucauuL96 1926 sense 21 AAUGAUGUCAGUCUUCUCAGCCA 831 asAfsugaUfgUfCfagucUfuCfucagcscsa 1927 antisense 23 GGCUGAGAAGACUGACAUCAU 832 gsgscugaGfaAfGfAfcugacaucauL96 1928 sense 21 AUGAUGUCAGUCUUCUCAGCCAU 833 asUfsgauGfuCfAfgucuUfcUfcagccsasu 1929 antisense 23 UAAUGCCUGAUUCACAACUUU 834 usasaugcCfuGfAfUfucacaacuuuL96 1930 sense 21 AAAGUUGUGAAUCAGGCAUUACC 835 asAfsaguUfgUfGfaaucAfgGfcauuascsc 1931 antisense 23 AAUGCCUGAUUCACAACUUUG 836 asasugccUfgAfUfUfcacaacuuugL96 1932 sense 21 CAAAGUUGUGAAUCAGGCAUUAC 837 csAfsaagUfuGfUfgaauCfaGfgcauusasc 1933 antisense 23 UUGGUAAUGCCUGAUUCACAA 838 ususgguaAfuGfCfCfugauucacaaL96 1934 sense 21 UUGUGAAUCAGGCAUUACCAACA 839 usUfsgugAfaUfCfaggcAfuUfaccaascsa 1935 antisense 23 GUUGGUAAUGCCUGAUUCACA 840 gsusugguAfaUfGfCfcugauucacaL96 1936 sense 21 UGUGAAUCAGGCAUUACCAACAC 841 usGfsugaAfuCfAfggcaUfuAfccaacsasc 1937 antisense 23 UAUCAAAUGGCUGAGAAGACU 842 usasucaaAfuGfGfCfugagaagacuL96 1938 sense 21 AGUCUUCUCAGCCAUUUGAUAUC 843 asGfsucuUfcUfCfagccAfuUfugauasusc 1939 antisense 23 AUCAAAUGGCUGAGAAGACUG 844 asuscaaaUfgGfCfUfgagaagacugL96 1940 sense 21 CAGUCUUCUCAGCCAUUUGAUAU 845 csAfsgucUfuCfUfcagcCfaUfuugausasu 1941 antisense 23 AAGAUAUCAAAUGGCUGAGAA 846 asasgauaUfcAfAfAfuggcugagaaL96 1942 sense 21 UUCUCAGCCAUUUGAUAUCUUCC 847 usUfscucAfgCfCfauuuGfaUfaucuuscsc 1943 antisense 23 GAAGAUAUCAAAUGGCUGAGA 848 gsasagauAfuCfAfAfauggcugagaL96 1944 sense 21 UCUCAGCCAUUUGAUAUCUUCCC 849 usCfsucaGfcCfAfuuugAfuAfucuucscsc 1945 antisense 23 UCUGACAGUGCACAAUAUUUU 850 uscsugacAfgUfGfCfacaauauuuuL96 1946 sense 21 AAAAUAUUGUGCACUGUCAGAUC 851 asAfsaauAfuUfGfugcaCfuGfucagasusc 1947 antisense 23 CUGACAGUGCACAAUAUUUUC 852 csusgacaGfuGfCfAfcaauauuuucL96 1948 sense 21 GAAAAUAUUGUGCACUGUCAGAU 853 gsAfsaaaUfaUfUfgugcAfcUfgucagsasu 1949 antisense 23 AAGAUCUGACAGUGCACAAUA 854 asasgaucUfgAfCfAfgugcacaauaL96 1950 sense 21 UAUUGUGCACUGUCAGAUCUUGG 855 usAfsuugUfgCfAfcuguCfaGfaucuusgsg 1951 antisense 23 CAAGAUCUGACAGUGCACAAU 856 csasagauCfuGfAfCfagugcacaauL96 1952 sense 21 AUUGUGCACUGUCAGAUCUUGGA 857 asUfsuguGfcAfCfugucAfgAfucuugsgsa 1953 antisense 23 ACUGAUGUUCUGAAAGCUCUG 858 ascsugauGfuUfCfUfgaaagcucugL96 1954 sense 21 CAGAGCUUUCAGAACAUCAGUGC 859 csAfsgagCfuUfUfcagaAfcAfucagusgsc 1955 antisense 23 CUGAUGUUCUGAAAGCUCUGG 860 csusgaugUfuCfUfGfaaagcucuggL96 1956 sense 21 CCAGAGCUUUCAGAACAUCAGUG 861 csCfsagaGfcUfUfucagAfaCfaucagsusg 1957 antisense 23 AGGCACUGAUGUUCUGAAAGC 862 asgsgcacUfgAfUfGfuucugaaagcL96 1958 sense 21 GCUUUCAGAACAUCAGUGCCUUU 863 gsCfsuuuCfaGfAfacauCfaGfugccususu 1959 antisense 23 AAGGCACUGAUGUUCUGAAAG 864 asasggcaCfuGfAfUfguucugaaagL96 1960 sense 21 CUUUCAGAACAUCAGUGCCUUUC 865 csUfsuucAfgAfAfcaucAfgUfgccuususc 1961 antisense 23 AACAACAUGCUAAAUCAGUAC 866 asascaacAfuGfCfUfaaaucaguacL96 1962 sense 21 GUACUGAUUUAGCAUGUUGUUCA 867 gsUfsacuGfaUfUfuagcAfuGfuuguuscsa 1963 antisense 23 ACAACAUGCUAAAUCAGUACU 868 ascsaacaUfgCfUfAfaaucaguacuL96 1964 sense 21 AGUACUGAUUUAGCAUGUUGUUC 869 asGfsuacUfgAfUfuuagCfaUfguugususc 1965 antisense 23 UAUGAACAACAUGCUAAAUCA 870 usasugaaCfaAfCfAfugcuaaaucaL96 1966 sense 21 UGAUUUAGCAUGUUGUUCAUAAU 871 usGfsauuUfaGfCfauguUfgUfucauasasu 1967 antisense 23 UUAUGAACAACAUGCUAAAUC 872 ususaugaAfcAfAfCfaugcuaaaucL96 1968 sense 21 GAUUUAGCAUGUUGUUCAUAAUC 873 gsAfsuuuAfgCfAfuguuGfuUfcauaasusc 1969 antisense 23 UCUUUAGUGUCUGAAUAUAUC 874 uscsuuuaGfuGfUfCfugaauauaucL96 1970 sense 21 GAUAUAUUCAGACACUAAAGAUG 875 gsAfsuauAfuUfCfagacAfcUfaaagasusg 1971 antisense 23 CUUUAGUGUCUGAAUAUAUCC 876 csusuuagUfgUfCfUfgaauauauccL96 1972 sense 21 GGAUAUAUUCAGACACUAAAGAU 877 gsGfsauaUfaUfUfcagaCfaCfuaaagsasu 1973 antisense 23 CACAUCUUUAGUGUCUGAAUA 878 csascaucUfuUfAfGfugucugaauaL96 1974 sense 21 UAUUCAGACACUAAAGAUGUGAU 879 usAfsuucAfgAfCfacuaAfaGfaugugsasu 1975 antisense 23 UCACAUCUUUAGUGUCUGAAU 880 uscsacauCfuUfUfAfgugucugaauL96 1976 sense 21 AUUCAGACACUAAAGAUGUGAUU 881 asUfsucaGfaCfAfcuaaAfgAfugugasusu 1977 antisense 23 UGAUACUUCUUUGAAUGUAGA 882 usgsauacUfuCfUfUfugaauguagaL96 1978 sense 21 UCUACAUUCAAAGAAGUAUCACC 883 usCfsuacAfuUfCfaaagAfaGfuaucascsc 1979 antisense 23 GAUACUUCUUUGAAUGUAGAU 884 gsasuacuUfcUfUfUfgaauguagauL96 1980 sense 21 AUCUACAUUCAAAGAAGUAUCAC 885 asUfscuaCfaUfUfcaaaGfaAfguaucsasc 1981 antisense 23 UUGGUGAUACUUCUUUGAAUG 886 ususggugAfuAfCfUfucuuugaaugL96 1982 sense 21 CAUUCAAAGAAGUAUCACCAAUU 887 csAfsuucAfaAfGfaaguAfuCfaccaasusu 1983 antisense 23 AUUGGUGAUACUUCUUUGAAU 888 asusugguGfaUfAfCfuucuuugaauL96 1984 sense 21 AUUCAAAGAAGUAUCACCAAUUA 889 asUfsucaAfaGfAfaguaUfcAfccaaususa 1985 antisense 23 AAUAACCUGUGAAAAUGCUCC 890 asasuaacCfuGfUfGfaaaaugcuccL96 1986 sense 21 GGAGCAUUUUCACAGGUUAUUGC 891 gsGfsagcAfuUfUfucacAfgGfuuauusgsc 1987 antisense 23 AUAACCUGUGAAAAUGCUCCC 892 asusaaccUfgUfGfAfaaaugcucccL96 1988 sense 21 GGGAGCAUUUUCACAGGUUAUUG 893 gsGfsgagCfaUfUfuucaCfaGfguuaususg 1989 antisense 23 UAGCAAUAACCUGUGAAAAUG 894 usasgcaaUfaAfCfCfugugaaaaugL96 1990 sense 21 CAUUUUCACAGGUUAUUGCUAUC 895 csAfsuuuUfcAfCfagguUfaUfugcuasusc 1991 antisense 23 AUAGCAAUAACCUGUGAAAAU 896 asusagcaAfuAfAfCfcugugaaaauL96 1992 sense 21 AUUUUCACAGGUUAUUGCUAUCC 897 asUfsuuuCfaCfAfgguuAfuUfgcuauscsc 1993 antisense 23 AAUCACAUCUUUAGUGUCUGA 898 asasucacAfuCfUfUfuagugucugaL96 1994 sense 21 UCAGACACUAAAGAUGUGAUUGG 899 usCfsagaCfaCfUfaaagAfuGfugauusgsg 1995 antisense 23 AUCACAUCUUUAGUGUCUGAA 900 asuscacaUfcUfUfUfagugucugaaL96 1996 sense 21 UUCAGACACUAAAGAUGUGAUUG 901 usUfscagAfcAfCfuaaaGfaUfgugaususg 1997 antisense 23 UUCCAAUCACAUCUUUAGUGU 902 ususccaaUfcAfCfAfucuuuaguguL96 1998 sense 21 ACACUAAAGAUGUGAUUGGAAAU 903 asCfsacuAfaAfGfauguGfaUfuggaasasu 1999 antisense 23 UUUCCAAUCACAUCUUUAGUG 904 ususuccaAfuCfAfCfaucuuuagugL96 2000 sense 21 CACUAAAGAUGUGAUUGGAAAUC 905 csAfscuaAfaGfAfugugAfuUfggaaasusc 2001 antisense 23 ACGGGCAUGAUGUUGAGUUCC 906 ascsgggcAfuGfAfUfguugaguuccL96 2002 sense 21 GGAACUCAACAUCAUGCCCGUUC 907 gsGfsaacUfcAfAfcaucAfuGfcccgususc 2003 antisense 23 CGGGCAUGAUGUUGAGUUCCU 908 csgsggcaUfgAfUfGfuugaguuccuL96 2004 sense 21 AGGAACUCAACAUCAUGCCCGUU 909 asGfsgaaCfuCfAfacauCfaUfgcccgsusu 2005 antisense 23 GGGAACGGGCAUGAUGUUGAG 910 gsgsgaacGfgGfCfAfugauguugagL96 2006 sense 21 CUCAACAUCAUGCCCGUUCCCAG 911 csUfscaaCfaUfCfaugcCfcGfuucccsasg 2007 antisense 23 UGGGAACGGGCAUGAUGUUGA 912 usgsggaaCfgGfGfCfaugauguugaL96 2008 sense 21 UCAACAUCAUGCCCGUUCCCAGG 913 usCfsaacAfuCfAfugccCfgUfucccasgsg 2009 antisense 23 ACUAAGGUGAAAAGAUAAUGA 914 ascsuaagGfuGfAfAfaagauaaugaL96 2010 sense 21 UCAUUAUCUUUUCACCUUAGUGU 915 usCfsauuAfuCfUfuuucAfcCfuuagusgsu 2011 antisense 23 CUAAGGUGAAAAGAUAAUGAU 916 csusaaggUfgAfAfAfagauaaugauL96 2012 sense 21 AUCAUUAUCUUUUCACCUUAGUG 917 asUfscauUfaUfCfuuuuCfaCfcuuagsusg 2013 antisense 23 AAACACUAAGGUGAAAAGAUA 918 asasacacUfaAfGfGfugaaaagauaL96 2014 sense 21 UAUCUUUUCACCUUAGUGUUUGC 919 usAfsucuUfuUfCfaccuUfaGfuguuusgsc 2015 antisense 23 CAAACACUAAGGUGAAAAGAU 920 csasaacaCfuAfAfGfgugaaaagauL96 2016 sense 21 AUCUUUUCACCUUAGUGUUUGCU 921 asUfscuuUfuCfAfccuuAfgUfguuugscsu 2017 antisense 23 AGGUAGCACUGGAGAGAAUUG 922 asgsguagCfaCfUfGfgagagaauugL96 2018 sense 21 CAAUUCUCUCCAGUGCUACCUUC 923 csAfsauuCfuCfUfccagUfgCfuaccususc 2019 antisense 23 GGUAGCACUGGAGAGAAUUGG 924 gsgsuagcAfcUfGfGfagagaauuggL96 2020 sense 21 CCAAUUCUCUCCAGUGCUACCUU 925 csCfsaauUfcUfCfuccaGfuGfcuaccsusu 2021 antisense 23 GAGAAGGUAGCACUGGAGAGA 926 gsasgaagGfuAfGfCfacuggagagaL96 2022 sense 21 UCUCUCCAGUGCUACCUUCUCAA 927 usCfsucuCfcAfGfugcuAfcCfuucucsasa 2023 antisense 23 UGAGAAGGUAGCACUGGAGAG 928 usgsagaaGfgUfAfGfcacuggagagL96 2024 sense 21 CUCUCCAGUGCUACCUUCUCAAA 929 csUfscucCfaGfUfgcuaCfcUfucucasasa 2025 antisense 23 AGUGGACUUGCUGCAUAUGUG 930 asgsuggaCfuUfGfCfugcauaugugL96 2026 sense 21 CACAUAUGCAGCAAGUCCACUGU 931 csAfscauAfuGfCfagcaAfgUfccacusgsu 2027 antisense 23 GUGGACUUGCUGCAUAUGUGG 932 gsusggacUfuGfCfUfgcauauguggL96 2028 sense 21 CCACAUAUGCAGCAAGUCCACUG 933 csCfsacaUfaUfGfcagcAfaGfuccacsusg 2029 antisense 23 CGACAGUGGACUUGCUGCAUA 934 csgsacagUfgGfAfCfuugcugcauaL96 2030 sense 21 UAUGCAGCAAGUCCACUGUCGUC 935 usAfsugcAfgCfAfagucCfaCfugucgsusc 2031 antisense 23 ACGACAGUGGACUUGCUGCAU 936 ascsgacaGfuGfGfAfcuugcugcauL96 2032 sense 21 AUGCAGCAAGUCCACUGUCGUCU 937 asUfsgcaGfcAfAfguccAfcUfgucguscsu 2033 antisense 23 AAGGUGUUCAAGAUGUCCUCG 938 asasggugUfuCfAfAfgauguccucgL96 2034 sense 21 CGAGGACAUCUUGAACACCUUUC 939 csGfsaggAfcAfUfcuugAfaCfaccuususc 2035 antisense 23 AGGUGUUCAAGAUGUCCUCGA 940 asgsguguUfcAfAfGfauguccucgaL96 2036 sense 21 UCGAGGACAUCUUGAACACCUUU 941 usCfsgagGfaCfAfucuuGfaAfcaccususu 2037 antisense 23 GAGAAAGGUGUUCAAGAUGUC 942 gsasgaaaGfgUfGfUfucaagaugucL96 2038 sense 21 GACAUCUUGAACACCUUUCUCCC 943 gsAfscauCfuUfGfaacaCfcUfuucucscsc 2039 antisense 23 GGAGAAAGGUGUUCAAGAUGU 944 gsgsagaaAfgGfUfGfuucaagauguL96 2040 sense 21 ACAUCUUGAACACCUUUCUCCCC 945 asCfsaucUfuGfAfacacCfuUfucuccscsc 2041 antisense 23 AACCGUCUGGAUGAUGUGCGU 946 asasccguCfuGfGfAfugaugugcguL96 2042 sense 21 ACGCACAUCAUCCAGACGGUUGC 947 asCfsgcaCfaUfCfauccAfgAfcgguusgsc 2043 antisense 23 ACCGUCUGGAUGAUGUGCGUA 948 ascscgucUfgGfAfUfgaugugcguaL96 2044 sense 21 UACGCACAUCAUCCAGACGGUUG 949 usAfscgcAfcAfUfcaucCfaGfacggususg 2045 antisense 23 GGGCAACCGUCUGGAUGAUGU 950 gsgsgcaaCfcGfUfCfuggaugauguL96 2046 sense 21 ACAUCAUCCAGACGGUUGCCCAG 951 asCfsaucAfuCfCfagacGfgUfugcccsasg 2047 antisense 23 UGGGCAACCGUCUGGAUGAUG 952 usgsggcaAfcCfGfUfcuggaugaugL96 2048 sense 21 CAUCAUCCAGACGGUUGCCCAGG 953 csAfsucaUfcCfAfgacgGfuUfgcccasgsg 2049 antisense 23 GAAACUUUGGCUGAUAAUAUU 954 gsasaacuUfuGfGfCfugauaauauuL96 2050 sense 21 AAUAUUAUCAGCCAAAGUUUCUU 955 asAfsuauUfaUfCfagccAfaAfguuucsusu 2051 antisense 23 AAACUUUGGCUGAUAAUAUUG 956 asasacuuUfgGfCfUfgauaauauugL96 2052 sense 21 CAAUAUUAUCAGCCAAAGUUUCU 957 csAfsauaUfuAfUfcagcCfaAfaguuuscsu 2053 antisense 23 UGAAGAAACUUUGGCUGAUAA 958 usgsaagaAfaCfUfUfuggcugauaaL96 2054 sense 21 UUAUCAGCCAAAGUUUCUUCAUC 959 usUfsaucAfgCfCfaaagUfuUfcuucasusc 2055 antisense 23 AUGAAGAAACUUUGGCUGAUA 960 asusgaagAfaAfCfUfuuggcugauaL96 2056 sense 21 UAUCAGCCAAAGUUUCUUCAUCA 961 usAfsucaGfcCfAfaaguUfuCfuucauscsa 2057 antisense 23 AAAGGUGUUCAAGAUGUCCUC 962 asasagguGfuUfCfAfagauguccucL96 2058 sense 21 GAGGACAUCUUGAACACCUUUCU 963 gsAfsggaCfaUfCfuugaAfcAfccuuuscsu 2059 antisense 23 AAGGUGUUCAAGAUGUCCUCG 964 asasggugUfuCfAfAfgauguccucgL96 2060 sense 21 CGAGGACAUCUUGAACACCUUUC 965 csGfsaggAfcAfUfcuugAfaCfaccuususc 2061 antisense 23 GGAGAAAGGUGUUCAAGAUGU 966 gsgsagaaAfgGfUfGfuucaagauguL96 2062 sense 21 ACAUCUUGAACACCUUUCUCCCC 967 asCfsaucUfuGfAfacacCfuUfucuccscsc 2063 antisense 23 GGGAGAAAGGUGUUCAAGAUG 968 gsgsgagaAfaGfGfUfguucaagaugL96 2064 sense 21 CAUCUUGAACACCUUUCUCCCCC 969 csAfsucuUfgAfAfcaccUfuUfcucccscsc 2065 antisense 23 AAAUCAGUACUUCCAAAGUCU 970 asasaucaGfuAfCfUfuccaaagucuL96 2066 sense 21 AGACUUUGGAAGUACUGAUUUAG 971 asGfsacuUfuGfGfaaguAfcUfgauuusasg 2067 antisense 23 AAUCAGUACUUCCAAAGUCUA 972 asasucagUfaCfUfUfccaaagucuaL96 2068 sense 21 UAGACUUUGGAAGUACUGAUUUA 973 usAfsgacUfuUfGfgaagUfaCfugauususa 2069 antisense 23 UGCUAAAUCAGUACUUCCAAA 974 usgscuaaAfuCfAfGfuacuuccaaaL96 2070 sense 21 UUUGGAAGUACUGAUUUAGCAUG 975 usUfsuggAfaGfUfacugAfuUfuagcasusg 2071 antisense 23 AUGCUAAAUCAGUACUUCCAA 976 asusgcuaAfaUfCfAfguacuuccaaL96 2072 sense 21 UUGGAAGUACUGAUUUAGCAUGU 977 usUfsggaAfgUfAfcugaUfuUfagcausgsu 2073 antisense 23 ACAUCUUUAGUGUCUGAAUAU 978 ascsaucuUfuAfGfUfgucugaauauL96 2074 sense 21 AUAUUCAGACACUAAAGAUGUGA 979 asUfsauuCfaGfAfcacuAfaAfgaugusgsa 2075 antisense 23 CAUCUUUAGUGUCUGAAUAUA 980 csasucuuUfaGfUfGfucugaauauaL96 2076 sense 21 UAUAUUCAGACACUAAAGAUGUG 981 usAfsuauUfcAfGfacacUfaAfagaugsusg 2077 antisense 23 AAUCACAUCUUUAGUGUCUGA 982 asasucacAfuCfUfUfuagugucugaL96 2078 sense 21 UCAGACACUAAAGAUGUGAUUGG 983 usCfsagaCfaCfUfaaagAfuGfugauusgsg 2079 antisense 23 CAAUCACAUCUUUAGUGUCUG 984 csasaucaCfaUfCfUfuuagugucugL96 2080 sense 21 CAGACACUAAAGAUGUGAUUGGA 985 csAfsgacAfcUfAfaagaUfgUfgauugsgsa 2081 antisense 23 GCAUGUAUUACUUGACAAAGA 986 gscsauguAfuUfAfCfuugacaaagaL96 2082 sense 21 UCUUUGUCAAGUAAUACAUGCUG 987 usCfsuuuGfuCfAfaguaAfuAfcaugcsusg 2083 antisense 23 CAUGUAUUACUUGACAAAGAG 988 csasuguaUfuAfCfUfugacaaagagL96 2084 sense 21 CUCUUUGUCAAGUAAUACAUGCU 989 csUfscuuUfgUfCfaaguAfaUfacaugscsu 2085 antisense 23 UUCAGCAUGUAUUACUUGACA 990 ususcagcAfuGfUfAfuuacuugacaL96 2086 sense 21 UGUCAAGUAAUACAUGCUGAAAA 991 usGfsucaAfgUfAfauacAfuGfcugaasasa 2087 antisense 23 UUUCAGCAUGUAUUACUUGAC 992 ususucagCfaUfGfUfauuacuugacL96 2088 sense 21 GUCAAGUAAUACAUGCUGAAAAA 993 gsUfscaaGfuAfAfuacaUfgCfugaaasasa 2089 antisense 23 AUGUUACUUCUUAGAGAGAAA 994 asusguuaCfuUfCfUfuagagagaaaL96 2090 sense 21 UUUCUCUCUAAGAAGUAACAUAC 995 usUfsucuCfuCfUfaagaAfgUfaacausasc 2091 antisense 23 UGUUACUUCUUAGAGAGAAAU 996 usgsuuacUfuCfUfUfagagagaaauL96 2092 sense 21 AUUUCUCUCUAAGAAGUAACAUA 997 asUfsuucUfcUfCfuaagAfaGfuaacasusa 2093 antisense 23 AUGUAUGUUACUUCUUAGAGA 998 asusguauGfuUfAfCfuucuuagagaL96 2094 sense 21 UCUCUAAGAAGUAACAUACAUCC 999 usCfsucuAfaGfAfaguaAfcAfuacauscsc 2095 antisense 23 GAUGUAUGUUACUUCUUAGAG 1000 gsasuguaUfgUfUfAfcuucuuagagL96 2096 sense 21 CUCUAAGAAGUAACAUACAUCCU 1001 csUfscuaAfgAfAfguaaCfaUfacaucscsu 2097 antisense 23 ACAACUUUGAGAAGGUAGCAC 1002 ascsaacuUfuGfAfGfaagguagcacL96 2098 sense 21 GUGCUACCUUCUCAAAGUUGUGA 1003 gsUfsgcuAfcCfUfucucAfaAfguugusgsa 2099 antisense 23 CAACUUUGAGAAGGUAGCACU 1004 csasacuuUfgAfGfAfagguagcacuL96 2100 sense 21 AGUGCUACCUUCUCAAAGUUGUG 1005 asGfsugcUfaCfCfuucuCfaAfaguugsusg 2101 antisense 23 AUUCACAACUUUGAGAAGGUA 1006 asusucacAfaCfUfUfugagaagguaL96 2102 sense 21 UACCUUCUCAAAGUUGUGAAUCA 1007 usAfsccuUfcUfCfaaagUfuGfugaauscsa 2103 antisense 23 GAUUCACAACUUUGAGAAGGU 1008 gsasuucaCfaAfCfUfuugagaagguL96 2104 sense 21 ACCUUCUCAAAGUUGUGAAUCAG 1009 asCfscuuCfuCfAfaaguUfgUfgaaucsasg 2105 antisense 23 AACAUGCUAAAUCAGUACUUC 1010 asascaugCfuAfAfAfucaguacuucL96 2106 sense 21 GAAGUACUGAUUUAGCAUGUUGU 1011 gsAfsaguAfcUfGfauuuAfgCfauguusgsu 2107 antisense 23 ACAUGCUAAAUCAGUACUUCC 1012 ascsaugcUfaAfAfUfcaguacuuccL96 2108 sense 21 GGAAGUACUGAUUUAGCAUGUUG 1013 gsGfsaagUfaCfUfgauuUfaGfcaugususg 2109 antisense 23 GAACAACAUGCUAAAUCAGUA 1014 gsasacaaCfaUfGfCfuaaaucaguaL96 2110 sense 21 UACUGAUUUAGCAUGUUGUUCAU 1015 usAfscugAfuUfUfagcaUfgUfuguucsasu 2111 antisense 23 UGAACAACAUGCUAAAUCAGU 1016 usgsaacaAfcAfUfGfcuaaaucaguL96 2112 sense 21 ACUGAUUUAGCAUGUUGUUCAUA 1017 asCfsugaUfuUfAfgcauGfuUfguucasusa 2113 antisense 23 AAACCAGUACUUUAUCAUUUU 1018 asasaccaGfuAfCfUfuuaucauuuuL96 2114 sense 21 AAAAUGAUAAAGUACUGGUUUCA 1019 asAfsaauGfaUfAfaaguAfcUfgguuuscsa 2115 antisense 23 AACCAGUACUUUAUCAUUUUC 1020 asasccagUfaCfUfUfuaucauuuucL96 2116 sense 21 GAAAAUGAUAAAGUACUGGUUUC 1021 gsAfsaaaUfgAfUfaaagUfaCfugguususc 2117 antisense 23 UUUGAAACCAGUACUUUAUCA 1022 ususugaaAfcCfAfGfuacuuuaucaL96 2118 sense 21 UGAUAAAGUACUGGUUUCAAAAU 1023 usGfsauaAfaGfUfacugGfuUfucaaasasu 2119 antisense 23 UUUUGAAACCAGUACUUUAUC 1024 ususuugaAfaCfCfAfguacuuuaucL96 2120 sense 21 GAUAAAGUACUGGUUUCAAAAUU 1025 gsAfsuaaAfgUfAfcuggUfuUfcaaaasusu 2121 antisense 23 GAGAAGAUGGGCUACAAGGCC 1026 gsasgaagAfuGfGfGfcuacaaggccL96 2122 sense 21 GGCCUUGUAGCCCAUCUUCUCUG 1027 gsGfsccuUfgUfAfgcccAfuCfuucucsusg 2123 antisense 23 AGAAGAUGGGCUACAAGGCCA 1028 asgsaagaUfgGfGfCfuacaaggccaL96 2124 sense 21 UGGCCUUGUAGCCCAUCUUCUCU 1029 usGfsgccUfuGfUfagccCfaUfcuucuscsu 2125 antisense 23 GGCAGAGAAGAUGGGCUACAA 1030 gsgscagaGfaAfGfAfugggcuacaaL96 2126 sense 21 UUGUAGCCCAUCUUCUCUGCCUG 1031 usUfsguaGfcCfCfaucuUfcUfcugccsusg 2127 antisense 23 AGGCAGAGAAGAUGGGCUACA 1032 asgsgcagAfgAfAfGfaugggcuacaL96 2128 sense 21 UGUAGCCCAUCUUCUCUGCCUGC 1033 usGfsuagCfcCfAfucuuCfuCfugccusgsc 2129 antisense 23 AACGGGCAUGAUGUUGAGUUC 1034 asascgggCfaUfGfAfuguugaguucL96 2130 sense 21 GAACUCAACAUCAUGCCCGUUCC 1035 gsAfsacuCfaAfCfaucaUfgCfccguuscsc 2131 antisense 23 ACGGGCAUGAUGUUGAGUUCC 1036 ascsgggcAfuGfAfUfguugaguuccL96 2132 sense 21 GGAACUCAACAUCAUGCCCGUUC 1037 gsGfsaacUfcAfAfcaucAfuGfcccgususc 2133 antisense 23 UGGGAACGGGCAUGAUGUUGA 1038 usgsggaaCfgGfGfCfaugauguugaL96 2134 sense 21 UCAACAUCAUGCCCGUUCCCAGG 1039 usCfsaacAfuCfAfugccCfgUfucccasgsg 2135 antisense 23 CUGGGAACGGGCAUGAUGUUG 1040 csusgggaAfcGfGfGfcaugauguugL96 2136 sense 21 CAACAUCAUGCCCGUUCCCAGGG 1041 csAfsacaUfcAfUfgcccGfuUfcccagsgsg 2137 antisense 23 AUGUGGCUAAAGCAAUAGACC 1042 asusguggCfuAfAfAfgcaauagaccL96 2138 sense 21 GGUCUAUUGCUUUAGCCACAUAU 1043 gsGfsucuAfuUfGfcuuuAfgCfcacausasu 2139 antisense 23 UGUGGCUAAAGCAAUAGACCC 1044 usgsuggcUfaAfAfGfcaauagacccL96 2140 sense 21 GGGUCUAUUGCUUUAGCCACAUA 1045 gsGfsgucUfaUfUfgcuuUfaGfccacasusa 2141 antisense 23 GCAUAUGUGGCUAAAGCAAUA 1046 gscsauauGfuGfGfCfuaaagcaauaL96 2142 sense 21 UAUUGCUUUAGCCACAUAUGCAG 1047 usAfsuugCfuUfUfagccAfcAfuaugcsasg 2143 antisense 23 UGCAUAUGUGGCUAAAGCAAU 1048 usgscauaUfgUfGfGfcuaaagcaauL96 2144 sense 21 AUUGCUUUAGCCACAUAUGCAGC 1049 asUfsugcUfuUfAfgccaCfaUfaugcasgsc 2145 antisense 23 AGGAUGCUCCGGAAUGUUGCU 1050 asgsgaugCfuCfCfGfgaauguugcuL96 2146 sense 21 AGCAACAUUCCGGAGCAUCCUUG 1051 asGfscaaCfaUfUfccggAfgCfauccususg 2147 antisense 23 GGAUGCUCCGGAAUGUUGCUG 1052 gsgsaugcUfcCfGfGfaauguugcugL96 2148 sense 21 CAGCAACAUUCCGGAGCAUCCUU 1053 csAfsgcaAfcAfUfuccgGfaGfcauccsusu 2149 antisense 23 UCCAAGGAUGCUCCGGAAUGU 1054 uscscaagGfaUfGfCfuccggaauguL96 2150 sense 21 ACAUUCCGGAGCAUCCUUGGAUA 1055 asCfsauuCfcGfGfagcaUfcCfuuggasusa 2151 antisense 23 AUCCAAGGAUGCUCCGGAAUG 1056 asusccaaGfgAfUfGfcuccggaaugL96 2152 sense 21 CAUUCCGGAGCAUCCUUGGAUAC 1057 csAfsuucCfgGfAfgcauCfcUfuggausasc 2153 antisense 23 UCACAUCUUUAGUGUCUGAAU 1058 uscsacauCfuUfUfAfgugucugaauL96 2154 sense 21 AUUCAGACACUAAAGAUGUGAUU 1059 asUfsucaGfaCfAfcuaaAfgAfugugasusu 2155 antisense 23 CACAUCUUUAGUGUCUGAAUA 1060 csascaucUfuUfAfGfugucugaauaL96 2156 sense 21 UAUUCAGACACUAAAGAUGUGAU 1061 usAfsuucAfgAfCfacuaAfaGfaugugsasu 2157 antisense 23 CCAAUCACAUCUUUAGUGUCU 1062 cscsaaucAfcAfUfCfuuuagugucuL96 2158 sense 21 AGACACUAAAGAUGUGAUUGGAA 1063 asGfsacaCfuAfAfagauGfuGfauuggsasa 2159 antisense 23 UCCAAUCACAUCUUUAGUGUC 1064 uscscaauCfaCfAfUfcuuuagugucL96 2160 sense 21 GACACUAAAGAUGUGAUUGGAAA 1065 gsAfscacUfaAfAfgaugUfgAfuuggasasa 2161 antisense 23 AAAUGUGUUUAGACAACGUCA 1066 asasauguGfuUfUfAfgacaacgucaL96 2162 sense 21 UGACGUUGUCUAAACACAUUUUC 1067 usGfsacgUfuGfUfcuaaAfcAfcauuususc 2163 antisense 23 AAUGUGUUUAGACAACGUCAU 1068 asasugugUfuUfAfGfacaacgucauL96 2164 sense 21 AUGACGUUGUCUAAACACAUUUU 1069 asUfsgacGfuUfGfucuaAfaCfacauususu 2165 antisense 23 UUGAAAAUGUGUUUAGACAAC 1070 ususgaaaAfuGfUfGfuuuagacaacL96 2166 sense 21 GUUGUCUAAACACAUUUUCAAUG 1071 gsUfsuguCfuAfAfacacAfuUfuucaasusg 2167 antisense 23 AUUGAAAAUGUGUUUAGACAA 1072 asusugaaAfaUfGfUfguuuagacaaL96 2168 sense 21 UUGUCUAAACACAUUUUCAAUGU 1073 usUfsgucUfaAfAfcacaUfuUfucaausgsu 2169 antisense 23 UACUAAAGGAAGAAUUCCGGU 1074 usascuaaAfgGfAfAfgaauuccgguL96 2170 sense 21 ACCGGAAUUCUUCCUUUAGUAUC 1075 asCfscggAfaUfUfcuucCfuUfuaguasusc 2171 antisense 23 ACUAAAGGAAGAAUUCCGGUU 1076 ascsuaaaGfgAfAfGfaauuccgguuL96 2172 sense 21 AACCGGAAUUCUUCCUUUAGUAU 1077 asAfsccgGfaAfUfucuuCfcUfuuagusasu 2173 antisense 23 GAGAUACUAAAGGAAGAAUUC 1078 gsasgauaCfuAfAfAfggaagaauucL96 2174 sense 21 GAAUUCUUCCUUUAGUAUCUCGA 1079 gsAfsauuCfuUfCfcuuuAfgUfaucucsgsa 2175 antisense 23 CGAGAUACUAAAGGAAGAAUU 1080 csgsagauAfcUfAfAfaggaagaauuL96 2176 sense 21 AAUUCUUCCUUUAGUAUCUCGAG 1081 asAfsuucUfuCfCfuuuaGfuAfucucgsasg 2177 antisense 23 AACUUUGGCUGAUAAUAUUGC 1082 asascuuuGfgCfUfGfauaauauugcL96 2178 sense 21 GCAAUAUUAUCAGCCAAAGUUUC 1083 gsCfsaauAfuUfAfucagCfcAfaaguususc 2179 antisense 23 ACUUUGGCUGAUAAUAUUGCA 1084 ascsuuugGfcUfGfAfuaauauugcaL96 2180 sense 21 UGCAAUAUUAUCAGCCAAAGUUU 1085 usGfscaaUfaUfUfaucaGfcCfaaagususu 2181 antisense 23 AAGAAACUUUGGCUGAUAAUA 1086 asasgaaaCfuUfUfGfgcugauaauaL96 2182 sense 21 UAUUAUCAGCCAAAGUUUCUUCA 1087 usAfsuuaUfcAfGfccaaAfgUfuucuuscsa 2183 antisense 23 GAAGAAACUUUGGCUGAUAAU 1088 gsasagaaAfcUfUfUfggcugauaauL96 2184 sense 21 AUUAUCAGCCAAAGUUUCUUCAU 1089 asUfsuauCfaGfCfcaaaGfuUfucuucsasu 2185 antisense 23 AAAUGGCUGAGAAGACUGACA 1090 asasauggCfuGfAfGfaagacugacaL96 2186 sense 21 UGUCAGUCUUCUCAGCCAUUUGA 1091 usGfsucaGfuCfUfucucAfgCfcauuusgsa 2187 antisense 23 AAUGGCUGAGAAGACUGACAU 1092 asasuggcUfgAfGfAfagacugacauL96 2188 sense 21 AUGUCAGUCUUCUCAGCCAUUUG 1093 asUfsgucAfgUfCfuucuCfaGfccauususg 2189 antisense 23 UAUCAAAUGGCUGAGAAGACU 1094 usasucaaAfuGfGfCfugagaagacuL96 2190 sense 21 AGUCUUCUCAGCCAUUUGAUAUC 1095 asGfsucuUfcUfCfagccAfuUfugauasusc 2191 antisense 23 AUAUCAAAUGGCUGAGAAGAC 1096 asusaucaAfaUfGfGfcugagaagacL96 2192 sense 21 GUCUUCUCAGCCAUUUGAUAUCU 1097 gsUfscuuCfuCfAfgccaUfuUfgauauscsu 2193 antisense 23 GUGGUUCUUAAAUUGUAAGCU 1098 gsusgguuCfuUfAfAfauuguaagcuL96 2194 sense 21 AGCUUACAAUUUAAGAACCACUG 1099 asGfscuuAfcAfAfuuuaAfgAfaccacsusg 2195 antisense 23 UGGUUCUUAAAUUGUAAGCUC 1100 usgsguucUfuAfAfAfuuguaagcucL96 2196 sense 21 GAGCUUACAAUUUAAGAACCACU 1101 gsAfsgcuUfaCfAfauuuAfaGfaaccascsu 2197 antisense 23 AACAGUGGUUCUUAAAUUGUA 1102 asascaguGfgUfUfCfuuaaauuguaL96 2198 sense 21 UACAAUUUAAGAACCACUGUUUU 1103 usAfscaaUfuUfAfagaaCfcAfcuguususu 2199 antisense 23 AAACAGUGGUUCUUAAAUUGU 1104 asasacagUfgGfUfUfcuuaaauuguL96 2200 sense 21 ACAAUUUAAGAACCACUGUUUUA 1105 asCfsaauUfuAfAfgaacCfaCfuguuususa 2201 antisense 23 AAGUCAUCGACAAGACAUUGG 1106 asasgucaUfcGfAfCfaagacauuggL96 2202 sense 21 CCAAUGUCUUGUCGAUGACUUUC 1107 csCfsaauGfuCfUfugucGfaUfgacuususc 2203 antisense 23 AGUCAUCGACAAGACAUUGGU 1108 asgsucauCfgAfCfAfagacauugguL96 2204 sense 21 ACCAAUGUCUUGUCGAUGACUUU 1109 asCfscaaUfgUfCfuuguCfgAfugacususu 2205 antisense 23 GUGAAAGUCAUCGACAAGACA 1110 gsusgaaaGfuCfAfUfcgacaagacaL96 2206 sense 21 UGUCUUGUCGAUGACUUUCACAU 1111 usGfsucuUfgUfCfgaugAfcUfuucacsasu 2207 antisense 23 UGUGAAAGUCAUCGACAAGAC 1112 usgsugaaAfgUfCfAfucgacaagacL96 2208 sense 21 GUCUUGUCGAUGACUUUCACAUU 1113 gsUfscuuGfuCfGfaugaCfuUfucacasusu 2209 antisense 23 GAUAAUAUUGCAGCAUUUUCC 1114 gsasuaauAfuUfGfCfagcauuuuccL96 2210 sense 21 GGAAAAUGCUGCAAUAUUAUCAG 1115 gsGfsaaaAfuGfCfugcaAfuAfuuaucsasg 2211 antisense 23 AUAAUAUUGCAGCAUUUUCCA 1116 asusaauaUfuGfCfAfgcauuuuccaL96 2212 sense 21 UGGAAAAUGCUGCAAUAUUAUCA 1117 usGfsgaaAfaUfGfcugcAfaUfauuauscsa 2213 antisense 23 GGCUGAUAAUAUUGCAGCAUU 1118 gsgscugaUfaAfUfAfuugcagcauuL96 2214 sense 21 AAUGCUGCAAUAUUAUCAGCCAA 1119 asAfsugcUfgCfAfauauUfaUfcagccsasa 2215 antisense 23 UGGCUGAUAAUAUUGCAGCAU 1120 usgsgcugAfuAfAfUfauugcagcauL96 2216 sense 21 AUGCUGCAAUAUUAUCAGCCAAA 1121 asUfsgcuGfcAfAfuauuAfuCfagccasasa 2217 antisense 23 GCUAAUUUGUAUCAAUGAUUA 1122 gscsuaauUfuGfUfAfucaaugauuaL96 2218 sense 21 UAAUCAUUGAUACAAAUUAGCCG 1123 usAfsaucAfuUfGfauacAfaAfuuagcscsg 2219 antisense 23 CUAAUUUGUAUCAAUGAUUAU 1124 csusaauuUfgUfAfUfcaaugauuauL96 2220 sense 21 AUAAUCAUUGAUACAAAUUAGCC 1125 asUfsaauCfaUfUfgauaCfaAfauuagscsc 2221 antisense 23 CCCGGCUAAUUUGUAUCAAUG 1126 cscscggcUfaAfUfUfuguaucaaugL96 2222 sense 21 CAUUGAUACAAAUUAGCCGGGGG 1127 csAfsuugAfuAfCfaaauUfaGfccgggsgsg 2223 antisense 23 CCCCGGCUAAUUUGUAUCAAU 1128 cscsccggCfuAfAfUfuuguaucaauL96 2224 sense 21 AUUGAUACAAAUUAGCCGGGGGA 1129 asUfsugaUfaCfAfaauuAfgCfcggggsgsa 2225 antisense 23 UAAUUGGUGAUACUUCUUUGA 1130 usasauugGfuGfAfUfacuucuuugaL96 2226 sense 21 UCAAAGAAGUAUCACCAAUUACC 1131 usCfsaaaGfaAfGfuaucAfcCfaauuascsc 2227 antisense 23 AAUUGGUGAUACUUCUUUGAA 1132 asasuuggUfgAfUfAfcuucuuugaaL96 2228 sense 21 UUCAAAGAAGUAUCACCAAUUAC 1133 usUfscaaAfgAfAfguauCfaCfcaauusasc 2229 antisense 23 GCGGUAAUUGGUGAUACUUCU 1134 gscsgguaAfuUfGfGfugauacuucuL96 2230 sense 21 AGAAGUAUCACCAAUUACCGCCA 1135 asGfsaagUfaUfCfaccaAfuUfaccgcscsa 2231 antisense 23 GGCGGUAAUUGGUGAUACUUC 1136 gsgscgguAfaUfUfGfgugauacuucL96 2232 sense 21 GAAGUAUCACCAAUUACCGCCAC 1137 gsAfsaguAfuCfAfccaaUfuAfccgccsasc 2233 antisense 23 CAGUGGUUCUUAAAUUGUAAG 1138 csasguggUfuCfUfUfaaauuguaagL96 2234 sense 21 CUUACAAUUUAAGAACCACUGUU 1139 csUfsuacAfaUfUfuaagAfaCfcacugsusu 2235 antisense 23 AGUGGUUCUUAAAUUGUAAGC 1140 asgsugguUfcUfUfAfaauuguaagcL96 2236 sense 21 GCUUACAAUUUAAGAACCACUGU 1141 gsCfsuuaCfaAfUfuuaaGfaAfccacusgsu 2237 antisense 23 AAAACAGUGGUUCUUAAAUUG 1142 asasaacaGfuGfGfUfucuuaaauugL96 2238 sense 21 CAAUUUAAGAACCACUGUUUUAA 1143 csAfsauuUfaAfGfaaccAfcUfguuuusasa 2239 antisense 23 UAAAACAGUGGUUCUUAAAUU 1144 usasaaacAfgUfGfGfuucuuaaauuL96 2240 sense 21 AAUUUAAGAACCACUGUUUUAAA 1145 asAfsuuuAfaGfAfaccaCfuGfuuuuasasa 2241 antisense 23 ACCUGUAUUCUGUUUACAUGU 1146 ascscuguAfuUfCfUfguuuacauguL96 2242 sense 21 ACAUGUAAACAGAAUACAGGUUA 1147 asCfsaugUfaAfAfcagaAfuAfcaggususa 2243 antisense 23 CCUGUAUUCUGUUUACAUGUC 1148 cscsuguaUfuCfUfGfuuuacaugucL96 2244 sense 21 GACAUGUAAACAGAAUACAGGUU 1149 gsAfscauGfuAfAfacagAfaUfacaggsusu 2245 antisense 23 AUUAACCUGUAUUCUGUUUAC 1150 asusuaacCfuGfUfAfuucuguuuacL96 2246 sense 21 GUAAACAGAAUACAGGUUAAUAA 1151 gsUfsaaaCfaGfAfauacAfgGfuuaausasa 2247 antisense 23 UAUUAACCUGUAUUCUGUUUA 1152 usasuuaaCfcUfGfUfauucuguuuaL96 2248 sense 21 UAAACAGAAUACAGGUUAAUAAA 1153 usAfsaacAfgAfAfuacaGfgUfuaauasasa 2249 antisense 23 AAGAAACUUUGGCUGAUAAUA 1154 asasgaaaCfuUfUfGfgcugauaauaL96 2250 sense 21 UAUUAUCAGCCAAAGUUUCUUCA 1155 usAfsuuaUfcAfGfccaaAfgUfuucuuscsa 2251 antisense 23 AGAAACUUUGGCUGAUAAUAU 1156 asgsaaacUfuUfGfGfcugauaauauL96 2252 sense 21 AUAUUAUCAGCCAAAGUUUCUUC 1157 asUfsauuAfuCfAfgccaAfaGfuuucususc 2253 antisense 23 GAUGAAGAAACUUUGGCUGAU 1158 gsasugaaGfaAfAfCfuuuggcugauL96 2254 sense 21 AUCAGCCAAAGUUUCUUCAUCAU 1159 asUfscagCfcAfAfaguuUfcUfucaucsasu 2255 antisense 23 UGAUGAAGAAACUUUGGCUGA 1160 usgsaugaAfgAfAfAfcuuuggcugaL96 2256 sense 21 UCAGCCAAAGUUUCUUCAUCAUU 1161 usCfsagcCfaAfAfguuuCfuUfcaucasusu 2257 antisense 23 GAAAGGUGUUCAAGAUGUCCU 1162 gsasaaggUfgUfUfCfaagauguccuL96 2258 sense 21 AGGACAUCUUGAACACCUUUCUC 1163 asGfsgacAfuCfUfugaaCfaCfcuuucsusc 2259 antisense 23 AAAGGUGUUCAAGAUGUCCUC 1164 asasagguGfuUfCfAfagauguccucL96 2260 sense 21 GAGGACAUCUUGAACACCUUUCU 1165 gsAfsggaCfaUfCfuugaAfcAfccuuuscsu 2261 antisense 23 GGGAGAAAGGUGUUCAAGAUG 1166 gsgsgagaAfaGfGfUfguucaagaugL96 2262 sense 21 CAUCUUGAACACCUUUCUCCCCC 1167 csAfsucuUfgAfAfcaccUfuUfcucccscsc 2263 antisense 23 GGGGAGAAAGGUGUUCAAGAU 1168 gsgsggagAfaAfGfGfuguucaagauL96 2264 sense 21 AUCUUGAACACCUUUCUCCCCCU 1169 asUfscuuGfaAfCfaccuUfuCfuccccscsu 2265 antisense 23 AUCUUGGUGUCGAAUCAUGGG 1170 asuscuugGfuGfUfCfgaaucaugggL96 2266 sense 21 CCCAUGAUUCGACACCAAGAUCC 1171 csCfscauGfaUfUfcgacAfcCfaagauscsc 2267 antisense 23 UCUUGGUGUCGAAUCAUGGGG 1172 uscsuuggUfgUfCfGfaaucauggggL96 2268 sense 21 CCCCAUGAUUCGACACCAAGAUC 1173 csCfsccaUfgAfUfucgaCfaCfcaagasusc 2269 antisense 23 UGGGAUCUUGGUGUCGAAUCA 1174 usgsggauCfuUfGfGfugucgaaucaL96 2270 sense 21 UGAUUCGACACCAAGAUCCCAUU 1175 usGfsauuCfgAfCfaccaAfgAfucccasusu 2271 antisense 23 AUGGGAUCUUGGUGUCGAAUC 1176 asusgggaUfcUfUfGfgugucgaaucL96 2272 sense 21 GAUUCGACACCAAGAUCCCAUUC 1177 gsAfsuucGfaCfAfccaaGfaUfcccaususc 2273 antisense 23 GCUACAAGGCCAUAUUUGUGA 1178 gscsuacaAfgGfCfCfauauuugugaL96 2274 sense 21 UCACAAAUAUGGCCUUGUAGCCC 1179 usCfsacaAfaUfAfuggcCfuUfguagcscsc 2275 antisense 23 CUACAAGGCCAUAUUUGUGAC 1180 csusacaaGfgCfCfAfuauuugugacL96 2276 sense 21 GUCACAAAUAUGGCCUUGUAGCC 1181 gsUfscacAfaAfUfauggCfcUfuguagscsc 2277 antisense 23 AUGGGCUACAAGGCCAUAUUU 1182 asusgggcUfaCfAfAfggccauauuuL96 2278 sense 21 AAAUAUGGCCUUGUAGCCCAUCU 1183 asAfsauaUfgGfCfcuugUfaGfcccauscsu 2279 antisense 23 GAUGGGCUACAAGGCCAUAUU 1184 gsasugggCfuAfCfAfaggccauauuL96 2280 sense 21 AAUAUGGCCUUGUAGCCCAUCUU 1185 asAfsuauGfgCfCfuuguAfgCfccaucsusu 2281 antisense 23 ACUGGAGAGAAUUGGAAUGGG 1186 ascsuggaGfaGfAfAfuuggaaugggL96 2282 sense 21 CCCAUUCCAAUUCUCUCCAGUGC 1187 csCfscauUfcCfAfauucUfcUfccagusgsc 2283 antisense 23 CUGGAGAGAAUUGGAAUGGGU 1188 csusggagAfgAfAfUfuggaauggguL96 2284 sense 21 ACCCAUUCCAAUUCUCUCCAGUG 1189 asCfsccaUfuCfCfaauuCfuCfuccagsusg 2285 antisense 23 UAGCACUGGAGAGAAUUGGAA 1190 usasgcacUfgGfAfGfagaauuggaaL96 2286 sense 21 UUCCAAUUCUCUCCAGUGCUACC 1191 usUfsccaAfuUfCfucucCfaGfugcuascsc 2287 antisense 23 GUAGCACUGGAGAGAAUUGGA 1192 gsusagcaCfuGfGfAfgagaauuggaL96 2288 sense 21 UCCAAUUCUCUCCAGUGCUACCU 1193 usCfscaaUfuCfUfcuccAfgUfgcuacscsu 2289 antisense 23 ACAGUGGACACACCUUACCUG 1194 ascsagugGfaCfAfCfaccuuaccugL96 2290 sense 21 CAGGUAAGGUGUGUCCACUGUCA 1195 csAfsgguAfaGfGfugugUfcCfacuguscsa 2291 antisense 23 CAGUGGACACACCUUACCUGG 1196 csasguggAfcAfCfAfccuuaccuggL96 2292 sense 21 CCAGGUAAGGUGUGUCCACUGUC 1197 csCfsaggUfaAfGfguguGfuCfcacugsusc 2293 antisense 23 UGUGACAGUGGACACACCUUA 1198 usgsugacAfgUfGfGfacacaccuuaL96 2294 sense 21 UAAGGUGUGUCCACUGUCACAAA 1199 usAfsaggUfgUfGfuccaCfuGfucacasasa 2295 antisense 23 UUGUGACAGUGGACACACCUU 1200 ususgugaCfaGfUfGfgacacaccuuL96 2296 sense 21 AAGGUGUGUCCACUGUCACAAAU 1201 asAfsgguGfuGfUfccacUfgUfcacaasasu 2297 antisense 23 GAAGACUGACAUCAUUGCCAA 1202 gsasagacUfgAfCfAfucauugccaaL96 2298 sense 21 UUGGCAAUGAUGUCAGUCUUCUC 1203 usUfsggcAfaUfGfauguCfaGfucuucsusc 2299 antisense 23 AAGACUGACAUCAUUGCCAAU 1204 asasgacuGfaCfAfUfcauugccaauL96 2300 sense 21 AUUGGCAAUGAUGUCAGUCUUCU 1205 asUfsuggCfaAfUfgaugUfcAfgucuuscsu 2301 antisense 23 CUGAGAAGACUGACAUCAUUG 1206 csusgagaAfgAfCfUfgacaucauugL96 2302 sense 21 CAAUGAUGUCAGUCUUCUCAGCC 1207 csAfsaugAfuGfUfcaguCfuUfcucagscsc 2303 antisense 23 GCUGAGAAGACUGACAUCAUU 1208 gscsugagAfaGfAfCfugacaucauuL96 2304 sense 21 AAUGAUGUCAGUCUUCUCAGCCA 1209 asAfsugaUfgUfCfagucUfuCfucagcscsa 2305 antisense 23 GCUCAGGUUCAAAGUGUUGGU 1210 gscsucagGfuUfCfAfaaguguugguL96 2306 sense 21 ACCAACACUUUGAACCUGAGCUU 1211 asCfscaaCfaCfUfuugaAfcCfugagcsusu 2307 antisense 23 CUCAGGUUCAAAGUGUUGGUA 1212 csuscaggUfuCfAfAfaguguugguaL96 2308 sense 21 UACCAACACUUUGAACCUGAGCU 1213 usAfsccaAfcAfCfuuugAfaCfcugagscsu 2309 antisense 23 GUAAGCUCAGGUUCAAAGUGU 1214 gsusaagcUfcAfGfGfuucaaaguguL96 2310 sense 21 ACACUUUGAACCUGAGCUUACAA 1215 asCfsacuUfuGfAfaccuGfaGfcuuacsasa 2311 antisense 23 UGUAAGCUCAGGUUCAAAGUG 1216 usgsuaagCfuCfAfGfguucaaagugL96 2312 sense 21 CACUUUGAACCUGAGCUUACAAU 1217 csAfscuuUfgAfAfccugAfgCfuuacasasu 2313 antisense 23 AUGUAUUACUUGACAAAGAGA 1218 asusguauUfaCfUfUfgacaaagagaL96 2314 sense 21 UCUCUUUGUCAAGUAAUACAUGC 1219 usCfsucuUfuGfUfcaagUfaAfuacausgsc 2315 antisense 23 UGUAUUACUUGACAAAGAGAC 1220 usgsuauuAfcUfUfGfacaaagagacL96 2316 sense 21 GUCUCUUUGUCAAGUAAUACAUG 1221 gsUfscucUfuUfGfucaaGfuAfauacasusg 2317 antisense 23 CAGCAUGUAUUACUUGACAAA 1222 csasgcauGfuAfUfUfacuugacaaaL96 2318 sense 21 UUUGUCAAGUAAUACAUGCUGAA 1223 usUfsuguCfaAfGfuaauAfcAfugcugsasa 2319 antisense 23 UCAGCAUGUAUUACUUGACAA 1224 uscsagcaUfgUfAfUfuacuugacaaL96 2320 sense 21 UUGUCAAGUAAUACAUGCUGAAA 1225 usUfsgucAfaGfUfaauaCfaUfgcugasasa 2321 antisense 23 CUGCAACUGUAUAUCUACAAG 1226 csusgcaaCfuGfUfAfuaucuacaagL96 2322 sense 21 CUUGUAGAUAUACAGUUGCAGCC 1227 csUfsuguAfgAfUfauacAfgUfugcagscsc 2323 antisense 23 UGCAACUGUAUAUCUACAAGG 1228 usgscaacUfgUfAfUfaucuacaaggL96 2324 sense 21 CCUUGUAGAUAUACAGUUGCAGC 1229 csCfsuugUfaGfAfuauaCfaGfuugcasgsc 2325 antisense 23 UUGGCUGCAACUGUAUAUCUA 1230 ususggcuGfcAfAfCfuguauaucuaL96 2326 sense 21 UAGAUAUACAGUUGCAGCCAACG 1231 usAfsgauAfuAfCfaguuGfcAfgccaascsg 2327 antisense 23 GUUGGCUGCAACUGUAUAUCU 1232 gsusuggcUfgCfAfAfcuguauaucuL96 2328 sense 21 AGAUAUACAGUUGCAGCCAACGA 1233 asGfsauaUfaCfAfguugCfaGfccaacsgsa 2329 antisense 23 CAAAUGAUGAAGAAACUUUGG 1234 csasaaugAfuGfAfAfgaaacuuuggL96 2330 sense 21 CCAAAGUUUCUUCAUCAUUUGCC 1235 csCfsaaaGfuUfUfcuucAfuCfauuugscsc 2331 antisense 23 AAAUGAUGAAGAAACUUUGGC 1236 asasaugaUfgAfAfGfaaacuuuggcL96 2332 sense 21 GCCAAAGUUUCUUCAUCAUUUGC 1237 gsCfscaaAfgUfUfucuuCfaUfcauuusgsc 2333 antisense 23 GGGGCAAAUGAUGAAGAAACU 1238 gsgsggcaAfaUfGfAfugaagaaacuL96 2334 sense 21 AGUUUCUUCAUCAUUUGCCCCAG 1239 asGfsuuuCfuUfCfaucaUfuUfgccccsasg 2335 antisense 23 UGGGGCAAAUGAUGAAGAAAC 1240 usgsgggcAfaAfUfGfaugaagaaacL96 2336 sense 21 GUUUCUUCAUCAUUUGCCCCAGA 1241 gsUfsuucUfuCfAfucauUfuGfccccasgsa 2337 antisense 23 CAAAGGGUGUCGUUCUUUUCC 1242 csasaaggGfuGfUfCfguucuuuuccL96 2338 sense 21 GGAAAAGAACGACACCCUUUGUA 1243 gsGfsaaaAfgAfAfcgacAfcCfcuuugsusa 2339 antisense 23 AAAGGGUGUCGUUCUUUUCCA 1244 asasagggUfgUfCfGfuucuuuuccaL96 2340 sense 21 UGGAAAAGAACGACACCCUUUGU 1245 usGfsgaaAfaGfAfacgaCfaCfccuuusgsu 2341 antisense 23 AAUACAAAGGGUGUCGUUCUU 1246 asasuacaAfaGfGfGfugucguucuuL96 2342 sense 21 AAGAACGACACCCUUUGUAUUGA 1247 asAfsgaaCfgAfCfacccUfuUfguauusgsa 2343 antisense 23 CAAUACAAAGGGUGUCGUUCU 1248 csasauacAfaAfGfGfgugucguucuL96 2344 sense 21 AGAACGACACCCUUUGUAUUGAA 1249 asGfsaacGfaCfAfcccuUfuGfuauugsasa 2345 antisense 23 AAAGGCACUGAUGUUCUGAAA 1250 asasaggcAfcUfGfAfuguucugaaaL96 2346 sense 21 UUUCAGAACAUCAGUGCCUUUCC 1251 usUfsucaGfaAfCfaucaGfuGfccuuuscsc 2347 antisense 23 AAGGCACUGAUGUUCUGAAAG 1252 asasggcaCfuGfAfUfguucugaaagL96 2348 sense 21 CUUUCAGAACAUCAGUGCCUUUC 1253 csUfsuucAfgAfAfcaucAfgUfgccuususc 2349 antisense 23 GCGGAAAGGCACUGAUGUUCU 1254 gscsggaaAfgGfCfAfcugauguucuL96 2350 sense 21 AGAACAUCAGUGCCUUUCCGCAC 1255 asGfsaacAfuCfAfgugcCfuUfuccgcsasc 2351 antisense 23 UGCGGAAAGGCACUGAUGUUC 1256 usgscggaAfaGfGfCfacugauguucL96 2352 sense 21 GAACAUCAGUGCCUUUCCGCACA 1257 gsAfsacaUfcAfGfugccUfuUfccgcascsa 2353 antisense 23 AAGGAUGCUCCGGAAUGUUGC 1258 asasggauGfcUfCfCfggaauguugcL96 2354 sense 21 GCAACAUUCCGGAGCAUCCUUGG 1259 gsCfsaacAfuUfCfcggaGfcAfuccuusgsg 2355 antisense 23 AGGAUGCUCCGGAAUGUUGCU 1260 asgsgaugCfuCfCfGfgaauguugcuL96 2356 sense 21 AGCAACAUUCCGGAGCAUCCUUG 1261 asGfscaaCfaUfUfccggAfgCfauccususg 2357 antisense 23 AUCCAAGGAUGCUCCGGAAUG 1262 asusccaaGfgAfUfGfcuccggaaugL96 2358 sense 21 CAUUCCGGAGCAUCCUUGGAUAC 1263 csAfsuucCfgGfAfgcauCfcUfuggausasc 2359 antisense 23 UAUCCAAGGAUGCUCCGGAAU 1264 usasuccaAfgGfAfUfgcuccggaauL96 2360 sense 21 AUUCCGGAGCAUCCUUGGAUACA 1265 asUfsuccGfgAfGfcaucCfuUfggauascsa 2361 antisense 23 AAUGGGUGGCGGUAAUUGGUG 1266 asasugggUfgGfCfGfguaauuggugL96 2362 sense 21 CACCAAUUACCGCCACCCAUUCC 1267 csAfsccaAfuUfAfccgcCfaCfccauuscsc 2363 antisense 23 AUGGGUGGCGGUAAUUGGUGA 1268 asusggguGfgCfGfGfuaauuggugaL96 2364 sense 21 UCACCAAUUACCGCCACCCAUUC 1269 usCfsaccAfaUfUfaccgCfcAfcccaususc 2365 antisense 23 UUGGAAUGGGUGGCGGUAAUU 1270 ususggaaUfgGfGfUfggcgguaauuL96 2366 sense 21 AAUUACCGCCACCCAUUCCAAUU 1271 asAfsuuaCfcGfCfcaccCfaUfuccaasusu 2367 antisense 23 AUUGGAAUGGGUGGCGGUAAU 1272 asusuggaAfuGfGfGfuggcgguaauL96 2368 sense 21 AUUACCGCCACCCAUUCCAAUUC 1273 asUfsuacCfgCfCfacccAfuUfccaaususc 2369 antisense 23 GGAAAGGCACUGAUGUUCUGA 1274 gsgsaaagGfcAfCfUfgauguucugaL96 2370 sense 21 UCAGAACAUCAGUGCCUUUCCGC 1275 usCfsagaAfcAfUfcaguGfcCfuuuccsgsc 2371 antisense 23 GAAAGGCACUGAUGUUCUGAA 1276 gsasaaggCfaCfUfGfauguucugaaL96 2372 sense 21 UUCAGAACAUCAGUGCCUUUCCG 1277 usUfscagAfaCfAfucagUfgCfcuuucscsg 2373 antisense 23 GUGCGGAAAGGCACUGAUGUU 1278 gsusgcggAfaAfGfGfcacugauguuL96 2374 sense 21 AACAUCAGUGCCUUUCCGCACAC 1279 asAfscauCfaGfUfgccuUfuCfcgcacsasc 2375 antisense 23 UGUGCGGAAAGGCACUGAUGU 1280 usgsugcgGfaAfAfGfgcacugauguL96 2376 sense 21 ACAUCAGUGCCUUUCCGCACACC 1281 asCfsaucAfgUfGfccuuUfcCfgcacascsc 2377 antisense 23 AAUUGUAAGCUCAGGUUCAAA 1282 asasuuguAfaGfCfUfcagguucaaaL96 2378 sense 21 UUUGAACCUGAGCUUACAAUUUA 1283 usUfsugaAfcCfUfgagcUfuAfcaauususa 2379 antisense 23 AUUGUAAGCUCAGGUUCAAAG 1284 asusuguaAfgCfUfCfagguucaaagL96 2380 sense 21 CUUUGAACCUGAGCUUACAAUUU 1285 csUfsuugAfaCfCfugagCfuUfacaaususu 2381 antisense 23 CUUAAAUUGUAAGCUCAGGUU 1286 csusuaaaUfuGfUfAfagcucagguuL96 2382 sense 21 AACCUGAGCUUACAAUUUAAGAA 1287 asAfsccuGfaGfCfuuacAfaUfuuaagsasa 2383 antisense 23 UCUUAAAUUGUAAGCUCAGGU 1288 uscsuuaaAfuUfGfUfaagcucagguL96 2384 sense 21 AC CUGAGCUUACAAUUUAAGAAC 1289 asCfscugAfgCfUfuacaAfuUfuaagasasc 2385 antisense 23 GCAAACACUAAGGUGAAAAGA 1290 gscsaaacAfcUfAfAfggugaaaagaL96 2386 sense 21 UCUUUUCACCUUAGUGUUUGCUA 1291 usCfsuuuUfcAfCfcuuaGfuGfuuugcsusa 2387 antisense 23 CAAACACUAAGGUGAAAAGAU 1292 csasaacaCfuAfAfGfgugaaaagauL96 2388 sense 21 AUCUUUUCACCUUAGUGUUUGCU 1293 asUfscuuUfuCfAfccuuAfgUfguuugscsu 2389 antisense 23 GGUAGCAAACACUAAGGUGAA 1294 gsgsuagcAfaAfCfAfcuaaggugaaL96 2390 sense 21 UUCACCUUAGUGUUUGCUACCUC 1295 usUfscacCfuUfAfguguUfuGfcuaccsusc 2391 antisense 23 AGGUAGCAAACACUAAGGUGA 1296 asgsguagCfaAfAfCfacuaaggugaL96 2392 sense 21 UCACCUUAGUGUUUGCUACCUCC 1297 usCfsaccUfuAfGfuguuUfgCfuaccuscsc 2393 antisense 23 AGGUAGCAAACACUAAGGUGA 1298 asgsguagCfaAfAfCfacuaaggugaL96 2394 sense 21 UCACCUUAGUGUUUGCUACCUCC 1299 usCfsaccUfuAfGfuguuUfgCfuaccuscsc 2395 antisense 23 GGUAGCAAACACUAAGGUGAA 1300 gsgsuagcAfaAfCfAfcuaaggugaaL96 2396 sense 21 UUCACCUUAGUGUUUGCUACCUC 1301 usUfscacCfuUfAfguguUfuGfcuaccsusc 2397 antisense 23 UUGGAGGUAGCAAACACUAAG 1302 ususggagGfuAfGfCfaaacacuaagL96 2398 sense 21 CUUAGUGUUUGCUACCUCCAAUU 1303 csUfsuagUfgUfUfugcuAfcCfuccaasusu 2399 antisense 23 AUUGGAGGUAGCAAACACUAA 1304 asusuggaGfgUfAfGfcaaacacuaaL96 2400 sense 21 UUAGUGUUUGCUACCUCCAAUUU 1305 usUfsaguGfuUfUfgcuaCfcUfccaaususu 2401 antisense 23 UAAAGUGCUGUAUCCUUUAGU 1306 usasaaguGfcUfGfUfauccuuuaguL96 2402 sense 21 ACUAAAGGAUACAGCACUUUAGC 1307 asCfsuaaAfgGfAfuacaGfcAfcuuuasgsc 2403 antisense 23 AAAGUGCUGUAUCCUUUAGUA 1308 asasagugCfuGfUfAfuccuuuaguaL96 2404 sense 21 UACUAAAGGAUACAGCACUUUAG 1309 usAfscuaAfaGfGfauacAfgCfacuuusasg 2405 antisense 23 AGGCUAAAGUGCUGUAUCCUU 1310 asgsgcuaAfaGfUfGfcuguauccuuL96 2406 sense 21 AAGGAUACAGCACUUUAGCCUGC 1311 asAfsggaUfaCfAfgcacUfuUfagccusgsc 2407 antisense 23 CAGGCUAAAGUGCUGUAUCCU 1312 csasggcuAfaAfGfUfgcuguauccuL96 2408 sense 21 AGGAUACAGCACUUUAGCCUGCC 1313 asGfsgauAfcAfGfcacuUfuAfgccugscsc 2409 antisense 23 AAGACAUUGGUGAGGAAAAAU 1314 asasgacaUfuGfGfUfgaggaaaaauL96 2410 sense 21 AUUUUUCCUCACCAAUGUCUUGU 1315 asUfsuuuUfcCfUfcaccAfaUfgucuusgsu 2411 antisense 23 AGACAUUGGUGAGGAAAAAUC 1316 asgsacauUfgGfUfGfaggaaaaaucL96 2412 sense 21 GAUUUUUCCUCACCAAUGUCUUG 1317 gsAfsuuuUfuCfCfucacCfaAfugucususg 2413 antisense 23 CGACAAGACAUUGGUGAGGAA 1318 csgsacaaGfaCfAfUfuggugaggaaL96 2414 sense 21 UUCCUCACCAAUGUCUUGUCGAU 1319 usUfsccuCfaCfCfaaugUfcUfugucgsasu 2415 antisense 23 UCGACAAGACAUUGGUGAGGA 1320 uscsgacaAfgAfCfAfuuggugaggaL96 2416 sense 21 UCCUCACCAAUGUCUUGUCGAUG 1321 usCfscucAfcCfAfauguCfuUfgucgasusg 2417 antisense 23 AAGAUGUCCUCGAGAUACUAA 1322 asasgaugUfcCfUfCfgagauacuaaL96 2418 sense 21 UUAGUAUCUCGAGGACAUCUUGA 1323 usUfsaguAfuCfUfcgagGfaCfaucuusgsa 2419 antisense 23 AGAUGUCCUCGAGAUACUAAA 1324 asgsauguCfcUfCfGfagauacuaaaL96 2420 sense 21 UUUAGUAUCUCGAGGACAUCUUG 1325 usUfsuagUfaUfCfucgaGfgAfcaucususg 2421 antisense 23 GUUCAAGAUGUCCUCGAGAUA 1326 gsusucaaGfaUfGfUfccucgagauaL96 2422 sense 21 UAUCUCGAGGACAUCUUGAACAC 1327 usAfsucuCfgAfGfgacaUfcUfugaacsasc 2423 antisense 23 UGUUCAAGAUGUCCUCGAGAU 1328 usgsuucaAfgAfUfGfuccucgagauL96 2424 sense 21 AUCUCGAGGACAUCUUGAACACC 1329 asUfscucGfaGfGfacauCfuUfgaacascsc 2425 antisense 23 GAGAAAGGUGUUCAAGAUGUC 1330 gsasgaaaGfgUfGfUfucaagaugucL96 2426 sense 21 GACAUCUUGAACACCUUUCUCCC 1331 gsAfscauCfuUfGfaacaCfcUfuucucscsc 2427 antisense 23 AGAAAGGUGUUCAAGAUGUCC 1332 asgsaaagGfuGfUfUfcaagauguccL96 2428 sense 21 GGACAUCUUGAACACCUUUCUCC 1333 gsGfsacaUfcUfUfgaacAfcCfuuucuscsc 2429 antisense 23 GGGGGAGAAAGGUGUUCAAGA 1334 gsgsgggaGfaAfAfGfguguucaagaL96 2430 sense 21 UCUUGAACACCUUUCUCCCCCUG 1335 usCfsuugAfaCfAfccuuUfcUfcccccsusg 2431 antisense 23 AGGGGGAGAAAGGUGUUCAAG 1336 asgsggggAfgAfAfAfgguguucaagL96 2432 sense 21 CUUGAACACCUUUCUCCCCCUGG 1337 csUfsugaAfcAfCfcuuuCfuCfccccusgsg 2433 antisense 23 GCUGGGAAGAUAUCAAAUGGC 1338 gscsugggAfaGfAfUfaucaaauggcL96 2434 sense 21 GCCAUUUGAUAUCUUCCCAGCUG 1339 gsCfscauUfuGfAfuaucUfuCfccagcsusg 2435 antisense 23 CUGGGAAGAUAUCAAAUGGCU 1340 csusgggaAfgAfUfAfucaaauggcuL96 2436 sense 21 AGCCAUUUGAUAUCUUCCCAGCU 1341 asGfsccaUfuUfGfauauCfuUfcccagscsu 2437 antisense 23 AUCAGCUGGGAAGAUAUCAAA 1342 asuscagcUfgGfGfAfagauaucaaaL96 2438 sense 21 UUUGAUAUCUUCCCAGCUGAUAG 1343 usUfsugaUfaUfCfuuccCfaGfcugausasg 2439 antisense 23 UAUCAGCUGGGAAGAUAUCAA 1344 usasucagCfuGfGfGfaagauaucaaL96 2440 sense 21 UUGAUAUCUUCCCAGCUGAUAGA 1345 usUfsgauAfuCfUfucccAfgCfugauasgsa 2441 antisense 23 UCUGUCGACUUCUGUUUUAGG 1346 uscsugucGfaCfUfUfcuguuuuaggL96 2442 sense 21 CCUAAAACAGAAGUCGACAGAUC 1347 csCfsuaaAfaCfAfgaagUfcGfacagasusc 2443 antisense 23 CUGUCGACUUCUGUUUUAGGA 1348 csusgucgAfcUfUfCfuguuuuaggaL96 2444 sense 21 UCCUAAAACAGAAGUCGACAGAU 1349 usCfscuaAfaAfCfagaaGfuCfgacagsasu 2445 antisense 23 CAGAUCUGUCGACUUCUGUUU 1350 csasgaucUfgUfCfGfacuucuguuuL96 2446 sense 21 AAACAGAAGUCGACAGAUCUGUU 1351 asAfsacaGfaAfGfucgaCfaGfaucugsusu 2447 antisense 23 ACAGAUCUGUCGACUUCUGUU 1352 ascsagauCfuGfUfCfgacuucuguuL96 2448 sense 21 AACAGAAGUCGACAGAUCUGUUU 1353 asAfscagAfaGfUfcgacAfgAfucugususu 2449 antisense 23 UACUUCUUUGAAUGUAGAUUU 1354 usascuucUfuUfGfAfauguagauuuL96 2450 sense 21 AAAUCUACAUUCAAAGAAGUAUC 1355 asAfsaucUfaCfAfuucaAfaGfaaguasusc 2451 antisense 23 ACUUCUUUGAAUGUAGAUUUC 1356 ascsuucuUfuGfAfAfuguagauuucL96 2452 sense 21 GAAAUCUACAUUCAAAGAAGUAU 1357 gsAfsaauCfuAfCfauucAfaAfgaagusasu 2453 antisense 23 GUGAUACUUCUUUGAAUGUAG 1358 gsusgauaCfuUfCfUfuugaauguagL96 2454 sense 21 CUACAUUCAAAGAAGUAUCACCA 1359 csUfsacaUfuCfAfaagaAfgUfaucacscsa 2455 antisense 23 GGUGAUACUUCUUUGAAUGUA 1360 gsgsugauAfcUfUfCfuuugaauguaL96 2456 sense 21 UACAUUCAAAGAAGUAUCACCAA 1361 usAfscauUfcAfAfagaaGfuAfucaccsasa 2457 antisense 23 UGGGAAGAUAUCAAAUGGCUG 1362 usgsggaaGfaUfAfUfcaaauggcugL96 2458 sense 21 CAGCCAUUUGAUAUCUUCCCAGC 1363 csAfsgccAfuUfUfgauaUfcUfucccasgsc 2459 antisense 23 GGGAAGAUAUCAAAUGGCUGA 1364 gsgsgaagAfuAfUfCfaaauggcugaL96 2460 sense 21 UCAGCCAUUUGAUAUCUUCCCAG 1365 usCfsagcCfaUfUfugauAfuCfuucccsasg 2461 antisense 23 CAGCUGGGAAGAUAUCAAAUG 1366 csasgcugGfgAfAfGfauaucaaaugL96 2462 sense 21 CAUUUGAUAUCUUCCCAGCUGAU 1367 csAfsuuuGfaUfAfucuuCfcCfagcugsasu 2463 antisense 23 UCAGCUGGGAAGAUAUCAAAU 1368 uscsagcuGfgGfAfAfgauaucaaauL96 2464 sense 21 AUUUGAUAUCUUCCCAGCUGAUA 1369 asUfsuugAfuAfUfcuucCfcAfgcugasusa 2465 antisense 23 UCCAAAGUCUAUAUAUGACUA 1370 uscscaaaGfuCfUfAfuauaugacuaL96 2466 sense 21 UAGUCAUAUAUAGACUUUGGAAG 1371 usAfsgucAfuAfUfauagAfcUfuuggasasg 2467 antisense 23 CCAAAGUCUAUAUAUGACUAU 1372 cscsaaagUfcUfAfUfauaugacuauL96 2468 sense 21 AUAGUCAUAUAUAGACUUUGGAA 1373 asUfsaguCfaUfAfuauaGfaCfuuuggsasa 2469 antisense 23 UACUUCCAAAGUCUAUAUAUG 1374 usascuucCfaAfAfGfucuauauaugL96 2470 sense 21 CAUAUAUAGACUUUGGAAGUACU 1375 csAfsuauAfuAfGfacuuUfgGfaaguascsu 2471 antisense 23 GUACUUCCAAAGUCUAUAUAU 1376 gsusacuuCfcAfAfAfgucuauauauL96 2472 sense 21 AUAUAUAGACUUUGGAAGUACUG 1377 asUfsauaUfaGfAfcuuuGfgAfaguacsusg 2473 antisense 23 UUAUGAACAACAUGCUAAAUC 1378 ususaugaAfcAfAfCfaugcuaaaucL96 2474 sense 21 GAUUUAGCAUGUUGUUCAUAAUC 1379 gsAfsuuuAfgCfAfuguuGfuUfcauaasusc 2475 antisense 23 UAUGAACAACAUGCUAAAUCA 1380 usasugaaCfaAfCfAfugcuaaaucaL96 2476 sense 21 UGAUUUAGCAUGUUGUUCAUAAU 1381 usGfsauuUfaGfCfauguUfgUfucauasasu 2477 antisense 23 AUGAUUAUGAACAACAUGCUA 1382 asusgauuAfuGfAfAfcaacaugcuaL96 2478 sense 21 UAGCAUGUUGUUCAUAAUCAUUG 1383 usAfsgcaUfgUfUfguucAfuAfaucaususg 2479 antisense 23 AAUGAUUAUGAACAACAUGCU 1384 asasugauUfaUfGfAfacaacaugcuL96 2480 sense 21 AGCAUGUUGUUCAUAAUCAUUGA 1385 asGfscauGfuUfGfuucaUfaAfucauusgsa 2481 antisense 23 AAUUCCCCACUUCAAUACAAA 1386 asasuuccCfcAfCfUfucaauacaaaL96 2482 sense 21 UUUGUAUUGAAGUGGGGAAUUAC 1387 usUfsuguAfuUfGfaaguGfgGfgaauusasc 2483 antisense 23 AUUCCCCACUUCAAUACAAAG 1388 asusucccCfaCfUfUfcaauacaaagL96 2484 sense 21 CUUUGUAUUGAAGUGGGGAAUUA 1389 csUfsuugUfaUfUfgaagUfgGfggaaususa 2485 antisense 23 CUGUAAUUCCCCACUUCAAUA 1390 csusguaaUfuCfCfCfcacuucaauaL96 2486 sense 21 UAUUGAAGUGGGGAAUUACAGAC 1391 usAfsuugAfaGfUfggggAfaUfuacagsasc 2487 antisense 23 UCUGUAAUUCCCCACUUCAAU 1392 uscsuguaAfuUfCfCfccacuucaauL96 2488 sense 21 AUUGAAGUGGGGAAUUACAGACU 1393 asUfsugaAfgUfGfgggaAfuUfacagascsu 2489 antisense 23 UGAUGUGCGUAACAGAUUCAA 1394 usgsauguGfcGfUfAfacagauucaaL96 2490 sense 21 UUGAAUCUGUUACGCACAUCAUC 1395 usUfsgaaUfcUfGfuuacGfcAfcaucasusc 2491 antisense 23 GAUGUGCGUAACAGAUUCAAA 1396 gsasugugCfgUfAfAfcagauucaaaL96 2492 sense 21 UUUGAAUCUGUUACGCACAUCAU 1397 usUfsugaAfuCfUfguuaCfgCfacaucsasu 2493 antisense 23 UGGAUGAUGUGCGUAACAGAU 1398 usgsgaugAfuGfUfGfcguaacagauL96 2494 sense 21 AUCUGUUACGCACAUCAUCCAGA 1399 asUfscugUfuAfCfgcacAfuCfauccasgsa 2495 antisense 23 CUGGAUGAUGUGCGUAACAGA 1400 csusggauGfaUfGfUfgcguaacagaL96 2496 sense 21 UCUGUUACGCACAUCAUCCAGAC 1401 usCfsuguUfaCfGfcacaUfcAfuccagsasc 2497 antisense 23 GAAUGGGUGGCGGUAAUUGGU 1402 gsasauggGfuGfGfCfgguaauugguL96 2498 sense 21 ACCAAUUACCGCCACCCAUUCCA 1403 asCfscaaUfuAfCfcgccAfcCfcauucscsa 2499 antisense 23 AAUGGGUGGCGGUAAUUGGUG 1404 asasugggUfgGfCfGfguaauuggugL96 2500 sense 21 CACCAAUUACCGCCACCCAUUCC 1405 csAfsccaAfuUfAfccgcCfaCfccauuscsc 2501 antisense 23 AUUGGAAUGGGUGGCGGUAAU 1406 asusuggaAfuGfGfGfuggcgguaauL96 2502 sense 21 AUUACCGCCACCCAUUCCAAUUC 1407 asUfsuacCfgCfCfacccAfuUfccaaususc 2503 antisense 23 AAUUGGAAUGGGUGGCGGUAA 1408 asasuuggAfaUfGfGfguggcgguaaL96 2504 sense 21 UUACCGCCACCCAUUCCAAUUCU 1409 usUfsaccGfcCfAfcccaUfuCfcaauuscsu 2505 antisense 23 UCCGGAAUGUUGCUGAAACAG 1410 uscscggaAfuGfUfUfgcugaaacagL96 2506 sense 21 CUGUUUCAGCAACAUUCCGGAGC 1411 csUfsguuUfcAfGfcaacAfuUfccggasgsc 2507 antisense 23 CCGGAAUGUUGCUGAAACAGA 1412 cscsggaaUfgUfUfGfcugaaacagaL96 2508 sense 21 UCUGUUUCAGCAACAUUCCGGAG 1413 usCfsuguUfuCfAfgcaaCfaUfuccggsasg 2509 antisense 23 AUGCUCCGGAAUGUUGCUGAA 1414 asusgcucCfgGfAfAfuguugcugaaL96 2510 sense 21 UUCAGCAACAUUCCGGAGCAUCC 1415 usUfscagCfaAfCfauucCfgGfagcauscsc 2511 antisense 23 GAUGCUCCGGAAUGUUGCUGA 1416 gsasugcuCfcGfGfAfauguugcugaL96 2512 sense 21 UCAGCAACAUUCCGGAGCAUCCU 1417 usCfsagcAfaCfAfuuccGfgAfgcaucscsu 2513 antisense 23 UGUCCUCGAGAUACUAAAGGA 1418 usgsuccuCfgAfGfAfuacuaaaggaL96 2514 sense 21 UCCUUUAGUAUCUCGAGGACAUC 1419 usCfscuuUfaGfUfaucuCfgAfggacasusc 2515 antisense 23 GUCCUCGAGAUACUAAAGGAA 1420 gsusccucGfaGfAfUfacuaaaggaaL96 2516 sense 21 UUCCUUUAGUAUCUCGAGGACAU 1421 usUfsccuUfuAfGfuaucUfcGfaggacsasu 2517 antisense 23 AAGAUGUCCUCGAGAUACUAA 1422 asasgaugUfcCfUfCfgagauacuaaL96 2518 sense 21 UUAGUAUCUCGAGGACAUCUUGA 1423 usUfsaguAfuCfUfcgagGfaCfaucuusgsa 2519 antisense 23 CAAGAUGUCCUCGAGAUACUA 1424 csasagauGfuCfCfUfcgagauacuaL96 2520 sense 21 UAGUAUCUCGAGGACAUCUUGAA 1425 usAfsguaUfcUfCfgaggAfcAfucuugsasa 2521 antisense 23 ACAACAUGCUAAAUCAGUACU 1426 ascsaacaUfgCfUfAfaaucaguacuL96 2522 sense 21 AGUACUGAUUUAGCAUGUUGUUC 1427 asGfsuacUfgAfUfuuagCfaUfguugususc 2523 antisense 23 CAACAUGCUAAAUCAGUACUU 1428 csasacauGfcUfAfAfaucaguacuuL96 2524 sense 21 AAGUACUGAUUUAGCAUGUUGUU 1429 asAfsguaCfuGfAfuuuaGfcAfuguugsusu 2525 antisense 23 AUGAACAACAUGCUAAAUCAG 1430 asusgaacAfaCfAfUfgcuaaaucagL96 2526 sense 21 CUGAUUUAGCAUGUUGUUCAUAA 1431 csUfsgauUfuAfGfcaugUfuGfuucausasa 2527 antisense 23 UAUGAACAACAUGCUAAAUCA 1432 usasugaaCfaAfCfAfugcuaaaucaL96 2528 sense 21 UGAUUUAGCAUGUUGUUCAUAAU 1433 usGfsauuUfaGfCfauguUfgUfucauasasu 2529 antisense 23 GCCAAGGCUGUGUUUGUGGGG 1434 gscscaagGfcUfGfUfguuuguggggL96 2530 sense 21 CCCCACAAACACAGCCUUGGCGC 1435 csCfsccaCfaAfAfcacaGfcCfuuggcsgsc 2531 antisense 23 CCAAGGCUGUGUUUGUGGGGA 1436 cscsaaggCfuGfUfGfuuuguggggaL96 2532 sense 21 UCCCCACAAACACAGCCUUGGCG 1437 usCfscccAfcAfAfacacAfgCfcuuggscsg 2533 antisense 23 UGGCGCCAAGGCUGUGUUUGU 1438 usgsgcgcCfaAfGfGfcuguguuuguL96 2534 sense 21 ACAAACACAGCCUUGGCGCCAAG 1439 asCfsaaaCfaCfAfgccuUfgGfcgccasasg 2535 antisense 23 UUGGCGCCAAGGCUGUGUUUG 1440 ususggcgCfcAfAfGfgcuguguuugL96 2536 sense 21 CAAACACAGCCUUGGCGCCAAGA 1441 csAfsaacAfcAfGfccuuGfgCfgccaasgsa 2537 antisense 23 UGAAAGCUCUGGCUCUUGGCG 1442 usgsaaagCfuCfUfGfgcucuuggcgL96 2538 sense 21 CGCCAAGAGCCAGAGCUUUCAGA 1443 csGfsccaAfgAfGfccagAfgCfuuucasgsa 2539 antisense 23 GAAAGCUCUGGCUCUUGGCGC 1444 gsasaagcUfcUfGfGfcucuuggcgcL96 2540 sense 21 GCGCCAAGAGCCAGAGCUUUCAG 1445 gsCfsgccAfaGfAfgccaGfaGfcuuucsasg 2541 antisense 23 GUUCUGAAAGCUCUGGCUCUU 1446 gsusucugAfaAfGfCfucuggcucuuL96 2542 sense 21 AAGAGCCAGAGCUUUCAGAACAU 1447 asAfsgagCfcAfGfagcuUfuCfagaacsasu 2543 antisense 23 UGUUCUGAAAGCUCUGGCUCU 1448 usgsuucuGfaAfAfGfcucuggcucuL96 2544 sense 21 AGAGCCAGAGCUUUCAGAACAUC 1449 asGfsagcCfaGfAfgcuuUfcAfgaacasusc 2545 antisense 23 CAGCCACUAUUGAUGUUCUGC 1450 csasgccaCfuAfUfUfgauguucugcL96 2546 sense 21 GCAGAACAUCAAUAGUGGCUGGC 1451 gsCfsagaAfcAfUfcaauAfgUfggcugsgsc 2547 antisense 23 AGCCACUAUUGAUGUUCUGCC 1452 asgsccacUfaUfUfGfauguucugccL96 2548 sense 21 GGCAGAACAUCAAUAGUGGCUGG 1453 gsGfscagAfaCfAfucaaUfaGfuggcusgsg 2549 antisense 23 GUGCCAGCCACUAUUGAUGUU 1454 gsusgccaGfcCfAfCfuauugauguuL96 2550 sense 21 AACAUCAAUAGUGGCUGGCACCC 1455 asAfscauCfaAfUfagugGfcUfggcacscsc 2551 antisense 23 GGUGCCAGCCACUAUUGAUGU 1456 gsgsugccAfgCfCfAfcuauugauguL96 2552 sense 21 ACAUCAAUAGUGGCUGGCACCCC 1457 asCfsaucAfaUfAfguggCfuGfgcaccscsc 2553 antisense 23 ACAAGGACCGAGAAGUCACCA 1458 ascsaaggAfcCfGfAfgaagucaccaL96 2554 sense 21 UGGUGACUUCUCGGUCCUUGUAG 1459 usGfsgugAfcUfUfcucgGfuCfcuugusasg 2555 antisense 23 CAAGGACCGAGAAGUCACCAA 1460 csasaggaCfcGfAfGfaagucaccaaL96 2556 sense 21 UUGGUGACUUCUCGGUCCUUGUA 1461 usUfsgguGfaCfUfucucGfgUfccuugsusa 2557 antisense 23 AUCUACAAGGACCGAGAAGUC 1462 asuscuacAfaGfGfAfccgagaagucL96 2558 sense 21 GACUUCUCGGUCCUUGUAGAUAU 1463 gsAfscuuCfuCfGfguccUfuGfuagausasu 2559 antisense 23 UAUCUACAAGGACCGAGAAGU 1464 usasucuaCfaAfGfGfaccgagaaguL96 2560 sense 21 ACUUCUCGGUCCUUGUAGAUAUA 1465 asCfsuucUfcGfGfuccuUfgUfagauasusa 2561 antisense 23 CAGAAUGUGAAAGUCAUCGAC 1466 csasgaauGfuGfAfAfagucaucgacL96 2562 sense 21 GUCGAUGACUUUCACAUUCUGGC 1467 gsUfscgaUfgAfCfuuucAfcAfuucugsgsc 2563 antisense 23 AGAAUGUGAAAGUCAUCGACA 1468 asgsaaugUfgAfAfAfgucaucgacaL96 2564 sense 21 UGUCGAUGACUUUCACAUUCUGG 1469 usGfsucgAfuGfAfcuuuCfaCfauucusgsg 2565 antisense 23 GUGCCAGAAUGUGAAAGUCAU 1470 gsusgccaGfaAfUfGfugaaagucauL96 2566 sense 21 AUGACUUUCACAUUCUGGCACCC 1471 asUfsgacUfuUfCfacauUfcUfggcacscsc 2567 antisense 23 GGUGCCAGAAUGUGAAAGUCA 1472 gsgsugccAfgAfAfUfgugaaagucaL96 2568 sense 21 UGACUUUCACAUUCUGGCACCCA 1473 usGfsacuUfuCfAfcauuCfuGfgcaccscsa 2569 antisense 23 AGAUGUCCUCGAGAUACUAAA 1474 asgsauguCfcUfCfGfagauacuaaaL96 2570 sense 21 UUUAGUAUCUCGAGGACAUCUUG 1475 usUfsuagUfaUfCfucgaGfgAfcaucususg 2571 antisense 23 GAUGUCCUCGAGAUACUAAAG 1476 gsasugucCfuCfGfAfgauacuaaagL96 2572 sense 21 CUUUAGUAUCUCGAGGACAUCUU 1477 csUfsuuaGfuAfUfcucgAfgGfacaucsusu 2573 antisense 23 UUCAAGAUGUCCUCGAGAUAC 1478 ususcaagAfuGfUfCfcucgagauacL96 2574 sense 21 GUAUCUCGAGGACAUCUUGAACA 1479 gsUfsaucUfcGfAfggacAfuCfuugaascsa 2575 antisense 23 GUUCAAGAUGUCCUCGAGAUA 1480 gsusucaaGfaUfGfUfccucgagauaL96 2576 sense 21 UAUCUCGAGGACAUCUUGAACAC 1481 usAfsucuCfgAfGfgacaUfcUfugaacsasc 2577 antisense 23 GUGGACUUGCUGCAUAUGUGG 1482 gsusggacUfuGfCfUfgcauauguggL96 2578 sense 21 CCACAUAUGCAGCAAGUCCACUG 1483 csCfsacaUfaUfGfcagcAfaGfuccacsusg 2579 antisense 23 UGGACUUGCUGCAUAUGUGGC 1484 usgsgacuUfgCfUfGfcauauguggcL96 2580 sense 21 GCCACAUAUGCAGCAAGUCCACU 1485 gsCfscacAfuAfUfgcagCfaAfguccascsu 2581 antisense 23 GACAGUGGACUUGCUGCAUAU 1486 gsascaguGfgAfCfUfugcugcauauL96 2582 sense 21 AUAUGCAGCAAGUCCACUGUCGU 1487 asUfsaugCfaGfCfaaguCfcAfcugucsgsu 2583 antisense 23 CGACAGUGGACUUGCUGCAUA 1488 csgsacagUfgGfAfCfuugcugcauaL96 2584 sense 21 UAUGCAGCAAGUCCACUGUCGUC 1489 usAfsugcAfgCfAfagucCfaCfugucgsusc 2585 antisense 23 AACCAGUACUUUAUCAUUUUC 1490 asasccagUfaCfUfUfuaucauuuucL96 2586 sense 21 GAAAAUGAUAAAGUACUGGUUUC 1491 gsAfsaaaUfgAfUfaaagUfaCfugguususc 2587 antisense 23 ACCAGUACUUUAUCAUUUUCU 1492 ascscaguAfcUfUfUfaucauuuucuL96 2588 sense 21 AGAAAAUGAUAAAGUACUGGUUU 1493 asGfsaaaAfuGfAfuaaaGfuAfcuggususu 2589 antisense 23 UUGAAACCAGUACUUUAUCAU 1494 ususgaaaCfcAfGfUfacuuuaucauL96 2590 sense 21 AUGAUAAAGUACUGGUUUCAAAA 1495 asUfsgauAfaAfGfuacuGfgUfuucaasasa 2591 antisense 23 UUUGAAACCAGUACUUUAUCA 1496 ususugaaAfcCfAfGfuacuuuaucaL96 2592 sense 21 UGAUAAAGUACUGGUUUCAAAAU 1497 usGfsauaAfaGfUfacugGfuUfucaaasasu 2593 antisense 23 CGAGAAGUCACCAAGAAGCUA 1498 csgsagaaGfuCfAfCfcaagaagcuaL96 2594 sense 21 UAGCUUCUUGGUGACUUCUCGGU 1499 usAfsgcuUfcUfUfggugAfcUfucucgsgsu 2595 antisense 23 GAGAAGUCACCAAGAAGCUAG 1500 gsasgaagUfcAfCfCfaagaagcuagL96 2596 sense 21 CUAGCUUCUUGGUGACUUCUCGG 1501 csUfsagcUfuCfUfugguGfaCfuucucsgsg 2597 antisense 23 GGACCGAGAAGUCACCAAGAA 1502 gsgsaccgAfgAfAfGfucaccaagaaL96 2598 sense 21 UUCUUGGUGACUUCUCGGUCCUU 1503 usUfscuuGfgUfGfacuuCfuCfgguccsusu 2599 antisense 23 AGGACCGAGAAGUCACCAAGA 1504 asgsgaccGfaGfAfAfgucaccaagaL96 2600 sense 21 UCUUGGUGACUUCUCGGUCCUUG 1505 usCfsuugGfuGfAfcuucUfcGfguccususg 2601 antisense 23 UCAAAGUGUUGGUAAUGCCUG 1506 uscsaaagUfgUfUfGfguaaugccugL96 2602 sense 21 CAGGCAUUACCAACACUUUGAAC 1507 csAfsggcAfuUfAfccaaCfaCfuuugasasc 2603 antisense 23 CAAAGUGUUGGUAAUGCCUGA 1508 csasaaguGfuUfGfGfuaaugccugaL96 2604 sense 21 UCAGGCAUUACCAACACUUUGAA 1509 usCfsaggCfaUfUfaccaAfcAfcuuugsasa 2605 antisense 23 AGGUUCAAAGUGUUGGUAAUG 1510 asgsguucAfaAfGfUfguugguaaugL96 2606 sense 21 CAUUACCAACACUUUGAACCUGA 1511 csAfsuuaCfcAfAfcacuUfuGfaaccusgsa 2607 antisense 23 CAGGUUCAAAGUGUUGGUAAU 1512 csasgguuCfaAfAfGfuguugguaauL96 2608 sense 21 AUUACCAACACUUUGAACCUGAG 1513 asUfsuacCfaAfCfacuuUfgAfaccugsasg 2609 antisense 23 UAUUACUUGACAAAGAGACAC 1514 usasuuacUfuGfAfCfaaagagacacL96 2610 sense 21 GUGUCUCUUUGUCAAGUAAUACA 1515 gsUfsgucUfcUfUfugucAfaGfuaauascsa 2611 antisense 23 AUUACUUGACAAAGAGACACU 1516 asusuacuUfgAfCfAfaagagacacuL96 2612 sense 21 AGUGUCUCUUUGUCAAGUAAUAC 1517 asGfsuguCfuCfUfuuguCfaAfguaausasc 2613 antisense 23 CAUGUAUUACUUGACAAAGAG 1518 csasuguaUfuAfCfUfugacaaagagL96 2614 sense 21 CUCUUUGUCAAGUAAUACAUGCU 1519 csUfscuuUfgUfCfaaguAfaUfacaugscsu 2615 antisense 23 GCAUGUAUUACUUGACAAAGA 1520 gscsauguAfuUfAfCfuugacaaagaL96 2616 sense 21 UCUUUGUCAAGUAAUACAUGCUG 1521 usCfsuuuGfuCfAfaguaAfuAfcaugcsusg 2617 antisense 23 AAAGUCAUCGACAAGACAUUG 1522 asasagucAfuCfGfAfcaagacauugL96 2618 sense 21 CAAUGUCUUGUCGAUGACUUUCA 1523 csAfsaugUfcUfUfgucgAfuGfacuuuscsa 2619 antisense 23 AAGUCAUCGACAAGACAUUGG 1524 asasgucaUfcGfAfCfaagacauuggL96 2620 sense 21 CCAAUGUCUUGUCGAUGACUUUC 1525 csCfsaauGfuCfUfugucGfaUfgacuususc 2621 antisense 23 UGUGAAAGUCAUCGACAAGAC 1526 usgsugaaAfgUfCfAfucgacaagacL96 2622 sense 21 GUCUUGUCGAUGACUUUCACAUU 1527 gsUfscuuGfuCfGfaugaCfuUfucacasusu 2623 antisense 23 AUGUGAAAGUCAUCGACAAGA 1528 asusgugaAfaGfUfCfaucgacaagaL96 2624 sense 21 UCUUGUCGAUGACUUUCACAUUC 1529 usCfsuugUfcGfAfugacUfuUfcacaususc 2625 antisense 23 AUAUGUGGCUAAAGCAAUAGA 1530 asusauguGfgCfUfAfaagcaauagaL96 2626 sense 21 UCUAUUGCUUUAGCCACAUAUGC 1531 usCfsuauUfgCfUfuuagCfcAfcauausgsc 2627 antisense 23 UAUGUGGCUAAAGCAAUAGAC 1532 usasugugGfcUfAfAfagcaauagacL96 2628 sense 21 GUCUAUUGCUUUAGCCACAUAUG 1533 gsUfscuaUfuGfCfuuuaGfcCfacauasusg 2629 antisense 23 CUGCAUAUGUGGCUAAAGCAA 1534 csusgcauAfuGfUfGfgcuaaagcaaL96 2630 sense 21 UUGCUUUAGCCACAUAUGCAGCA 1535 usUfsgcuUfuAfGfccacAfuAfugcagscsa 2631 antisense 23 GCUGCAUAUGUGGCUAAAGCA 1536 gscsugcaUfaUfGfUfggcuaaagcaL96 2632 sense 21 UGCUUUAGCCACAUAUGCAGCAA 1537 usGfscuuUfaGfCfcacaUfaUfgcagcsasa 2633 antisense 23 AGACGACAGUGGACUUGCUGC 1538 asgsacgaCfaGfUfGfgacuugcugcL96 2634 sense 21 GCAGCAAGUCCACUGUCGUCUCC 1539 gsCfsagcAfaGfUfccacUfgUfcgucuscsc 2635 antisense 23 GACGACAGUGGACUUGCUGCA 1540 gsascgacAfgUfGfGfacuugcugcaL96 2636 sense 21 UGCAGCAAGUCCACUGUCGUCUC 1541 usGfscagCfaAfGfuccaCfuGfucgucsusc 2637 antisense 23 UUGGAGACGACAGUGGACUUG 1542 ususggagAfcGfAfCfaguggacuugL96 2638 sense 21 CAAGUCCACUGUCGUCUCCAAAA 1543 csAfsaguCfcAfCfugucGfuCfuccaasasa 2639 antisense 23 UUUGGAGACGACAGUGGACUU 1544 ususuggaGfaCfGfAfcaguggacuuL96 2640 sense 21 AAGUCCACUGUCGUCUCCAAAAU 1545 asAfsgucCfaCfUfgucgUfcUfccaaasasu 2641 antisense 23 GGCCACCUCCUCAAUUGAAGA 1546 gsgsccacCfuCfCfUfcaauugaagaL96 2642 sense 21 UCUUCAAUUGAGGAGGUGGCCCA 1547 usCfsuucAfaUfUfgaggAfgGfuggccscsa 2643 antisense 23 GCCACCUCCUCAAUUGAAGAA 1548 gscscaccUfcCfUfCfaauugaagaaL96 2644 sense 21 UUCUUCAAUUGAGGAGGUGGCCC 1549 usUfscuuCfaAfUfugagGfaGfguggcscsc 2645 antisense 23 CCUGGGCCACCUCCUCAAUUG 1550 cscsugggCfcAfCfCfuccucaauugL96 2646 sense 21 CAAUUGAGGAGGUGGCCCAGGAA 1551 csAfsauuGfaGfGfagguGfgCfccaggsasa 2647 antisense 23 UCCUGGGCCACCUCCUCAAUU 1552 uscscuggGfcCfAfCfcuccucaauuL96 2648 sense 21 AAUUGAGGAGGUGGCCCAGGAAC 1553 asAfsuugAfgGfAfggugGfcCfcaggasasc 2649 antisense 23 UGUAUGUUACUUCUUAGAGAG 1554 usgsuaugUfuAfCfUfucuuagagagL96 2650 sense 21 CUCUCUAAGAAGUAACAUACAUC 1555 csUfscucUfaAfGfaaguAfaCfauacasusc 2651 antisense 23 GUAUGUUACUUCUUAGAGAGA 1556 gsusauguUfaCfUfUfcuuagagagaL96 2652 sense 21 UCUCUCUAAGAAGUAACAUACAU 1557 usCfsucuCfuAfAfgaagUfaAfcauacsasu 2653 antisense 23 AGGAUGUAUGUUACUUCUUAG 1558 asgsgaugUfaUfGfUfuacuucuuagL96 2654 sense 21 CUAAGAAGUAACAUACAUCCUAA 1559 csUfsaagAfaGfUfaacaUfaCfauccusasa 2655 antisense 23 UAGGAUGUAUGUUACUUCUUA 1560 usasggauGfuAfUfGfuuacuucuuaL96 2656 sense 21 UAAGAAGUAACAUACAUCCUAAA 1561 usAfsagaAfgUfAfacauAfcAfuccuasasa 2657 antisense 23 AAAUGUUUUAGGAUGUAUGUU 1562 asasauguUfuUfAfGfgauguauguuL96 2658 sense 21 AACAUACAUCCUAAAACAUUUGG 1563 asAfscauAfcAfUfccuaAfaAfcauuusgsg 2659 antisense 23 AAUGUUUUAGGAUGUAUGUUA 1564 asasuguuUfuAfGfGfauguauguuaL96 2660 sense 21 UAACAUACAUCCUAAAACAUUUG 1565 usAfsacaUfaCfAfuccuAfaAfacauususg 2661 antisense 23 AUCCAAAUGUUUUAGGAUGUA 1566 asusccaaAfuGfUfUfuuaggauguaL96 2662 sense 21 UACAUCCUAAAACAUUUGGAUAU 1567 usAfscauCfcUfAfaaacAfuUfuggausasu 2663 antisense 23 UAUCCAAAUGUUUUAGGAUGU 1568 usasuccaAfaUfGfUfuuuaggauguL96 2664 sense 21 ACAUCCUAAAACAUUUGGAUAUA 1569 asCfsaucCfuAfAfaacaUfuUfggauasusa 2665 antisense 23 AUGGGUGGCGGUAAUUGGUGA 1570 asusggguGfgCfGfGfuaauuggugaL96 2666 sense 21 UCACCAAUUACCGCCACCCAUUC 1571 usCfsaccAfaUfUfaccgCfcAfcccaususc 2667 antisense 23 UGGGUGGCGGUAAUUGGUGAU 1572 usgsggugGfcGfGfUfaauuggugauL96 2668 sense 21 AUCACCAAUUACCGCCACCCAUU 1573 asUfscacCfaAfUfuaccGfcCfacccasusu 2669 antisense 23 UGGAAUGGGUGGCGGUAAUUG 1574 usgsgaauGfgGfUfGfgcgguaauugL96 2670 sense 21 CAAUUACCGCCACCCAUUCCAAU 1575 csAfsauuAfcCfGfccacCfcAfuuccasasu 2671 antisense 23 UUGGAAUGGGUGGCGGUAAUU 1576 ususggaaUfgGfGfUfggcgguaauuL96 2672 sense 21 AAUUACCGCCACCCAUUCCAAUU 1577 asAfsuuaCfcGfCfcaccCfaUfuccaasusu 2673 antisense 23 UUCAAAGUGUUGGUAAUGCCU 1578 ususcaaaGfuGfUfUfgguaaugccuL96 2674 sense 21 AGGCAUUACCAACACUUUGAACC 1579 asGfsgcaUfuAfCfcaacAfcUfuugaascsc 2675 antisense 23 UCAAAGUGUUGGUAAUGCCUG 1580 uscsaaagUfgUfUfGfguaaugccugL96 2676 sense 21 CAGGCAUUACCAACACUUUGAAC 1581 csAfsggcAfuUfAfccaaCfaCfuuugasasc 2677 antisense 23 CAGGUUCAAAGUGUUGGUAAU 1582 csasgguuCfaAfAfGfuguugguaauL96 2678 sense 21 AUUACCAACACUUUGAACCUGAG 1583 asUfsuacCfaAfCfacuuUfgAfaccugsasg 2679 antisense 23 UCAGGUUCAAAGUGUUGGUAA 1584 uscsagguUfcAfAfAfguguugguaaL96 2680 sense 21 UUACCAACACUUUGAACCUGAGC 1585 usUfsaccAfaCfAfcuuuGfaAfccugasgsc 2681 antisense 23 CCACCUCCUCAAUUGAAGAAG 1586 cscsaccuCfcUfCfAfauugaagaagL96 2682 sense 21 CUUCUUCAAUUGAGGAGGUGGCC 1587 csUfsucuUfcAfAfuugaGfgAfgguggscsc 2683 antisense 23 CACCUCCUCAAUUGAAGAAGU 1588 csasccucCfuCfAfAfuugaagaaguL96 2684 sense 21 ACUUCUUCAAUUGAGGAGGUGGC 1589 asCfsuucUfuCfAfauugAfgGfaggugsgsc 2685 antisense 23 UGGGCCACCUCCUCAAUUGAA 1590 usgsggccAfcCfUfCfcucaauugaaL96 2686 sense 21 UUCAAUUGAGGAGGUGGCCCAGG 1591 usUfscaaUfuGfAfggagGfuGfgcccasgsg 2687 antisense 23 CUGGGCCACCUCCUCAAUUGA 1592 csusgggcCfaCfCfUfccucaauugaL96 2688 sense 21 UCAAUUGAGGAGGUGGCCCAGGA 1593 usCfsaauUfgAfGfgaggUfgGfcccagsgsa 2689 antisense 23 GAGUGGGUGCCAGAAUGUGAA 1594 gsasguggGfuGfCfCfagaaugugaaL96 2690 sense 21 UUCACAUUCUGGCACCCACUCAG 1595 usUfscacAfuUfCfuggcAfcCfcacucsasg 2691 antisense 23 AGUGGGUGCCAGAAUGUGAAA 1596 asgsugggUfgCfCfAfgaaugugaaaL96 2692 sense 21 UUUCACAUUCUGGCACCCACUCA 1597 usUfsucaCfaUfUfcuggCfaCfccacuscsa 2693 antisense 23 CUCUGAGUGGGUGCCAGAAUG 1598 csuscugaGfuGfGfGfugccagaaugL96 2694 sense 21 CAUUCUGGCACCCACUCAGAGCC 1599 csAfsuucUfgGfCfacccAfcUfcagagscsc 2695 antisense 23 GCUCUGAGUGGGUGCCAGAAU 1600 gscsucugAfgUfGfGfgugccagaauL96 2696 sense 21 AUUCUGGCACCCACUCAGAGCCA 1601 asUfsucuGfgCfAfcccaCfuCfagagcscsa 2697 antisense 23 GCACUGAUGUUCUGAAAGCUC 1602 gscsacugAfuGfUfUfcugaaagcucL96 2698 sense 21 GAGCUUUCAGAACAUCAGUGCCU 1603 gsAfsgcuUfuCfAfgaacAfuCfagugcscsu 2699 antisense 23 CACUGAUGUUCUGAAAGCUCU 1604 csascugaUfgUfUfCfugaaagcucuL96 2700 sense 21 AGAGCUUUCAGAACAUCAGUGCC 1605 asGfsagcUfuUfCfagaaCfaUfcagugscsc 2701 antisense 23 AAAGGCACUGAUGUUCUGAAA 1606 asasaggcAfcUfGfAfuguucugaaaL96 2702 sense 21 UUUCAGAACAUCAGUGCCUUUCC 1607 usUfsucaGfaAfCfaucaGfuGfccuuuscsc 2703 antisense 23 GAAAGGCACUGAUGUUCUGAA 1608 gsasaaggCfaCfUfGfauguucugaaL96 2704 sense 21 UUCAGAACAUCAGUGCCUUUCCG 1609 usUfscagAfaCfAfucagUfgCfcuuucscsg 2705 antisense 23 GGGAAGGUGGAAGUCUUCCUG 1610 gsgsgaagGfuGfGfAfagucuuccugL96 2706 sense 21 CAGGAAGACUUCCACCUUCCCUU 1611 csAfsggaAfgAfCfuuccAfcCfuucccsusu 2707 antisense 23 GGAAGGUGGAAGUCUUCCUGG 1612 gsgsaaggUfgGfAfAfgucuuccuggL96 2708 sense 21 CCAGGAAGACUUCCACCUUCCCU 1613 csCfsaggAfaGfAfcuucCfaCfcuuccscsu 2709 antisense 23 GGAAGGGAAGGUGGAAGUCUU 1614 gsgsaaggGfaAfGfGfuggaagucuuL96 2710 sense 21 AAGACUUCCACCUUCCCUUCCAC 1615 asAfsgacUfuCfCfaccuUfcCfcuuccsasc 2711 antisense 23 UGGAAGGGAAGGUGGAAGUCU 1616 usgsgaagGfgAfAfGfguggaagucuL96 2712 sense 21 AGACUUCCACCUUCCCUUCCACA 1617 asGfsacuUfcCfAfccuuCfcCfuuccascsa 2713 antisense 23 UGCUAAAUCAGUACUUCCAAA 1618 usgscuaaAfuCfAfGfuacuuccaaaL96 2714 sense 21 UUUGGAAGUACUGAUUUAGCAUG 1619 usUfsuggAfaGfUfacugAfuUfuagcasusg 2715 antisense 23 GCUAAAUCAGUACUUCCAAAG 1620 gscsuaaaUfcAfGfUfacuuccaaagL96 2716 sense 21 CUUUGGAAGUACUGAUUUAGCAU 1621 csUfsuugGfaAfGfuacuGfaUfuuagcsasu 2717 antisense 23 AACAUGCUAAAUCAGUACUUC 1622 asascaugCfuAfAfAfucaguacuucL96 2718 sense 21 GAAGUACUGAUUUAGCAUGUUGU 1623 gsAfsaguAfcUfGfauuuAfgCfauguusgsu 2719 antisense 23 CAACAUGCUAAAUCAGUACUU 1624 csasacauGfcUfAfAfaucaguacuuL96 2720 sense 21 AAGUACUGAUUUAGCAUGUUGUU 1625 asAfsguaCfuGfAfuuuaGfcAfuguugsusu 2721 antisense 23 CCACAACUCAGGAUGAAAAAU 1626 cscsacaaCfuCfAfGfgaugaaaaauL96 2722 sense 21 AUUUUUCAUCCUGAGUUGUGGCG 1627 asUfsuuuUfcAfUfccugAfgUfuguggscsg 2723 antisense 23 CACAACUCAGGAUGAAAAAUU 1628 csascaacUfcAfGfGfaugaaaaauuL96 2724 sense 21 AAUUUUUCAUCCUGAGUUGUGGC 1629 asAfsuuuUfuCfAfuccuGfaGfuugugsgsc 2725 antisense 23 GCCGCCACAACUCAGGAUGAA 1630 gscscgccAfcAfAfCfucaggaugaaL96 2726 sense 21 UUCAUCCUGAGUUGUGGCGGCAG 1631 usUfscauCfcUfGfaguuGfuGfgcggcsasg 2727 antisense 23 UGCCGCCACAACUCAGGAUGA 1632 usgsccgcCfaCfAfAfcucaggaugaL96 2728 sense 21 UCAUCCUGAGUUGUGGCGGCAGU 1633 usCfsaucCfuGfAfguugUfgGfcggcasgsu 2729 antisense 23 GCAACCGUCUGGAUGAUGUGC 1634 gscsaaccGfuCfUfGfgaugaugugcL96 2730 sense 21 GCACAUCAUCCAGACGGUUGCCC 1635 gsCfsacaUfcAfUfccagAfcGfguugcscsc 2731 antisense 23 CAACCGUCUGGAUGAUGUGCG 1636 csasaccgUfcUfGfGfaugaugugcgL96 2732 sense 21 CGCACAUCAUCCAGACGGUUGCC 1637 csGfscacAfuCfAfuccaGfaCfgguugscsc 2733 antisense 23 CUGGGCAACCGUCUGGAUGAU 1638 csusgggcAfaCfCfGfucuggaugauL96 2734 sense 21 AUCAUCCAGACGGUUGCCCAGGU 1639 asUfscauCfcAfGfacggUfuGfcccagsgsu 2735 antisense 23 CCUGGGCAACCGUCUGGAUGA 1640 cscsugggCfaAfCfCfgucuggaugaL96 2736 sense 21 UCAUCCAGACGGUUGCCCAGGUA 1641 usCfsaucCfaGfAfcgguUfgCfccaggsusa 2737 antisense 23 GCAAAUGAUGAAGAAACUUUG 1642 gscsaaauGfaUfGfAfagaaacuuugL96 2738 sense 21 CAAAGUUUCUUCAUCAUUUGCCC 1643 csAfsaagUfuUfCfuucaUfcAfuuugcscsc 2739 antisense 23 CAAAUGAUGAAGAAACUUUGG 1644 csasaaugAfuGfAfAfgaaacuuuggL96 2740 sense 21 CCAAAGUUUCUUCAUCAUUUGCC 1645 csCfsaaaGfuUfUfcuucAfuCfauuugscsc 2741 antisense 23 UGGGGCAAAUGAUGAAGAAAC 1646 usgsgggcAfaAfUfGfaugaagaaacL96 2742 sense 21 GUUUCUUCAUCAUUUGCCCCAGA 1647 gsUfsuucUfuCfAfucauUfuGfccccasgsa 2743 antisense 23 CUGGGGCAAAUGAUGAAGAAA 1648 csusggggCfaAfAfUfgaugaagaaaL96 2744 sense 21 UUUCUUCAUCAUUUGCCCCAGAC 1649 usUfsucuUfcAfUfcauuUfgCfcccagsasc 2745 antisense 23 CCAAGGCUGUGUUUGUGGGGA 1650 cscsaaggCfuGfUfGfuuuguggggaL96 2746 sense 21 UCCCCACAAACACAGCCUUGGCG 1651 usCfscccAfcAfAfacacAfgCfcuuggscsg 2747 antisense 23 CAAGGCUGUGUUUGUGGGGAG 1652 csasaggcUfgUfGfUfuuguggggagL96 2748 sense 21 CUCCCCACAAACACAGCCUUGGC 1653 csUfscccCfaCfAfaacaCfaGfccuugsgsc 2749 antisense 23 GGCGCCAAGGCUGUGUUUGUG 1654 gsgscgccAfaGfGfCfuguguuugugL96 2750 sense 21 CACAAACACAGCCUUGGCGCCAA 1655 csAfscaaAfcAfCfagccUfuGfgcgccsasa 2751 antisense 23 UGGCGCCAAGGCUGUGUUUGU 1656 usgsgcgcCfaAfGfGfcuguguuuguL96 2752 sense 21 ACAAACACAGCCUUGGCGCCAAG 1657 asCfsaaaCfaCfAfgccuUfgGfcgccasasg 2753 antisense 23 ACUGCCGCCACAACUCAGGAU 1658 ascsugccGfcCfAfCfaacucaggauL96 2754 sense 21 AUCCUGAGUUGUGGCGGCAGUUU 1659 asUfsccuGfaGfUfugugGfcGfgcagususu 2755 antisense 23 CUGCCGCCACAACUCAGGAUG 1660 csusgccgCfcAfCfAfacucaggaugL96 2756 sense 21 CAUCCUGAGUUGUGGCGGCAGUU 1661 csAfsuccUfgAfGfuuguGfgCfggcagsusu 2757 antisense 23 UCAAACUGCCGCCACAACUCA 1662 uscsaaacUfgCfCfGfccacaacucaL96 2758 sense 21 UGAGUUGUGGCGGCAGUUUGAAU 1663 usGfsaguUfgUfGfgcggCfaGfuuugasasu 2759 antisense 23 UUCAAACUGCCGCCACAACUC 1664 ususcaaaCfuGfCfCfgccacaacucL96 2760 sense 21 GAGUUGUGGCGGCAGUUUGAAUC 1665 gsAfsguuGfuGfGfcggcAfgUfuugaasusc 2761 antisense 23 GGGAAGAUAUCAAAUGGCUGA 1666 gsgsgaagAfuAfUfCfaaauggcugaL96 2762 sense 21 UCAGCCAUUUGAUAUCUUCCCAG 1667 usCfsagcCfaUfUfugauAfuCfuucccsasg 2763 antisense 23 GGAAGAUAUCAAAUGGCUGAG 1668 gsgsaagaUfaUfCfAfaauggcugagL96 2764 sense 21 CUCAGCCAUUUGAUAUCUUCCCA 1669 csUfscagCfcAfUfuugaUfaUfcuuccscsa 2765 antisense 23 AGCUGGGAAGAUAUCAAAUGG 1670 asgscuggGfaAfGfAfuaucaaauggL96 2766 sense 21 CCAUUUGAUAUCUUCCCAGCUGA 1671 csCfsauuUfgAfUfaucuUfcCfcagcusgsa 2767 antisense 23 CAGCUGGGAAGAUAUCAAAUG 1672 csasgcugGfgAfAfGfauaucaaaugL96 2768 sense 21 CAUUUGAUAUCUUCCCAGCUGAU 1673 csAfsuuuGfaUfAfucuuCfcCfagcugsasu 2769 antisense 23 AAUCAGUACUUCCAAAGUCUA 1674 asasucagUfaCfUfUfccaaagucuaL96 2770 sense 21 UAGACUUUGGAAGUACUGAUUUA 1675 usAfsgacUfuUfGfgaagUfaCfugauususa 2771 antisense 23 AUCAGUACUUCCAAAGUCUAU 1676 asuscaguAfcUfUfCfcaaagucuauL96 2772 sense 21 AUAGACUUUGGAAGUACUGAUUU 1677 asUfsagaCfuUfUfggaaGfuAfcugaususu 2773 antisense 23 GCUAAAUCAGUACUUCCAAAG 1678 gscsuaaaUfcAfGfUfacuuccaaagL96 2774 sense 21 CUUUGGAAGUACUGAUUUAGCAU 1679 csUfsuugGfaAfGfuacuGfaUfuuagcsasu 2775 antisense 23 UGCUAAAUCAGUACUUCCAAA 1680 usgscuaaAfuCfAfGfuacuuccaaaL96 2776 sense 21 UUUGGAAGUACUGAUUUAGCAUG 1681 usUfsuggAfaGfUfacugAfuUfuagcasusg 2777 antisense 23 UCAGCAUGCCAAUAUGUGUGG 1682 uscsagcaUfgCfCfAfauauguguggL96 2778 sense 21 CCACACAUAUUGGCAUGCUGACC 1683 csCfsacaCfaUfAfuuggCfaUfgcugascsc 2779 antisense 23 CAGCAUGCCAAUAUGUGUGGG 1684 csasgcauGfcCfAfAfuaugugugggL96 2780 sense 21 CCCACACAUAUUGGCAUGCUGAC 1685 csCfscacAfcAfUfauugGfcAfugcugsasc 2781 antisense 23 AGGGUCAGCAUGCCAAUAUGU 1686 asgsggucAfgCfAfUfgccaauauguL96 2782 sense 21 ACAUAUUGGCAUGCUGACCCUCU 1687 asCfsauaUfuGfGfcaugCfuGfacccuscsu 2783 antisense 23 GAGGGUCAGCAUGCCAAUAUG 1688 gsasggguCfaGfCfAfugccaauaugL96 2784 sense 21 CAUAUUGGCAUGCUGACCCUCUG 1689 csAfsuauUfgGfCfaugcUfgAfcccucsusg 2785 antisense 23 GCAUAUGUGGCUAAAGCAAUA 1690 gscsauauGfuGfGfCfuaaagcaauaL96 2786 sense 21 UAUUGCUUUAGCCACAUAUGCAG 1691 usAfsuugCfuUfUfagccAfcAfuaugcsasg 2787 antisense 23 CAUAUGUGGCUAAAGCAAUAG 1692 csasuaugUfgGfCfUfaaagcaauagL96 2788 sense 21 CUAUUGCUUUAGCCACAUAUGCA 1693 csUfsauuGfcUfUfuagcCfaCfauaugscsa 2789 antisense 23 UGCUGCAUAUGUGGCUAAAGC 1694 usgscugcAfuAfUfGfuggcuaaagcL96 2790 sense 21 GCUUUAGCCACAUAUGCAGCAAG 1695 gsCfsuuuAfgCfCfacauAfuGfcagcasasg 2791 antisense 23 UUGCUGCAUAUGUGGCUAAAG 1696 ususgcugCfaUfAfUfguggcuaaagL96 2792 sense 21 CUUUAGCCACAUAUGCAGCAAGU 1697 csUfsuuaGfcCfAfcauaUfgCfagcaasgsu 2793 antisense 23 AAAUGAUGAAGAAACUUUGGC 1698 asasaugaUfgAfAfGfaaacuuuggcL96 2794 sense 21 GCCAAAGUUUCUUCAUCAUUUGC 1699 gsCfscaaAfgUfUfucuuCfaUfcauuusgsc 2795 antisense 23 AAUGAUGAAGAAACUUUGGCU 1700 asasugauGfaAfGfAfaacuuuggcuL96 2796 sense 21 AGCCAAAGUUUCUUCAUCAUUUG 1701 asGfsccaAfaGfUfuucuUfcAfucauususg 2797 antisense 23 GGGCAAAUGAUGAAGAAACUU 1702 gsgsgcaaAfuGfAfUfgaagaaacuuL96 2798 sense 21 AAGUUUCUUCAUCAUUUGCCCCA 1703 asAfsguuUfcUfUfcaucAfuUfugcccscsa 2799 antisense 23 GGGGCAAAUGAUGAAGAAACU 1704 gsgsggcaAfaUfGfAfugaagaaacuL96 2800 sense 21 AGUUUCUUCAUCAUUUGCCCCAG 1705 asGfsuuuCfuUfCfaucaUfuUfgccccsasg 2801 antisense 23 GAGAUACUAAAGGAAGAAUUC 1706 gsasgauaCfuAfAfAfggaagaauucL96 2802 sense 21 GAAUUCUUCCUUUAGUAUCUCGA 1707 gsAfsauuCfuUfCfcuuuAfgUfaucucsgsa 2803 antisense 23 AGAUACUAAAGGAAGAAUUCC 1708 asgsauacUfaAfAfGfgaagaauuccL96 2804 sense 21 GGAAUUCUUCCUUUAGUAUCUCG 1709 gsGfsaauUfcUfUfccuuUfaGfuaucuscsg 2805 antisense 23 CCUCGAGAUACUAAAGGAAGA 1710 cscsucgaGfaUfAfCfuaaaggaagaL96 2806 sense 21 UCUUCCUUUAGUAUCUCGAGGAC 1711 usCfsuucCfuUfUfaguaUfcUfcgaggsasc 2807 antisense 23 UCCUCGAGAUACUAAAGGAAG 1712 uscscucgAfgAfUfAfcuaaaggaagL96 2808 sense 21 CUUCCUUUAGUAUCUCGAGGACA 1713 csUfsuccUfuUfAfguauCfuCfgaggascsa 2809 antisense 23 ACAACUCAGGAUGAAAAAUUU 1714 ascsaacuCfaGfGfAfugaaaaauuuL96 2810 sense 21 AAAUUUUUCAUCCUGAGUUGUGG 1715 asAfsauuUfuUfCfauccUfgAfguugusgsg 2811 antisense 23 CAACUCAGGAUGAAAAAUUUU 1716 csasacucAfgGfAfUfgaaaanuuuuL96 2812 sense 21 AAAAUUUUUCAUCCUGAGUUGUG 1717 asAfsaauUfuUfUfcaucCfuGfaguugsusg 2813 antisense 23 CGCCACAACUCAGGAUGAAAA 1718 csgsccacAfaCfUfCfaggaugaaaaL96 2814 sense 21 UUUUCAUCCUGAGUUGUGGCGGC 1719 usUfsuucAfuCfCfugagUfuGfuggcgsgsc 2815 antisense 23 CCGCCACAACUCAGGAUGAAA 1720 cscsgccaCfaAfCfUfcaggaugaaaL96 2816 sense 21 UUUCAUCCUGAGUUGUGGCGGCA 1721 usUfsucaUfcCfUfgaguUfgUfggcggscsa 2817 antisense 23 AGGGAAGGUGGAAGUCUUCCU 1722 asgsggaaGfgUfGfGfaagucuuccuL96 2818 sense 21 AGGAAGACUUCCACCUUCCCUUC 1723 asGfsgaaGfaCfUfuccaCfcUfucccususc 2819 antisense 23 GGGAAGGUGGAAGUCUUCCUG 1724 gsgsgaagGfuGfGfAfagucuuccugL96 2820 sense 21 CAGGAAGACUUCCACCUUCCCUU 1725 csAfsggaAfgAfCfuuccAfcCfuucccsusu 2821 antisense 23 UGGAAGGGAAGGUGGAAGUCU 1726 usgsgaagGfgAfAfGfguggaagucuL96 2822 sense 21 AGACUUCCACCUUCCCUUCCACA 1727 asGfsacuUfcCfAfccuuCfcCfuuccascsa 2823 antisense 23 GUGGAAGGGAAGGUGGAAGUC 1728 gsusggaaGfgGfAfAfgguggaagucL96 2824 sense 21 GACUUCCACCUUCCCUUCCACAG 1729 gsAfscuuCfcAfCfcuucCfcUfuccacsasg 2825 antisense 23 GGCGAGCUUGCCACUGUGAGA 1730 gsgscgagCfuUfGfCfcacugugagaL96 2826 sense 21 UCUCACAGUGGCAAGCUCGCCGU 1731 usCfsucaCfaGfUfggcaAfgCfucgccsgsu 2827 antisense 23 GCGAGCUUGCCACUGUGAGAG 1732 gscsgagcUfuGfCfCfacugugagagL96 2828 sense 21 CUCUCACAGUGGCAAGCUCGCCG 1733 csUfscucAfcAfGfuggcAfaGfcucgcscsg 2829 antisense 23 GGACGGCGAGCUUGCCACUGU 1734 gsgsacggCfgAfGfCfuugccacuguL96 2830 sense 21 ACAGUGGCAAGCUCGCCGUCCAC 1735 asCfsaguGfgCfAfagcuCfgCfcguccsasc 2831 antisense 23 UGGACGGCGAGCUUGCCACUG 1736 usgsgacgGfcGfAfGfcuugccacugL96 2832 sense 21 CAGUGGCAAGCUCGCCGUCCACA 1737 csAfsgugGfcAfAfgcucGfcCfguccascsa 2833 antisense 23 AUGUGCGUAACAGAUUCAAAC 1738 asusgugcGfuAfAfCfagauucaaacL96 2834 sense 21 GUUUGAAUCUGUUACGCACAUCA 1739 gsUfsuugAfaUfCfuguuAfcGfcacauscsa 2835 antisense 23 UGUGCGUAACAGAUUCAAACU 1740 usgsugcgUfaAfCfAfgauucaaacuL96 2836 sense 21 AGUUUGAAUCUGUUACGCACAUC 1741 asGfsuuuGfaAfUfcuguUfaCfgcacasusc 2837 antisense 23 GAUGAUGUGCGUAACAGAUUC 1742 gsasugauGfuGfCfGfuaacagauucL96 2838 sense 21 GAAUCUGUUACGCACAUCAUCCA 1743 gsAfsaucUfgUfUfacgcAfcAfucaucscsa 2839 antisense 23 GGAUGAUGUGCGUAACAGAUU 1744 gsgsaugaUfgUfGfCfguaacagauuL96 2840 sense 21 AAUCUGUUACGCACAUCAUCCAG 1745 asAfsucuGfuUfAfcgcaCfaUfcauccsasg 2841 antisense 23 GGGUCAGCAUGCCAAUAUGUG 1746 gsgsgucaGfcAfUfGfccaauaugugL96 2842 sense 21 CACAUAUUGGCAUGCUGACCCUC 1747 csAfscauAfuUfGfgcauGfcUfgacccsusc 2843 antisense 23 GGUCAGCAUGCCAAUAUGUGU 1748 gsgsucagCfaUfGfCfcaauauguguL96 2844 sense 21 ACACAUAUUGGCAUGCUGACCCU 1749 asCfsacaUfaUfUfggcaUfgCfugaccscsu 2845 antisense 23 CAGAGGGUCAGCAUGCCAAUA 1750 csasgaggGfuCfAfGfcaugccaauaL96 2846 sense 21 UAUUGGCAUGCUGACCCUCUGUC 1751 usAfsuugGfcAfUfgcugAfcCfcucugsusc 2847 antisense 23 ACAGAGGGUCAGCAUGCCAAU 1752 ascsagagGfgUfCfAfgcaugccaauL96 2848 sense 21 AUUGGCAUGCUGACCCUCUGUCC 1753 asUfsuggCfaUfGfcugaCfcCfucuguscsc 2849 antisense 23 GCUUGAAUGGGAUCUUGGUGU 1754 gscsuugaAfuGfGfGfaucuugguguL96 2850 sense 21 ACACCAAGAUCCCAUUCAAGCCA 1755 asCfsaccAfaGfAfucccAfuUfcaagcscsa 2851 antisense 23 CUUGAAUGGGAUCUUGGUGUC 1756 csusugaaUfgGfGfAfucuuggugucL96 2852 sense 21 GACACCAAGAUCCCAUUCAAGCC 1757 gsAfscacCfaAfGfauccCfaUfucaagscsc 2853 antisense 23 CAUGGCUUGAAUGGGAUCUUG 1758 csasuggcUfuGfAfAfugggaucuugL96 2854 sense 21 CAAGAUCCCAUUCAAGCCAUGUU 1759 csAfsagaUfcCfCfauucAfaGfccaugsusu 2855 antisense 23 ACAUGGCUUGAAUGGGAUCUU 1760 ascsauggCfuUfGfAfaugggaucuuL96 2856 sense 21 AAGAUCCCAUUCAAGCCAUGUUU 1761 asAfsgauCfcCfAfuucaAfgCfcaugususu 2857 antisense 23 UCAAAUGGCUGAGAAGACUGA 1762 uscsaaauGfgCfUfGfagaagacugaL96 2858 sense 21 UCAGUCUUCUCAGCCAUUUGAUA 1763 usCfsaguCfuUfCfucagCfcAfuuugasusa 2859 antisense 23 CAAAUGGCUGAGAAGACUGAC 1764 csasaaugGfcUfGfAfgaagacugacL96 2860 sense 21 GUCAGUCUUCUCAGCCAUUUGAU 1765 gsUfscagUfcUfUfcucaGfcCfauuugsasu 2861 antisense 23 GAUAUCAAAUGGCUGAGAAGA 1766 gsasuaucAfaAfUfGfgcugagaagaL96 2862 sense 21 UCUUCUCAGCCAUUUGAUAUCUU 1767 usCfsuucUfcAfGfccauUfuGfauaucsusu 2863 antisense 23 AGAUAUCAAAUGGCUGAGAAG 1768 asgsauauCfaAfAfUfggcugagaagL96 2864 sense 21 CUUCUCAGCCAUUUGAUAUCUUC 1769 csUfsucuCfaGfCfcauuUfgAfuaucususc 2865 antisense 23 GAAAGUCAUCGACAAGACAUU 1770 gsasaaguCfaUfCfGfacaagacauuL96 2866 sense 21 AAUGUCUUGUCGAUGACUUUCAC 1771 asAfsuguCfuUfGfucgaUfgAfcuuucsasc 2867 antisense 23 AAAGUCAUCGACAAGACAUUG 1772 asasagucAfuCfGfAfcaagacauugL96 2868 sense 21 CAAUGUCUUGUCGAUGACUUUCA 1773 csAfsaugUfcUfUfgucgAfuGfacuuuscsa 2869 antisense 23 AUGUGAAAGUCAUCGACAAGA 1774 asusgugaAfaGfUfCfaucgacaagaL96 2870 sense 21 UCUUGUCGAUGACUUUCACAUUC 1775 usCfsuugUfcGfAfugacUfuUfcacaususc 2871 antisense 23 AAUGUGAAAGUCAUCGACAAG 1776 asasugugAfaAfGfUfcaucgacaagL96 2872 sense 21 CUUGUCGAUGACUUUCACAUUCU 1777 csUfsuguCfgAfUfgacuUfuCfacauuscsu 2873 antisense 23 GGCUAAUUUGUAUCAAUGAUU 1778 gsgscuaaUfuUfGfUfaucaaugauuL96 2874 sense 21 AAUCAUUGAUACAAAUUAGCCGG 1779 asAfsucaUfuGfAfuacaAfaUfuagccsgsg 2875 antisense 23 GCUAAUUUGUAUCAAUGAUUA 1780 gscsuaauUfuGfUfAfucaaugauuaL96 2876 sense 21 UAAUCAUUGAUACAAAUUAGCCG 1781 usAfsaucAfuUfGfauacAfaAfuuagcscsg 2877 antisense 23 CCCCGGCUAAUUUGUAUCAAU 1782 cscsccggCfuAfAfUfuuguaucaauL96 2878 sense 21 AUUGAUACAAAUUAGCCGGGGGA 1783 asUfsugaUfaCfAfaauuAfgCfcggggsgsa 2879 antisense 23 CCCCCGGCUAAUUUGUAUCAA 1784 cscscccgGfcUfAfAfuuuguaucaaL96 2880 sense 21 UUGAUACAAAUUAGCCGGGGGAG 1785 usUfsgauAfcAfAfauuaGfcCfgggggsasg 2881 antisense 23 UGUCGACUUCUGUUUUAGGAC 1786 usgsucgaCfuUfCfUfguuuuaggacL96 2882 sense 21 GUCCUAAAACAGAAGUCGACAGA 1787 gsUfsccuAfaAfAfcagaAfgUfcgacasgsa 2883 antisense 23 GUCGACUUCUGUUUUAGGACA 1788 gsuscgacUfuCfUfGfuuuuaggacaL96 2884 sense 21 UGUCCUAAAACAGAAGUCGACAG 1789 usGfsuccUfaAfAfacagAfaGfucgacsasg 2885 antisense 23 GAUCUGUCGACUUCUGUUUUA 1790 gsasucugUfcGfAfCfuucuguuuuaL96 2886 sense 21 UAAAACAGAAGUCGACAGAUCUG 1791 usAfsaaaCfaGfAfagucGfaCfagaucsusg 2887 antisense 23 AGAUCUGUCGACUUCUGUUUU 1792 asgsaucuGfuCfGfAfcuucuguuuuL96 2888 sense 21 AAAACAGAAGUCGACAGAUCUGU 1793 asAfsaacAfgAfAfgucgAfcAfgaucusgsu 2889 antisense 23 CCGAGAAGUCACCAAGAAGCU 1794 cscsgagaAfgUfCfAfccaagaagcuL96 2890 sense 21 AGCUUCUUGGUGACUUCUCGGUC 1795 asGfscuuCfuUfGfgugaCfuUfcucggsusc 2891 antisense 23 CGAGAAGUCACCAAGAAGCUA 1796 csgsagaaGfuCfAfCfcaagaagcuaL96 2892 sense 21 UAGCUUCUUGGUGACUUCUCGGU 1797 usAfsgcuUfcUfUfggugAfcUfucucgsgsu 2893 antisense 23 AGGACCGAGAAGUCACCAAGA 1798 asgsgaccGfaGfAfAfgucaccaagaL96 2894 sense 21 UCUUGGUGACUUCUCGGUCCUUG 1799 usCfsuugGfuGfAfcuucUfcGfguccususg 2895 antisense 23 AAGGACCGAGAAGUCACCAAG 1800 asasggacCfgAfGfAfagucaccaagL96 2896 sense 21 CUUGGUGACUUCUCGGUCCUUGU 1801 csUfsuggUfgAfCfuucuCfgGfuccuusgsu 2897 antisense 23 AAACAUGGCUUGAAUGGGAUC 1802 asasacauGfgCfUfUfgaaugggaucL96 2898 sense 21 GAUCCCAUUCAAGCCAUGUUUAA 1803 gsAfsuccCfaUfUfcaagCfcAfuguuusasa 2899 antisense 23 AACAUGGCUUGAAUGGGAUCU 1804 asascaugGfcUfUfGfaaugggaucuL96 2900 sense 21 AGAUCCCAUUCAAGCCAUGUUUA 1805 asGfsaucCfcAfUfucaaGfcCfauguususa 2901 antisense 23 UGUUAAACAUGGCUUGAAUGG 1806 usgsuuaaAfcAfUfGfgcuugaauggL96 2902 sense 21 CCAUUCAAGCCAUGUUUAACAGC 1807 csCfsauuCfaAfGfccauGfuUfuaacasgsc 2903 antisense 23 CUGUUAAACAUGGCUUGAAUG 1808 csusguuaAfaCfAfUfggcuugaaugL96 2904 sense 21 CAUUCAAGCCAUGUUUAACAGCC 1809 csAfsuucAfaGfCfcaugUfuUfaacagscsc 2905 antisense 23 GACUUGCUGCAUAUGUGGCUA 1810 gsascuugCfuGfCfAfuauguggcuaL96 2906 sense 21 UAGCCACAUAUGCAGCAAGUCCA 1811 usAfsgccAfcAfUfaugcAfgCfaagucscsa 2907 antisense 23 ACUUGCUGCAUAUGUGGCUAA 1812 ascsuugcUfgCfAfUfauguggcuaaL96 2908 sense 21 UUAGCCACAUAUGCAGCAAGUCC 1813 usUfsagcCfaCfAfuaugCfaGfcaaguscsc 2909 antisense 23 AGUGGACUUGCUGCAUAUGUG 1814 asgsuggaCfuUfGfCfugcauaugugL96 2910 sense 21 CACAUAUGCAGCAAGUCCACUGU 1815 csAfscauAfuGfCfagcaAfgUfccacusgsu 2911 antisense 23 CAGUGGACUUGCUGCAUAUGU 1816 csasguggAfcUfUfGfcugcauauguL96 2912 sense 21 ACAUAUGCAGCAAGUCCACUGUC 1817 asCfsauaUfgCfAfgcaaGfuCfcacugsusc 2913 antisense 23 UAAAUCAGUACUUCCAAAGUC 1818 usasaaucAfgUfAfCfuuccaaagucL96 2914 sense 21 GACUUUGGAAGUACUGAUUUAGC 1819 gsAfscuuUfgGfAfaguaCfuGfauuuasgsc 2915 antisense 23 AAAUCAGUACUUCCAAAGUCU 1820 asasaucaGfuAfCfUfuccaaagucuL96 2916 sense 21 AGACUUUGGAAGUACUGAUUUAG 1821 asGfsacuUfuGfGfaaguAfcUfgauuusasg 2917 antisense 23 AUGCUAAAUCAGUACUUCCAA 1822 asusgcuaAfaUfCfAfguacuuccaaL96 2918 sense 21 UUGGAAGUACUGAUUUAGCAUGU 1823 usUfsggaAfgUfAfcugaUfuUfagcausgsu 2919 antisense 23 CAUGCUAAAUCAGUACUUCCA 1824 csasugcuAfaAfUfCfaguacuuccaL96 2920 sense 21 UGGAAGUACUGAUUUAGCAUGUU 1825 usGfsgaaGfuAfCfugauUfuAfgcaugsusu 2921 antisense 23 UCCUCAAUUGAAGAAGUGGCG 1826 uscscucaAfuUfGfAfagaaguggcgL96 2922 sense 21 CGCCACUUCUUCAAUUGAGGAGG 1827 csGfsccaCfuUfCfuucaAfuUfgaggasgsg 2923 antisense 23 CCUCAAUUGAAGAAGUGGCGG 1828 cscsucaaUfuGfAfAfgaaguggcggL96 2924 sense 21 CCGCCACUUCUUCAAUUGAGGAG 1829 csCfsgccAfcUfUfcuucAfaUfugaggsasg 2925 antisense 23 CACCUCCUCAAUUGAAGAAGU 1830 csasccucCfuCfAfAfuugaagaaguL96 2926 sense 21 ACUUCUUCAAUUGAGGAGGUGGC 1831 asCfsuucUfuCfAfauugAfgGfaggugsgsc 2927 antisense 23 CCACCUCCUCAAUUGAAGAAG 1832 cscsaccuCfcUfCfAfauugaagaagL96 2928 sense 21 CUUCUUCAAUUGAGGAGGUGGCC 1833 csUfsucuUfcAfAfuugaGfgAfgguggscsc 2929 antisense 23 CAAGAUGUCCUCGAGAUACUA 1834 csasagauGfuCfCfUfcgagauacuaL96 2930 sense 21 UAGUAUCUCGAGGACAUCUUGAA 1835 usAfsguaUfcUfCfgaggAfcAfucuugsasa 2931 antisense 23 AAGAUGUCCUCGAGAUACUAA 1836 asasgaugUfcCfUfCfgagauacuaaL96 2932 sense 21 UUAGUAUCUCGAGGACAUCUUGA 1837 usUfsaguAfuCfUfcgagGfaCfaucuusgsa 2933 antisense 23 UGUUCAAGAUGUCCUCGAGAU 1838 usgsuucaAfgAfUfGfuccucgagauL96 2934 sense 21 AUCUCGAGGACAUCUUGAACACC 1839 asUfscucGfaGfGfacauCfuUfgaacascsc 2935 antisense 23 GUGUUCAAGAUGUCCUCGAGA 1840 gsusguucAfaGfAfUfguccucgagaL96 2936 sense 21 UCUCGAGGACAUCUUGAACACCU 1841 usCfsucgAfgGfAfcaucUfuGfaacacscsu 2937 antisense 23 ACAUGCUAAAUCAGUACUUCC 1842 ascsaugcUfaAfAfUfcaguacuuccL96 2938 sense 21 GGAAGUACUGAUUUAGCAUGUUG 1843 gsGfsaagUfaCfUfgauuUfaGfcaugususg 2939 antisense 23 CAUGCUAAAUCAGUACUUCCA 1844 csasugcuAfaAfUfCfaguacuuccaL96 2940 sense 21 UGGAAGUACUGAUUUAGCAUGUU 1845 usGfsgaaGfuAfCfugauUfuAfgcaugsusu 2941 antisense 23 AACAACAUGCUAAAUCAGUAC 1846 asascaacAfuGfCfUfaaaucaguacL96 2942 sense 21 GUACUGAUUUAGCAUGUUGUUCA 1847 gsUfsacuGfaUfUfuagcAfuGfuuguuscsa 2943 antisense 23 GAACAACAUGCUAAAUCAGUA 1848 gsasacaaCfaUfGfCfuaaaucaguaL96 2944 sense 21 UACUGAUUUAGCAUGUUGUUCAU 1849 usAfscugAfuUfUfagcaUfgUfuguucsasu 2945 antisense 23 GAAAGGCACUGAUGUUCUGAA 1850 gsasaaggCfaCfUfGfauguucugaaL96 2946 sense 21 UUCAGAACAUCAGUGCCUUUCCG 1851 usUfscagAfaCfAfucagUfgCfcuuucscsg 2947 antisense 23 AAAGGCACUGAUGUUCUGAAA 1852 asasaggcAfcUfGfAfuguucugaaaL96 2948 sense 21 UUUCAGAACAUCAGUGCCUUUCC 1853 usUfsucaGfaAfCfaucaGfuGfccuuuscsc 2949 antisense 23 UGCGGAAAGGCACUGAUGUUC 1854 usgscggaAfaGfGfCfacugauguucL96 2950 sense 21 GAACAUCAGUGCCUUUCCGCACA 1855 gsAfsacaUfcAfGfugccUfuUfccgcascsa 2951 antisense 23 GUGCGGAAAGGCACUGAUGUU 1856 gsusgcggAfaAfGfGfcacugauguuL96 2952 sense 21 AACAUCAGUGCCUUUCCGCACAC 1857 asAfscauCfaGfUfgccuUfuCfcgcacsasc 2953 antisense 23 GUCAGCAUGCCAAUAUGUGUG 1858 gsuscagcAfuGfCfCfaauaugugugL96 2954 sense 21 CACACAUAUUGGCAUGCUGACCC 1859 csAfscacAfuAfUfuggcAfuGfcugacscsc 2955 antisense 23 UCAGCAUGCCAAUAUGUGUGG 1860 uscsagcaUfgCfCfAfauauguguggL96 2956 sense 21 CCACACAUAUUGGCAUGCUGACC 1861 csCfsacaCfaUfAfuuggCfaUfgcugascsc 2957 antisense 23 GAGGGUCAGCAUGCCAAUAUG 1862 gsasggguCfaGfCfAfugccaauaugL96 2958 sense 21 CAUAUUGGCAUGCUGACCCUCUG 1863 csAfsuauUfgGfCfaugcUfgAfcccucsusg 2959 antisense 23 AGAGGGUCAGCAUGCCAAUAU 1864 asgsagggUfcAfGfCfaugccaauauL96 2960 sense 21 AUAUUGGCAUGCUGACCCUCUGU 1865 asUfsauuGfgCfAfugcuGfaCfccucusgsu 2961 antisense 23 GAUGCUCCGGAAUGUUGCUGA 1866 gsasugcuCfcGfGfAfauguugcugaL96 2962 sense 21 UCAGCAACAUUCCGGAGCAUCCU 1867 usCfsagcAfaCfAfuuccGfgAfgcaucscsu 2963 antisense 23 AUGCUCCGGAAUGUUGCUGAA 1868 asusgcucCfgGfAfAfuguugcugaaL96 2964 sense 21 UUCAGCAACAUUCCGGAGCAUCC 1869 usUfscagCfaAfCfauucCfgGfagcauscsc 2965 antisense 23 CAAGGAUGCUCCGGAAUGUUG 1870 csasaggaUfgCfUfCfcggaauguugL96 2966 sense 21 CAACAUUCCGGAGCAUCCUUGGA 1871 csAfsacaUfuCfCfggagCfaUfccuugsgsa 2967 antisense 23 CCAAGGAUGCUCCGGAAUGUU 1872 cscsaaggAfuGfCfUfccggaauguuL96 2968 sense 21 AACAUUCCGGAGCAUCCUUGGAU 1873 asAfscauUfcCfGfgagcAfuCfcuuggsasu 2969 antisense 23 GCGUAACAGAUUCAAACUGCC 1874 gscsguaaCfaGfAfUfucaaacugccL96 2970 sense 21 GGCAGUUUGAAUCUGUUACGCAC 1875 gsGfscagUfuUfGfaaucUfgUfuacgcsasc 2971 antisense 23 CGUAACAGAUUCAAACUGCCG 1876 csgsuaacAfgAfUfUfcaaacugccgL96 2972 sense 21 CGGCAGUUUGAAUCUGUUACGCA 1877 csGfsgcaGfuUfUfgaauCfuGfuuacgscsa 2973 antisense 23 AUGUGCGUAACAGAUUCAAAC 1878 asusgugcGfuAfAfCfagauucaaacL96 2974 sense 21 GUUUGAAUCUGUUACGCACAUCA 1879 gsUfsuugAfaUfCfuguuAfcGfcacauscsa 2975 antisense 23 GAUGUGCGUAACAGAUUCAAA 1880 gsasugugCfgUfAfAfcagauucaaaL96 2976 sense 21 UUUGAAUCUGUUACGCACAUCAU 1881 usUfsugaAfuCfUfguuaCfgCfacaucsasu 2977 antisense 23 AGAGAAGAUGGGCUACAAGGC 1882 asgsagaaGfaUfGfGfgcuacaaggcL96 2978 sense 21 GCCUUGUAGCCCAUCUUCUCUGC 1883 gsCfscuuGfuAfGfcccaUfcUfucucusgsc 2979 antisense 23 GAGAAGAUGGGCUACAAGGCC 1884 gsasgaagAfuGfGfGfcuacaaggccL96 2980 sense 21 GGCCUUGUAGCCCAUCUUCUCUG 1885 gsGfsccuUfgUfAfgcccAfuCfuucucsusg 2981 antisense 23 AGGCAGAGAAGAUGGGCUACA 1886 asgsgcagAfgAfAfGfaugggcuacaL96 2982 sense 21 UGUAGCCCAUCUUCUCUGCCUGC 1887 usGfsuagCfcCfAfucuuCfuCfugccusgsc 2983 antisense 23 CAGGCAGAGAAGAUGGGCUAC 1888 csasggcaGfaGfAfAfgaugggcuacL96 2984 sense 21 GUAGCCCAUCUUCUCUGCCUGCC 1889 gsUfsagcCfcAfUfcuucUfcUfgccugscsc 2985 antisense 23

    Example 2. A Single Dose of AD-84788 Potently Inhibits Ldha Expression and Activity In Vivo

    [0867] The effect of AD-84788 on the level of expression of Ldha in vivo was evaluated in C57BL/6J wild-type mice by subcutaneous administration of a single 0.1 mg/kg, 0.3 mg/kg, 1.0 mg/kg, 3.0 mg/kg, or 10 mg/kg dose of AD-84788. Forty-eight hours after administration, mice were euthanized and the livers were dissected and flash frozen in liquid nitrogen. Livers were ground and approximately 10 mg of liver powder per sample was used for RNA isolation. RNA concentration was measured, adjusted to 100 ng/μl, cDNA was prepared, and RT-PCR analysis was performed as described above.

    [0868] The results of these assays are depicted in FIG. 2 which demonstrates that a single 1 mg/kg, 3 mg/kg or 10 mg/kg dose of AD-84788 potently inhibits Ldha expression.

    [0869] The effects of a single 0.1 mg/kg, 0.3 mg/kg, 1.0 mg/kg, 3.0 mg/kg, or 10 mg/kg subcutaneous dose of AD-84788 on hepatic Ldha enzyme activity was evaluated in Agxt deficient mice.

    [0870] Agxt deficient mice have a targeted disruption of the alanine-glyoxylate amino transferase gene (Agxt) (Salido, et al. (2006) Proc. Natl. Acad. Sci. U.S.A. 103:18249). Mutant mice develop normally, but exhibit hyperoxaluria and calcium oxalate crystal formation. These Agxt knock-out mice are a recognized animal model of primary hyperoxaluria type I, a rare disease characterized by excessive hepatic oxalate production that leads to renal failure and which is caused by mutations in the AGXT gene.

    [0871] Liver LDH enzyme activity was measured by the reduction of NAD to NADH in liver tissue lysates. Four weeks after administration, mice were euthanized and liver samples were collected and processed. Briefly, liver samples were weighed, homogenized in lysis buffer (25 mM HEPES, 1% Triton, 1% protease inhibitor) and homogenates were centrifuged to pellet cell debris. The supernantants were recovered, and solutions of NAD and either lactic acid or glyoxylate were added. The samples were placed into a multi-well plate and placed into a plate reader. Absorbance readings at 340 nm were collected for 20 minutes at 1 minute intervals. The data was used to calculate LDHA specific activity (nmoles of LDHA activity/min/mg protein).

    [0872] The results of these assays are depicted in FIG. 3 which demonstrates that a single 0.3 mg/kg, 1 mg/kg, 3 mg/kg or 10 mg/kg dose of AD-84788 potently inhibits Ldha enzyme activity.

    Example 3. AD-84788 Potently Reduces Endogenous LDHA Expression, LDHA Activity, and Oxalate Levels In Vivo

    [0873] The effect of AD-84788 on endogenous oxalate production in vivo was evaluated in wild-type mice, Agxt deficient mice, and Grhpr knockout mice

    [0874] Grhpr deficient mice have a targeted disruption of the glyoxylate reductase/hydroxypyruvate reductase (Grhpr) gene (see, e.g., Knight et al., (2011) Am J Physiol Renal Physiol 302(6): F688-F693). Mutant mice exhibit no difference in growth and development, but exhibit nephrocalcinosis including deposits of calcium oxalate in cortical and medullary tubules. Grhpr knock-out mice are an art recognized animal model of primary hyperoxaluria type II, an inherited disease characterized by excessive production of oxalate caused by mutations in the Grhpr gene.

    Methods and Materials

    [0875] Animals

    [0876] Adult (12-14 weeks of age) male Agt deficient (Agxt Ko) mice on a C57BL/6J background, Grhpr deficient (Grhpr Ko) mice, and wild type litter mates were used for these studies. Mice were maintained in a barrier facility with a 12:12-hour light-dark cycle and an ambient temperature of 23±1° C. and had free access to food and water. All mice were placed on an ultra low oxalate diet to eliminate dietary oxalate contributions, e.g., so that urinary oxalate excretion levels represent substantially only endogenous oxalate production. All animal studies were approved by the Institutional Animal Use and Care Committee.

    [0877] Metabolic Cage Urine Collections

    [0878] For metabolic cage urine collections, animals were singly housed in Nalgene metabolic cages for collection of 24-hour urines, as previously described (Li, et. al. (2016) Biochimica et Biophysica Acta 1862:233). Three to four 24-hour urines were performed for each mouse before and after administration of an iRNA agent. The mean of these collections was used to characterize the urinary oxalate excretion of each animal.

    [0879] LDHA iRNA Administration

    [0880] The effect and durability of AD-84788 on urinary oxalate excretion excretion was determined by administering Agxt deficient mice (n=6) a single 0.3 mg/kg, 1 mg/kg, 3 mg/kg, or 10 mg/kg dose of AD-84788 diluted in sterile 0.9% sodium chloride on Day 0. Twenty-four-hour urines were collected on weeks 1, 2, 3, 4, 6, 8, 9, and 10 post-dose. Baseline twenty-four-hour urine collections were also performed prior to the administration of AD-84788.

    [0881] The effect of AD-84788 on urinary oxalate excretion was further determined by administering wild-type mice (n=6), Agxt mice (n=6) or Grhpr mice (n=6) a single 10 mg/kg dose of AD-84788 diluted in sterile 0.9% sodium chloride on Day 0. Twenty-four-hour urine samples were collected on days 7-10 post-dose. Baseline twenty-four-hour urine collections were also performed prior to the administration of AD-84788

    [0882] The effect of multi-dose administration of AD-84788 on urinary oxalate excretion and was also determined Agxt mice (n=6). Agxt deficient mice were administered a 10 mg/kg dose of AD-84788 on Days 0, 11, 18, and 25. Twenty-four-hour urines were collected on Days −6, −5, −4, and −3 pre-dose. Twenty-four-hour urines were also collected on Days 7, 8, 9, and 10 post-dose; and on Days 28, 29, 30, and 31 post-dose.

    [0883] Following completion of 24-hour urine collections (Day 32 post-dose), tissue was collected to determine inhibition of LDHA protein and activity by enzymatic assays. Animals were fasted for 6 hours and anesthetized with vaporized isoflurane (Fluriso, MWI, Boise Id.) prior to tissue procurement. A schematic of this multi-dose study protocol is provided in FIG. 4.

    [0884] Analytical Methods

    [0885] Urinary oxalate levels were determined by ion chromatography coupled with mass spectroscopy (ICMS), as previously described (Li, et. al. (2016) Biochimica et Biophysica Acta 1862:233). Liver lactate was determined by ICMS (Knight, et. al. (2012). Anal Biochem. 421:121-124), and pyruvate and glyoxylate levels by HPLC (Knight and Holmes (2005) Am J Nephrol 25:171). Prior to lactate, pyruvate and glyoxylate measurements, tissue was extracted in trichloroacetic acid (final 10% v/v).

    [0886] Liver LDH Enzyme Assay—Lactic Acid or Glyoxylate Substrates

    [0887] Liver LDH enzyme activity was measured by the reduction of NAD to NADH in liver tissue lysates. Briefly, liver samples were weighed, homogenized in lysis buffer (25 mM HEPES, 1% Triton, 1% protease inhibitor) and homogenates were centrifuged to pellet cell debris. The supernantants were recovered, and solutions of NAD and either lactic acid or glyoxylate were added. The samples were placed into a multi-well plate and placed into a plate reader. Absorbance readings at 340 nm were collected for 20 minutes at 1 minute intervals. The data was used to calculate LDHA specific activity (nmoles of LDHA activity/min/mg protein).

    [0888] Heart and Thigh Skeletal Muscle LDH Enzyme Assay

    [0889] Heart and thigh skeletal muscle LDH enzyme activity was also measured using lactic acid as a substrate. Briefly, liver samples were weighed, homogenized in lysis buffer (25 mM HEPES, 1% Triton, 1% protease inhibitor) and homogenates were centrifuged to pellet cell debris. The supernantants were recovered, and solutions of NAD and lactic acid were added. The samples were placed into a multi-well plate and placed into a plate reader. Absorbance readings at 340 nm were collected for 20 minutes at 1 minute intervals. The data was used to calculate LDHA specific activity (nmoles of LDHA activity/min/mg protein).

    Results

    [0890] The effect and durability of LDHA inhibition on endogenous oxalate excretion was also assessed and, as depicted in FIG. 5, compared to untreated control animals, administration of a single 0.3 mg/kg 1 mg/kg, 3 mg/kg or 10 mg/kg dose of AD-84788 decreased urinary oxalate excretion for at least 4 weeks post-dose of AD-84788.

    [0891] Furthermore, as depicted in FIG. 6, four weeks after the administration of a single 10 mg/kg dose of siRNA, the level of endogenous oxalate excreted in the urine of Agxt deficient mice was significantly reduced by about 75%±3% compared to baseline, and the level of endogenous oxalate excretion in the urine of Grhpr deficient mice was reduced by about 32%±5%

    [0892] As depicted in FIG. 7, at one week following a single 10 mg/kg dose of AD-84788, the level of endogenous oxalate excreted in the urine of Agxt deficient mice was decreased. After the administration of four 10 mg/kg doses of AD-84788, endogenous oxalate levels excreted in the urine of Agxt deficient mice were unexpectedly reduced by about 75±3% from baseline levels of 120 mg/dl, demonstrating that decreasing the level of Ldha decreases the level of excreted oxalate and, thus, is useful for treating subjects having a kidney stone formation disease, disorder, or condition (e.g., a subject having a non-hyperoxaluria kidney stone formation disease, disorder, or condition).

    [0893] The effect of administration of four 10 mg/kg doses of AD-84788 on the levels of Ldha protein was also assessed by measuring the enzymic activity of Ldha present in liver samples from both wild-type and Agxt mice using either lactic acid or glyoxylate as a substrate. FIGS. 8A, 8B, 9A, and 9B demonstrate that, compared to untreated control animals, after the administration of four 10 mg/kg doses of AD-84788 to wild-type mice, significantly decreased liver LDH enzymatic activity as measured by the reduction of NAD to NADH using either lactic acid (FIGS. 8A and 8B) or glyoxylate (FIGS. 9A and 9B).

    [0894] Similarly, in Agxt mice, compared to untreated control animals, after the administration of four 10 mg/kg doses of AD-84788 significantly decreased liver LDH enzymatic activity as measured by the reduction of NAD to NADH using either lactic acid (FIGS. 10A and 10B) or glyoxylate (FIGS. 11A and 11B).

    [0895] Lactate dehydrogenase is present throughout the body and the use of iRNA agents targeting LDHA may have systemic effects. However, as depicted in FIGS. 12A-12D, the reduction in LDH enzymatic activity by administration of AD-84788 (i.e., an iRNA agent conjugated to a GalNAc ligand which targets hepatocytes) is specific to the LDH present in the liver. In particular, compared to untreated control animals, administration of four 10 mg/kg doses of AD-84788 to wild-type mice does not significantly reduce either heart (FIGS. 12A and 12B) or skeletal muscle (FIGS. 12C and 12D) LDH enzymatic activity using lactic acid (FIGS. 8A and 8B) as a substrate.

    [0896] Furthermore, the reduction of Ldha levels by administration of four 10 mg/kg doses of AD-84788 to either wild-type of Agxt deficient mice did not increase liver or muscle lactate levels. In fact, in both wild-type (FIG. 13A) and Agxt deficient mice (FIG. 14A), lactate levels were significantly decreased in animals administered multiple doses of AD-84788. In addition, as depicted in FIGS. 13B and 14B, liver pyruvate levels were higher and, as depicted in FIGS. 15A and 15B, liver glyoxylate levels were unchanged in wild-type mice and Agxt deficient mice administered multiple doses of AD-84788. Further despite reduction of liver lactate levels in both the wild-type and Agxt deficient mice after the administration of four 10 mg/kg doses of AD-84788, plasma levels of lactate in both the wild-type and Agxt deficient mice were unaffected (FIGS. 17A and 17B). Notably, during the entirety of the study, the behavior and weights (see FIGS. 16A and 16B) of the treated and untreated control mice remained constant indicating that there were no significant metabolic changes in the animals, thus, demonstrating the safety of specific inhibition of liver Ldha using an iRNA agent such as AD-84788.

    [0897] In summary, liver-specific knockdown of LDHA using the dsRNA agents of the invention resulted in profound oxalate lowering in both healthy and diseased animals. Additionally, substantial changes were seen in the levels of lactate, pyruvate and TCA Cycle organic acids in the livers of treated animals, consistent with the role of LDH in carbohydrate metabolism (see, e.g., FIG. 1B). However, none of the treated mice showed signs of behavioral and/or weight changes indicating that there were no significant metabolic changes in the animals. Accordingly, the data presented herein demonstrates the utility of the compositions and methods provided herein to decrease oxalate synthesis in subjects, such as subjects having a kidney stone formation disease, disorder, or condition (e.g., a subject having a non-hyperoxaluria kidney stone formation disease, disorder, or condition) and permit the determination of a suitable decrease in the level of oxalate that is beneficial to such subjects without resulting in adverse effects or safety concerns.